>Feature sequence01 534 10 gene locus_tag LOCUS_00010 534 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1249 1070 gene locus_tag LOCUS_00020 1249 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2082 1318 gene locus_tag LOCUS_00030 2082 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3407 2067 gene locus_tag LOCUS_00040 3407 2067 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337713.1 protein_id gnl|my_center|LOCUS_00040 3647 3723 gene locus_tag LOCUS_t00010 3647 3723 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4247 5350 gene locus_tag LOCUS_00050 4247 5350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 6408 5503 gene locus_tag LOCUS_00060 6408 5503 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87M95 protein_id gnl|my_center|LOCUS_00060 7283 6396 gene locus_tag LOCUS_00070 7283 6396 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHQ3 protein_id gnl|my_center|LOCUS_00070 8277 7396 gene locus_tag LOCUS_00080 8277 7396 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705176.1 protein_id gnl|my_center|LOCUS_00080 8898 8494 gene locus_tag LOCUS_00090 8898 8494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 9419 9051 gene locus_tag LOCUS_00100 9419 9051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 9772 10335 gene locus_tag LOCUS_00110 9772 10335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704609.1 protein_id gnl|my_center|LOCUS_00110 10594 11589 gene locus_tag LOCUS_00120 10594 11589 CDS product NADP-dependent aryl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036002.1 protein_id gnl|my_center|LOCUS_00120 11899 12336 gene locus_tag LOCUS_00130 11899 12336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 12795 13133 gene locus_tag LOCUS_00140 12795 13133 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555808.1 protein_id gnl|my_center|LOCUS_00140 13197 14498 gene locus_tag LOCUS_00150 13197 14498 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500B0 protein_id gnl|my_center|LOCUS_00150 14630 15403 gene locus_tag LOCUS_00160 14630 15403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 15400 15660 gene locus_tag LOCUS_00170 gene rpsR 15400 15660 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN0 protein_id gnl|my_center|LOCUS_00170 15682 16203 gene locus_tag LOCUS_00180 gene rplI 15682 16203 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JR2 protein_id gnl|my_center|LOCUS_00180 16690 16463 gene locus_tag LOCUS_00190 16690 16463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 16655 17773 gene locus_tag LOCUS_00200 gene dnaB 16655 17773 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VK7 protein_id gnl|my_center|LOCUS_00200 17770 18843 gene locus_tag LOCUS_00210 gene alr1 17770 18843 CDS product alanine racemase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUY6 protein_id gnl|my_center|LOCUS_00210 18836 20197 gene locus_tag LOCUS_00220 gene radA 18836 20197 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96963 protein_id gnl|my_center|LOCUS_00220 20284 20820 gene locus_tag LOCUS_00230 20284 20820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 21736 20915 gene locus_tag LOCUS_00240 gene dapD 21736 20915 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZH69 protein_id gnl|my_center|LOCUS_00240 24512 21819 gene locus_tag LOCUS_00250 gene glnD 24512 21819 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886P5 protein_id gnl|my_center|LOCUS_00250 25279 24509 gene locus_tag LOCUS_00260 gene map 25279 24509 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUS3 protein_id gnl|my_center|LOCUS_00260 25504 26550 gene locus_tag LOCUS_00270 25504 26550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 26554 27441 gene locus_tag LOCUS_00280 gene tsf 26554 27441 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUS9 protein_id gnl|my_center|LOCUS_00280 27445 27642 gene locus_tag LOCUS_00290 27445 27642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00290 27658 27927 gene locus_tag LOCUS_00300 27658 27927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00300 27927 28184 gene locus_tag LOCUS_00310 27927 28184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00310 28181 28738 gene locus_tag LOCUS_00320 gene frr 28181 28738 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUT1 protein_id gnl|my_center|LOCUS_00320 29085 29732 gene locus_tag LOCUS_00330 gene uppS 29085 29732 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63T16 protein_id gnl|my_center|LOCUS_00330 29735 30571 gene locus_tag LOCUS_00340 gene cdsA-1 29735 30571 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886N8 protein_id gnl|my_center|LOCUS_00340 30707 31366 gene locus_tag LOCUS_00350 30707 31366 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083641.1 protein_id gnl|my_center|LOCUS_00350 31369 32586 gene locus_tag LOCUS_00360 gene dxr 31369 32586 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KGU6 protein_id gnl|my_center|LOCUS_00360 32634 33995 gene locus_tag LOCUS_00370 32634 33995 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886N6 protein_id gnl|my_center|LOCUS_00370 34062 36314 gene locus_tag LOCUS_00380 gene bamA 34062 36314 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WF59 protein_id gnl|my_center|LOCUS_00380 36388 36852 gene locus_tag LOCUS_00390 36388 36852 CDS product outer membrane protein chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811782.1 protein_id gnl|my_center|LOCUS_00390 36906 37952 gene locus_tag LOCUS_00400 gene lpxD 36906 37952 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAW3 protein_id gnl|my_center|LOCUS_00400 37954 38397 gene locus_tag LOCUS_00410 gene fabZ 37954 38397 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGG4 protein_id gnl|my_center|LOCUS_00410 38398 39168 gene locus_tag LOCUS_00420 gene lpxA 38398 39168 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZY61 protein_id gnl|my_center|LOCUS_00420 39249 40382 gene locus_tag LOCUS_00430 gene lpxB 39249 40382 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY8 protein_id gnl|my_center|LOCUS_00430 40388 40972 gene locus_tag LOCUS_00440 gene rnhB 40388 40972 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY9 protein_id gnl|my_center|LOCUS_00440 40962 44504 gene locus_tag LOCUS_00450 gene dnaE 40962 44504 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZWX2 protein_id gnl|my_center|LOCUS_00450 44545 45504 gene locus_tag LOCUS_00460 gene accA 44545 45504 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ2 protein_id gnl|my_center|LOCUS_00460 45501 46874 gene locus_tag LOCUS_00470 gene tilS 45501 46874 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BJ9 protein_id gnl|my_center|LOCUS_00470 47034 48674 gene locus_tag LOCUS_00480 gene pyrG 47034 48674 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M9P3 protein_id gnl|my_center|LOCUS_00480 48678 49496 gene locus_tag LOCUS_00490 gene kdsA 48678 49496 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PD85 protein_id gnl|my_center|LOCUS_00490 49555 50853 gene locus_tag LOCUS_00500 gene eno 49555 50853 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9Z3 protein_id gnl|my_center|LOCUS_00500 50888 51166 gene locus_tag LOCUS_00510 50888 51166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 52285 51254 gene locus_tag LOCUS_00520 52285 51254 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198416.1 protein_id gnl|my_center|LOCUS_00520 52861 53721 gene locus_tag LOCUS_00530 52861 53721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 54042 54230 gene locus_tag LOCUS_00540 54042 54230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 54322 54720 gene locus_tag LOCUS_00550 54322 54720 CDS product succinate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528874.1 protein_id gnl|my_center|LOCUS_00550 54717 55076 gene locus_tag LOCUS_00560 54717 55076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 55097 56881 gene locus_tag LOCUS_00570 55097 56881 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2N0 protein_id gnl|my_center|LOCUS_00570 56911 57699 gene locus_tag LOCUS_00580 gene sdhB 56911 57699 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8V5 protein_id gnl|my_center|LOCUS_00580 57727 58005 gene locus_tag LOCUS_00590 57727 58005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83D70 protein_id gnl|my_center|LOCUS_00590 57989 58393 gene locus_tag LOCUS_00600 57989 58393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 60009 58390 gene locus_tag LOCUS_00610 gene nadB 60009 58390 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WH5 protein_id gnl|my_center|LOCUS_00610 60191 60769 gene locus_tag LOCUS_00620 gene algU 60191 60769 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WIP2 protein_id gnl|my_center|LOCUS_00620 60976 62394 gene locus_tag LOCUS_00630 60976 62394 CDS product serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764764.1 protein_id gnl|my_center|LOCUS_00630 62669 64480 gene locus_tag LOCUS_00640 gene lepA 62669 64480 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63S94 protein_id gnl|my_center|LOCUS_00640 64480 65253 gene locus_tag LOCUS_00650 gene lepB-1 64480 65253 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUD3 protein_id gnl|my_center|LOCUS_00650 65263 65949 gene locus_tag LOCUS_00660 gene rnc 65263 65949 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LN9 protein_id gnl|my_center|LOCUS_00660 65942 66835 gene locus_tag LOCUS_00670 gene era 65942 66835 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB51 protein_id gnl|my_center|LOCUS_00670 66841 67593 gene locus_tag LOCUS_00680 gene recO 66841 67593 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51838 protein_id gnl|my_center|LOCUS_00680 67590 68318 gene locus_tag LOCUS_00690 gene pdxJ 67590 68318 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P341 protein_id gnl|my_center|LOCUS_00690 68676 68410 gene locus_tag LOCUS_00700 68676 68410 CDS product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83D06 protein_id gnl|my_center|LOCUS_00700 68823 69218 gene locus_tag LOCUS_00710 68823 69218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 69601 70695 gene locus_tag LOCUS_00720 69601 70695 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807926.1 protein_id gnl|my_center|LOCUS_00720 71174 70707 gene locus_tag LOCUS_00730 71174 70707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 71342 72325 gene locus_tag LOCUS_00740 gene cysB 71342 72325 CDS product transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459882.1 protein_id gnl|my_center|LOCUS_00740 72688 72613 gene locus_tag LOCUS_t00020 72688 72613 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 73393 72797 gene locus_tag LOCUS_00750 73393 72797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 74687 73497 gene locus_tag LOCUS_00760 gene aspC 74687 73497 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKK1 protein_id gnl|my_center|LOCUS_00760 74770 76812 gene locus_tag LOCUS_00770 gene uvrB 74770 76812 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E18 protein_id gnl|my_center|LOCUS_00770 76885 76961 gene locus_tag LOCUS_t00030 76885 76961 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 77048 78958 gene locus_tag LOCUS_00780 gene thrS 77048 78958 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZS05 protein_id gnl|my_center|LOCUS_00780 79080 79541 gene locus_tag LOCUS_00790 gene infC 79080 79541 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57226 protein_id gnl|my_center|LOCUS_00790 79797 80156 gene locus_tag LOCUS_00800 gene rplT 79797 80156 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZS07 protein_id gnl|my_center|LOCUS_00800 80266 81297 gene locus_tag LOCUS_00810 gene pheS 80266 81297 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A3 protein_id gnl|my_center|LOCUS_00810 81303 83681 gene locus_tag LOCUS_00820 gene pheT 81303 83681 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83C15 protein_id gnl|my_center|LOCUS_00820 83698 84024 gene locus_tag LOCUS_00830 83698 84024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 84025 84414 gene locus_tag LOCUS_00840 84025 84414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 84654 84730 gene locus_tag LOCUS_t00040 84654 84730 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 85858 84740 gene locus_tag LOCUS_00850 gene modC 85858 84740 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074078.1 protein_id gnl|my_center|LOCUS_00850 86505 85828 gene locus_tag LOCUS_00860 gene modB 86505 85828 CDS product molybdenum ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074079.1 protein_id gnl|my_center|LOCUS_00860 87328 86543 gene locus_tag LOCUS_00870 gene modA 87328 86543 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074080.1 protein_id gnl|my_center|LOCUS_00870 88100 87342 gene locus_tag LOCUS_00880 88100 87342 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87P64 protein_id gnl|my_center|LOCUS_00880 88237 88710 gene locus_tag LOCUS_00890 88237 88710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 88885 90456 gene locus_tag LOCUS_00900 88885 90456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122297.1 protein_id gnl|my_center|LOCUS_00900 91366 90557 gene locus_tag LOCUS_00910 91366 90557 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729714.1 protein_id gnl|my_center|LOCUS_00910 92868 91531 gene locus_tag LOCUS_00920 92868 91531 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958306.1 protein_id gnl|my_center|LOCUS_00920 93733 93218 gene locus_tag LOCUS_00930 93733 93218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 96012 93790 gene locus_tag LOCUS_00940 96012 93790 CDS product marine proteobacterial sortase target protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083797.1 protein_id gnl|my_center|LOCUS_00940 96260 97084 gene locus_tag LOCUS_00950 96260 97084 CDS product tungsten ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479446.1 protein_id gnl|my_center|LOCUS_00950 97091 97792 gene locus_tag LOCUS_00960 97091 97792 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479424.1 protein_id gnl|my_center|LOCUS_00960 97810 98451 gene locus_tag LOCUS_00970 gene tupC 97810 98451 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074307.1 protein_id gnl|my_center|LOCUS_00970 98522 99748 gene locus_tag LOCUS_00980 98522 99748 CDS product molybdopterin biosynthesis protein MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_455380.1 protein_id gnl|my_center|LOCUS_00980 100005 99796 gene locus_tag LOCUS_00990 100005 99796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 100162 99998 gene locus_tag LOCUS_01000 100162 99998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 100509 100183 gene locus_tag LOCUS_01010 100509 100183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 100924 104493 gene locus_tag LOCUS_01020 100924 104493 CDS product pyruvate-flavodoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B6M5 protein_id gnl|my_center|LOCUS_01020 104496 105488 gene locus_tag LOCUS_01030 104496 105488 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_01030 105618 106685 gene locus_tag LOCUS_01040 105618 106685 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_599790.1 protein_id gnl|my_center|LOCUS_01040 106744 108144 gene locus_tag LOCUS_01050 gene ubiD 106744 108144 CDS product 3-octaprenyl-4-hydroxybenzoate carboxy-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJG1 protein_id gnl|my_center|LOCUS_01050 108162 108959 gene locus_tag LOCUS_01060 108162 108959 CDS product p-nitrophenyl phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877881.1 protein_id gnl|my_center|LOCUS_01060 108952 109404 gene locus_tag LOCUS_01070 108952 109404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 109448 110032 gene locus_tag LOCUS_01080 gene ubiX 109448 110032 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3G3X8 protein_id gnl|my_center|LOCUS_01080 110040 110498 gene locus_tag LOCUS_01090 110040 110498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 110578 111795 gene locus_tag LOCUS_01100 gene ftsA 110578 111795 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122747.1 protein_id gnl|my_center|LOCUS_01100 111958 113805 gene locus_tag LOCUS_01110 111958 113805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_599789.1 protein_id gnl|my_center|LOCUS_01110 114045 116252 gene locus_tag LOCUS_01120 114045 116252 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391701.1 protein_id gnl|my_center|LOCUS_01120 117251 116373 gene locus_tag LOCUS_01130 117251 116373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 117450 117241 gene locus_tag LOCUS_01140 117450 117241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 118926 117847 gene locus_tag LOCUS_01150 118926 117847 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074212.1 protein_id gnl|my_center|LOCUS_01150 120172 118943 gene locus_tag LOCUS_01160 120172 118943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 120875 120183 gene locus_tag LOCUS_01170 120875 120183 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482754.1 protein_id gnl|my_center|LOCUS_01170 122114 120885 gene locus_tag LOCUS_01180 122114 120885 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261736.1 protein_id gnl|my_center|LOCUS_01180 123351 122128 gene locus_tag LOCUS_01190 123351 122128 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482600.1 protein_id gnl|my_center|LOCUS_01190 124154 123348 gene locus_tag LOCUS_01200 124154 123348 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 protein_id gnl|my_center|LOCUS_01200 125049 124468 gene locus_tag LOCUS_01210 125049 124468 CDS product electron transport complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WY90 protein_id gnl|my_center|LOCUS_01210 125701 125039 gene locus_tag LOCUS_01220 gene rnfE 125701 125039 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HYR5 protein_id gnl|my_center|LOCUS_01220 126381 125701 gene locus_tag LOCUS_01230 126381 125701 CDS product Na+-transporting NADH:ubiquinone oxidoreductase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020708.1 protein_id gnl|my_center|LOCUS_01230 127457 126378 gene locus_tag LOCUS_01240 127457 126378 CDS product electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA46 protein_id gnl|my_center|LOCUS_01240 128803 127454 gene locus_tag LOCUS_01250 gene rnfC 128803 127454 CDS product electron transport complex subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HYR2 protein_id gnl|my_center|LOCUS_01250 133780 128837 gene locus_tag LOCUS_01260 133780 128837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 134852 133974 gene locus_tag LOCUS_01270 134852 133974 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583458.1 protein_id gnl|my_center|LOCUS_01270 134952 135992 gene locus_tag LOCUS_01280 134952 135992 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHD2 protein_id gnl|my_center|LOCUS_01280 136024 136938 gene locus_tag LOCUS_01290 136024 136938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098734.1 protein_id gnl|my_center|LOCUS_01290 138908 137115 gene locus_tag LOCUS_01300 138908 137115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 138984 139160 gene locus_tag LOCUS_01310 138984 139160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 139167 139391 gene locus_tag LOCUS_01320 139167 139391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 139392 139574 gene locus_tag LOCUS_01330 139392 139574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 139611 139814 gene locus_tag LOCUS_01340 139611 139814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 141481 139832 gene locus_tag LOCUS_01350 141481 139832 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868905.1 protein_id gnl|my_center|LOCUS_01350 141880 141491 gene locus_tag LOCUS_01360 141880 141491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 142118 142339 gene locus_tag LOCUS_01370 142118 142339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 143729 142527 gene locus_tag LOCUS_01380 143729 142527 CDS product D-amino-acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709513.1 protein_id gnl|my_center|LOCUS_01380 144096 145775 gene locus_tag LOCUS_01390 gene fhs 144096 145775 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TI03 protein_id gnl|my_center|LOCUS_01390 145902 147050 gene locus_tag LOCUS_01400 gene soxB 145902 147050 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524302.1 protein_id gnl|my_center|LOCUS_01400 147064 147372 gene locus_tag LOCUS_01410 gene soxD 147064 147372 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524301.1 protein_id gnl|my_center|LOCUS_01410 147369 150356 gene locus_tag LOCUS_01420 gene soxA 147369 150356 CDS product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524300.1 protein_id gnl|my_center|LOCUS_01420 150349 150948 gene locus_tag LOCUS_01430 150349 150948 CDS product sarcosine oxidase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269190.1 protein_id gnl|my_center|LOCUS_01430 151185 151904 gene locus_tag LOCUS_01440 151185 151904 CDS product 5-methyltetrahydrofolate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708366.1 protein_id gnl|my_center|LOCUS_01440 151910 152563 gene locus_tag LOCUS_01450 151910 152563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708368.1 protein_id gnl|my_center|LOCUS_01450 153038 154075 gene locus_tag LOCUS_01460 153038 154075 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92P13 protein_id gnl|my_center|LOCUS_01460 154062 154958 gene locus_tag LOCUS_01470 154062 154958 CDS product methyltetrahydrofolate--corrinoid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969617.1 protein_id gnl|my_center|LOCUS_01470 154992 156977 gene locus_tag LOCUS_01480 154992 156977 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531166.1 protein_id gnl|my_center|LOCUS_01480 157985 157083 gene locus_tag LOCUS_01490 157985 157083 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402189.1 protein_id gnl|my_center|LOCUS_01490 160821 158389 gene locus_tag LOCUS_01500 160821 158389 CDS product dimethylglycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971758.1 protein_id gnl|my_center|LOCUS_01500 161082 162308 gene locus_tag LOCUS_01510 161082 162308 CDS product creatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336960.1 protein_id gnl|my_center|LOCUS_01510 163163 162309 gene locus_tag LOCUS_01520 163163 162309 CDS product polyamine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722803.1 protein_id gnl|my_center|LOCUS_01520 164356 163166 gene locus_tag LOCUS_01530 164356 163166 CDS product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337052.1 protein_id gnl|my_center|LOCUS_01530 165586 164483 gene locus_tag LOCUS_01540 165586 164483 CDS product ABC polyamine/opine transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003526.1 protein_id gnl|my_center|LOCUS_01540 166795 165695 gene locus_tag LOCUS_01550 166795 165695 CDS product polyamine-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5T5 protein_id gnl|my_center|LOCUS_01550 168045 167026 gene locus_tag LOCUS_01560 168045 167026 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258562.1 protein_id gnl|my_center|LOCUS_01560 168344 168835 gene locus_tag LOCUS_01570 168344 168835 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392242.1 protein_id gnl|my_center|LOCUS_01570 168889 170736 gene locus_tag LOCUS_01580 168889 170736 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941578.1 protein_id gnl|my_center|LOCUS_01580 170868 172127 gene locus_tag LOCUS_01590 170868 172127 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812847.1 protein_id gnl|my_center|LOCUS_01590 172130 172378 gene locus_tag LOCUS_01600 172130 172378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 172402 173226 gene locus_tag LOCUS_01610 gene rnz 172402 173226 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TYN1 protein_id gnl|my_center|LOCUS_01610 173556 173239 gene locus_tag LOCUS_01620 173556 173239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 174794 173577 gene locus_tag LOCUS_01630 gene cycH 174794 173577 CDS product cytochrome c-type biogenesis protein CycH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3M9 protein_id gnl|my_center|LOCUS_01630 175303 174791 gene locus_tag LOCUS_01640 175303 174791 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705303.1 protein_id gnl|my_center|LOCUS_01640 175833 175300 gene locus_tag LOCUS_01650 gene dsbE 175833 175300 CDS product thiol:disulfide interchange protein DsbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N1 protein_id gnl|my_center|LOCUS_01650 177789 175834 gene locus_tag LOCUS_01660 gene ccmF 177789 175834 CDS product c-type cytochrome biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765253.1 protein_id gnl|my_center|LOCUS_01660 178274 177786 gene locus_tag LOCUS_01670 gene ccmE 178274 177786 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N3 protein_id gnl|my_center|LOCUS_01670 178450 178271 gene locus_tag LOCUS_01680 178450 178271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 179192 178443 gene locus_tag LOCUS_01690 179192 178443 CDS product heme exporter protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457654.1 protein_id gnl|my_center|LOCUS_01690 179882 179196 gene locus_tag LOCUS_01700 gene ccmB 179882 179196 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK41 protein_id gnl|my_center|LOCUS_01700 180535 179882 gene locus_tag LOCUS_01710 gene ccmA 180535 179882 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XE58 protein_id gnl|my_center|LOCUS_01710 182234 180921 gene locus_tag LOCUS_01720 gene fccB-2 182234 180921 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933736.1 protein_id gnl|my_center|LOCUS_01720 182564 182247 gene locus_tag LOCUS_01730 182564 182247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 182775 182599 gene locus_tag LOCUS_01740 182775 182599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 183634 182822 gene locus_tag LOCUS_01750 183634 182822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 183828 185066 gene locus_tag LOCUS_01760 183828 185066 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267455.1 protein_id gnl|my_center|LOCUS_01760 185411 185842 gene locus_tag LOCUS_01770 185411 185842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 186095 186316 gene locus_tag LOCUS_01780 186095 186316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 186423 186860 gene locus_tag LOCUS_01790 186423 186860 CDS product inosine-5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174003.1 protein_id gnl|my_center|LOCUS_01790 188199 187252 gene locus_tag LOCUS_01800 gene nfo 188199 187252 CDS product putative endonuclease 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FV76 protein_id gnl|my_center|LOCUS_01800 188385 189272 gene locus_tag LOCUS_01810 gene rarD-1 188385 189272 CDS product chloramphenicol resistance permease RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704249.1 protein_id gnl|my_center|LOCUS_01810 189627 190466 gene locus_tag LOCUS_01820 gene livG 189627 190466 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930184.1 protein_id gnl|my_center|LOCUS_01820 190463 191353 gene locus_tag LOCUS_01830 gene livH 190463 191353 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812445.1 protein_id gnl|my_center|LOCUS_01830 191376 192419 gene locus_tag LOCUS_01840 gene livM 191376 192419 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812443.1 protein_id gnl|my_center|LOCUS_01840 192625 193842 gene locus_tag LOCUS_01850 gene livK 192625 193842 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926442.1 protein_id gnl|my_center|LOCUS_01850 194018 194812 gene locus_tag LOCUS_01860 gene livF 194018 194812 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063643.1 protein_id gnl|my_center|LOCUS_01860 194800 196656 gene locus_tag LOCUS_01870 194800 196656 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039705.1 protein_id gnl|my_center|LOCUS_01870 196724 198175 gene locus_tag LOCUS_01880 196724 198175 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705774.1 protein_id gnl|my_center|LOCUS_01880 198540 198208 gene locus_tag LOCUS_01890 198540 198208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01890 198951 198544 gene locus_tag LOCUS_01900 198951 198544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01900 199806 200195 gene locus_tag LOCUS_01910 199806 200195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 200456 201202 gene locus_tag LOCUS_01920 gene surE 200456 201202 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9Y7 protein_id gnl|my_center|LOCUS_01920 201199 201873 gene locus_tag LOCUS_01930 gene pcm 201199 201873 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45683 protein_id gnl|my_center|LOCUS_01930 201873 202448 gene locus_tag LOCUS_01940 201873 202448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704776.1 protein_id gnl|my_center|LOCUS_01940 202464 203210 gene locus_tag LOCUS_01950 202464 203210 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203979.1 protein_id gnl|my_center|LOCUS_01950 203231 204112 gene locus_tag LOCUS_01960 gene rpoS 203231 204112 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45684 protein_id gnl|my_center|LOCUS_01960 204555 204157 gene locus_tag LOCUS_01970 204555 204157 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957854.1 protein_id gnl|my_center|LOCUS_01970 204858 206072 gene locus_tag LOCUS_01980 204858 206072 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100170.1 protein_id gnl|my_center|LOCUS_01980 206069 207382 gene locus_tag LOCUS_01990 gene hom 206069 207382 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29365 protein_id gnl|my_center|LOCUS_01990 207379 208470 gene locus_tag LOCUS_02000 gene thrC 207379 208470 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK49 protein_id gnl|my_center|LOCUS_02000 208494 209057 gene locus_tag LOCUS_02010 208494 209057 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071102.1 protein_id gnl|my_center|LOCUS_02010 209141 209329 gene locus_tag LOCUS_02020 209141 209329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 209348 210832 gene locus_tag LOCUS_02030 gene xdhA 209348 210832 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972218.1 protein_id gnl|my_center|LOCUS_02030 210825 213128 gene locus_tag LOCUS_02040 gene xdhB 210825 213128 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708904.1 protein_id gnl|my_center|LOCUS_02040 213121 214143 gene locus_tag LOCUS_02050 213121 214143 CDS product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189595.1 protein_id gnl|my_center|LOCUS_02050 214200 214685 gene locus_tag LOCUS_02060 214200 214685 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768302.1 protein_id gnl|my_center|LOCUS_02060 214770 215222 gene locus_tag LOCUS_02070 214770 215222 CDS product preQ0 transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391204.1 protein_id gnl|my_center|LOCUS_02070 215402 216760 gene locus_tag LOCUS_02080 215402 216760 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088900.1 protein_id gnl|my_center|LOCUS_02080 217210 216764 gene locus_tag LOCUS_02090 217210 216764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405106.1 protein_id gnl|my_center|LOCUS_02090 219522 217243 gene locus_tag LOCUS_02100 219522 217243 CDS product proteobacterial dedicated sortase system histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072224.1 protein_id gnl|my_center|LOCUS_02100 220342 219566 gene locus_tag LOCUS_02110 220342 219566 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072225.1 protein_id gnl|my_center|LOCUS_02110 221293 220520 gene locus_tag LOCUS_02120 221293 220520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771252.1 protein_id gnl|my_center|LOCUS_02120 222379 221309 gene locus_tag LOCUS_02130 gene holB 222379 221309 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52024 protein_id gnl|my_center|LOCUS_02130 223007 222369 gene locus_tag LOCUS_02140 gene tmk 223007 222369 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YH1 protein_id gnl|my_center|LOCUS_02140 224057 223050 gene locus_tag LOCUS_02150 224057 223050 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036223.1 protein_id gnl|my_center|LOCUS_02150 225342 224104 gene locus_tag LOCUS_02160 gene fabF 225342 224104 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WJC8 protein_id gnl|my_center|LOCUS_02160 225672 225430 gene locus_tag LOCUS_02170 gene acpP 225672 225430 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E38 protein_id gnl|my_center|LOCUS_02170 226617 225874 gene locus_tag LOCUS_02180 gene fabG 226617 225874 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O54438 protein_id gnl|my_center|LOCUS_02180 227611 226637 gene locus_tag LOCUS_02190 gene fabH 227611 226637 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBV1 protein_id gnl|my_center|LOCUS_02190 228628 227612 gene locus_tag LOCUS_02200 gene plsX 228628 227612 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVP8 protein_id gnl|my_center|LOCUS_02200 228878 228693 gene locus_tag LOCUS_02210 gene rpmF 228878 228693 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBV2 protein_id gnl|my_center|LOCUS_02210 229166 229747 gene locus_tag LOCUS_02220 229166 229747 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87N16 protein_id gnl|my_center|LOCUS_02220 230719 229757 gene locus_tag LOCUS_02230 gene rluC 230719 229757 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JN53 protein_id gnl|my_center|LOCUS_02230 231108 233387 gene locus_tag LOCUS_02240 231108 233387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 234775 233456 gene locus_tag LOCUS_02250 gene rlmD 234775 233456 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB48 protein_id gnl|my_center|LOCUS_02250 235751 234870 gene locus_tag LOCUS_02260 gene cysM 235751 234870 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I526 protein_id gnl|my_center|LOCUS_02260 237507 235753 gene locus_tag LOCUS_02270 gene recJ 237507 235753 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100681.1 protein_id gnl|my_center|LOCUS_02270 237662 237913 gene locus_tag LOCUS_02280 237662 237913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 238360 243246 gene locus_tag LOCUS_02290 238360 243246 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887375.1 protein_id gnl|my_center|LOCUS_02290 243243 245261 gene locus_tag LOCUS_02300 243243 245261 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338902.1 protein_id gnl|my_center|LOCUS_02300 245771 245301 gene locus_tag LOCUS_02310 245771 245301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 246120 245782 gene locus_tag LOCUS_02320 246120 245782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 246399 246315 gene locus_tag LOCUS_t00050 246399 246315 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 247237 246470 gene locus_tag LOCUS_02330 247237 246470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941457.1 protein_id gnl|my_center|LOCUS_02330 247326 247775 gene locus_tag LOCUS_02340 247326 247775 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZCF8 protein_id gnl|my_center|LOCUS_02340 >Feature sequence02 1376 150 gene locus_tag LOCUS_02350 1376 150 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938819.1 protein_id gnl|my_center|LOCUS_02350 1612 1538 gene locus_tag LOCUS_t00060 1612 1538 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1699 3024 gene locus_tag LOCUS_02360 gene pcnB 1699 3024 CDS product poly(A) polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888Q3 protein_id gnl|my_center|LOCUS_02360 3021 3551 gene locus_tag LOCUS_02370 gene folK 3021 3551 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065009.1 protein_id gnl|my_center|LOCUS_02370 3714 4265 gene locus_tag LOCUS_02380 3714 4265 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192132.1 protein_id gnl|my_center|LOCUS_02380 4467 6506 gene locus_tag LOCUS_02390 gene prc 4467 6506 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091593.1 protein_id gnl|my_center|LOCUS_02390 6516 7766 gene locus_tag LOCUS_02400 gene avtA 6516 7766 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200164.1 protein_id gnl|my_center|LOCUS_02400 8174 7785 gene locus_tag LOCUS_02410 8174 7785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946746.1 protein_id gnl|my_center|LOCUS_02410 9342 8257 gene locus_tag LOCUS_02420 gene ddl 9342 8257 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPH3 protein_id gnl|my_center|LOCUS_02420 10258 9362 gene locus_tag LOCUS_02430 10258 9362 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057878.1 protein_id gnl|my_center|LOCUS_02430 10306 11058 gene locus_tag LOCUS_02440 gene nudF 10306 11058 CDS product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369649.1 protein_id gnl|my_center|LOCUS_02440 11072 11869 gene locus_tag LOCUS_02450 11072 11869 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143074.1 protein_id gnl|my_center|LOCUS_02450 11888 12304 gene locus_tag LOCUS_02460 11888 12304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 12335 13516 gene locus_tag LOCUS_02470 12335 13516 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389303.1 protein_id gnl|my_center|LOCUS_02470 13564 14352 gene locus_tag LOCUS_02480 gene gloB 13564 14352 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP80 protein_id gnl|my_center|LOCUS_02480 15376 14642 gene locus_tag LOCUS_02490 gene mas1 15376 14642 CDS product agropine synthesis reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086406.1 protein_id gnl|my_center|LOCUS_02490 16776 15373 gene locus_tag LOCUS_02500 16776 15373 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388879.1 protein_id gnl|my_center|LOCUS_02500 16953 17771 gene locus_tag LOCUS_02510 16953 17771 CDS product histidinol phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336750.1 protein_id gnl|my_center|LOCUS_02510 17782 18327 gene locus_tag LOCUS_02520 17782 18327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 18560 18396 gene locus_tag LOCUS_02530 18560 18396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 18709 19266 gene locus_tag LOCUS_02540 18709 19266 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974667.1 protein_id gnl|my_center|LOCUS_02540 19263 21146 gene locus_tag LOCUS_02550 19263 21146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968865.1 protein_id gnl|my_center|LOCUS_02550 21549 21148 gene locus_tag LOCUS_02560 21549 21148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 22903 21653 gene locus_tag LOCUS_02570 22903 21653 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040635.1 protein_id gnl|my_center|LOCUS_02570 24136 22979 gene locus_tag LOCUS_02580 24136 22979 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTH4 protein_id gnl|my_center|LOCUS_02580 24842 24195 gene locus_tag LOCUS_02590 24842 24195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 25437 24913 gene locus_tag LOCUS_02600 25437 24913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 27516 25483 gene locus_tag LOCUS_02610 27516 25483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 28312 27551 gene locus_tag LOCUS_02620 28312 27551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 30060 28354 gene locus_tag LOCUS_02630 30060 28354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 30608 30057 gene locus_tag LOCUS_02640 30608 30057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 32119 30686 gene locus_tag LOCUS_02650 32119 30686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 33765 32089 gene locus_tag LOCUS_02660 33765 32089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 34313 33762 gene locus_tag LOCUS_02670 34313 33762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 34847 34326 gene locus_tag LOCUS_02680 34847 34326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 36423 35029 gene locus_tag LOCUS_02690 36423 35029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 37724 36426 gene locus_tag LOCUS_02700 37724 36426 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644782.1 protein_id gnl|my_center|LOCUS_02700 37776 38828 gene locus_tag LOCUS_02710 gene tqsA 37776 38828 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_02710 38828 39832 gene locus_tag LOCUS_02720 38828 39832 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970329.1 protein_id gnl|my_center|LOCUS_02720 40822 39947 gene locus_tag LOCUS_02730 gene folD 40822 39947 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YAJ9 protein_id gnl|my_center|LOCUS_02730 42397 40949 gene locus_tag LOCUS_02740 42397 40949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 44130 42484 gene locus_tag LOCUS_02750 44130 42484 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087212.1 protein_id gnl|my_center|LOCUS_02750 45768 44392 gene locus_tag LOCUS_02760 gene sdaA 45768 44392 CDS product L-serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113084.1 protein_id gnl|my_center|LOCUS_02760 47078 45825 gene locus_tag LOCUS_02770 gene glyA2 47078 45825 CDS product serine hydroxymethyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WC1 protein_id gnl|my_center|LOCUS_02770 48238 47216 gene locus_tag LOCUS_02780 48238 47216 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390379.1 protein_id gnl|my_center|LOCUS_02780 48517 48987 gene locus_tag LOCUS_02790 48517 48987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 49029 49622 gene locus_tag LOCUS_02800 49029 49622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 50179 49658 gene locus_tag LOCUS_02810 gene mobB 50179 49658 CDS product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175770.1 protein_id gnl|my_center|LOCUS_02810 50756 50172 gene locus_tag LOCUS_02820 gene mobA 50756 50172 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8E3 protein_id gnl|my_center|LOCUS_02820 51140 51808 gene locus_tag LOCUS_02830 51140 51808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 52049 52630 gene locus_tag LOCUS_02840 52049 52630 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084228.1 protein_id gnl|my_center|LOCUS_02840 52670 53569 gene locus_tag LOCUS_02850 52670 53569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 54841 53699 gene locus_tag LOCUS_02860 54841 53699 CDS product putative glutamate--cysteine ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRI3 protein_id gnl|my_center|LOCUS_02860 55724 54822 gene locus_tag LOCUS_02870 55724 54822 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390216.1 protein_id gnl|my_center|LOCUS_02870 55711 56619 gene locus_tag LOCUS_02880 55711 56619 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972240.1 protein_id gnl|my_center|LOCUS_02880 56544 56780 gene locus_tag LOCUS_02890 56544 56780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 57708 56857 gene locus_tag LOCUS_02900 gene cztR 57708 56857 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921339.1 protein_id gnl|my_center|LOCUS_02900 57855 58907 gene locus_tag LOCUS_02910 gene gcvT2 57855 58907 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I140 protein_id gnl|my_center|LOCUS_02910 58988 59365 gene locus_tag LOCUS_02920 gene gcvH 58988 59365 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPV0 protein_id gnl|my_center|LOCUS_02920 59401 62286 gene locus_tag LOCUS_02930 gene gcvP1 59401 62286 CDS product glycine dehydrogenase (decarboxylating) 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I137 protein_id gnl|my_center|LOCUS_02930 62367 63341 gene locus_tag LOCUS_02940 gene lipA 62367 63341 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHQ6 protein_id gnl|my_center|LOCUS_02940 63880 63362 gene locus_tag LOCUS_02950 63880 63362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 64707 63916 gene locus_tag LOCUS_02960 64707 63916 CDS product arginine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193736.1 protein_id gnl|my_center|LOCUS_02960 65624 64731 gene locus_tag LOCUS_02970 65624 64731 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105885.1 protein_id gnl|my_center|LOCUS_02970 65671 65853 gene locus_tag LOCUS_02980 65671 65853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 67078 65873 gene locus_tag LOCUS_02990 67078 65873 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532422.1 protein_id gnl|my_center|LOCUS_02990 68210 67191 gene locus_tag LOCUS_03000 gene bztA 68210 67191 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722552.1 protein_id gnl|my_center|LOCUS_03000 69760 68624 gene locus_tag LOCUS_03010 69760 68624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 69955 70392 gene locus_tag LOCUS_03020 69955 70392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 70629 70441 gene locus_tag LOCUS_03030 70629 70441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 70561 71853 gene locus_tag LOCUS_03040 gene cysG 70561 71853 CDS product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRL6 protein_id gnl|my_center|LOCUS_03040 71878 72186 gene locus_tag LOCUS_03050 71878 72186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 73110 72454 gene locus_tag LOCUS_03060 73110 72454 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688682.1 protein_id gnl|my_center|LOCUS_03060 74732 73110 gene locus_tag LOCUS_03070 74732 73110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 75120 74791 gene locus_tag LOCUS_03080 75120 74791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 76542 75148 gene locus_tag LOCUS_03090 gene cbiA 76542 75148 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RI09 protein_id gnl|my_center|LOCUS_03090 77793 76591 gene locus_tag LOCUS_03100 77793 76591 CDS product Hdr menaquinol oxidoreductase integral membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878007.1 protein_id gnl|my_center|LOCUS_03100 78567 77818 gene locus_tag LOCUS_03110 78567 77818 CDS product Hdr menaquinol oxidoreductase iron-sulfur subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878006.1 protein_id gnl|my_center|LOCUS_03110 78969 78568 gene locus_tag LOCUS_03120 78969 78568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 80932 78974 gene locus_tag LOCUS_03130 80932 78974 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932535.1 protein_id gnl|my_center|LOCUS_03130 82484 80952 gene locus_tag LOCUS_03140 82484 80952 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393112.1 protein_id gnl|my_center|LOCUS_03140 83260 82508 gene locus_tag LOCUS_03150 83260 82508 CDS product nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393108.1 protein_id gnl|my_center|LOCUS_03150 83658 83323 gene locus_tag LOCUS_03160 83658 83323 CDS product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546467.1 protein_id gnl|my_center|LOCUS_03160 83996 83691 gene locus_tag LOCUS_03170 gene dsrH 83996 83691 CDS product multidrug MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932538.1 protein_id gnl|my_center|LOCUS_03170 84428 84021 gene locus_tag LOCUS_03180 84428 84021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 84833 84441 gene locus_tag LOCUS_03190 gene dsrE 84833 84441 CDS product sulfurtransferase TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932536.1 protein_id gnl|my_center|LOCUS_03190 85925 84849 gene locus_tag LOCUS_03200 gene dsrB-1 85925 84849 CDS product sulfite reductase, dissimilatory-type beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932534.1 protein_id gnl|my_center|LOCUS_03200 87216 85960 gene locus_tag LOCUS_03210 gene dsrA-2 87216 85960 CDS product sulfite reductase, dissimilatory-type subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932533.1 protein_id gnl|my_center|LOCUS_03210 87664 87921 gene locus_tag LOCUS_03220 87664 87921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 87896 88588 gene locus_tag LOCUS_03230 87896 88588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 88710 89042 gene locus_tag LOCUS_03240 88710 89042 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLN3 protein_id gnl|my_center|LOCUS_03240 89094 89297 gene locus_tag LOCUS_03250 89094 89297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 90303 89434 gene locus_tag LOCUS_03260 gene livF 90303 89434 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894681.1 protein_id gnl|my_center|LOCUS_03260 91046 90303 gene locus_tag LOCUS_03270 91046 90303 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942651.1 protein_id gnl|my_center|LOCUS_03270 92101 91046 gene locus_tag LOCUS_03280 92101 91046 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809683.1 protein_id gnl|my_center|LOCUS_03280 92991 92098 gene locus_tag LOCUS_03290 92991 92098 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039248.1 protein_id gnl|my_center|LOCUS_03290 94301 93066 gene locus_tag LOCUS_03300 94301 93066 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546283.1 protein_id gnl|my_center|LOCUS_03300 94580 95740 gene locus_tag LOCUS_03310 94580 95740 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382995.1 protein_id gnl|my_center|LOCUS_03310 95836 96417 gene locus_tag LOCUS_03320 95836 96417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 96784 96581 gene locus_tag LOCUS_03330 96784 96581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 97304 97029 gene locus_tag LOCUS_03340 97304 97029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 97748 97341 gene locus_tag LOCUS_03350 97748 97341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 98449 97967 gene locus_tag LOCUS_03360 98449 97967 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932542.1 protein_id gnl|my_center|LOCUS_03360 98747 98514 gene locus_tag LOCUS_03370 98747 98514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193727.1 protein_id gnl|my_center|LOCUS_03370 98963 100423 gene locus_tag LOCUS_03380 98963 100423 CDS product putative beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W8 protein_id gnl|my_center|LOCUS_03380 100478 100846 gene locus_tag LOCUS_03390 100478 100846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 100903 101325 gene locus_tag LOCUS_03400 100903 101325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 101509 102354 gene locus_tag LOCUS_03410 gene soxA 101509 102354 CDS product SoxAX cytochrome complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDM7 protein_id gnl|my_center|LOCUS_03410 102438 105554 gene locus_tag LOCUS_03420 gene putA 102438 105554 CDS product bifunctional protein PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P476 protein_id gnl|my_center|LOCUS_03420 105661 106773 gene locus_tag LOCUS_03430 105661 106773 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092864.1 protein_id gnl|my_center|LOCUS_03430 107398 106961 gene locus_tag LOCUS_03440 107398 106961 CDS product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3C8 protein_id gnl|my_center|LOCUS_03440 107549 108118 gene locus_tag LOCUS_03450 107549 108118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 108309 109343 gene locus_tag LOCUS_03460 108309 109343 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529168.1 protein_id gnl|my_center|LOCUS_03460 109358 110959 gene locus_tag LOCUS_03470 gene thiP 109358 110959 CDS product thiamine/thiamine pyrophosphate ABC transporter, permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704815.1 protein_id gnl|my_center|LOCUS_03470 110946 111653 gene locus_tag LOCUS_03480 gene thiQ 110946 111653 CDS product thiamine import ATP-binding protein ThiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SV4 protein_id gnl|my_center|LOCUS_03480 113900 111738 gene locus_tag LOCUS_03490 113900 111738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 114603 114007 gene locus_tag LOCUS_03500 gene gph 114603 114007 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181645.1 protein_id gnl|my_center|LOCUS_03500 114945 115847 gene locus_tag LOCUS_03510 114945 115847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 116062 116364 gene locus_tag LOCUS_03520 116062 116364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203854.1 protein_id gnl|my_center|LOCUS_03520 116364 117455 gene locus_tag LOCUS_03530 116364 117455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550161.1 protein_id gnl|my_center|LOCUS_03530 119045 117348 gene locus_tag LOCUS_03540 gene glpA 119045 117348 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D6F1 protein_id gnl|my_center|LOCUS_03540 119866 119087 gene locus_tag LOCUS_03550 gene glpR 119866 119087 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035615.1 protein_id gnl|my_center|LOCUS_03550 120239 121027 gene locus_tag LOCUS_03560 120239 121027 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974911.1 protein_id gnl|my_center|LOCUS_03560 121855 121226 gene locus_tag LOCUS_03570 gene upp 121855 121226 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TCU5 protein_id gnl|my_center|LOCUS_03570 122774 122163 gene locus_tag LOCUS_03580 gene tesA 122774 122163 CDS product esterase TesA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZY8 protein_id gnl|my_center|LOCUS_03580 122773 123456 gene locus_tag LOCUS_03590 122773 123456 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 protein_id gnl|my_center|LOCUS_03590 123456 125972 gene locus_tag LOCUS_03600 123456 125972 CDS product inner membrane transport permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039500.1 protein_id gnl|my_center|LOCUS_03600 128261 125958 gene locus_tag LOCUS_03610 128261 125958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 129061 128489 gene locus_tag LOCUS_03620 129061 128489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 129508 129071 gene locus_tag LOCUS_03630 129508 129071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 130109 129576 gene locus_tag LOCUS_03640 130109 129576 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266710.1 protein_id gnl|my_center|LOCUS_03640 131600 130224 gene locus_tag LOCUS_03650 131600 130224 CDS product 4Fe-4S binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529892.1 protein_id gnl|my_center|LOCUS_03650 132895 131657 gene locus_tag LOCUS_03660 132895 131657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 133302 132901 gene locus_tag LOCUS_03670 133302 132901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 134032 133619 gene locus_tag LOCUS_03680 gene fur 134032 133619 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194273.1 protein_id gnl|my_center|LOCUS_03680 134479 134273 gene locus_tag LOCUS_03690 134479 134273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 134510 135109 gene locus_tag LOCUS_03700 134510 135109 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975937.1 protein_id gnl|my_center|LOCUS_03700 135218 136186 gene locus_tag LOCUS_03710 135218 136186 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204922.1 protein_id gnl|my_center|LOCUS_03710 136296 137084 gene locus_tag LOCUS_03720 136296 137084 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072225.1 protein_id gnl|my_center|LOCUS_03720 137745 137230 gene locus_tag LOCUS_03730 137745 137230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03730 138049 138723 gene locus_tag LOCUS_03740 138049 138723 CDS product phosphate transport regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073546.1 protein_id gnl|my_center|LOCUS_03740 138743 140008 gene locus_tag LOCUS_03750 138743 140008 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAX0 protein_id gnl|my_center|LOCUS_03750 140182 141984 gene locus_tag LOCUS_03760 140182 141984 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957983.1 protein_id gnl|my_center|LOCUS_03760 144469 142136 gene locus_tag LOCUS_03770 144469 142136 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903632.1 protein_id gnl|my_center|LOCUS_03770 145071 144490 gene locus_tag LOCUS_03780 145071 144490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 145070 145348 gene locus_tag LOCUS_03790 145070 145348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 146553 145444 gene locus_tag LOCUS_03800 146553 145444 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND11 protein_id gnl|my_center|LOCUS_03800 146754 146566 gene locus_tag LOCUS_03810 146754 146566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 147051 147620 gene locus_tag LOCUS_03820 147051 147620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 147645 149162 gene locus_tag LOCUS_03830 gene ctaD 147645 149162 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328372.1 protein_id gnl|my_center|LOCUS_03830 149409 150125 gene locus_tag LOCUS_03840 149409 150125 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338189.1 protein_id gnl|my_center|LOCUS_03840 150165 150632 gene locus_tag LOCUS_03850 gene prx-4 150165 150632 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944057.1 protein_id gnl|my_center|LOCUS_03850 151024 151317 gene locus_tag LOCUS_03860 151024 151317 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948267.1 protein_id gnl|my_center|LOCUS_03860 151452 152159 gene locus_tag LOCUS_03870 151452 152159 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948268.1 protein_id gnl|my_center|LOCUS_03870 152231 152683 gene locus_tag LOCUS_03880 152231 152683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 152691 153020 gene locus_tag LOCUS_03890 152691 153020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 154794 153136 gene locus_tag LOCUS_03900 gene ccrB 154794 153136 CDS product serine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031832.1 protein_id gnl|my_center|LOCUS_03900 >Feature sequence03 556 308 gene locus_tag LOCUS_03910 556 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 1308 709 gene locus_tag LOCUS_03920 1308 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 2526 1315 gene locus_tag LOCUS_03930 2526 1315 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938819.1 protein_id gnl|my_center|LOCUS_03930 2810 2734 gene locus_tag LOCUS_t00070 2810 2734 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3981 2890 gene locus_tag LOCUS_03940 gene ychF 3981 2890 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44681 protein_id gnl|my_center|LOCUS_03940 4588 4004 gene locus_tag LOCUS_03950 gene pth 4588 4004 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888C8 protein_id gnl|my_center|LOCUS_03950 5330 4629 gene locus_tag LOCUS_03960 5330 4629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 6408 5452 gene locus_tag LOCUS_03970 gene prs 6408 5452 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VUH1 protein_id gnl|my_center|LOCUS_03970 6511 6435 gene locus_tag LOCUS_t00080 6511 6435 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 7423 6566 gene locus_tag LOCUS_03980 gene ispE 7423 6566 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN01 protein_id gnl|my_center|LOCUS_03980 8046 7405 gene locus_tag LOCUS_03990 gene lolB 8046 7405 CDS product outer-membrane lipoprotein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AQ2 protein_id gnl|my_center|LOCUS_03990 9629 8043 gene locus_tag LOCUS_04000 9629 8043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103429.1 protein_id gnl|my_center|LOCUS_04000 10016 11203 gene locus_tag LOCUS_04010 gene hemA 10016 11203 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42807 protein_id gnl|my_center|LOCUS_04010 11209 12303 gene locus_tag LOCUS_04020 gene prfA 11209 12303 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NIA8 protein_id gnl|my_center|LOCUS_04020 12312 13163 gene locus_tag LOCUS_04030 gene prmC 12312 13163 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC99 protein_id gnl|my_center|LOCUS_04030 13661 13239 gene locus_tag LOCUS_04040 13661 13239 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063809.1 protein_id gnl|my_center|LOCUS_04040 13902 13699 gene locus_tag LOCUS_04050 13902 13699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 13853 13996 gene locus_tag LOCUS_04060 13853 13996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 14007 14666 gene locus_tag LOCUS_04070 14007 14666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 16493 14700 gene locus_tag LOCUS_04080 gene deaD-1 16493 14700 CDS product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KET5 protein_id gnl|my_center|LOCUS_04080 16741 19068 gene locus_tag LOCUS_04090 16741 19068 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 protein_id gnl|my_center|LOCUS_04090 19065 19865 gene locus_tag LOCUS_04100 19065 19865 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_04100 19862 21028 gene locus_tag LOCUS_04110 19862 21028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480779.1 protein_id gnl|my_center|LOCUS_04110 23115 21034 gene locus_tag LOCUS_04120 gene prlC 23115 21034 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704124.1 protein_id gnl|my_center|LOCUS_04120 23273 24625 gene locus_tag LOCUS_04130 23273 24625 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703747.1 protein_id gnl|my_center|LOCUS_04130 25608 24748 gene locus_tag LOCUS_04140 gene aroE 25608 24748 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QP8 protein_id gnl|my_center|LOCUS_04140 26588 25674 gene locus_tag LOCUS_04150 26588 25674 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704312.1 protein_id gnl|my_center|LOCUS_04150 26872 26627 gene locus_tag LOCUS_04160 26872 26627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 27862 27008 gene locus_tag LOCUS_04170 gene ubiA 27862 27008 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJJ5 protein_id gnl|my_center|LOCUS_04170 29921 27852 gene locus_tag LOCUS_04180 gene recG 29921 27852 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTL3 protein_id gnl|my_center|LOCUS_04180 30343 29957 gene locus_tag LOCUS_04190 30343 29957 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070722.1 protein_id gnl|my_center|LOCUS_04190 32579 30390 gene locus_tag LOCUS_04200 gene spoT 32579 30390 CDS product guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096603.1 protein_id gnl|my_center|LOCUS_04200 32979 32545 gene locus_tag LOCUS_04210 32979 32545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 33739 33134 gene locus_tag LOCUS_04220 gene gmk 33739 33134 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60546 protein_id gnl|my_center|LOCUS_04220 34641 33775 gene locus_tag LOCUS_04230 34641 33775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208998.1 protein_id gnl|my_center|LOCUS_04230 34783 35523 gene locus_tag LOCUS_04240 gene rph 34783 35523 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQU6 protein_id gnl|my_center|LOCUS_04240 35580 36131 gene locus_tag LOCUS_04250 35580 36131 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5T3 protein_id gnl|my_center|LOCUS_04250 36208 36951 gene locus_tag LOCUS_04260 gene gpmA 36208 36951 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MD24 protein_id gnl|my_center|LOCUS_04260 38118 36991 gene locus_tag LOCUS_04270 gene agxT 38118 36991 CDS product serine--pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 protein_id gnl|my_center|LOCUS_04270 39421 38255 gene locus_tag LOCUS_04280 39421 38255 CDS product sodium:hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947236.1 protein_id gnl|my_center|LOCUS_04280 40154 39543 gene locus_tag LOCUS_04290 40154 39543 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_04290 40941 40171 gene locus_tag LOCUS_04300 40941 40171 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001894479.1 protein_id gnl|my_center|LOCUS_04300 41053 41538 gene locus_tag LOCUS_04310 gene moaC 41053 41538 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WV5 protein_id gnl|my_center|LOCUS_04310 42043 41600 gene locus_tag LOCUS_04320 42043 41600 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888773.1 protein_id gnl|my_center|LOCUS_04320 43050 42046 gene locus_tag LOCUS_04330 43050 42046 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531115.1 protein_id gnl|my_center|LOCUS_04330 43278 43847 gene locus_tag LOCUS_04340 43278 43847 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941339.1 protein_id gnl|my_center|LOCUS_04340 43847 44470 gene locus_tag LOCUS_04350 43847 44470 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943780.1 protein_id gnl|my_center|LOCUS_04350 44777 45802 gene locus_tag LOCUS_04360 gene moaA 44777 45802 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39757 protein_id gnl|my_center|LOCUS_04360 45851 46084 gene locus_tag LOCUS_04370 45851 46084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04370 46087 46521 gene locus_tag LOCUS_04380 46087 46521 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266803.1 protein_id gnl|my_center|LOCUS_04380 46539 46952 gene locus_tag LOCUS_04390 gene hslR 46539 46952 CDS product heat shock protein 15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CFW8 protein_id gnl|my_center|LOCUS_04390 47578 46970 gene locus_tag LOCUS_04400 gene thrH 47578 46970 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116438.1 protein_id gnl|my_center|LOCUS_04400 47794 48753 gene locus_tag LOCUS_04410 gene hprA 47794 48753 CDS product glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114710.1 protein_id gnl|my_center|LOCUS_04410 48887 49909 gene locus_tag LOCUS_04420 48887 49909 CDS product YggW family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266423.1 protein_id gnl|my_center|LOCUS_04420 50096 50578 gene locus_tag LOCUS_04430 gene trmL 50096 50578 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F639 protein_id gnl|my_center|LOCUS_04430 51170 50709 gene locus_tag LOCUS_04440 51170 50709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 52304 51279 gene locus_tag LOCUS_04450 gene gpsA 52304 51279 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF08 protein_id gnl|my_center|LOCUS_04450 52816 52304 gene locus_tag LOCUS_04460 gene secB 52816 52304 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKP0 protein_id gnl|my_center|LOCUS_04460 53281 52862 gene locus_tag LOCUS_04470 53281 52862 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815278.1 protein_id gnl|my_center|LOCUS_04470 53782 53414 gene locus_tag LOCUS_04480 53782 53414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008492915.1 protein_id gnl|my_center|LOCUS_04480 54026 55369 gene locus_tag LOCUS_04490 54026 55369 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413541.1 protein_id gnl|my_center|LOCUS_04490 55797 55477 gene locus_tag LOCUS_04500 gene nirD 55797 55477 CDS product benzene 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010050.1 protein_id gnl|my_center|LOCUS_04500 56270 55806 gene locus_tag LOCUS_04510 56270 55806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 57513 56263 gene locus_tag LOCUS_04520 57513 56263 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKV3 protein_id gnl|my_center|LOCUS_04520 58831 57506 gene locus_tag LOCUS_04530 58831 57506 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946340.1 protein_id gnl|my_center|LOCUS_04530 59583 58828 gene locus_tag LOCUS_04540 59583 58828 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141371.1 protein_id gnl|my_center|LOCUS_04540 61092 59644 gene locus_tag LOCUS_04550 gene ycf24 61092 59644 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946338.1 protein_id gnl|my_center|LOCUS_04550 61702 61199 gene locus_tag LOCUS_04560 gene iscR 61702 61199 CDS product HTH-type transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E785 protein_id gnl|my_center|LOCUS_04560 63545 61851 gene locus_tag LOCUS_04570 gene ubiB 63545 61851 CDS product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRH7 protein_id gnl|my_center|LOCUS_04570 64131 63547 gene locus_tag LOCUS_04580 64131 63547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958604.1 protein_id gnl|my_center|LOCUS_04580 64904 64146 gene locus_tag LOCUS_04590 gene ubiE 64904 64146 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUC0 protein_id gnl|my_center|LOCUS_04590 65290 64916 gene locus_tag LOCUS_04600 65290 64916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190130.1 protein_id gnl|my_center|LOCUS_04600 66386 65457 gene locus_tag LOCUS_04610 gene hemB 66386 65457 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9Q8 protein_id gnl|my_center|LOCUS_04610 66597 66960 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccttcttgaccgctgccttttt 66969 67141 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccttcgtagttgccttcttggct 68210 68554 gene locus_tag LOCUS_04620 68210 68554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 68625 69887 gene locus_tag LOCUS_04630 gene pfp 68625 69887 CDS product pyrophosphate--fructose 6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZU94 protein_id gnl|my_center|LOCUS_04630 69906 70106 gene locus_tag LOCUS_04640 69906 70106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 71020 70124 gene locus_tag LOCUS_04650 gene xerC 71020 70124 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFI3 protein_id gnl|my_center|LOCUS_04650 71753 71010 gene locus_tag LOCUS_04660 71753 71010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 72589 71750 gene locus_tag LOCUS_04670 gene dapF 72589 71750 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVL6 protein_id gnl|my_center|LOCUS_04670 72685 72969 gene locus_tag LOCUS_04680 72685 72969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 73594 73022 gene locus_tag LOCUS_04690 gene nudE 73594 73022 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459019.1 protein_id gnl|my_center|LOCUS_04690 73875 74216 gene locus_tag LOCUS_04700 73875 74216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 74825 74238 gene locus_tag LOCUS_04710 74825 74238 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087070.1 protein_id gnl|my_center|LOCUS_04710 75367 75077 gene locus_tag LOCUS_04720 gene hupB 75367 75077 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772706.1 protein_id gnl|my_center|LOCUS_04720 75737 76147 gene locus_tag LOCUS_04730 gene queF 75737 76147 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F719 protein_id gnl|my_center|LOCUS_04730 76724 76173 gene locus_tag LOCUS_04740 gene mogA 76724 76173 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707146.1 protein_id gnl|my_center|LOCUS_04740 77005 79371 gene locus_tag LOCUS_04750 77005 79371 CDS product copper-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093042.1 protein_id gnl|my_center|LOCUS_04750 79533 79949 gene locus_tag LOCUS_04760 79533 79949 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086688.1 protein_id gnl|my_center|LOCUS_04760 80007 80588 gene locus_tag LOCUS_04770 80007 80588 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176066.1 protein_id gnl|my_center|LOCUS_04770 80882 80643 gene locus_tag LOCUS_04780 80882 80643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 81116 81041 gene locus_tag LOCUS_t00090 81116 81041 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 81459 81166 gene locus_tag LOCUS_04790 81459 81166 CDS product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62IU9 protein_id gnl|my_center|LOCUS_04790 82406 81456 gene locus_tag LOCUS_04800 gene mutY 82406 81456 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261209.1 protein_id gnl|my_center|LOCUS_04800 82618 84453 gene locus_tag LOCUS_04810 82618 84453 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390914.1 protein_id gnl|my_center|LOCUS_04810 84478 85581 gene locus_tag LOCUS_04820 84478 85581 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552742.1 protein_id gnl|my_center|LOCUS_04820 85712 86668 gene locus_tag LOCUS_04830 85712 86668 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087942.1 protein_id gnl|my_center|LOCUS_04830 86665 88317 gene locus_tag LOCUS_04840 86665 88317 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770761.1 protein_id gnl|my_center|LOCUS_04840 88347 89150 gene locus_tag LOCUS_04850 88347 89150 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083898.1 protein_id gnl|my_center|LOCUS_04850 89449 89174 gene locus_tag LOCUS_04860 89449 89174 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228240.1 protein_id gnl|my_center|LOCUS_04860 89657 91501 gene locus_tag LOCUS_04870 89657 91501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 91538 92836 gene locus_tag LOCUS_04880 91538 92836 CDS product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016225.1 protein_id gnl|my_center|LOCUS_04880 92854 93663 gene locus_tag LOCUS_04890 92854 93663 CDS product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879451.1 protein_id gnl|my_center|LOCUS_04890 93663 94493 gene locus_tag LOCUS_04900 gene hadI 93663 94493 CDS product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888223.1 protein_id gnl|my_center|LOCUS_04900 94496 94789 gene locus_tag LOCUS_04910 94496 94789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 95479 94868 gene locus_tag LOCUS_04920 95479 94868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185803.1 protein_id gnl|my_center|LOCUS_04920 95749 95985 gene locus_tag LOCUS_04930 95749 95985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 96016 96165 gene locus_tag LOCUS_04940 96016 96165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 97362 96142 gene locus_tag LOCUS_04950 97362 96142 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085877.1 protein_id gnl|my_center|LOCUS_04950 97443 97370 gene locus_tag LOCUS_t00100 97443 97370 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 97559 98248 gene locus_tag LOCUS_04960 gene trmB 97559 98248 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6B3 protein_id gnl|my_center|LOCUS_04960 98963 98262 gene locus_tag LOCUS_04970 gene rpiA 98963 98262 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLU8 protein_id gnl|my_center|LOCUS_04970 99168 99392 gene locus_tag LOCUS_04980 99168 99392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 99392 100144 gene locus_tag LOCUS_04990 99392 100144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 100141 101241 gene locus_tag LOCUS_05000 gene zapE 100141 101241 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVX7 protein_id gnl|my_center|LOCUS_05000 101605 101261 gene locus_tag LOCUS_05010 101605 101261 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531657.1 protein_id gnl|my_center|LOCUS_05010 102009 101770 gene locus_tag LOCUS_05020 102009 101770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 102763 104025 gene locus_tag LOCUS_05030 102763 104025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 104038 107205 gene locus_tag LOCUS_05040 104038 107205 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261108.1 protein_id gnl|my_center|LOCUS_05040 107645 107172 gene locus_tag LOCUS_05050 107645 107172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 108153 107656 gene locus_tag LOCUS_05060 gene folA 108153 107656 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225957.1 protein_id gnl|my_center|LOCUS_05060 108993 108160 gene locus_tag LOCUS_05070 gene thyA 108993 108160 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG32 protein_id gnl|my_center|LOCUS_05070 110362 109004 gene locus_tag LOCUS_05080 110362 109004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 111498 110776 gene locus_tag LOCUS_05090 111498 110776 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531778.1 protein_id gnl|my_center|LOCUS_05090 112211 111507 gene locus_tag LOCUS_05100 112211 111507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087917.1 protein_id gnl|my_center|LOCUS_05100 114898 112208 gene locus_tag LOCUS_05110 gene pepN 114898 112208 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 protein_id gnl|my_center|LOCUS_05110 115170 114895 gene locus_tag LOCUS_05120 115170 114895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 115380 115192 gene locus_tag LOCUS_05130 115380 115192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 115559 115834 gene locus_tag LOCUS_05140 115559 115834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 119546 115848 gene locus_tag LOCUS_05150 gene metH 119546 115848 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096035.1 protein_id gnl|my_center|LOCUS_05150 120310 119549 gene locus_tag LOCUS_05160 gene metF 120310 119549 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V72 protein_id gnl|my_center|LOCUS_05160 121829 120411 gene locus_tag LOCUS_05170 gene ahcY 121829 120411 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63PT2 protein_id gnl|my_center|LOCUS_05170 123033 121858 gene locus_tag LOCUS_05180 gene metK 123033 121858 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPS4 protein_id gnl|my_center|LOCUS_05180 123943 123290 gene locus_tag LOCUS_05190 123943 123290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 125333 123933 gene locus_tag LOCUS_05200 gene ntrC 125333 123933 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104661.1 protein_id gnl|my_center|LOCUS_05200 126406 125336 gene locus_tag LOCUS_05210 gene ntrB 126406 125336 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096033.1 protein_id gnl|my_center|LOCUS_05210 127893 126484 gene locus_tag LOCUS_05220 127893 126484 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TE8 protein_id gnl|my_center|LOCUS_05220 129407 128208 gene locus_tag LOCUS_05230 129407 128208 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947750.1 protein_id gnl|my_center|LOCUS_05230 129668 129426 gene locus_tag LOCUS_05240 129668 129426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 130708 129665 gene locus_tag LOCUS_05250 130708 129665 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583848.1 protein_id gnl|my_center|LOCUS_05250 131606 130950 gene locus_tag LOCUS_05260 gene adk 131606 130950 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD69 protein_id gnl|my_center|LOCUS_05260 132044 132925 gene locus_tag LOCUS_05270 gene glyQ 132044 132925 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKS5 protein_id gnl|my_center|LOCUS_05270 132912 135065 gene locus_tag LOCUS_05280 gene glyS 132912 135065 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z9W7 protein_id gnl|my_center|LOCUS_05280 135065 135427 gene locus_tag LOCUS_05290 135065 135427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 135432 136016 gene locus_tag LOCUS_05300 135432 136016 CDS product D,D-heptose 1,7-bisphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P9H1 protein_id gnl|my_center|LOCUS_05300 136013 136729 gene locus_tag LOCUS_05310 gene lptA 136013 136729 CDS product lysophosphatidic acid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100265.1 protein_id gnl|my_center|LOCUS_05310 137437 136853 gene locus_tag LOCUS_05320 137437 136853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 138117 137434 gene locus_tag LOCUS_05330 gene rsmA 138117 137434 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U5 protein_id gnl|my_center|LOCUS_05330 139256 138264 gene locus_tag LOCUS_05340 gene pdxA 139256 138264 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGT9 protein_id gnl|my_center|LOCUS_05340 139396 139229 gene locus_tag LOCUS_05350 139396 139229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 139971 139408 gene locus_tag LOCUS_05360 139971 139408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 141803 140067 gene locus_tag LOCUS_05370 gene argS 141803 140067 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTX7 protein_id gnl|my_center|LOCUS_05370 144173 141939 gene locus_tag LOCUS_05380 gene priA 144173 141939 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZF4 protein_id gnl|my_center|LOCUS_05380 >Feature sequence04 4879 1241 gene locus_tag LOCUS_05390 gene narG 4879 1241 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729064.1 protein_id gnl|my_center|LOCUS_05390 5527 5033 gene locus_tag LOCUS_05400 5527 5033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 5955 6815 gene locus_tag LOCUS_05410 5955 6815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064968.1 protein_id gnl|my_center|LOCUS_05410 6838 7686 gene locus_tag LOCUS_05420 gene ttcA 6838 7686 CDS product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4E6 protein_id gnl|my_center|LOCUS_05420 8659 7739 gene locus_tag LOCUS_05430 gene gluQ 8659 7739 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BE3 protein_id gnl|my_center|LOCUS_05430 9103 8699 gene locus_tag LOCUS_05440 9103 8699 CDS product SirB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073594.1 protein_id gnl|my_center|LOCUS_05440 10170 9121 gene locus_tag LOCUS_05450 gene ctaA 10170 9121 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QR8 protein_id gnl|my_center|LOCUS_05450 10343 11143 gene locus_tag LOCUS_05460 gene fnr 10343 11143 CDS product transcriptional regulator FNR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160911.1 protein_id gnl|my_center|LOCUS_05460 12602 11187 gene locus_tag LOCUS_05470 gene hemN 12602 11187 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P77915 protein_id gnl|my_center|LOCUS_05470 13253 13540 gene locus_tag LOCUS_05480 13253 13540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 13621 14952 gene locus_tag LOCUS_05490 13621 14952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536312.1 protein_id gnl|my_center|LOCUS_05490 15747 14998 gene locus_tag LOCUS_05500 15747 14998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 16029 15766 gene locus_tag LOCUS_05510 16029 15766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 17368 15959 gene locus_tag LOCUS_05520 17368 15959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637104.2 protein_id gnl|my_center|LOCUS_05520 17575 18009 gene locus_tag LOCUS_05530 17575 18009 CDS product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932672.1 protein_id gnl|my_center|LOCUS_05530 18987 18055 gene locus_tag LOCUS_05540 18987 18055 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205164.1 protein_id gnl|my_center|LOCUS_05540 19973 18978 gene locus_tag LOCUS_05550 19973 18978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524668.1 protein_id gnl|my_center|LOCUS_05550 20430 20987 gene locus_tag LOCUS_05560 20430 20987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124788.1 protein_id gnl|my_center|LOCUS_05560 22094 21153 gene locus_tag LOCUS_05570 22094 21153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 22212 22415 gene locus_tag LOCUS_05580 22212 22415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 23449 22904 gene locus_tag LOCUS_05590 gene korC 23449 22904 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942116.1 protein_id gnl|my_center|LOCUS_05590 24318 23446 gene locus_tag LOCUS_05600 gene oorB 24318 23446 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854895.1 protein_id gnl|my_center|LOCUS_05600 25459 24311 gene locus_tag LOCUS_05610 gene korA 25459 24311 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942114.1 protein_id gnl|my_center|LOCUS_05610 26340 25456 gene locus_tag LOCUS_05620 26340 25456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 28166 26337 gene locus_tag LOCUS_05630 28166 26337 CDS product indolepyruvate oxidoreductase subunit IorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG75 protein_id gnl|my_center|LOCUS_05630 28930 28460 gene locus_tag LOCUS_05640 gene ElaA 28930 28460 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721534.1 protein_id gnl|my_center|LOCUS_05640 30594 29020 gene locus_tag LOCUS_05650 gene prfC 30594 29020 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZX60 protein_id gnl|my_center|LOCUS_05650 31980 30646 gene locus_tag LOCUS_05660 gene rimO 31980 30646 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXP6 protein_id gnl|my_center|LOCUS_05660 32989 32153 gene locus_tag LOCUS_05670 32989 32153 CDS product putative phosphoenolpyruvate synthase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVB2 protein_id gnl|my_center|LOCUS_05670 33156 35513 gene locus_tag LOCUS_05680 gene ppsA 33156 35513 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883Q8 protein_id gnl|my_center|LOCUS_05680 36419 35529 gene locus_tag LOCUS_05690 gene exo 36419 35529 CDS product exodeoxyribonuclease IX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036075.1 protein_id gnl|my_center|LOCUS_05690 37203 36424 gene locus_tag LOCUS_05700 gene lgt 37203 36424 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6F2 protein_id gnl|my_center|LOCUS_05700 37464 38888 gene locus_tag LOCUS_05710 37464 38888 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388201.1 protein_id gnl|my_center|LOCUS_05710 39571 38975 gene locus_tag LOCUS_05720 gene ahpC 39571 38975 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854219.1 protein_id gnl|my_center|LOCUS_05720 41213 39663 gene locus_tag LOCUS_05730 gene ggt 41213 39663 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142355.1 protein_id gnl|my_center|LOCUS_05730 42075 41554 gene locus_tag LOCUS_05740 42075 41554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084789.1 protein_id gnl|my_center|LOCUS_05740 42557 42276 gene locus_tag LOCUS_05750 42557 42276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 43542 42907 gene locus_tag LOCUS_05760 43542 42907 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142016.1 protein_id gnl|my_center|LOCUS_05760 45248 43566 gene locus_tag LOCUS_05770 45248 43566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 45978 45385 gene locus_tag LOCUS_05780 45978 45385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 46769 45984 gene locus_tag LOCUS_05790 46769 45984 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084052.1 protein_id gnl|my_center|LOCUS_05790 48087 46792 gene locus_tag LOCUS_05800 gene cysD 48087 46792 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084053.1 protein_id gnl|my_center|LOCUS_05800 48664 48209 gene locus_tag LOCUS_05810 48664 48209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521667.1 protein_id gnl|my_center|LOCUS_05810 49018 50337 gene locus_tag LOCUS_05820 49018 50337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 51588 50428 gene locus_tag LOCUS_05830 51588 50428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550279.1 protein_id gnl|my_center|LOCUS_05830 53053 51602 gene locus_tag LOCUS_05840 53053 51602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204001.1 protein_id gnl|my_center|LOCUS_05840 53319 54302 gene locus_tag LOCUS_05850 gene fabD 53319 54302 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HEW3 protein_id gnl|my_center|LOCUS_05850 54395 54856 gene locus_tag LOCUS_05860 54395 54856 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946342.1 protein_id gnl|my_center|LOCUS_05860 55263 54859 gene locus_tag LOCUS_05870 55263 54859 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531105.1 protein_id gnl|my_center|LOCUS_05870 56282 55287 gene locus_tag LOCUS_05880 56282 55287 CDS product putative GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WPZ1 protein_id gnl|my_center|LOCUS_05880 58298 56307 gene locus_tag LOCUS_05890 58298 56307 CDS product acetyl/propionyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387813.1 protein_id gnl|my_center|LOCUS_05890 59855 58323 gene locus_tag LOCUS_05900 59855 58323 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387814.1 protein_id gnl|my_center|LOCUS_05900 62088 59938 gene locus_tag LOCUS_05910 gene mcmA 62088 59938 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337301.1 protein_id gnl|my_center|LOCUS_05910 63998 62100 gene locus_tag LOCUS_05920 63998 62100 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388801.1 protein_id gnl|my_center|LOCUS_05920 64211 64987 gene locus_tag LOCUS_05930 64211 64987 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391548.1 protein_id gnl|my_center|LOCUS_05930 65038 65805 gene locus_tag LOCUS_05940 65038 65805 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089546.1 protein_id gnl|my_center|LOCUS_05940 67677 66376 gene locus_tag LOCUS_05950 gene hemL 67677 66376 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NPI4 protein_id gnl|my_center|LOCUS_05950 69319 67688 gene locus_tag LOCUS_05960 gene hutH2 69319 67688 CDS product histidine ammonia-lyase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RDU4 protein_id gnl|my_center|LOCUS_05960 69547 70014 gene locus_tag LOCUS_05970 69547 70014 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205287.1 protein_id gnl|my_center|LOCUS_05970 71943 70105 gene locus_tag LOCUS_05980 71943 70105 CDS product feruloyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083866.1 protein_id gnl|my_center|LOCUS_05980 73189 72074 gene locus_tag LOCUS_05990 gene hemE 73189 72074 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGD0 protein_id gnl|my_center|LOCUS_05990 73946 73203 gene locus_tag LOCUS_06000 gene pyrF 73946 73203 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3D7 protein_id gnl|my_center|LOCUS_06000 74033 74578 gene locus_tag LOCUS_06010 gene msrA 74033 74578 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89W59 protein_id gnl|my_center|LOCUS_06010 74575 75237 gene locus_tag LOCUS_06020 74575 75237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 76640 75234 gene locus_tag LOCUS_06030 gene gltD 76640 75234 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095829.1 protein_id gnl|my_center|LOCUS_06030 81052 76664 gene locus_tag LOCUS_06040 gene gltB 81052 76664 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103700.1 protein_id gnl|my_center|LOCUS_06040 82388 81294 gene locus_tag LOCUS_06050 gene aroB 82388 81294 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V15 protein_id gnl|my_center|LOCUS_06050 82897 82385 gene locus_tag LOCUS_06060 gene aroK 82897 82385 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V14 protein_id gnl|my_center|LOCUS_06060 83034 85409 gene locus_tag LOCUS_06070 gene ponA 83034 85409 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958515.1 protein_id gnl|my_center|LOCUS_06070 85406 86059 gene locus_tag LOCUS_06080 85406 86059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 86380 87756 gene locus_tag LOCUS_06090 86380 87756 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975253.1 protein_id gnl|my_center|LOCUS_06090 87758 89230 gene locus_tag LOCUS_06100 87758 89230 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193515.1 protein_id gnl|my_center|LOCUS_06100 89687 89211 gene locus_tag LOCUS_06110 89687 89211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 92234 89805 gene locus_tag LOCUS_06120 gene topA 92234 89805 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4F3 protein_id gnl|my_center|LOCUS_06120 92934 92449 gene locus_tag LOCUS_06130 gene smg 92934 92449 CDS product protein Smg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEX3 protein_id gnl|my_center|LOCUS_06130 94364 93258 gene locus_tag LOCUS_06140 gene smf 94364 93258 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929874.1 protein_id gnl|my_center|LOCUS_06140 94509 95021 gene locus_tag LOCUS_06150 gene def 94509 95021 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63916 protein_id gnl|my_center|LOCUS_06150 95073 96005 gene locus_tag LOCUS_06160 gene fmt 95073 96005 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23882 protein_id gnl|my_center|LOCUS_06160 95989 97362 gene locus_tag LOCUS_06170 95989 97362 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500T1 protein_id gnl|my_center|LOCUS_06170 97422 97994 gene locus_tag LOCUS_06180 97422 97994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 98144 100189 gene locus_tag LOCUS_06190 98144 100189 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929884.1 protein_id gnl|my_center|LOCUS_06190 100190 101578 gene locus_tag LOCUS_06200 100190 101578 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_06200 101575 102972 gene locus_tag LOCUS_06210 gene trkA 101575 102972 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768190.1 protein_id gnl|my_center|LOCUS_06210 103007 104458 gene locus_tag LOCUS_06220 103007 104458 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNI3 protein_id gnl|my_center|LOCUS_06220 105288 104476 gene locus_tag LOCUS_06230 gene lpxL 105288 104476 CDS product lipid A biosynthesis lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ8 protein_id gnl|my_center|LOCUS_06230 105519 107150 gene locus_tag LOCUS_06240 gene glpA 105519 107150 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142835.1 protein_id gnl|my_center|LOCUS_06240 107177 108001 gene locus_tag LOCUS_06250 107177 108001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 108019 109506 gene locus_tag LOCUS_06260 108019 109506 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919511.1 protein_id gnl|my_center|LOCUS_06260 109503 109931 gene locus_tag LOCUS_06270 109503 109931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 109928 110602 gene locus_tag LOCUS_06280 109928 110602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 110599 111666 gene locus_tag LOCUS_06290 110599 111666 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973127.1 protein_id gnl|my_center|LOCUS_06290 111669 113597 gene locus_tag LOCUS_06300 gene asnB 111669 113597 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288533.1 protein_id gnl|my_center|LOCUS_06300 113605 114345 gene locus_tag LOCUS_06310 113605 114345 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937647.1 protein_id gnl|my_center|LOCUS_06310 >Feature sequence05 <1 1087 gene locus_tag LOCUS_06320 <1 1087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939232.1:2-oxoglutarate ferredoxin oxidoreductase subunit beta 1472 3034 gene locus_tag LOCUS_06330 1472 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 3049 3219 gene locus_tag LOCUS_06340 3049 3219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 3319 3786 gene locus_tag LOCUS_06350 3319 3786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 3783 4400 gene locus_tag LOCUS_06360 3783 4400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 5683 4553 gene locus_tag LOCUS_06370 5683 4553 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268679.1 protein_id gnl|my_center|LOCUS_06370 6036 6614 gene locus_tag LOCUS_06380 gene orn 6036 6614 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FQM7 protein_id gnl|my_center|LOCUS_06380 7736 6663 gene locus_tag LOCUS_06390 gene queG 7736 6663 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL4 protein_id gnl|my_center|LOCUS_06390 7754 9301 gene locus_tag LOCUS_06400 gene nnr 7754 9301 CDS product bifunctional NAD(P)H-hydrate repair enzyme Nnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CM5 protein_id gnl|my_center|LOCUS_06400 9307 9741 gene locus_tag LOCUS_06410 gene yjeE 9307 9741 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070930.1 protein_id gnl|my_center|LOCUS_06410 9745 10905 gene locus_tag LOCUS_06420 gene amiB 9745 10905 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123571.1 protein_id gnl|my_center|LOCUS_06420 10950 12752 gene locus_tag LOCUS_06430 gene mutL 10950 12752 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8E4 protein_id gnl|my_center|LOCUS_06430 12803 13711 gene locus_tag LOCUS_06440 gene miaA 12803 13711 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L06 protein_id gnl|my_center|LOCUS_06440 13788 14051 gene locus_tag LOCUS_06450 13788 14051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 14110 15456 gene locus_tag LOCUS_06460 gene hflX 14110 15456 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGS2 protein_id gnl|my_center|LOCUS_06460 15756 16787 gene locus_tag LOCUS_06470 gene hflK 15756 16787 CDS product HflK protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040075.1 protein_id gnl|my_center|LOCUS_06470 16787 17665 gene locus_tag LOCUS_06480 gene hflC 16787 17665 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM3 protein_id gnl|my_center|LOCUS_06480 17680 17871 gene locus_tag LOCUS_06490 17680 17871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 17926 19125 gene locus_tag LOCUS_06500 gene hisZ 17926 19125 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VJ8 protein_id gnl|my_center|LOCUS_06500 19165 20478 gene locus_tag LOCUS_06510 gene purA 19165 20478 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2D3 protein_id gnl|my_center|LOCUS_06510 20544 20882 gene locus_tag LOCUS_06520 20544 20882 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635217.1 protein_id gnl|my_center|LOCUS_06520 21014 22642 gene locus_tag LOCUS_06530 gene mppA 21014 22642 CDS product periplasmic murein peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P77348 protein_id gnl|my_center|LOCUS_06530 22740 23663 gene locus_tag LOCUS_06540 gene oppB 22740 23663 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210654.1 protein_id gnl|my_center|LOCUS_06540 23675 24604 gene locus_tag LOCUS_06550 gene oppC 23675 24604 CDS product oligopeptide transport system permease protein OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AFH7 protein_id gnl|my_center|LOCUS_06550 24609 25583 gene locus_tag LOCUS_06560 gene oppD 24609 25583 CDS product oligopeptide ABC transporter ATP-binding protein OppD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106016.1 protein_id gnl|my_center|LOCUS_06560 25598 26566 gene locus_tag LOCUS_06570 25598 26566 CDS product oligopeptide ABC transporter ATP-binding protein OppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706426.1 protein_id gnl|my_center|LOCUS_06570 26827 26741 gene locus_tag LOCUS_t00110 26827 26741 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 26955 29096 gene locus_tag LOCUS_06580 gene rnr 26955 29096 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM7 protein_id gnl|my_center|LOCUS_06580 29093 29836 gene locus_tag LOCUS_06590 gene rlmB 29093 29836 CDS product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG60 protein_id gnl|my_center|LOCUS_06590 30508 29858 gene locus_tag LOCUS_06600 gene nth 30508 29858 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CMP5 protein_id gnl|my_center|LOCUS_06600 31050 30505 gene locus_tag LOCUS_06610 31050 30505 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813855.1 protein_id gnl|my_center|LOCUS_06610 33228 31192 gene locus_tag LOCUS_06620 gene metG 33228 31192 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NCE4 protein_id gnl|my_center|LOCUS_06620 33551 34642 gene locus_tag LOCUS_06630 33551 34642 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P1M7 protein_id gnl|my_center|LOCUS_06630 34836 35369 gene locus_tag LOCUS_06640 gene dcd 34836 35369 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63904 protein_id gnl|my_center|LOCUS_06640 35523 36590 gene locus_tag LOCUS_06650 gene aroC 35523 36590 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CRQ8 protein_id gnl|my_center|LOCUS_06650 36625 36900 gene locus_tag LOCUS_06660 36625 36900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 37147 38229 gene locus_tag LOCUS_06670 gene asd1 37147 38229 CDS product aspartate-semialdehyde dehydrogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQG2 protein_id gnl|my_center|LOCUS_06670 38491 39354 gene locus_tag LOCUS_06680 38491 39354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101866.1 protein_id gnl|my_center|LOCUS_06680 40220 39381 gene locus_tag LOCUS_06690 gene trpA 40220 39381 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WE4 protein_id gnl|my_center|LOCUS_06690 41341 40217 gene locus_tag LOCUS_06700 gene trpB 41341 40217 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CFJ6 protein_id gnl|my_center|LOCUS_06700 41373 41591 gene locus_tag LOCUS_06710 41373 41591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 41604 42383 gene locus_tag LOCUS_06720 gene truA 41604 42383 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVY6 protein_id gnl|my_center|LOCUS_06720 42503 43123 gene locus_tag LOCUS_06730 gene trpF 42503 43123 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59649 protein_id gnl|my_center|LOCUS_06730 43146 44102 gene locus_tag LOCUS_06740 gene accD 43146 44102 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WAP5 protein_id gnl|my_center|LOCUS_06740 44132 45406 gene locus_tag LOCUS_06750 gene folC 44132 45406 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811819.1 protein_id gnl|my_center|LOCUS_06750 45430 46122 gene locus_tag LOCUS_06760 45430 46122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 46163 46669 gene locus_tag LOCUS_06770 gene dedE 46163 46669 CDS product colicin V biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947074.1 protein_id gnl|my_center|LOCUS_06770 46765 48285 gene locus_tag LOCUS_06780 gene purF 46765 48285 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YI6 protein_id gnl|my_center|LOCUS_06780 49040 48315 gene locus_tag LOCUS_06790 gene lpxH 49040 48315 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QK1 protein_id gnl|my_center|LOCUS_06790 49207 50619 gene locus_tag LOCUS_06800 gene cysS 49207 50619 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U7 protein_id gnl|my_center|LOCUS_06800 50757 52490 gene locus_tag LOCUS_06810 gene ilvI 50757 52490 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VP8 protein_id gnl|my_center|LOCUS_06810 52494 52985 gene locus_tag LOCUS_06820 gene ilvH 52494 52985 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814006.1 protein_id gnl|my_center|LOCUS_06820 53100 54116 gene locus_tag LOCUS_06830 gene ilvC 53100 54116 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BW9 protein_id gnl|my_center|LOCUS_06830 54141 54794 gene locus_tag LOCUS_06840 gene psd 54141 54794 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VP5 protein_id gnl|my_center|LOCUS_06840 54828 55589 gene locus_tag LOCUS_06850 gene pssA 54828 55589 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073396.1 protein_id gnl|my_center|LOCUS_06850 55831 57378 gene locus_tag LOCUS_06860 gene leuA 55831 57378 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JZG1 protein_id gnl|my_center|LOCUS_06860 57378 58046 gene locus_tag LOCUS_06870 57378 58046 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204013.1 protein_id gnl|my_center|LOCUS_06870 58063 58530 gene locus_tag LOCUS_06880 gene rimI 58063 58530 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCS0 protein_id gnl|my_center|LOCUS_06880 60291 58561 gene locus_tag LOCUS_06890 60291 58561 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264066.1 protein_id gnl|my_center|LOCUS_06890 60793 61464 gene locus_tag LOCUS_06900 60793 61464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 61524 61973 gene locus_tag LOCUS_06910 gene rnhA 61524 61973 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVL1 protein_id gnl|my_center|LOCUS_06910 61985 62686 gene locus_tag LOCUS_06920 gene dnaQ 61985 62686 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947114.1 protein_id gnl|my_center|LOCUS_06920 64414 62720 gene locus_tag LOCUS_06930 64414 62720 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118364.1 protein_id gnl|my_center|LOCUS_06930 64583 64401 gene locus_tag LOCUS_06940 64583 64401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 66148 64682 gene locus_tag LOCUS_06950 66148 64682 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118365.1 protein_id gnl|my_center|LOCUS_06950 67638 66145 gene locus_tag LOCUS_06960 67638 66145 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389325.1 protein_id gnl|my_center|LOCUS_06960 67991 67635 gene locus_tag LOCUS_06970 67991 67635 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_06970 68416 67988 gene locus_tag LOCUS_06980 68416 67988 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389327.1 protein_id gnl|my_center|LOCUS_06980 68886 68416 gene locus_tag LOCUS_06990 68886 68416 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389328.1 protein_id gnl|my_center|LOCUS_06990 69302 68973 gene locus_tag LOCUS_07000 69302 68973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 69586 69302 gene locus_tag LOCUS_07010 69586 69302 CDS product pH regulation protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389330.1 protein_id gnl|my_center|LOCUS_07010 70094 69588 gene locus_tag LOCUS_07020 70094 69588 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389331.1 protein_id gnl|my_center|LOCUS_07020 70799 72733 gene locus_tag LOCUS_07030 gene acsA2 70799 72733 CDS product acetyl-coenzyme A synthetase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV66 protein_id gnl|my_center|LOCUS_07030 73073 73270 gene locus_tag LOCUS_07040 73073 73270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 73314 73928 gene locus_tag LOCUS_07050 73314 73928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 73964 74338 gene locus_tag LOCUS_07060 73964 74338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 74450 75163 gene locus_tag LOCUS_07070 74450 75163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087270.1 protein_id gnl|my_center|LOCUS_07070 77313 75430 gene locus_tag LOCUS_07080 gene uup 77313 75430 CDS product heme ABC transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941581.1 protein_id gnl|my_center|LOCUS_07080 78016 77447 gene locus_tag LOCUS_07090 78016 77447 CDS product signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946580.1 protein_id gnl|my_center|LOCUS_07090 78490 78789 gene locus_tag LOCUS_07100 78490 78789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 78860 79465 gene locus_tag LOCUS_07110 gene lexA 78860 79465 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HFB0 protein_id gnl|my_center|LOCUS_07110 79487 79897 gene locus_tag LOCUS_07120 79487 79897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 79866 81146 gene locus_tag LOCUS_07130 gene dinB 79866 81146 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H50 protein_id gnl|my_center|LOCUS_07130 81461 81312 gene locus_tag LOCUS_07140 81461 81312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 82035 81535 gene locus_tag LOCUS_07150 82035 81535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 83708 83037 gene locus_tag LOCUS_07160 83708 83037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 84268 83927 gene locus_tag LOCUS_07170 84268 83927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707068.1 protein_id gnl|my_center|LOCUS_07170 84498 84797 gene locus_tag LOCUS_07180 84498 84797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 84851 86122 gene locus_tag LOCUS_07190 84851 86122 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088518.1 protein_id gnl|my_center|LOCUS_07190 86312 87331 gene locus_tag LOCUS_07200 86312 87331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338924.1 protein_id gnl|my_center|LOCUS_07200 89055 87412 gene locus_tag LOCUS_07210 89055 87412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 >Feature sequence06 1528 221 gene locus_tag LOCUS_07220 1528 221 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222287.1 protein_id gnl|my_center|LOCUS_07220 2868 1576 gene locus_tag LOCUS_07230 2868 1576 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392822.1 protein_id gnl|my_center|LOCUS_07230 3348 2878 gene locus_tag LOCUS_07240 3348 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07240 3783 3391 gene locus_tag LOCUS_07250 3783 3391 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313469.1 protein_id gnl|my_center|LOCUS_07250 4372 3788 gene locus_tag LOCUS_07260 4372 3788 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IWR1 protein_id gnl|my_center|LOCUS_07260 5148 4429 gene locus_tag LOCUS_07270 5148 4429 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388026.1 protein_id gnl|my_center|LOCUS_07270 5915 5145 gene locus_tag LOCUS_07280 gene fadB 5915 5145 CDS product putative enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94549 protein_id gnl|my_center|LOCUS_07280 7065 5917 gene locus_tag LOCUS_07290 7065 5917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 8177 7110 gene locus_tag LOCUS_07300 8177 7110 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240530.1 protein_id gnl|my_center|LOCUS_07300 8511 8903 gene locus_tag LOCUS_07310 8511 8903 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814990.1 protein_id gnl|my_center|LOCUS_07310 8991 10574 gene locus_tag LOCUS_07320 8991 10574 CDS product acetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083897.1 protein_id gnl|my_center|LOCUS_07320 10574 11788 gene locus_tag LOCUS_07330 10574 11788 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705607.1 protein_id gnl|my_center|LOCUS_07330 13135 11867 gene locus_tag LOCUS_07340 13135 11867 CDS product hydroxypyruvate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390217.1 protein_id gnl|my_center|LOCUS_07340 13521 15557 gene locus_tag LOCUS_07350 13521 15557 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_07350 15929 16099 gene locus_tag LOCUS_07360 15929 16099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 16596 16159 gene locus_tag LOCUS_07370 16596 16159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 18091 16604 gene locus_tag LOCUS_07380 18091 16604 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214612.1 protein_id gnl|my_center|LOCUS_07380 19211 18753 gene locus_tag LOCUS_07390 19211 18753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 20540 19611 gene locus_tag LOCUS_07400 20540 19611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 21184 20633 gene locus_tag LOCUS_07410 21184 20633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 23963 21234 gene locus_tag LOCUS_07420 gene narB 23963 21234 CDS product nitrate reductase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141570.1 protein_id gnl|my_center|LOCUS_07420 24654 24007 gene locus_tag LOCUS_07430 24654 24007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 25483 24728 gene locus_tag LOCUS_07440 gene napC 25483 24728 CDS product cytochrome c-type protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4G5 protein_id gnl|my_center|LOCUS_07440 26796 26158 gene locus_tag LOCUS_07450 26796 26158 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390717.1 protein_id gnl|my_center|LOCUS_07450 27793 26813 gene locus_tag LOCUS_07460 27793 26813 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039061.1 protein_id gnl|my_center|LOCUS_07460 31256 28041 gene locus_tag LOCUS_07470 gene mcm 31256 28041 CDS product Fused isobutyryl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D452 protein_id gnl|my_center|LOCUS_07470 31390 31779 gene locus_tag LOCUS_07480 gene liuR 31390 31779 CDS product liu genes regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100383.1 protein_id gnl|my_center|LOCUS_07480 32329 31796 gene locus_tag LOCUS_07490 32329 31796 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q882L6 protein_id gnl|my_center|LOCUS_07490 33347 32418 gene locus_tag LOCUS_07500 33347 32418 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932553.1 protein_id gnl|my_center|LOCUS_07500 34109 33393 gene locus_tag LOCUS_07510 34109 33393 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087136.1 protein_id gnl|my_center|LOCUS_07510 36309 34303 gene locus_tag LOCUS_07520 gene apsA 36309 34303 CDS product adenylylsulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932546.1 protein_id gnl|my_center|LOCUS_07520 36821 36354 gene locus_tag LOCUS_07530 gene aspB 36821 36354 CDS product adenylylsulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932545.1 protein_id gnl|my_center|LOCUS_07530 38388 37483 gene locus_tag LOCUS_07540 38388 37483 CDS product heterodisulfide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_07540 39029 38406 gene locus_tag LOCUS_07550 39029 38406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 41304 39043 gene locus_tag LOCUS_07560 41304 39043 CDS product heterodisulfide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932548.1 protein_id gnl|my_center|LOCUS_07560 42646 41351 gene locus_tag LOCUS_07570 gene hdrA-1 42646 41351 CDS product heterodisulfide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932547.1 protein_id gnl|my_center|LOCUS_07570 43948 42761 gene locus_tag LOCUS_07580 gene sat 43948 42761 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE30 protein_id gnl|my_center|LOCUS_07580 45626 44307 gene locus_tag LOCUS_07590 45626 44307 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812141.1 protein_id gnl|my_center|LOCUS_07590 46143 45646 gene locus_tag LOCUS_07600 46143 45646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 47199 46159 gene locus_tag LOCUS_07610 47199 46159 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812137.1 protein_id gnl|my_center|LOCUS_07610 47611 48921 gene locus_tag LOCUS_07620 gene paaA 47611 48921 CDS product phenylacetate-coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QH8 protein_id gnl|my_center|LOCUS_07620 49067 50233 gene locus_tag LOCUS_07630 49067 50233 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947550.1 protein_id gnl|my_center|LOCUS_07630 50462 51064 gene locus_tag LOCUS_07640 50462 51064 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389697.1 protein_id gnl|my_center|LOCUS_07640 51065 52672 gene locus_tag LOCUS_07650 gene mccB 51065 52672 CDS product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087192.1 protein_id gnl|my_center|LOCUS_07650 52673 53485 gene locus_tag LOCUS_07660 52673 53485 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201022.1 protein_id gnl|my_center|LOCUS_07660 53512 54444 gene locus_tag LOCUS_07670 gene leuA 53512 54444 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957633.1 protein_id gnl|my_center|LOCUS_07670 55740 54523 gene locus_tag LOCUS_07680 gene metZ 55740 54523 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVV5 protein_id gnl|my_center|LOCUS_07680 56036 56851 gene locus_tag LOCUS_07690 56036 56851 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727762.1 protein_id gnl|my_center|LOCUS_07690 57281 56865 gene locus_tag LOCUS_07700 57281 56865 CDS product (R)-hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719468.1 protein_id gnl|my_center|LOCUS_07700 57465 59102 gene locus_tag LOCUS_07710 57465 59102 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389348.1 protein_id gnl|my_center|LOCUS_07710 59913 59149 gene locus_tag LOCUS_07720 59913 59149 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090570.1 protein_id gnl|my_center|LOCUS_07720 60735 59953 gene locus_tag LOCUS_07730 gene djlA 60735 59953 CDS product co-chaperone protein DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74Q30 protein_id gnl|my_center|LOCUS_07730 60984 61958 gene locus_tag LOCUS_07740 60984 61958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545040.1 protein_id gnl|my_center|LOCUS_07740 62664 61987 gene locus_tag LOCUS_07750 gene mip 62664 61987 CDS product outer membrane protein MIP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXE0 protein_id gnl|my_center|LOCUS_07750 62939 63088 gene locus_tag LOCUS_07760 62939 63088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 64176 63112 gene locus_tag LOCUS_07770 gene aroG 64176 63112 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P5N9 protein_id gnl|my_center|LOCUS_07770 65040 64303 gene locus_tag LOCUS_07780 65040 64303 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVJ3 protein_id gnl|my_center|LOCUS_07780 67248 65206 gene locus_tag LOCUS_07790 67248 65206 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479820.1 protein_id gnl|my_center|LOCUS_07790 67466 69115 gene locus_tag LOCUS_07800 67466 69115 CDS product electron-transferring-flavoprotein dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388018.1 protein_id gnl|my_center|LOCUS_07800 >Feature sequence07 884 312 gene locus_tag LOCUS_07810 884 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 2448 1213 gene locus_tag LOCUS_07820 2448 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462038.1 protein_id gnl|my_center|LOCUS_07820 3455 2484 gene locus_tag LOCUS_07830 3455 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 7085 3621 gene locus_tag LOCUS_07840 7085 3621 CDS product indolepyruvate ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268160.1 protein_id gnl|my_center|LOCUS_07840 7395 7898 gene locus_tag LOCUS_07850 7395 7898 CDS product acyl dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902978.1 protein_id gnl|my_center|LOCUS_07850 7885 8358 gene locus_tag LOCUS_07860 7885 8358 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337309.1 protein_id gnl|my_center|LOCUS_07860 8358 8795 gene locus_tag LOCUS_07870 8358 8795 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072665.1 protein_id gnl|my_center|LOCUS_07870 9313 8837 gene locus_tag LOCUS_07880 9313 8837 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035414.1 protein_id gnl|my_center|LOCUS_07880 9510 11087 gene locus_tag LOCUS_07890 gene hutH 9510 11087 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCB3 protein_id gnl|my_center|LOCUS_07890 12734 11751 gene locus_tag LOCUS_07900 gene serA 12734 11751 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675255.1 protein_id gnl|my_center|LOCUS_07900 14213 13137 gene locus_tag LOCUS_07910 14213 13137 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975571.1 protein_id gnl|my_center|LOCUS_07910 15183 14260 gene locus_tag LOCUS_07920 15183 14260 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389656.1 protein_id gnl|my_center|LOCUS_07920 16253 15180 gene locus_tag LOCUS_07930 16253 15180 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389657.1 protein_id gnl|my_center|LOCUS_07930 17778 16240 gene locus_tag LOCUS_07940 17778 16240 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389658.1 protein_id gnl|my_center|LOCUS_07940 18157 17879 gene locus_tag LOCUS_07950 18157 17879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 19233 18520 gene locus_tag LOCUS_07960 19233 18520 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709687.1 protein_id gnl|my_center|LOCUS_07960 19715 19326 gene locus_tag LOCUS_07970 19715 19326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 20022 20651 gene locus_tag LOCUS_07980 20022 20651 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525684.1 protein_id gnl|my_center|LOCUS_07980 20739 21512 gene locus_tag LOCUS_07990 gene cysQ 20739 21512 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071807.1 protein_id gnl|my_center|LOCUS_07990 21656 21471 gene locus_tag LOCUS_08000 21656 21471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 22218 21628 gene locus_tag LOCUS_08010 22218 21628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 23317 22313 gene locus_tag LOCUS_08020 23317 22313 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140080.1 protein_id gnl|my_center|LOCUS_08020 23955 23320 gene locus_tag LOCUS_08030 23955 23320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 24181 25386 gene locus_tag LOCUS_08040 24181 25386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460369.1 protein_id gnl|my_center|LOCUS_08040 25433 26950 gene locus_tag LOCUS_08050 25433 26950 CDS product acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088826.1 protein_id gnl|my_center|LOCUS_08050 27072 29198 gene locus_tag LOCUS_08060 27072 29198 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_08060 29185 30858 gene locus_tag LOCUS_08070 29185 30858 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393464.1 protein_id gnl|my_center|LOCUS_08070 30924 32057 gene locus_tag LOCUS_08080 30924 32057 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816049.1 protein_id gnl|my_center|LOCUS_08080 32054 32452 gene locus_tag LOCUS_08090 32054 32452 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249283.1 protein_id gnl|my_center|LOCUS_08090 32449 34053 gene locus_tag LOCUS_08100 32449 34053 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867965.1 protein_id gnl|my_center|LOCUS_08100 34061 34927 gene locus_tag LOCUS_08110 gene xdhB 34061 34927 CDS product xanthine dehydrogenase FAD-binding subunit XdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459159.1 protein_id gnl|my_center|LOCUS_08110 34911 35390 gene locus_tag LOCUS_08120 34911 35390 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393459.1 protein_id gnl|my_center|LOCUS_08120 35402 37717 gene locus_tag LOCUS_08130 35402 37717 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_08130 37722 38927 gene locus_tag LOCUS_08140 37722 38927 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205160.1 protein_id gnl|my_center|LOCUS_08140 38938 40101 gene locus_tag LOCUS_08150 38938 40101 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973796.1 protein_id gnl|my_center|LOCUS_08150 40616 40161 gene locus_tag LOCUS_08160 40616 40161 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390656.1 protein_id gnl|my_center|LOCUS_08160 41001 44432 gene locus_tag LOCUS_08170 41001 44432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 44449 45090 gene locus_tag LOCUS_08180 44449 45090 CDS product indolepyruvate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868412.1 protein_id gnl|my_center|LOCUS_08180 45253 46647 gene locus_tag LOCUS_08190 gene trpB 45253 46647 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WA80 protein_id gnl|my_center|LOCUS_08190 47696 46701 gene locus_tag LOCUS_08200 47696 46701 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249284.1 protein_id gnl|my_center|LOCUS_08200 49883 47862 gene locus_tag LOCUS_08210 49883 47862 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877531.1 protein_id gnl|my_center|LOCUS_08210 50168 50761 gene locus_tag LOCUS_08220 50168 50761 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF67 protein_id gnl|my_center|LOCUS_08220 50796 51671 gene locus_tag LOCUS_08230 50796 51671 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459741.1 protein_id gnl|my_center|LOCUS_08230 53145 51757 gene locus_tag LOCUS_08240 53145 51757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 54036 53254 gene locus_tag LOCUS_08250 54036 53254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_08250 56512 54050 gene locus_tag LOCUS_08260 56512 54050 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858465.1 protein_id gnl|my_center|LOCUS_08260 56833 57492 gene locus_tag LOCUS_08270 gene rutR 56833 57492 CDS product HTH-type transcriptional regulator RutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8X4Z7 protein_id gnl|my_center|LOCUS_08270 57705 58571 gene locus_tag LOCUS_08280 57705 58571 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228419.1 protein_id gnl|my_center|LOCUS_08280 58669 59472 gene locus_tag LOCUS_08290 58669 59472 CDS product sulfonate ABC transporter ATP-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972284.1 protein_id gnl|my_center|LOCUS_08290 59459 60367 gene locus_tag LOCUS_08300 59459 60367 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972285.1 protein_id gnl|my_center|LOCUS_08300 60364 61506 gene locus_tag LOCUS_08310 60364 61506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 61549 62535 gene locus_tag LOCUS_08320 61549 62535 CDS product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066596.1 protein_id gnl|my_center|LOCUS_08320 >Feature sequence08 354 887 gene locus_tag LOCUS_08330 gene hpt 354 887 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420875.1 protein_id gnl|my_center|LOCUS_08330 1805 930 gene locus_tag LOCUS_08340 gene hisG1 1805 930 CDS product ATP phosphoribosyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60804 protein_id gnl|my_center|LOCUS_08340 1995 2249 gene locus_tag LOCUS_08350 1995 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 2287 4086 gene locus_tag LOCUS_08360 2287 4086 CDS product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883377.1 protein_id gnl|my_center|LOCUS_08360 4099 5235 gene locus_tag LOCUS_08370 4099 5235 CDS product glutaconyl-CoA decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480910.1 protein_id gnl|my_center|LOCUS_08370 5851 5273 gene locus_tag LOCUS_08380 gene tdk 5851 5273 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECK0 protein_id gnl|my_center|LOCUS_08380 6492 5863 gene locus_tag LOCUS_08390 gene dsbA 6492 5863 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIP0 protein_id gnl|my_center|LOCUS_08390 7101 6574 gene locus_tag LOCUS_08400 7101 6574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 7282 8355 gene locus_tag LOCUS_08410 gene rnd 7282 8355 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSM2 protein_id gnl|my_center|LOCUS_08410 8488 9333 gene locus_tag LOCUS_08420 8488 9333 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390362.1 protein_id gnl|my_center|LOCUS_08420 11089 9377 gene locus_tag LOCUS_08430 11089 9377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 11493 11110 gene locus_tag LOCUS_08440 11493 11110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880147.1 protein_id gnl|my_center|LOCUS_08440 13135 11579 gene locus_tag LOCUS_08450 13135 11579 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87X49 protein_id gnl|my_center|LOCUS_08450 14277 13159 gene locus_tag LOCUS_08460 gene aroF2 14277 13159 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546648.1 protein_id gnl|my_center|LOCUS_08460 14666 14914 gene locus_tag LOCUS_08470 14666 14914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 14956 16044 gene locus_tag LOCUS_08480 gene truD 14956 16044 CDS product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGH7 protein_id gnl|my_center|LOCUS_08480 16201 17178 gene locus_tag LOCUS_08490 gene mdh 16201 17178 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SKV7 protein_id gnl|my_center|LOCUS_08490 17354 17965 gene locus_tag LOCUS_08500 17354 17965 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090091.1 protein_id gnl|my_center|LOCUS_08500 17962 18738 gene locus_tag LOCUS_08510 17962 18738 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525829.1 protein_id gnl|my_center|LOCUS_08510 18849 19646 gene locus_tag LOCUS_08520 gene dapB 18849 19646 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WP2 protein_id gnl|my_center|LOCUS_08520 19927 21066 gene locus_tag LOCUS_08530 gene carA 19927 21066 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLT1 protein_id gnl|my_center|LOCUS_08530 21072 24299 gene locus_tag LOCUS_08540 21072 24299 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNQ1 protein_id gnl|my_center|LOCUS_08540 24296 24772 gene locus_tag LOCUS_08550 gene greA 24296 24772 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WJ80 protein_id gnl|my_center|LOCUS_08550 25072 24779 gene locus_tag LOCUS_08560 gene yhbY 25072 24779 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417663.1 protein_id gnl|my_center|LOCUS_08560 25299 25958 gene locus_tag LOCUS_08570 gene rrmJ 25299 25958 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EM90 protein_id gnl|my_center|LOCUS_08570 25992 26201 gene locus_tag LOCUS_08580 25992 26201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 26221 28143 gene locus_tag LOCUS_08590 gene ftsH 26221 28143 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MFV2 protein_id gnl|my_center|LOCUS_08590 28212 29012 gene locus_tag LOCUS_08600 28212 29012 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNQ6 protein_id gnl|my_center|LOCUS_08600 29161 30525 gene locus_tag LOCUS_08610 gene glmM 29161 30525 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRT4 protein_id gnl|my_center|LOCUS_08610 30782 31534 gene locus_tag LOCUS_08620 gene tpiA 30782 31534 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHL9 protein_id gnl|my_center|LOCUS_08620 31539 31922 gene locus_tag LOCUS_08630 gene secG 31539 31922 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930017.1 protein_id gnl|my_center|LOCUS_08630 31944 32028 gene locus_tag LOCUS_t00120 31944 32028 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 32234 32608 gene locus_tag LOCUS_08640 gene nuoA 32234 32608 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BQ5 protein_id gnl|my_center|LOCUS_08640 32616 33092 gene locus_tag LOCUS_08650 gene nuoB1 32616 33092 CDS product NADH-quinone oxidoreductase subunit B 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62IN6 protein_id gnl|my_center|LOCUS_08650 33102 33731 gene locus_tag LOCUS_08660 gene nuoC 33102 33731 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62IN7 protein_id gnl|my_center|LOCUS_08660 33724 34977 gene locus_tag LOCUS_08670 gene nuoD 33724 34977 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BQ8 protein_id gnl|my_center|LOCUS_08670 34990 35460 gene locus_tag LOCUS_08680 34990 35460 CDS product NADH dehydrogenase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948474.1 protein_id gnl|my_center|LOCUS_08680 35460 36746 gene locus_tag LOCUS_08690 gene nuoF 35460 36746 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948473.1 protein_id gnl|my_center|LOCUS_08690 36766 39132 gene locus_tag LOCUS_08700 gene nuoG 36766 39132 CDS product NADH-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRU4 protein_id gnl|my_center|LOCUS_08700 39134 40174 gene locus_tag LOCUS_08710 gene nuoH 39134 40174 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BR2 protein_id gnl|my_center|LOCUS_08710 40184 40672 gene locus_tag LOCUS_08720 gene nuoI 40184 40672 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7U0 protein_id gnl|my_center|LOCUS_08720 40685 41323 gene locus_tag LOCUS_08730 gene nuoJ 40685 41323 CDS product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037650.1 protein_id gnl|my_center|LOCUS_08730 41320 41625 gene locus_tag LOCUS_08740 gene nuoK 41320 41625 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62IP5 protein_id gnl|my_center|LOCUS_08740 41641 43596 gene locus_tag LOCUS_08750 gene nuoL 41641 43596 CDS product NADH dehydrogenase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526462.1 protein_id gnl|my_center|LOCUS_08750 43620 45104 gene locus_tag LOCUS_08760 gene nuoM 43620 45104 CDS product NADH dehydrogenase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186137.1 protein_id gnl|my_center|LOCUS_08760 45101 46555 gene locus_tag LOCUS_08770 gene nuoN 45101 46555 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MIP4 protein_id gnl|my_center|LOCUS_08770 46610 46686 gene locus_tag LOCUS_t00130 46610 46686 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 46820 47290 gene locus_tag LOCUS_08780 gene rimP 46820 47290 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV53 protein_id gnl|my_center|LOCUS_08780 47317 48819 gene locus_tag LOCUS_08790 gene nusA 47317 48819 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7U6 protein_id gnl|my_center|LOCUS_08790 48829 51375 gene locus_tag LOCUS_08800 gene infB 48829 51375 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRV4 protein_id gnl|my_center|LOCUS_08800 51410 51775 gene locus_tag LOCUS_08810 gene rbfA 51410 51775 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BS2 protein_id gnl|my_center|LOCUS_08810 51785 52693 gene locus_tag LOCUS_08820 gene truB 51785 52693 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNR4 protein_id gnl|my_center|LOCUS_08820 52825 53094 gene locus_tag LOCUS_08830 gene rpsO 52825 53094 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7L2 protein_id gnl|my_center|LOCUS_08830 53158 55251 gene locus_tag LOCUS_08840 gene pnp 53158 55251 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87M06 protein_id gnl|my_center|LOCUS_08840 55374 55817 gene locus_tag LOCUS_08850 gene dtd 55374 55817 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B603 protein_id gnl|my_center|LOCUS_08850 55895 56332 gene locus_tag LOCUS_08860 55895 56332 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196360.1 protein_id gnl|my_center|LOCUS_08860 57701 56373 gene locus_tag LOCUS_08870 gene pyrC 57701 56373 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NF57 protein_id gnl|my_center|LOCUS_08870 >Feature sequence09 1394 114 gene locus_tag LOCUS_08880 1394 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 2500 1655 gene locus_tag LOCUS_08890 2500 1655 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038652.1 protein_id gnl|my_center|LOCUS_08890 3779 2532 gene locus_tag LOCUS_08900 3779 2532 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337262.1 protein_id gnl|my_center|LOCUS_08900 5607 4213 gene locus_tag LOCUS_08910 5607 4213 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114627.1 protein_id gnl|my_center|LOCUS_08910 7142 6231 gene locus_tag LOCUS_08920 7142 6231 CDS product carboxyvinyl-carboxyphosphonate phosphorylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809362.1 protein_id gnl|my_center|LOCUS_08920 7713 8918 gene locus_tag LOCUS_08930 7713 8918 CDS product sugar ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368564.1 protein_id gnl|my_center|LOCUS_08930 9002 9865 gene locus_tag LOCUS_08940 9002 9865 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707246.1 protein_id gnl|my_center|LOCUS_08940 9862 10725 gene locus_tag LOCUS_08950 9862 10725 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387855.1 protein_id gnl|my_center|LOCUS_08950 10729 11820 gene locus_tag LOCUS_08960 10729 11820 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080048.1 protein_id gnl|my_center|LOCUS_08960 12927 11788 gene locus_tag LOCUS_08970 gene hisC 12927 11788 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UCK0 protein_id gnl|my_center|LOCUS_08970 14398 12920 gene locus_tag LOCUS_08980 14398 12920 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113043.1 protein_id gnl|my_center|LOCUS_08980 16083 14395 gene locus_tag LOCUS_08990 16083 14395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085749.1 protein_id gnl|my_center|LOCUS_08990 16378 16094 gene locus_tag LOCUS_09000 16378 16094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 17554 16403 gene locus_tag LOCUS_09010 17554 16403 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706186.1 protein_id gnl|my_center|LOCUS_09010 19150 17558 gene locus_tag LOCUS_09020 19150 17558 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257221.1 protein_id gnl|my_center|LOCUS_09020 19667 19341 gene locus_tag LOCUS_09030 19667 19341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530739.1 protein_id gnl|my_center|LOCUS_09030 21796 20327 gene locus_tag LOCUS_09040 21796 20327 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201919.1 protein_id gnl|my_center|LOCUS_09040 21914 22249 gene locus_tag LOCUS_09050 21914 22249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 22935 22501 gene locus_tag LOCUS_09060 22935 22501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 24129 23383 gene locus_tag LOCUS_09070 24129 23383 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921407.1 protein_id gnl|my_center|LOCUS_09070 25557 24385 gene locus_tag LOCUS_09080 gene uxuA 25557 24385 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KLT7 protein_id gnl|my_center|LOCUS_09080 25853 25554 gene locus_tag LOCUS_09090 25853 25554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 26158 25850 gene locus_tag LOCUS_09100 26158 25850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 26322 27215 gene locus_tag LOCUS_09110 26322 27215 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477410.1 protein_id gnl|my_center|LOCUS_09110 28125 27424 gene locus_tag LOCUS_09120 28125 27424 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532669.1 protein_id gnl|my_center|LOCUS_09120 29035 28460 gene locus_tag LOCUS_09130 29035 28460 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114949.1 protein_id gnl|my_center|LOCUS_09130 29898 29317 gene locus_tag LOCUS_09140 29898 29317 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708516.1 protein_id gnl|my_center|LOCUS_09140 30895 30017 gene locus_tag LOCUS_09150 30895 30017 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940063.1 protein_id gnl|my_center|LOCUS_09150 31868 30915 gene locus_tag LOCUS_09160 31868 30915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 32490 31798 gene locus_tag LOCUS_09170 32490 31798 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T35 protein_id gnl|my_center|LOCUS_09170 33409 32504 gene locus_tag LOCUS_09180 gene nqrC 33409 32504 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK8 protein_id gnl|my_center|LOCUS_09180 34370 33396 gene locus_tag LOCUS_09190 34370 33396 CDS product electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8R6G9 protein_id gnl|my_center|LOCUS_09190 35833 34499 gene locus_tag LOCUS_09200 gene rnfC 35833 34499 CDS product electron transport complex subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HYR2 protein_id gnl|my_center|LOCUS_09200 36488 35982 gene locus_tag LOCUS_09210 36488 35982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 37536 36508 gene locus_tag LOCUS_09220 gene korB 37536 36508 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121170.1 protein_id gnl|my_center|LOCUS_09220 39470 37533 gene locus_tag LOCUS_09230 gene korA 39470 37533 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324152.1 protein_id gnl|my_center|LOCUS_09230 39972 39472 gene locus_tag LOCUS_09240 39972 39472 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037987.1 protein_id gnl|my_center|LOCUS_09240 40413 40338 gene locus_tag LOCUS_t00140 40413 40338 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 40923 40462 gene locus_tag LOCUS_09250 40923 40462 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391535.1 protein_id gnl|my_center|LOCUS_09250 41975 41052 gene locus_tag LOCUS_09260 gene ispH 41975 41052 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYJ1 protein_id gnl|my_center|LOCUS_09260 42665 42180 gene locus_tag LOCUS_09270 gene lspA 42665 42180 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIM3 protein_id gnl|my_center|LOCUS_09270 45490 42665 gene locus_tag LOCUS_09280 gene ileS 45490 42665 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG39 protein_id gnl|my_center|LOCUS_09280 46471 45527 gene locus_tag LOCUS_09290 gene ribF 46471 45527 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889E5 protein_id gnl|my_center|LOCUS_09290 48160 46580 gene locus_tag LOCUS_09300 gene murJ 48160 46580 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBI2 protein_id gnl|my_center|LOCUS_09300 48251 48529 gene locus_tag LOCUS_09310 gene rpsT 48251 48529 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ED6 protein_id gnl|my_center|LOCUS_09310 49754 48624 gene locus_tag LOCUS_09320 gene proB 49754 48624 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVL9 protein_id gnl|my_center|LOCUS_09320 50790 49738 gene locus_tag LOCUS_09330 gene obg 50790 49738 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ED8 protein_id gnl|my_center|LOCUS_09330 51119 50862 gene locus_tag LOCUS_09340 gene rpmA 51119 50862 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66132 protein_id gnl|my_center|LOCUS_09340 51460 51146 gene locus_tag LOCUS_09350 gene rplU 51460 51146 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7DDR4 protein_id gnl|my_center|LOCUS_09350 51644 52678 gene locus_tag LOCUS_09360 51644 52678 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704869.1 protein_id gnl|my_center|LOCUS_09360 53067 53693 gene locus_tag LOCUS_09370 53067 53693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 >Feature sequence10 <1 593 gene locus_tag LOCUS_09380 <1 593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071244.1:lactate dehydrogenase 1000 2475 gene locus_tag LOCUS_09390 1000 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 2696 2620 gene locus_tag LOCUS_t00150 2696 2620 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2890 4062 gene locus_tag LOCUS_09400 2890 4062 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423059.1 protein_id gnl|my_center|LOCUS_09400 4194 5021 gene locus_tag LOCUS_09410 4194 5021 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404543.1 protein_id gnl|my_center|LOCUS_09410 5367 5777 gene locus_tag LOCUS_09420 5367 5777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 5945 5869 gene locus_tag LOCUS_t00160 5945 5869 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7799 5988 gene locus_tag LOCUS_09430 gene rpoD 7799 5988 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P26480 protein_id gnl|my_center|LOCUS_09430 9628 7844 gene locus_tag LOCUS_09440 gene dnaG 9628 7844 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CGG5 protein_id gnl|my_center|LOCUS_09440 10287 9808 gene locus_tag LOCUS_09450 10287 9808 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190948.1 protein_id gnl|my_center|LOCUS_09450 10541 10326 gene locus_tag LOCUS_09460 gene rpsU 10541 10326 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2K1 protein_id gnl|my_center|LOCUS_09460 11646 10648 gene locus_tag LOCUS_09470 gene add 11646 10648 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI68 protein_id gnl|my_center|LOCUS_09470 11724 12743 gene locus_tag LOCUS_09480 gene ygjD 11724 12743 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2K2 protein_id gnl|my_center|LOCUS_09480 13099 12749 gene locus_tag LOCUS_09490 13099 12749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 13061 13327 gene locus_tag LOCUS_09500 13061 13327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 13444 13800 gene locus_tag LOCUS_09510 gene folB 13444 13800 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P495 protein_id gnl|my_center|LOCUS_09510 13804 14292 gene locus_tag LOCUS_09520 gene folK-2 13804 14292 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707548.1 protein_id gnl|my_center|LOCUS_09520 15098 14322 gene locus_tag LOCUS_09530 15098 14322 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948549.1 protein_id gnl|my_center|LOCUS_09530 15170 16342 gene locus_tag LOCUS_09540 15170 16342 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958470.1 protein_id gnl|my_center|LOCUS_09540 16357 17151 gene locus_tag LOCUS_09550 gene uppP 16357 17151 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2K6 protein_id gnl|my_center|LOCUS_09550 18399 17143 gene locus_tag LOCUS_09560 gene cca 18399 17143 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JQW2 protein_id gnl|my_center|LOCUS_09560 19368 18415 gene locus_tag LOCUS_09570 19368 18415 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927008.1 protein_id gnl|my_center|LOCUS_09570 20112 19465 gene locus_tag LOCUS_09580 gene pyrE 20112 19465 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JHW8 protein_id gnl|my_center|LOCUS_09580 20928 20281 gene locus_tag LOCUS_09590 20928 20281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084530.1 protein_id gnl|my_center|LOCUS_09590 22067 20925 gene locus_tag LOCUS_09600 gene metX 22067 20925 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM58 protein_id gnl|my_center|LOCUS_09600 22474 22145 gene locus_tag LOCUS_09610 22474 22145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 23015 22452 gene locus_tag LOCUS_09620 23015 22452 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958645.1 protein_id gnl|my_center|LOCUS_09620 23864 23031 gene locus_tag LOCUS_09630 gene proC 23864 23031 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNF3 protein_id gnl|my_center|LOCUS_09630 24593 23880 gene locus_tag LOCUS_09640 24593 23880 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527690.1 protein_id gnl|my_center|LOCUS_09640 25930 24650 gene locus_tag LOCUS_09650 gene pyrC' 25930 24650 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WK54 protein_id gnl|my_center|LOCUS_09650 26910 25930 gene locus_tag LOCUS_09660 gene pyrB 26910 25930 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62I89 protein_id gnl|my_center|LOCUS_09660 27436 26945 gene locus_tag LOCUS_09670 gene pyrR 27436 26945 CDS product bifunctional protein PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X6W6 protein_id gnl|my_center|LOCUS_09670 27882 27451 gene locus_tag LOCUS_09680 27882 27451 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P766 protein_id gnl|my_center|LOCUS_09680 28439 27879 gene locus_tag LOCUS_09690 28439 27879 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P765 protein_id gnl|my_center|LOCUS_09690 28855 29652 gene locus_tag LOCUS_09700 28855 29652 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687170.1 protein_id gnl|my_center|LOCUS_09700 29946 31970 gene locus_tag LOCUS_09710 gene tkt1 29946 31970 CDS product transketolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUP2 protein_id gnl|my_center|LOCUS_09710 32222 33229 gene locus_tag LOCUS_09720 gene gap 32222 33229 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59199 protein_id gnl|my_center|LOCUS_09720 33242 33433 gene locus_tag LOCUS_09730 33242 33433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 33464 34645 gene locus_tag LOCUS_09740 gene pgk 33464 34645 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIB1 protein_id gnl|my_center|LOCUS_09740 34665 36131 gene locus_tag LOCUS_09750 34665 36131 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87N36 protein_id gnl|my_center|LOCUS_09750 36243 37307 gene locus_tag LOCUS_09760 gene fbaB 36243 37307 CDS product fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022162.1 protein_id gnl|my_center|LOCUS_09760 38250 37465 gene locus_tag LOCUS_09770 gene pdhR 38250 37465 CDS product pyruvate dehydrogenase complex repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0ACL9 protein_id gnl|my_center|LOCUS_09770 38546 39337 gene locus_tag LOCUS_09780 38546 39337 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391353.1 protein_id gnl|my_center|LOCUS_09780 39334 40758 gene locus_tag LOCUS_09790 39334 40758 CDS product iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391352.1 protein_id gnl|my_center|LOCUS_09790 40755 41408 gene locus_tag LOCUS_09800 40755 41408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391350.1 protein_id gnl|my_center|LOCUS_09800 41413 42288 gene locus_tag LOCUS_09810 41413 42288 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706015.1 protein_id gnl|my_center|LOCUS_09810 42410 42928 gene locus_tag LOCUS_09820 gene fabA 42410 42928 CDS product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883Y6 protein_id gnl|my_center|LOCUS_09820 42942 44159 gene locus_tag LOCUS_09830 gene fabB 42942 44159 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114255.1 protein_id gnl|my_center|LOCUS_09830 44628 44209 gene locus_tag LOCUS_09840 44628 44209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 44608 44832 gene locus_tag LOCUS_09850 44608 44832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 45016 45249 gene locus_tag LOCUS_09860 45016 45249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 45714 46142 gene locus_tag LOCUS_09870 gene rplM 45714 46142 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CQB9 protein_id gnl|my_center|LOCUS_09870 46152 46550 gene locus_tag LOCUS_09880 gene rpsI 46152 46550 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WW8 protein_id gnl|my_center|LOCUS_09880 46599 46672 gene locus_tag LOCUS_t00170 46599 46672 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 46806 47837 gene locus_tag LOCUS_09890 gene argC 46806 47837 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMM3 protein_id gnl|my_center|LOCUS_09890 47869 48324 gene locus_tag LOCUS_09900 47869 48324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 48556 48894 gene locus_tag LOCUS_09910 gene erpA 48556 48894 CDS product putative iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MN49 protein_id gnl|my_center|LOCUS_09910 50472 48928 gene locus_tag LOCUS_09920 50472 48928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 50876 50673 gene locus_tag LOCUS_09930 50876 50673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 50944 52143 gene locus_tag LOCUS_09940 gene tyrS 50944 52143 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHB3 protein_id gnl|my_center|LOCUS_09940 >Feature sequence11 3590 2307 gene locus_tag LOCUS_09950 3590 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 3879 3712 gene locus_tag LOCUS_09960 3879 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 3972 5639 gene locus_tag LOCUS_09970 3972 5639 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114325.1 protein_id gnl|my_center|LOCUS_09970 6452 5796 gene locus_tag LOCUS_09980 6452 5796 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966072.1 protein_id gnl|my_center|LOCUS_09980 6711 6457 gene locus_tag LOCUS_09990 6711 6457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 7522 6677 gene locus_tag LOCUS_10000 7522 6677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261699.1 protein_id gnl|my_center|LOCUS_10000 8524 7634 gene locus_tag LOCUS_10010 gene argB 8524 7634 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZY1 protein_id gnl|my_center|LOCUS_10010 9131 8685 gene locus_tag LOCUS_10020 gene hspC 9131 8685 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880818.1 protein_id gnl|my_center|LOCUS_10020 10665 9325 gene locus_tag LOCUS_10030 gene hslU 10665 9325 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXU0 protein_id gnl|my_center|LOCUS_10030 11211 10672 gene locus_tag LOCUS_10040 gene hslV 11211 10672 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXU1 protein_id gnl|my_center|LOCUS_10040 11756 11280 gene locus_tag LOCUS_10050 11756 11280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 12407 11778 gene locus_tag LOCUS_10060 gene sspA 12407 11778 CDS product stringent starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162411.1 protein_id gnl|my_center|LOCUS_10060 13867 13088 gene locus_tag LOCUS_10070 gene tatC 13867 13088 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEG1 protein_id gnl|my_center|LOCUS_10070 14279 13860 gene locus_tag LOCUS_10080 14279 13860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 14567 14310 gene locus_tag LOCUS_10090 gene tatA 14567 14310 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TH1 protein_id gnl|my_center|LOCUS_10090 14977 14663 gene locus_tag LOCUS_10100 gene hisE 14977 14663 CDS product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GE7 protein_id gnl|my_center|LOCUS_10100 15390 15001 gene locus_tag LOCUS_10110 gene hisI 15390 15001 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB7 protein_id gnl|my_center|LOCUS_10110 16157 15387 gene locus_tag LOCUS_10120 gene hisF 16157 15387 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q92 protein_id gnl|my_center|LOCUS_10120 16910 16161 gene locus_tag LOCUS_10130 gene hisA 16910 16161 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLQ1 protein_id gnl|my_center|LOCUS_10130 17583 16954 gene locus_tag LOCUS_10140 gene hisH 17583 16954 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VSY8 protein_id gnl|my_center|LOCUS_10140 18242 17607 gene locus_tag LOCUS_10150 gene hisB 18242 17607 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MK23 protein_id gnl|my_center|LOCUS_10150 18744 18938 gene locus_tag LOCUS_10160 18744 18938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 20099 19053 gene locus_tag LOCUS_10170 gene hisC1 20099 19053 CDS product histidinol-phosphate aminotransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GE0 protein_id gnl|my_center|LOCUS_10170 21441 20119 gene locus_tag LOCUS_10180 gene hisD 21441 20119 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW9 protein_id gnl|my_center|LOCUS_10180 22100 21438 gene locus_tag LOCUS_10190 gene hisG 22100 21438 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WV4 protein_id gnl|my_center|LOCUS_10190 23425 22100 gene locus_tag LOCUS_10200 gene murA 23425 22100 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW7 protein_id gnl|my_center|LOCUS_10200 23749 23441 gene locus_tag LOCUS_10210 23749 23441 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WCR2 protein_id gnl|my_center|LOCUS_10210 24034 23810 gene locus_tag LOCUS_10220 24034 23810 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199917.1 protein_id gnl|my_center|LOCUS_10220 24535 24236 gene locus_tag LOCUS_10230 24535 24236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 25149 24532 gene locus_tag LOCUS_10240 25149 24532 CDS product signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946580.1 protein_id gnl|my_center|LOCUS_10240 25616 25146 gene locus_tag LOCUS_10250 25616 25146 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313587.1 protein_id gnl|my_center|LOCUS_10250 26398 25619 gene locus_tag LOCUS_10260 26398 25619 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707619.1 protein_id gnl|my_center|LOCUS_10260 27228 26395 gene locus_tag LOCUS_10270 27228 26395 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620333.1 protein_id gnl|my_center|LOCUS_10270 27805 28794 gene locus_tag LOCUS_10280 gene kdsD 27805 28794 CDS product arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7V9 protein_id gnl|my_center|LOCUS_10280 28936 29406 gene locus_tag LOCUS_10290 28936 29406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 29410 30291 gene locus_tag LOCUS_10300 29410 30291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 30313 31038 gene locus_tag LOCUS_10310 gene yhbG 30313 31038 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210116.1 protein_id gnl|my_center|LOCUS_10310 31283 32638 gene locus_tag LOCUS_10320 gene rpoN 31283 32638 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQ11 protein_id gnl|my_center|LOCUS_10320 32677 33000 gene locus_tag LOCUS_10330 32677 33000 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094359.1 protein_id gnl|my_center|LOCUS_10330 32997 33509 gene locus_tag LOCUS_10340 gene ptsN 32997 33509 CDS product PTS IIA-like nitrogen-regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766506.1 protein_id gnl|my_center|LOCUS_10340 33906 34400 gene locus_tag LOCUS_10350 33906 34400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 34452 34721 gene locus_tag LOCUS_10360 gene ptsH 34452 34721 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198013.1 protein_id gnl|my_center|LOCUS_10360 34721 36460 gene locus_tag LOCUS_10370 gene ptsI 34721 36460 CDS product phosphoenolpyruvate-protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JXH7 protein_id gnl|my_center|LOCUS_10370 36633 37991 gene locus_tag LOCUS_10380 gene mgtE 36633 37991 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P704 protein_id gnl|my_center|LOCUS_10380 38910 38050 gene locus_tag LOCUS_10390 38910 38050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 40391 39549 gene locus_tag LOCUS_10400 40391 39549 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093161.1 protein_id gnl|my_center|LOCUS_10400 40886 40443 gene locus_tag LOCUS_10410 gene ybeY 40886 40443 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JQ74 protein_id gnl|my_center|LOCUS_10410 41860 40883 gene locus_tag LOCUS_10420 41860 40883 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093159.1 protein_id gnl|my_center|LOCUS_10420 43366 42008 gene locus_tag LOCUS_10430 gene miaB 43366 42008 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83DX3 protein_id gnl|my_center|LOCUS_10430 44893 43388 gene locus_tag LOCUS_10440 44893 43388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 45041 44877 gene locus_tag LOCUS_10450 45041 44877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 45605 45276 gene locus_tag LOCUS_10460 45605 45276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 47130 45721 gene locus_tag LOCUS_10470 47130 45721 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483284.1 protein_id gnl|my_center|LOCUS_10470 47778 47131 gene locus_tag LOCUS_10480 47778 47131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 >Feature sequence12 1357 353 gene locus_tag LOCUS_10490 1357 353 CDS product sulfolactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970694.1 protein_id gnl|my_center|LOCUS_10490 2472 1675 gene locus_tag LOCUS_10500 2472 1675 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088485.1 protein_id gnl|my_center|LOCUS_10500 4429 2939 gene locus_tag LOCUS_10510 gene trpE 4429 2939 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035712.1 protein_id gnl|my_center|LOCUS_10510 5123 4410 gene locus_tag LOCUS_10520 gene gph 5123 4410 CDS product phosphoglycolate phosphatase, bacterial inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815386.1 protein_id gnl|my_center|LOCUS_10520 5815 5120 gene locus_tag LOCUS_10530 gene rpe 5815 5120 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSC9 protein_id gnl|my_center|LOCUS_10530 7376 5970 gene locus_tag LOCUS_10540 gene degQ 7376 5970 CDS product serine endoprotease DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886707.1 protein_id gnl|my_center|LOCUS_10540 8305 7373 gene locus_tag LOCUS_10550 8305 7373 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958093.1 protein_id gnl|my_center|LOCUS_10550 11732 8334 gene locus_tag LOCUS_10560 11732 8334 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958091.1 protein_id gnl|my_center|LOCUS_10560 14376 11725 gene locus_tag LOCUS_10570 14376 11725 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958090.1 protein_id gnl|my_center|LOCUS_10570 15483 14440 gene locus_tag LOCUS_10580 gene hemH1 15483 14440 CDS product ferrochelatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFF4 protein_id gnl|my_center|LOCUS_10580 16559 15480 gene locus_tag LOCUS_10590 gene nadA 16559 15480 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N9Z2 protein_id gnl|my_center|LOCUS_10590 16835 17314 gene locus_tag LOCUS_10600 16835 17314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 17948 17478 gene locus_tag LOCUS_10610 17948 17478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 19254 18658 gene locus_tag LOCUS_10620 19254 18658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 19407 20093 gene locus_tag LOCUS_10630 19407 20093 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887702.1 protein_id gnl|my_center|LOCUS_10630 20106 21506 gene locus_tag LOCUS_10640 20106 21506 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208493.1 protein_id gnl|my_center|LOCUS_10640 21503 23146 gene locus_tag LOCUS_10650 21503 23146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 23155 23847 gene locus_tag LOCUS_10660 23155 23847 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210674.1 protein_id gnl|my_center|LOCUS_10660 23844 25076 gene locus_tag LOCUS_10670 23844 25076 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545399.1 protein_id gnl|my_center|LOCUS_10670 25832 25101 gene locus_tag LOCUS_10680 gene nrdJb 25832 25101 CDS product TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096987.1 protein_id gnl|my_center|LOCUS_10680 27968 25845 gene locus_tag LOCUS_10690 gene nrdJa 27968 25845 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895708.1 protein_id gnl|my_center|LOCUS_10690 28370 29074 gene locus_tag LOCUS_10700 28370 29074 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038978.1 protein_id gnl|my_center|LOCUS_10700 30138 29116 gene locus_tag LOCUS_10710 30138 29116 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040521.1 protein_id gnl|my_center|LOCUS_10710 30921 30322 gene locus_tag LOCUS_10720 30921 30322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 31043 31981 gene locus_tag LOCUS_10730 31043 31981 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090885.1 protein_id gnl|my_center|LOCUS_10730 31978 32751 gene locus_tag LOCUS_10740 31978 32751 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KP13 protein_id gnl|my_center|LOCUS_10740 33301 32960 gene locus_tag LOCUS_10750 33301 32960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093157.1 protein_id gnl|my_center|LOCUS_10750 34271 33390 gene locus_tag LOCUS_10760 34271 33390 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097867.1 protein_id gnl|my_center|LOCUS_10760 34573 35946 gene locus_tag LOCUS_10770 34573 35946 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8L5 protein_id gnl|my_center|LOCUS_10770 36268 36537 gene locus_tag LOCUS_10780 36268 36537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 36689 36976 gene locus_tag LOCUS_10790 36689 36976 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KK58 protein_id gnl|my_center|LOCUS_10790 36981 37355 gene locus_tag LOCUS_10800 36981 37355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 37403 37999 gene locus_tag LOCUS_10810 37403 37999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 38069 38617 gene locus_tag LOCUS_10820 38069 38617 CDS product hemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073378.1 protein_id gnl|my_center|LOCUS_10820 39431 38646 gene locus_tag LOCUS_10830 gene xni 39431 38646 CDS product Flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHE3 protein_id gnl|my_center|LOCUS_10830 42514 39818 gene locus_tag LOCUS_10840 42514 39818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 45311 42612 gene locus_tag LOCUS_10850 45311 42612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 46067 45363 gene locus_tag LOCUS_10860 46067 45363 CDS product nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969212.1 protein_id gnl|my_center|LOCUS_10860 46683 46057 gene locus_tag LOCUS_10870 46683 46057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 <47503 46676 gene locus_tag LOCUS_10880 <47503 46676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003092958.1:respiratory nitrate reductase subunit beta >Feature sequence13 128 1018 gene locus_tag LOCUS_10890 gene btuF 128 1018 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526312.1 protein_id gnl|my_center|LOCUS_10890 1088 2077 gene locus_tag LOCUS_10900 1088 2077 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192857.1 protein_id gnl|my_center|LOCUS_10900 2074 2841 gene locus_tag LOCUS_10910 2074 2841 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460056.1 protein_id gnl|my_center|LOCUS_10910 3001 2795 gene locus_tag LOCUS_10920 3001 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 2985 3794 gene locus_tag LOCUS_10930 2985 3794 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 protein_id gnl|my_center|LOCUS_10930 4398 3805 gene locus_tag LOCUS_10940 4398 3805 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193229.1 protein_id gnl|my_center|LOCUS_10940 4491 5309 gene locus_tag LOCUS_10950 4491 5309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 5427 7025 gene locus_tag LOCUS_10960 gene pckA2 5427 7025 CDS product phosphoenolpyruvate carboxykinase [ATP] 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RH96 protein_id gnl|my_center|LOCUS_10960 7126 7566 gene locus_tag LOCUS_10970 7126 7566 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071992.1 protein_id gnl|my_center|LOCUS_10970 7631 8806 gene locus_tag LOCUS_10980 7631 8806 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530004.1 protein_id gnl|my_center|LOCUS_10980 9467 10186 gene locus_tag LOCUS_10990 9467 10186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123114.1 protein_id gnl|my_center|LOCUS_10990 10340 10687 gene locus_tag LOCUS_11000 10340 10687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 11483 10692 gene locus_tag LOCUS_11010 gene sfsA 11483 10692 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUC5 protein_id gnl|my_center|LOCUS_11010 12539 11493 gene locus_tag LOCUS_11020 12539 11493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 12853 13494 gene locus_tag LOCUS_11030 gene mlaA 12853 13494 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073084.1 protein_id gnl|my_center|LOCUS_11030 13500 14315 gene locus_tag LOCUS_11040 gene apaH 13500 14315 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U7 protein_id gnl|my_center|LOCUS_11040 15059 14340 gene locus_tag LOCUS_11050 15059 14340 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707332.1 protein_id gnl|my_center|LOCUS_11050 15425 15090 gene locus_tag LOCUS_11060 15425 15090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 18118 15722 gene locus_tag LOCUS_11070 gene gyrB 18118 15722 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEE9 protein_id gnl|my_center|LOCUS_11070 19501 18398 gene locus_tag LOCUS_11080 19501 18398 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500U6 protein_id gnl|my_center|LOCUS_11080 21029 19695 gene locus_tag LOCUS_11090 gene dnaA 21029 19695 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83FD8 protein_id gnl|my_center|LOCUS_11090 21385 21750 gene locus_tag LOCUS_11100 gene rnpA 21385 21750 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVY2 protein_id gnl|my_center|LOCUS_11100 21987 23684 gene locus_tag LOCUS_11110 gene yidC 21987 23684 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT06 protein_id gnl|my_center|LOCUS_11110 23715 25082 gene locus_tag LOCUS_11120 gene mnmE 23715 25082 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XB41 protein_id gnl|my_center|LOCUS_11120 25221 26192 gene locus_tag LOCUS_11130 25221 26192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 26189 27874 gene locus_tag LOCUS_11140 26189 27874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 27898 29784 gene locus_tag LOCUS_11150 gene mnmG 27898 29784 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8A9 protein_id gnl|my_center|LOCUS_11150 29822 30475 gene locus_tag LOCUS_11160 gene rsmG 29822 30475 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZL14 protein_id gnl|my_center|LOCUS_11160 30600 31367 gene locus_tag LOCUS_11170 30600 31367 CDS product cobyric acid synthase CobQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707916.1 protein_id gnl|my_center|LOCUS_11170 31364 32218 gene locus_tag LOCUS_11180 gene spoOJ 31364 32218 CDS product chromosome partitioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 protein_id gnl|my_center|LOCUS_11180 32487 32897 gene locus_tag LOCUS_11190 32487 32897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 32914 33687 gene locus_tag LOCUS_11200 gene atpB 32914 33687 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8B4 protein_id gnl|my_center|LOCUS_11200 33727 34020 gene locus_tag LOCUS_11210 gene atpE 33727 34020 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZR96 protein_id gnl|my_center|LOCUS_11210 34065 34535 gene locus_tag LOCUS_11220 gene atpF 34065 34535 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT16 protein_id gnl|my_center|LOCUS_11220 34547 35083 gene locus_tag LOCUS_11230 gene atpH 34547 35083 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT17 protein_id gnl|my_center|LOCUS_11230 35100 36647 gene locus_tag LOCUS_11240 gene atpA2 35100 36647 CDS product ATP synthase subunit alpha 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZR99 protein_id gnl|my_center|LOCUS_11240 36674 37537 gene locus_tag LOCUS_11250 gene atpG 36674 37537 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT19 protein_id gnl|my_center|LOCUS_11250 37604 38983 gene locus_tag LOCUS_11260 gene atpD 37604 38983 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43715 protein_id gnl|my_center|LOCUS_11260 39011 39430 gene locus_tag LOCUS_11270 gene atpC 39011 39430 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJH0 protein_id gnl|my_center|LOCUS_11270 39446 39916 gene locus_tag LOCUS_11280 gene slyD 39446 39916 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212871.1 protein_id gnl|my_center|LOCUS_11280 40018 40632 gene locus_tag LOCUS_11290 40018 40632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097831.1 protein_id gnl|my_center|LOCUS_11290 40746 42122 gene locus_tag LOCUS_11300 gene glmU 40746 42122 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z9S7 protein_id gnl|my_center|LOCUS_11300 42145 43974 gene locus_tag LOCUS_11310 gene glmS 42145 43974 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQX0 protein_id gnl|my_center|LOCUS_11310 >Feature sequence14 1245 526 gene locus_tag LOCUS_11320 1245 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 1939 1864 gene locus_tag LOCUS_t00180 1939 1864 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3199 2057 gene locus_tag LOCUS_11330 3199 2057 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085683.1 protein_id gnl|my_center|LOCUS_11330 4348 3287 gene locus_tag LOCUS_11340 4348 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 4930 4361 gene locus_tag LOCUS_11350 gene pal 4930 4361 CDS product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418623.1 protein_id gnl|my_center|LOCUS_11350 6242 4950 gene locus_tag LOCUS_11360 gene tolB 6242 4950 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6F2 protein_id gnl|my_center|LOCUS_11360 7192 6254 gene locus_tag LOCUS_11370 7192 6254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 7631 7197 gene locus_tag LOCUS_11380 gene tolR 7631 7197 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011242259.1 protein_id gnl|my_center|LOCUS_11380 8333 7635 gene locus_tag LOCUS_11390 gene tolQ 8333 7635 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50598 protein_id gnl|my_center|LOCUS_11390 8900 8430 gene locus_tag LOCUS_11400 8900 8430 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186455.1 protein_id gnl|my_center|LOCUS_11400 9092 9937 gene locus_tag LOCUS_11410 9092 9937 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933760.1 protein_id gnl|my_center|LOCUS_11410 9937 10719 gene locus_tag LOCUS_11420 9937 10719 CDS product zinc ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020083.1 protein_id gnl|my_center|LOCUS_11420 10840 11712 gene locus_tag LOCUS_11430 10840 11712 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020084.1 protein_id gnl|my_center|LOCUS_11430 11705 12151 gene locus_tag LOCUS_11440 gene zur 11705 12151 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707398.1 protein_id gnl|my_center|LOCUS_11440 13213 12173 gene locus_tag LOCUS_11450 gene ruvB 13213 12173 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JZ86 protein_id gnl|my_center|LOCUS_11450 13809 13210 gene locus_tag LOCUS_11460 gene ruvA 13809 13210 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51425 protein_id gnl|my_center|LOCUS_11460 14318 13824 gene locus_tag LOCUS_11470 gene ruvC 14318 13824 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6A1 protein_id gnl|my_center|LOCUS_11470 15089 14340 gene locus_tag LOCUS_11480 15089 14340 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NH19 protein_id gnl|my_center|LOCUS_11480 15689 15219 gene locus_tag LOCUS_11490 gene ntpA 15689 15219 CDS product NUDIX pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002240378.1 protein_id gnl|my_center|LOCUS_11490 17479 15686 gene locus_tag LOCUS_11500 gene aspS 17479 15686 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51422 protein_id gnl|my_center|LOCUS_11500 18149 17520 gene locus_tag LOCUS_11510 18149 17520 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772090.1 protein_id gnl|my_center|LOCUS_11510 18458 18156 gene locus_tag LOCUS_11520 18458 18156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 20005 18677 gene locus_tag LOCUS_11530 gene pmbA 20005 18677 CDS product PmbA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112740.1 protein_id gnl|my_center|LOCUS_11530 21484 20036 gene locus_tag LOCUS_11540 21484 20036 CDS product protease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268865.1 protein_id gnl|my_center|LOCUS_11540 22382 21576 gene locus_tag LOCUS_11550 22382 21576 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946685.1 protein_id gnl|my_center|LOCUS_11550 22759 22379 gene locus_tag LOCUS_11560 22759 22379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 26510 22761 gene locus_tag LOCUS_11570 26510 22761 CDS product DUF3971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478842.1 protein_id gnl|my_center|LOCUS_11570 28087 26594 gene locus_tag LOCUS_11580 gene cafA 28087 26594 CDS product axial filament protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 protein_id gnl|my_center|LOCUS_11580 28686 28084 gene locus_tag LOCUS_11590 28686 28084 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU3 protein_id gnl|my_center|LOCUS_11590 29196 28714 gene locus_tag LOCUS_11600 gene rlmH 29196 28714 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTF1 protein_id gnl|my_center|LOCUS_11600 29692 29324 gene locus_tag LOCUS_11610 gene rsfS 29692 29324 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX22 protein_id gnl|my_center|LOCUS_11610 30348 29689 gene locus_tag LOCUS_11620 gene nadD 30348 29689 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN91 protein_id gnl|my_center|LOCUS_11620 31631 30351 gene locus_tag LOCUS_11630 gene proA 31631 30351 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX20 protein_id gnl|my_center|LOCUS_11630 32674 31628 gene locus_tag LOCUS_11640 gene holA 32674 31628 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268982.1 protein_id gnl|my_center|LOCUS_11640 33234 32695 gene locus_tag LOCUS_11650 33234 32695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 35832 33373 gene locus_tag LOCUS_11660 gene leuS 35832 33373 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83DY1 protein_id gnl|my_center|LOCUS_11660 36179 35841 gene locus_tag LOCUS_11670 36179 35841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 36711 36403 gene locus_tag LOCUS_11680 36711 36403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 37052 36708 gene locus_tag LOCUS_11690 37052 36708 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810206.1 protein_id gnl|my_center|LOCUS_11690 37701 37225 gene locus_tag LOCUS_11700 gene omp 37701 37225 CDS product 17 kDa surface antigen inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P16624 protein_id gnl|my_center|LOCUS_11700 38261 37830 gene locus_tag LOCUS_11710 38261 37830 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401957.1 protein_id gnl|my_center|LOCUS_11710 39115 38315 gene locus_tag LOCUS_11720 gene trpC 39115 38315 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD70 protein_id gnl|my_center|LOCUS_11720 40147 39128 gene locus_tag LOCUS_11730 gene trpD 40147 39128 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20574 protein_id gnl|my_center|LOCUS_11730 40919 40341 gene locus_tag LOCUS_11740 gene pabA 40919 40341 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602287.1 protein_id gnl|my_center|LOCUS_11740 >Feature sequence15 1 909 gene locus_tag LOCUS_11750 1 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 932 1564 gene locus_tag LOCUS_11760 gene lolA 932 1564 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57068 protein_id gnl|my_center|LOCUS_11760 1583 2899 gene locus_tag LOCUS_11770 1583 2899 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405078.1 protein_id gnl|my_center|LOCUS_11770 2896 3270 gene locus_tag LOCUS_11780 gene crcB 2896 3270 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61389 protein_id gnl|my_center|LOCUS_11780 3225 3431 gene locus_tag LOCUS_11790 3225 3431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 3437 4711 gene locus_tag LOCUS_11800 gene serS 3437 4711 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZGC4 protein_id gnl|my_center|LOCUS_11800 4725 6656 gene locus_tag LOCUS_11810 4725 6656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 7461 6790 gene locus_tag LOCUS_11820 7461 6790 CDS product BAX inhibitor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946684.1 protein_id gnl|my_center|LOCUS_11820 7670 7757 gene locus_tag LOCUS_t00190 7670 7757 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8087 8353 gene locus_tag LOCUS_11830 8087 8353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 8375 8662 gene locus_tag LOCUS_11840 8375 8662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 9494 8829 gene locus_tag LOCUS_11850 9494 8829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 9734 11059 gene locus_tag LOCUS_11860 gene glnA 9734 11059 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024100.1 protein_id gnl|my_center|LOCUS_11860 11087 11986 gene locus_tag LOCUS_11870 11087 11986 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875830.1 protein_id gnl|my_center|LOCUS_11870 11974 12699 gene locus_tag LOCUS_11880 11974 12699 CDS product tributyrin esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875831.1 protein_id gnl|my_center|LOCUS_11880 12724 14013 gene locus_tag LOCUS_11890 12724 14013 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875833.1 protein_id gnl|my_center|LOCUS_11890 14087 14365 gene locus_tag LOCUS_11900 14087 14365 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225095.1 protein_id gnl|my_center|LOCUS_11900 14362 15831 gene locus_tag LOCUS_11910 gene ooxA 14362 15831 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089926.1 protein_id gnl|my_center|LOCUS_11910 15828 17546 gene locus_tag LOCUS_11920 15828 17546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 17543 19387 gene locus_tag LOCUS_11930 17543 19387 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941578.1 protein_id gnl|my_center|LOCUS_11930 19356 19655 gene locus_tag LOCUS_11940 19356 19655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 19836 21020 gene locus_tag LOCUS_11950 19836 21020 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869387.1 protein_id gnl|my_center|LOCUS_11950 21037 21753 gene locus_tag LOCUS_11960 gene livF 21037 21753 CDS product high-affinity branched-chain amino acid transport ATP-binding protein LivF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A192 protein_id gnl|my_center|LOCUS_11960 21750 22637 gene locus_tag LOCUS_11970 21750 22637 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970223.1 protein_id gnl|my_center|LOCUS_11970 22637 24454 gene locus_tag LOCUS_11980 22637 24454 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813865.1 protein_id gnl|my_center|LOCUS_11980 24766 26007 gene locus_tag LOCUS_11990 24766 26007 CDS product PLP-dependent lyase/thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064255.1 protein_id gnl|my_center|LOCUS_11990 26011 27252 gene locus_tag LOCUS_12000 26011 27252 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532461.1 protein_id gnl|my_center|LOCUS_12000 27269 28171 gene locus_tag LOCUS_12010 27269 28171 CDS product N-carbamoyl-D-amino-acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085362.1 protein_id gnl|my_center|LOCUS_12010 28412 30853 gene locus_tag LOCUS_12020 28412 30853 CDS product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393495.1 protein_id gnl|my_center|LOCUS_12020 33017 30954 gene locus_tag LOCUS_12030 33017 30954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 34377 33064 gene locus_tag LOCUS_12040 34377 33064 CDS product chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393455.1 protein_id gnl|my_center|LOCUS_12040 34810 34646 gene locus_tag LOCUS_12050 34810 34646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 34907 35461 gene locus_tag LOCUS_12060 34907 35461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 35518 36687 gene locus_tag LOCUS_12070 gene sucC 35518 36687 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62MG7 protein_id gnl|my_center|LOCUS_12070 36690 37568 gene locus_tag LOCUS_12080 gene sucD 36690 37568 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WW1 protein_id gnl|my_center|LOCUS_12080 38140 37688 gene locus_tag LOCUS_12090 38140 37688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 >Feature sequence16 219 1241 gene locus_tag LOCUS_12100 gene queA 219 1241 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P867 protein_id gnl|my_center|LOCUS_12100 1256 2365 gene locus_tag LOCUS_12110 gene tgt 1256 2365 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXH9 protein_id gnl|my_center|LOCUS_12110 2564 2896 gene locus_tag LOCUS_12120 gene yajC 2564 2896 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947718.1 protein_id gnl|my_center|LOCUS_12120 2915 4807 gene locus_tag LOCUS_12130 gene secD 2915 4807 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S34 protein_id gnl|my_center|LOCUS_12130 4818 5822 gene locus_tag LOCUS_12140 gene secF 4818 5822 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3D5 protein_id gnl|my_center|LOCUS_12140 5838 6317 gene locus_tag LOCUS_12150 gene nrdR 5838 6317 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMX9 protein_id gnl|my_center|LOCUS_12150 6404 7069 gene locus_tag LOCUS_12160 gene ribC 6404 7069 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093316.1 protein_id gnl|my_center|LOCUS_12160 7076 8218 gene locus_tag LOCUS_12170 gene ribB 7076 8218 CDS product 3,4-dihydroxy-2-butanone 4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPU3 protein_id gnl|my_center|LOCUS_12170 8505 8975 gene locus_tag LOCUS_12180 gene ribH 8505 8975 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RU4 protein_id gnl|my_center|LOCUS_12180 9000 9440 gene locus_tag LOCUS_12190 gene nusB 9000 9440 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z8X6 protein_id gnl|my_center|LOCUS_12190 9470 10435 gene locus_tag LOCUS_12200 gene thiL 9470 10435 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FSL2 protein_id gnl|my_center|LOCUS_12200 10428 10904 gene locus_tag LOCUS_12210 10428 10904 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNG4 protein_id gnl|my_center|LOCUS_12210 11153 11638 gene locus_tag LOCUS_12220 11153 11638 CDS product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WM4 protein_id gnl|my_center|LOCUS_12220 11665 12390 gene locus_tag LOCUS_12230 gene dsbC 11665 12390 CDS product thiol:disulfide interchange protein DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092626.1 protein_id gnl|my_center|LOCUS_12230 12808 12485 gene locus_tag LOCUS_12240 gene fdxA 12808 12485 CDS product ferredoxin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY07 protein_id gnl|my_center|LOCUS_12240 15638 13035 gene locus_tag LOCUS_12250 gene mutS 15638 13035 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZBQ3 protein_id gnl|my_center|LOCUS_12250 16444 15653 gene locus_tag LOCUS_12260 gene suhB 16444 15653 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958026.1 protein_id gnl|my_center|LOCUS_12260 16940 17695 gene locus_tag LOCUS_12270 gene trmJ 16940 17695 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887A4 protein_id gnl|my_center|LOCUS_12270 18045 18371 gene locus_tag LOCUS_12280 18045 18371 CDS product iron-binding protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTY0 protein_id gnl|my_center|LOCUS_12280 18510 19784 gene locus_tag LOCUS_12290 gene mtaB 18510 19784 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_12290 19887 20318 gene locus_tag LOCUS_12300 gene ndk 19887 20318 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMP3 protein_id gnl|my_center|LOCUS_12300 20327 21445 gene locus_tag LOCUS_12310 gene rlmN 20327 21445 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZV93 protein_id gnl|my_center|LOCUS_12310 21514 22851 gene locus_tag LOCUS_12320 21514 22851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 22852 24126 gene locus_tag LOCUS_12330 gene hisS 22852 24126 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTX0 protein_id gnl|my_center|LOCUS_12330 24335 24967 gene locus_tag LOCUS_12340 24335 24967 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103549.1 protein_id gnl|my_center|LOCUS_12340 24964 26127 gene locus_tag LOCUS_12350 gene bamB 24964 26127 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZV98 protein_id gnl|my_center|LOCUS_12350 26127 27479 gene locus_tag LOCUS_12360 gene der 26127 27479 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTW7 protein_id gnl|my_center|LOCUS_12360 27495 28076 gene locus_tag LOCUS_12370 27495 28076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 29409 28060 gene locus_tag LOCUS_12380 gene xseA 29409 28060 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NQV5 protein_id gnl|my_center|LOCUS_12380 29662 31125 gene locus_tag LOCUS_12390 gene guaB 29662 31125 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886X6 protein_id gnl|my_center|LOCUS_12390 31133 32719 gene locus_tag LOCUS_12400 gene guaA 31133 32719 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJS0 protein_id gnl|my_center|LOCUS_12400 33060 34052 gene locus_tag LOCUS_12410 33060 34052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 >Feature sequence17 841 446 gene locus_tag LOCUS_12420 841 446 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709924.1 protein_id gnl|my_center|LOCUS_12420 2497 926 gene locus_tag LOCUS_12430 2497 926 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456939.1 protein_id gnl|my_center|LOCUS_12430 3408 2506 gene locus_tag LOCUS_12440 3408 2506 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249611.1 protein_id gnl|my_center|LOCUS_12440 4385 3414 gene locus_tag LOCUS_12450 4385 3414 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249610.1 protein_id gnl|my_center|LOCUS_12450 5808 4624 gene locus_tag LOCUS_12460 5808 4624 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762231.1 protein_id gnl|my_center|LOCUS_12460 6850 5945 gene locus_tag LOCUS_12470 gene rbsK 6850 5945 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TCR6 protein_id gnl|my_center|LOCUS_12470 7800 6847 gene locus_tag LOCUS_12480 7800 6847 CDS product ribosylpyrimidine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529592.1 protein_id gnl|my_center|LOCUS_12480 8081 8980 gene locus_tag LOCUS_12490 8081 8980 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532152.1 protein_id gnl|my_center|LOCUS_12490 9024 9932 gene locus_tag LOCUS_12500 9024 9932 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002071.1 protein_id gnl|my_center|LOCUS_12500 10079 10411 gene locus_tag LOCUS_12510 10079 10411 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583590.1 protein_id gnl|my_center|LOCUS_12510 10416 12236 gene locus_tag LOCUS_12520 gene dsbD 10416 12236 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555990.1 protein_id gnl|my_center|LOCUS_12520 12241 12777 gene locus_tag LOCUS_12530 12241 12777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 13078 13527 gene locus_tag LOCUS_12540 gene accB 13078 13527 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262775.1 protein_id gnl|my_center|LOCUS_12540 13538 14881 gene locus_tag LOCUS_12550 13538 14881 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459551.1 protein_id gnl|my_center|LOCUS_12550 14895 15779 gene locus_tag LOCUS_12560 gene prmA 14895 15779 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUW3 protein_id gnl|my_center|LOCUS_12560 15978 16967 gene locus_tag LOCUS_12570 gene dusB 15978 16967 CDS product tRNA-dihydrouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUW1 protein_id gnl|my_center|LOCUS_12570 16970 17224 gene locus_tag LOCUS_12580 gene fis 16970 17224 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814221.1 protein_id gnl|my_center|LOCUS_12580 17290 18900 gene locus_tag LOCUS_12590 gene purH 17290 18900 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KV80 protein_id gnl|my_center|LOCUS_12590 18916 20217 gene locus_tag LOCUS_12600 gene purD 18916 20217 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KV81 protein_id gnl|my_center|LOCUS_12600 20239 20745 gene locus_tag LOCUS_12610 gene purE-2 20239 20745 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEX5 protein_id gnl|my_center|LOCUS_12610 20748 21314 gene locus_tag LOCUS_12620 gene tsaC 20748 21314 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AA2 protein_id gnl|my_center|LOCUS_12620 21358 22629 gene locus_tag LOCUS_12630 21358 22629 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094897.1 protein_id gnl|my_center|LOCUS_12630 24133 22790 gene locus_tag LOCUS_12640 24133 22790 CDS product channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266478.1 protein_id gnl|my_center|LOCUS_12640 24891 24238 gene locus_tag LOCUS_12650 gene pcm 24891 24238 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522277.1 protein_id gnl|my_center|LOCUS_12650 26273 25080 gene locus_tag LOCUS_12660 26273 25080 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093049.1 protein_id gnl|my_center|LOCUS_12660 26600 26289 gene locus_tag LOCUS_12670 26600 26289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 27598 26831 gene locus_tag LOCUS_12680 gene dpm1 27598 26831 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038929.1 protein_id gnl|my_center|LOCUS_12680 28947 27709 gene locus_tag LOCUS_12690 gene nhaP 28947 27709 CDS product Na(+)/H(+) antiporter NhaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD29 protein_id gnl|my_center|LOCUS_12690 30373 29069 gene locus_tag LOCUS_12700 gene pepP 30373 29069 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_12700 30923 30387 gene locus_tag LOCUS_12710 30923 30387 CDS product UPF0149 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTW5 protein_id gnl|my_center|LOCUS_12710 31076 31279 gene locus_tag LOCUS_12720 31076 31279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 31279 31593 gene locus_tag LOCUS_12730 gene zapA 31279 31593 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTW3 protein_id gnl|my_center|LOCUS_12730 31837 32448 gene locus_tag LOCUS_12740 31837 32448 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZN3 protein_id gnl|my_center|LOCUS_12740 32480 33304 gene locus_tag LOCUS_12750 32480 33304 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941799.1 protein_id gnl|my_center|LOCUS_12750 >Feature sequence18 <1 833 gene locus_tag LOCUS_12760 <1 833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942903.1:UDP-N-acetylglucosamine 3-dehydrogenase 818 1936 gene locus_tag LOCUS_12770 818 1936 CDS product aminotransferase DegT/DnrJ/EryC1/StrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546476.1 protein_id gnl|my_center|LOCUS_12770 1987 2463 gene locus_tag LOCUS_12780 1987 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 2460 4448 gene locus_tag LOCUS_12790 2460 4448 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258483.1 protein_id gnl|my_center|LOCUS_12790 5937 4504 gene locus_tag LOCUS_12800 gene gatB 5937 4504 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BM8 protein_id gnl|my_center|LOCUS_12800 7406 5940 gene locus_tag LOCUS_12810 gene gatA 7406 5940 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BM9 protein_id gnl|my_center|LOCUS_12810 7700 7413 gene locus_tag LOCUS_12820 gene gatC 7700 7413 CDS product glutamyl-tRNA(Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVT9 protein_id gnl|my_center|LOCUS_12820 7865 8905 gene locus_tag LOCUS_12830 gene mreB 7865 8905 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189550.1 protein_id gnl|my_center|LOCUS_12830 8973 9842 gene locus_tag LOCUS_12840 gene mreC 8973 9842 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU1 protein_id gnl|my_center|LOCUS_12840 9835 10332 gene locus_tag LOCUS_12850 gene mreD 9835 10332 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JRJ1 protein_id gnl|my_center|LOCUS_12850 10335 12224 gene locus_tag LOCUS_12860 gene pbpA 10335 12224 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093191.1 protein_id gnl|my_center|LOCUS_12860 12226 13344 gene locus_tag LOCUS_12870 gene mrdB 12226 13344 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707028.1 protein_id gnl|my_center|LOCUS_12870 13341 14357 gene locus_tag LOCUS_12880 gene mltB-2 13341 14357 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707030.1 protein_id gnl|my_center|LOCUS_12880 14354 15193 gene locus_tag LOCUS_12890 14354 15193 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815184.1 protein_id gnl|my_center|LOCUS_12890 15465 16490 gene locus_tag LOCUS_12900 15465 16490 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268985.1 protein_id gnl|my_center|LOCUS_12900 16507 16794 gene locus_tag LOCUS_12910 16507 16794 CDS product UPF0250 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63XX9 protein_id gnl|my_center|LOCUS_12910 16808 17500 gene locus_tag LOCUS_12920 gene lipB 16808 17500 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P589 protein_id gnl|my_center|LOCUS_12920 17728 20004 gene locus_tag LOCUS_12930 gene lptD 17728 20004 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E862 protein_id gnl|my_center|LOCUS_12930 20001 21377 gene locus_tag LOCUS_12940 gene surA 20001 21377 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCE1 protein_id gnl|my_center|LOCUS_12940 22800 21502 gene locus_tag LOCUS_12950 22800 21502 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500B0 protein_id gnl|my_center|LOCUS_12950 23161 22823 gene locus_tag LOCUS_12960 gene glnB 23161 22823 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720289.1 protein_id gnl|my_center|LOCUS_12960 23563 23805 gene locus_tag LOCUS_12970 23563 23805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 24018 25541 gene locus_tag LOCUS_12980 gene comM 24018 25541 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038949.1 protein_id gnl|my_center|LOCUS_12980 26024 28042 gene locus_tag LOCUS_12990 gene hppA 26024 28042 CDS product K(+)-insensitive pyrophosphate-energized proton pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5M6 protein_id gnl|my_center|LOCUS_12990 28187 28663 gene locus_tag LOCUS_13000 28187 28663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 30680 28743 gene locus_tag LOCUS_13010 30680 28743 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227894.1 protein_id gnl|my_center|LOCUS_13010 >Feature sequence19 3427 1871 gene locus_tag LOCUS_13020 gene betC 3427 1871 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186939.1 protein_id gnl|my_center|LOCUS_13020 4432 3455 gene locus_tag LOCUS_13030 gene qor 4432 3455 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088878.1 protein_id gnl|my_center|LOCUS_13030 5345 4443 gene locus_tag LOCUS_13040 5345 4443 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814620.1 protein_id gnl|my_center|LOCUS_13040 5511 7316 gene locus_tag LOCUS_13050 5511 7316 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189741.1 protein_id gnl|my_center|LOCUS_13050 11258 7317 gene locus_tag LOCUS_13060 gene purL 11258 7317 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ51 protein_id gnl|my_center|LOCUS_13060 12015 11287 gene locus_tag LOCUS_13070 gene purC 12015 11287 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W0 protein_id gnl|my_center|LOCUS_13070 13246 12089 gene locus_tag LOCUS_13080 13246 12089 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039334.1 protein_id gnl|my_center|LOCUS_13080 14149 13274 gene locus_tag LOCUS_13090 gene dapA 14149 13274 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W3 protein_id gnl|my_center|LOCUS_13090 14530 15072 gene locus_tag LOCUS_13100 14530 15072 CDS product ATP:cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201622.1 protein_id gnl|my_center|LOCUS_13100 15270 16499 gene locus_tag LOCUS_13110 15270 16499 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249472.1 protein_id gnl|my_center|LOCUS_13110 16725 20357 gene locus_tag LOCUS_13120 gene oplaH 16725 20357 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930621.1 protein_id gnl|my_center|LOCUS_13120 20440 21708 gene locus_tag LOCUS_13130 20440 21708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704211.1 protein_id gnl|my_center|LOCUS_13130 21850 23547 gene locus_tag LOCUS_13140 gene glnS 21850 23547 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747A1 protein_id gnl|my_center|LOCUS_13140 23617 24672 gene locus_tag LOCUS_13150 23617 24672 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769160.1 protein_id gnl|my_center|LOCUS_13150 24672 25190 gene locus_tag LOCUS_13160 24672 25190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40882 protein_id gnl|my_center|LOCUS_13160 25374 25177 gene locus_tag LOCUS_13170 25374 25177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 25351 26139 gene locus_tag LOCUS_13180 gene panC 25351 26139 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X0G6 protein_id gnl|my_center|LOCUS_13180 27377 26205 gene locus_tag LOCUS_13190 27377 26205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 28370 29164 gene locus_tag LOCUS_13200 gene cysE 28370 29164 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004106845.1 protein_id gnl|my_center|LOCUS_13200 >Feature sequence20 234 159 gene locus_tag LOCUS_t00200 234 159 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 330 257 gene locus_tag LOCUS_t00210 330 257 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 500 416 gene locus_tag LOCUS_t00220 500 416 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1834 647 gene locus_tag LOCUS_13210 1834 647 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249918.1 protein_id gnl|my_center|LOCUS_13210 2625 1861 gene locus_tag LOCUS_13220 2625 1861 CDS product Asp/Glu racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531948.1 protein_id gnl|my_center|LOCUS_13220 2850 2653 gene locus_tag LOCUS_13230 2850 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 3011 4054 gene locus_tag LOCUS_13240 3011 4054 CDS product muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123092.1 protein_id gnl|my_center|LOCUS_13240 4044 5078 gene locus_tag LOCUS_13250 4044 5078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121962.1 protein_id gnl|my_center|LOCUS_13250 5481 6014 gene locus_tag LOCUS_13260 5481 6014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 6043 7509 gene locus_tag LOCUS_13270 6043 7509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 7520 9709 gene locus_tag LOCUS_13280 7520 9709 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_13280 9706 12615 gene locus_tag LOCUS_13290 9706 12615 CDS product NHLP family bacteriocin export ABC transporter permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458930.1 protein_id gnl|my_center|LOCUS_13290 12696 14087 gene locus_tag LOCUS_13300 12696 14087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 14422 15891 gene locus_tag LOCUS_13310 gene ubiD 14422 15891 CDS product 3-octaprenyl-4-hydroxybenzoate carboxy-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UQ5 protein_id gnl|my_center|LOCUS_13310 16086 17273 gene locus_tag LOCUS_13320 16086 17273 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088819.1 protein_id gnl|my_center|LOCUS_13320 17599 18474 gene locus_tag LOCUS_13330 17599 18474 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064203.1 protein_id gnl|my_center|LOCUS_13330 18474 19463 gene locus_tag LOCUS_13340 18474 19463 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809842.1 protein_id gnl|my_center|LOCUS_13340 19456 20196 gene locus_tag LOCUS_13350 19456 20196 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809845.1 protein_id gnl|my_center|LOCUS_13350 20193 20912 gene locus_tag LOCUS_13360 20193 20912 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039306.1 protein_id gnl|my_center|LOCUS_13360 21194 22372 gene locus_tag LOCUS_13370 21194 22372 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337850.1 protein_id gnl|my_center|LOCUS_13370 22435 23217 gene locus_tag LOCUS_13380 22435 23217 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384138.1 protein_id gnl|my_center|LOCUS_13380 23214 23918 gene locus_tag LOCUS_13390 23214 23918 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720082.1 protein_id gnl|my_center|LOCUS_13390 23922 24935 gene locus_tag LOCUS_13400 23922 24935 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337851.1 protein_id gnl|my_center|LOCUS_13400 24932 26245 gene locus_tag LOCUS_13410 24932 26245 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337852.1 protein_id gnl|my_center|LOCUS_13410 26879 26283 gene locus_tag LOCUS_13420 gene pdxH 26879 26283 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHI2 protein_id gnl|my_center|LOCUS_13420 27200 27637 gene locus_tag LOCUS_13430 27200 27637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 27650 28330 gene locus_tag LOCUS_13440 27650 28330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 >Feature sequence21 1477 353 gene locus_tag LOCUS_13450 1477 353 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250076.1 protein_id gnl|my_center|LOCUS_13450 1793 1599 gene locus_tag LOCUS_13460 1793 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 2381 1806 gene locus_tag LOCUS_13470 gene recR 2381 1806 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFF8 protein_id gnl|my_center|LOCUS_13470 2747 2418 gene locus_tag LOCUS_13480 2747 2418 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M9U8 protein_id gnl|my_center|LOCUS_13480 4438 2780 gene locus_tag LOCUS_13490 4438 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 5148 4717 gene locus_tag LOCUS_13500 gene yqaA 5148 4717 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261304.1 protein_id gnl|my_center|LOCUS_13500 5990 5229 gene locus_tag LOCUS_13510 5990 5229 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FX0 protein_id gnl|my_center|LOCUS_13510 6922 5987 gene locus_tag LOCUS_13520 6922 5987 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975756.1 protein_id gnl|my_center|LOCUS_13520 7540 7046 gene locus_tag LOCUS_13530 7540 7046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 8097 9116 gene locus_tag LOCUS_13540 gene ltaE 8097 9116 CDS product L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746W0 protein_id gnl|my_center|LOCUS_13540 11275 9215 gene locus_tag LOCUS_13550 11275 9215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 12010 11330 gene locus_tag LOCUS_13560 12010 11330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970038.1 protein_id gnl|my_center|LOCUS_13560 12992 12126 gene locus_tag LOCUS_13570 12992 12126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 13576 13486 gene locus_tag LOCUS_t00230 13576 13486 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 13886 13662 gene locus_tag LOCUS_13580 13886 13662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 14592 13891 gene locus_tag LOCUS_13590 gene dnr 14592 13891 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113234.1 protein_id gnl|my_center|LOCUS_13590 14974 17010 gene locus_tag LOCUS_13600 14974 17010 CDS product N-methylproline demethylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532328.1 protein_id gnl|my_center|LOCUS_13600 17203 18300 gene locus_tag LOCUS_13610 gene ribD 17203 18300 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX2 protein_id gnl|my_center|LOCUS_13610 18733 20085 gene locus_tag LOCUS_13620 18733 20085 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880464.1 protein_id gnl|my_center|LOCUS_13620 20193 21185 gene locus_tag LOCUS_13630 20193 21185 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289860.1 protein_id gnl|my_center|LOCUS_13630 22703 21396 gene locus_tag LOCUS_13640 22703 21396 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897686.1 protein_id gnl|my_center|LOCUS_13640 23194 22871 gene locus_tag LOCUS_13650 23194 22871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 23864 23187 gene locus_tag LOCUS_13660 23864 23187 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065707.1 protein_id gnl|my_center|LOCUS_13660 24420 24127 gene locus_tag LOCUS_13670 24420 24127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 24769 24569 gene locus_tag LOCUS_13680 24769 24569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 24956 26116 gene locus_tag LOCUS_13690 24956 26116 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459735.1 protein_id gnl|my_center|LOCUS_13690 27874 26225 gene locus_tag LOCUS_13700 gene ilvB 27874 26225 CDS product acetolactate synthase I/II/III large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226410.1 protein_id gnl|my_center|LOCUS_13700 >Feature sequence22 232 35 gene locus_tag LOCUS_13710 232 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 800 564 gene locus_tag LOCUS_13720 800 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 1721 903 gene locus_tag LOCUS_13730 1721 903 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065502.1 protein_id gnl|my_center|LOCUS_13730 2172 1834 gene locus_tag LOCUS_13740 2172 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 2518 2901 gene locus_tag LOCUS_13750 2518 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 3031 3540 gene locus_tag LOCUS_13760 3031 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 3984 4068 gene locus_tag LOCUS_t00240 3984 4068 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4147 5475 gene locus_tag LOCUS_13770 gene tig 4147 5475 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U2 protein_id gnl|my_center|LOCUS_13770 5507 6121 gene locus_tag LOCUS_13780 gene clpP 5507 6121 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVM7 protein_id gnl|my_center|LOCUS_13780 6275 7552 gene locus_tag LOCUS_13790 gene clpX 6275 7552 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U0 protein_id gnl|my_center|LOCUS_13790 7730 10144 gene locus_tag LOCUS_13800 gene lon 7730 10144 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P74956 protein_id gnl|my_center|LOCUS_13800 10505 10777 gene locus_tag LOCUS_13810 10505 10777 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552737.1 protein_id gnl|my_center|LOCUS_13810 10789 10864 gene locus_tag LOCUS_t00250 10789 10864 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 11189 11265 gene locus_tag LOCUS_t00260 11189 11265 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 11439 13376 gene locus_tag LOCUS_13820 11439 13376 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YS0 protein_id gnl|my_center|LOCUS_13820 14194 13394 gene locus_tag LOCUS_13830 14194 13394 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVM0 protein_id gnl|my_center|LOCUS_13830 14298 15050 gene locus_tag LOCUS_13840 gene rsmJ 14298 15050 CDS product ribosomal RNA small subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSQ2 protein_id gnl|my_center|LOCUS_13840 15050 15769 gene locus_tag LOCUS_13850 15050 15769 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I694 protein_id gnl|my_center|LOCUS_13850 18648 15856 gene locus_tag LOCUS_13860 gene valS 18648 15856 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887M3 protein_id gnl|my_center|LOCUS_13860 19203 18760 gene locus_tag LOCUS_13870 gene holC 19203 18760 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948332.1 protein_id gnl|my_center|LOCUS_13870 20710 19205 gene locus_tag LOCUS_13880 gene pepA 20710 19205 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZBH3 protein_id gnl|my_center|LOCUS_13880 21006 22016 gene locus_tag LOCUS_13890 21006 22016 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092863.1 protein_id gnl|my_center|LOCUS_13890 22495 22863 gene locus_tag LOCUS_13900 22495 22863 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071871.1 protein_id gnl|my_center|LOCUS_13900 22990 23289 gene locus_tag LOCUS_13910 22990 23289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 23412 23336 gene locus_tag LOCUS_t00270 23412 23336 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 24082 24645 gene locus_tag LOCUS_13920 24082 24645 CDS product amino acid transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704971.1 protein_id gnl|my_center|LOCUS_13920 25088 25297 gene locus_tag LOCUS_13930 25088 25297 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005331438.1 protein_id gnl|my_center|LOCUS_13930 26072 25539 gene locus_tag LOCUS_13940 26072 25539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 26371 26296 gene locus_tag LOCUS_t00280 26371 26296 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence23 123 440 gene locus_tag LOCUS_13950 gene rpsJ 123 440 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHW9 protein_id gnl|my_center|LOCUS_13950 481 1146 gene locus_tag LOCUS_13960 gene rplC 481 1146 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PB20 protein_id gnl|my_center|LOCUS_13960 1175 1795 gene locus_tag LOCUS_13970 gene rplD 1175 1795 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD6 protein_id gnl|my_center|LOCUS_13970 1792 2091 gene locus_tag LOCUS_13980 gene rplW 1792 2091 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYP1 protein_id gnl|my_center|LOCUS_13980 2121 2945 gene locus_tag LOCUS_13990 gene rplB 2121 2945 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK65 protein_id gnl|my_center|LOCUS_13990 2966 3244 gene locus_tag LOCUS_14000 gene rpsS 2966 3244 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF89 protein_id gnl|my_center|LOCUS_14000 3256 3600 gene locus_tag LOCUS_14010 gene rplV 3256 3600 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O85387 protein_id gnl|my_center|LOCUS_14010 3600 4292 gene locus_tag LOCUS_14020 gene rpsC 3600 4292 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC44 protein_id gnl|my_center|LOCUS_14020 4292 4705 gene locus_tag LOCUS_14030 gene rplP 4292 4705 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M9M9 protein_id gnl|my_center|LOCUS_14030 4711 4905 gene locus_tag LOCUS_14040 gene rpmC 4711 4905 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF29 protein_id gnl|my_center|LOCUS_14040 4909 5178 gene locus_tag LOCUS_14050 gene rpsQ 4909 5178 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87T04 protein_id gnl|my_center|LOCUS_14050 5192 5560 gene locus_tag LOCUS_14060 gene rplN 5192 5560 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK59 protein_id gnl|my_center|LOCUS_14060 5574 5891 gene locus_tag LOCUS_14070 gene rplX 5574 5891 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ER5 protein_id gnl|my_center|LOCUS_14070 5916 6455 gene locus_tag LOCUS_14080 gene rplE 5916 6455 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNZ6 protein_id gnl|my_center|LOCUS_14080 6484 6789 gene locus_tag LOCUS_14090 gene rpsN 6484 6789 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE8 protein_id gnl|my_center|LOCUS_14090 6824 7219 gene locus_tag LOCUS_14100 gene rpsH 6824 7219 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CQH1 protein_id gnl|my_center|LOCUS_14100 7248 7778 gene locus_tag LOCUS_14110 gene rplF 7248 7778 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K1I3 protein_id gnl|my_center|LOCUS_14110 7812 8168 gene locus_tag LOCUS_14120 gene rplR 7812 8168 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF1 protein_id gnl|my_center|LOCUS_14120 8188 8697 gene locus_tag LOCUS_14130 gene rpsE 8188 8697 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P721 protein_id gnl|my_center|LOCUS_14130 8708 8896 gene locus_tag LOCUS_14140 gene rpmD 8708 8896 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83EQ8 protein_id gnl|my_center|LOCUS_14140 8899 9333 gene locus_tag LOCUS_14150 gene rplO 8899 9333 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHU9 protein_id gnl|my_center|LOCUS_14150 9333 10673 gene locus_tag LOCUS_14160 gene secY 9333 10673 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P9K3 protein_id gnl|my_center|LOCUS_14160 10948 11304 gene locus_tag LOCUS_14170 gene rpsM 10948 11304 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JS04 protein_id gnl|my_center|LOCUS_14170 11311 11703 gene locus_tag LOCUS_14180 gene rpsK 11311 11703 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F5V0 protein_id gnl|my_center|LOCUS_14180 11820 12368 gene locus_tag LOCUS_14190 gene rpsD 11820 12368 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FKH0 protein_id gnl|my_center|LOCUS_14190 12410 13420 gene locus_tag LOCUS_14200 gene rpoA 12410 13420 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52760 protein_id gnl|my_center|LOCUS_14200 13425 13808 gene locus_tag LOCUS_14210 gene rplQ 13425 13808 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889U5 protein_id gnl|my_center|LOCUS_14210 13898 14632 gene locus_tag LOCUS_14220 13898 14632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389565.1 protein_id gnl|my_center|LOCUS_14220 15616 14795 gene locus_tag LOCUS_14230 15616 14795 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390517.1 protein_id gnl|my_center|LOCUS_14230 17338 15620 gene locus_tag LOCUS_14240 gene lpdA 17338 15620 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WEH2 protein_id gnl|my_center|LOCUS_14240 18693 17350 gene locus_tag LOCUS_14250 18693 17350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 21377 18711 gene locus_tag LOCUS_14260 gene aceE 21377 18711 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVD6 protein_id gnl|my_center|LOCUS_14260 24419 21576 gene locus_tag LOCUS_14270 gene uvrA 24419 21576 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMS2 protein_id gnl|my_center|LOCUS_14270 24568 25881 gene locus_tag LOCUS_14280 24568 25881 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400420.1 protein_id gnl|my_center|LOCUS_14280 25948 26409 gene locus_tag LOCUS_14290 25948 26409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 26940 26479 gene locus_tag LOCUS_14300 26940 26479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 >Feature sequence24 1608 463 gene locus_tag LOCUS_14310 1608 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141098.1 protein_id gnl|my_center|LOCUS_14310 2414 1608 gene locus_tag LOCUS_14320 2414 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 2555 4282 gene locus_tag LOCUS_14330 2555 4282 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920032.1 protein_id gnl|my_center|LOCUS_14330 5268 4393 gene locus_tag LOCUS_14340 5268 4393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14340 5558 5265 gene locus_tag LOCUS_14350 5558 5265 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945908.1 protein_id gnl|my_center|LOCUS_14350 6340 5870 gene locus_tag LOCUS_14360 6340 5870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 6639 7760 gene locus_tag LOCUS_14370 6639 7760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 8041 8205 gene locus_tag LOCUS_14380 8041 8205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 8207 9112 gene locus_tag LOCUS_14390 8207 9112 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14390 9215 10129 gene locus_tag LOCUS_14400 9215 10129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 10144 12246 gene locus_tag LOCUS_14410 10144 12246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 13253 12408 gene locus_tag LOCUS_14420 13253 12408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 13227 13730 gene locus_tag LOCUS_14430 13227 13730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 14148 15452 gene locus_tag LOCUS_14440 gene hisD 14148 15452 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QTY8 protein_id gnl|my_center|LOCUS_14440 15558 15740 gene locus_tag LOCUS_14450 15558 15740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 15764 16309 gene locus_tag LOCUS_14460 15764 16309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14460 16464 16745 gene locus_tag LOCUS_14470 16464 16745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582865.1 protein_id gnl|my_center|LOCUS_14470 16791 17966 gene locus_tag LOCUS_14480 16791 17966 CDS product D-galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460953.1 protein_id gnl|my_center|LOCUS_14480 20136 18073 gene locus_tag LOCUS_14490 20136 18073 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_14490 20945 20169 gene locus_tag LOCUS_14500 20945 20169 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WJ69 protein_id gnl|my_center|LOCUS_14500 21782 21024 gene locus_tag LOCUS_14510 gene cysH 21782 21024 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207530.1 protein_id gnl|my_center|LOCUS_14510 24983 22170 gene locus_tag LOCUS_14520 24983 22170 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937562.1 protein_id gnl|my_center|LOCUS_14520 >Feature sequence25 25 1188 gene locus_tag LOCUS_14530 25 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 1226 1151 gene locus_tag LOCUS_t00290 1226 1151 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1308 1233 gene locus_tag LOCUS_t00300 1308 1233 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1828 1752 gene locus_tag LOCUS_t00310 1828 1752 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2068 3996 gene locus_tag LOCUS_14540 gene htpG 2068 3996 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7W0M8 protein_id gnl|my_center|LOCUS_14540 5251 4121 gene locus_tag LOCUS_14550 5251 4121 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056459.1 protein_id gnl|my_center|LOCUS_14550 8036 5460 gene locus_tag LOCUS_14560 gene clpB 8036 5460 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUP3 protein_id gnl|my_center|LOCUS_14560 8823 8122 gene locus_tag LOCUS_14570 8823 8122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 9339 10112 gene locus_tag LOCUS_14580 gene nadC 9339 10112 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957378.1 protein_id gnl|my_center|LOCUS_14580 11071 10247 gene locus_tag LOCUS_14590 11071 10247 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQE6 protein_id gnl|my_center|LOCUS_14590 12113 11118 gene locus_tag LOCUS_14600 gene rluD 12113 11118 CDS product ribosomal large subunit pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S65 protein_id gnl|my_center|LOCUS_14600 12207 12968 gene locus_tag LOCUS_14610 gene bamD 12207 12968 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F9W0 protein_id gnl|my_center|LOCUS_14610 14694 13063 gene locus_tag LOCUS_14620 gene nadE 14694 13063 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815768.1 protein_id gnl|my_center|LOCUS_14620 14917 15624 gene locus_tag LOCUS_14630 gene aat 14917 15624 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M1 protein_id gnl|my_center|LOCUS_14630 15928 16122 gene locus_tag LOCUS_14640 gene infA 15928 16122 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRK8 protein_id gnl|my_center|LOCUS_14640 16744 16589 gene locus_tag LOCUS_14650 gene rpmG 16744 16589 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FL97 protein_id gnl|my_center|LOCUS_14650 17011 16775 gene locus_tag LOCUS_14660 gene rpmB 17011 16775 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62HM5 protein_id gnl|my_center|LOCUS_14660 17126 16962 gene locus_tag LOCUS_14670 17126 16962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 17815 17123 gene locus_tag LOCUS_14680 17815 17123 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTN5 protein_id gnl|my_center|LOCUS_14680 17902 18366 gene locus_tag LOCUS_14690 gene dut 17902 18366 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EN46 protein_id gnl|my_center|LOCUS_14690 18544 21366 gene locus_tag LOCUS_14700 gene sucA 18544 21366 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168018.1 protein_id gnl|my_center|LOCUS_14700 21356 22606 gene locus_tag LOCUS_14710 gene sucB 21356 22606 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZY40 protein_id gnl|my_center|LOCUS_14710 22619 24052 gene locus_tag LOCUS_14720 gene lpdG 22619 24052 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D1 protein_id gnl|my_center|LOCUS_14720 >Feature sequence26 1614 904 gene locus_tag LOCUS_14730 1614 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 3090 1693 gene locus_tag LOCUS_14740 gene pntB 3090 1693 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSB4 protein_id gnl|my_center|LOCUS_14740 3399 3115 gene locus_tag LOCUS_14750 3399 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 4547 3414 gene locus_tag LOCUS_14760 gene pntAA 4547 3414 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112662.1 protein_id gnl|my_center|LOCUS_14760 5138 6115 gene locus_tag LOCUS_14770 gene prfB 5138 6115 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A290 protein_id gnl|my_center|LOCUS_14770 6176 7678 gene locus_tag LOCUS_14780 gene lysS 6176 7678 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPL4 protein_id gnl|my_center|LOCUS_14780 7675 8922 gene locus_tag LOCUS_14790 7675 8922 CDS product lipoprotein releasing system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191984.1 protein_id gnl|my_center|LOCUS_14790 8979 9596 gene locus_tag LOCUS_14800 gene lolD 8979 9596 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62J04 protein_id gnl|my_center|LOCUS_14800 10219 9692 gene locus_tag LOCUS_14810 10219 9692 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706585.1 protein_id gnl|my_center|LOCUS_14810 10290 12677 gene locus_tag LOCUS_14820 10290 12677 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540034.1 protein_id gnl|my_center|LOCUS_14820 12851 13792 gene locus_tag LOCUS_14830 gene lpxK 12851 13792 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83D83 protein_id gnl|my_center|LOCUS_14830 13803 14555 gene locus_tag LOCUS_14840 gene kdsB 13803 14555 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87R14 protein_id gnl|my_center|LOCUS_14840 14589 15104 gene locus_tag LOCUS_14850 14589 15104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 15104 15589 gene locus_tag LOCUS_14860 gene ptpA 15104 15589 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812465.1 protein_id gnl|my_center|LOCUS_14860 16205 15642 gene locus_tag LOCUS_14870 gene efp 16205 15642 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3I2 protein_id gnl|my_center|LOCUS_14870 16315 16956 gene locus_tag LOCUS_14880 16315 16956 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 protein_id gnl|my_center|LOCUS_14880 16953 18785 gene locus_tag LOCUS_14890 gene uvrC 16953 18785 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0Q1 protein_id gnl|my_center|LOCUS_14890 18828 19436 gene locus_tag LOCUS_14900 gene pgsA 18828 19436 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957964.1 protein_id gnl|my_center|LOCUS_14900 19501 19576 gene locus_tag LOCUS_t00320 19501 19576 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 19650 19723 gene locus_tag LOCUS_t00330 19650 19723 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 19990 21207 gene locus_tag LOCUS_14910 19990 21207 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938819.1 protein_id gnl|my_center|LOCUS_14910 21319 21852 gene locus_tag LOCUS_14920 21319 21852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 21959 22147 gene locus_tag LOCUS_14930 21959 22147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 22150 22461 gene locus_tag LOCUS_14940 22150 22461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 22452 23933 gene locus_tag LOCUS_14950 22452 23933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 >Feature sequence27 <1 671 gene locus_tag LOCUS_14960 <1 671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971231.1:proline/glycine betaine ABC transporter ATP-binding protein 675 1448 gene locus_tag LOCUS_14970 675 1448 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267485.1 protein_id gnl|my_center|LOCUS_14970 1690 2094 gene locus_tag LOCUS_14980 1690 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 2102 2737 gene locus_tag LOCUS_14990 2102 2737 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106022.1 protein_id gnl|my_center|LOCUS_14990 3550 2891 gene locus_tag LOCUS_15000 3550 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201153.1 protein_id gnl|my_center|LOCUS_15000 4084 3611 gene locus_tag LOCUS_15010 4084 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 5235 4120 gene locus_tag LOCUS_15020 gene ald 5235 4120 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PU16 protein_id gnl|my_center|LOCUS_15020 8289 5833 gene locus_tag LOCUS_15030 8289 5833 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708705.1 protein_id gnl|my_center|LOCUS_15030 8621 10126 gene locus_tag LOCUS_15040 gene mmsA-1 8621 10126 CDS product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704254.1 protein_id gnl|my_center|LOCUS_15040 10555 11271 gene locus_tag LOCUS_15050 10555 11271 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970528.1 protein_id gnl|my_center|LOCUS_15050 11313 12233 gene locus_tag LOCUS_15060 11313 12233 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528466.1 protein_id gnl|my_center|LOCUS_15060 12958 12266 gene locus_tag LOCUS_15070 12958 12266 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705577.1 protein_id gnl|my_center|LOCUS_15070 13654 12968 gene locus_tag LOCUS_15080 13654 12968 CDS product histidine/lysine/arginine/ornithine ABC transporter permease HisQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705576.1 protein_id gnl|my_center|LOCUS_15080 14503 13727 gene locus_tag LOCUS_15090 14503 13727 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705575.1 protein_id gnl|my_center|LOCUS_15090 15376 14606 gene locus_tag LOCUS_15100 15376 14606 CDS product histidine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705574.1 protein_id gnl|my_center|LOCUS_15100 15882 15373 gene locus_tag LOCUS_15110 15882 15373 CDS product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035710.1 protein_id gnl|my_center|LOCUS_15110 16329 18020 gene locus_tag LOCUS_15120 16329 18020 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_15120 18295 19965 gene locus_tag LOCUS_15130 18295 19965 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389659.1 protein_id gnl|my_center|LOCUS_15130 20428 22593 gene locus_tag LOCUS_15140 20428 22593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 >Feature sequence28 322 903 gene locus_tag LOCUS_15150 322 903 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868483.1 protein_id gnl|my_center|LOCUS_15150 897 2153 gene locus_tag LOCUS_15160 gene porA 897 2153 CDS product 2-ketoisovalerate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020091.1 protein_id gnl|my_center|LOCUS_15160 2165 3154 gene locus_tag LOCUS_15170 2165 3154 CDS product pyruvate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020090.1 protein_id gnl|my_center|LOCUS_15170 3151 4788 gene locus_tag LOCUS_15180 3151 4788 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705394.1 protein_id gnl|my_center|LOCUS_15180 5021 6040 gene locus_tag LOCUS_15190 5021 6040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 6119 7183 gene locus_tag LOCUS_15200 gene phbC 6119 7183 CDS product poly-beta-hydroxybutyrate polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037305.1 protein_id gnl|my_center|LOCUS_15200 7259 8446 gene locus_tag LOCUS_15210 gene phbA 7259 8446 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527150.1 protein_id gnl|my_center|LOCUS_15210 8476 9213 gene locus_tag LOCUS_15220 gene phbB 8476 9213 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037438.1 protein_id gnl|my_center|LOCUS_15220 9255 9716 gene locus_tag LOCUS_15230 9255 9716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637650.2 protein_id gnl|my_center|LOCUS_15230 9794 9958 gene locus_tag LOCUS_15240 9794 9958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 10769 10014 gene locus_tag LOCUS_15250 gene phbB-1 10769 10014 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193701.1 protein_id gnl|my_center|LOCUS_15250 11307 10894 gene locus_tag LOCUS_15260 11307 10894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 12164 11565 gene locus_tag LOCUS_15270 12164 11565 CDS product electron transporter SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391107.1 protein_id gnl|my_center|LOCUS_15270 12775 12305 gene locus_tag LOCUS_15280 12775 12305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263638.1 protein_id gnl|my_center|LOCUS_15280 12830 13093 gene locus_tag LOCUS_15290 12830 13093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 14280 13078 gene locus_tag LOCUS_15300 14280 13078 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931214.1 protein_id gnl|my_center|LOCUS_15300 14473 14922 gene locus_tag LOCUS_15310 gene arsC 14473 14922 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880408.1 protein_id gnl|my_center|LOCUS_15310 15089 15598 gene locus_tag LOCUS_15320 15089 15598 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014038.1 protein_id gnl|my_center|LOCUS_15320 16223 15642 gene locus_tag LOCUS_15330 16223 15642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036287.1 protein_id gnl|my_center|LOCUS_15330 18019 16358 gene locus_tag LOCUS_15340 18019 16358 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882029.1 protein_id gnl|my_center|LOCUS_15340 18886 18245 gene locus_tag LOCUS_15350 18886 18245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389165.1 protein_id gnl|my_center|LOCUS_15350 20309 18879 gene locus_tag LOCUS_15360 20309 18879 CDS product iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216936.1 protein_id gnl|my_center|LOCUS_15360 21051 20296 gene locus_tag LOCUS_15370 21051 20296 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389167.1 protein_id gnl|my_center|LOCUS_15370 21812 21051 gene locus_tag LOCUS_15380 21812 21051 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095221.1 protein_id gnl|my_center|LOCUS_15380 >Feature sequence29 <1 449 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctctaacttcccttcaaaactgcg 493 1554 gene locus_tag LOCUS_15390 493 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 5425 1658 gene locus_tag LOCUS_15400 5425 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 5905 5813 gene locus_tag LOCUS_t00340 5905 5813 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6163 5963 gene locus_tag LOCUS_15410 gene csrA2 6163 5963 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CQ8 protein_id gnl|my_center|LOCUS_15410 7495 6266 gene locus_tag LOCUS_15420 gene lysC 7495 6266 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69077 protein_id gnl|my_center|LOCUS_15420 10209 7603 gene locus_tag LOCUS_15430 gene alaS 10209 7603 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I553 protein_id gnl|my_center|LOCUS_15430 10684 10217 gene locus_tag LOCUS_15440 10684 10217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 11729 10710 gene locus_tag LOCUS_15450 gene recA 11729 10710 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUJ7 protein_id gnl|my_center|LOCUS_15450 12370 11876 gene locus_tag LOCUS_15460 12370 11876 CDS product competence damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036895.1 protein_id gnl|my_center|LOCUS_15460 12549 14078 gene locus_tag LOCUS_15470 12549 14078 CDS product trimethylamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531176.1 protein_id gnl|my_center|LOCUS_15470 14431 14715 gene locus_tag LOCUS_15480 14431 14715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 14990 15748 gene locus_tag LOCUS_15490 14990 15748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 15783 16226 gene locus_tag LOCUS_15500 15783 16226 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256727.1 protein_id gnl|my_center|LOCUS_15500 16325 16555 gene locus_tag LOCUS_15510 16325 16555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 17263 18804 gene locus_tag LOCUS_15520 17263 18804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 >Feature sequence30 1509 703 gene locus_tag LOCUS_15530 1509 703 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532964.1 protein_id gnl|my_center|LOCUS_15530 2328 1528 gene locus_tag LOCUS_15540 gene panB 2328 1528 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R49 protein_id gnl|my_center|LOCUS_15540 2999 2340 gene locus_tag LOCUS_15550 2999 2340 CDS product deoxyguanosine kinase/deoxyadenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532195.1 protein_id gnl|my_center|LOCUS_15550 3134 3709 gene locus_tag LOCUS_15560 3134 3709 CDS product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83D36 protein_id gnl|my_center|LOCUS_15560 3709 4008 gene locus_tag LOCUS_15570 3709 4008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767703.1 protein_id gnl|my_center|LOCUS_15570 4005 4268 gene locus_tag LOCUS_15580 4005 4268 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140693.1 protein_id gnl|my_center|LOCUS_15580 6931 4265 gene locus_tag LOCUS_15590 6931 4265 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHM1 protein_id gnl|my_center|LOCUS_15590 7121 9049 gene locus_tag LOCUS_15600 7121 9049 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066909.1 protein_id gnl|my_center|LOCUS_15600 11126 9153 gene locus_tag LOCUS_15610 gene ligA 11126 9153 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIF8 protein_id gnl|my_center|LOCUS_15610 12388 11171 gene locus_tag LOCUS_15620 12388 11171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 15888 12388 gene locus_tag LOCUS_15630 gene smc 15888 12388 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3I6 protein_id gnl|my_center|LOCUS_15630 >Feature sequence31 2238 136 gene locus_tag LOCUS_15640 gene fusA 2238 136 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ES7 protein_id gnl|my_center|LOCUS_15640 2755 2285 gene locus_tag LOCUS_15650 gene rpsG 2755 2285 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PAD3 protein_id gnl|my_center|LOCUS_15650 3277 2903 gene locus_tag LOCUS_15660 gene rpsL 3277 2903 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYP8 protein_id gnl|my_center|LOCUS_15660 7699 3404 gene locus_tag LOCUS_15670 gene rpoC 7699 3404 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC9 protein_id gnl|my_center|LOCUS_15670 11881 7790 gene locus_tag LOCUS_15680 gene rpoB 11881 7790 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYQ0 protein_id gnl|my_center|LOCUS_15680 12413 12030 gene locus_tag LOCUS_15690 gene rplL 12413 12030 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q727C8 protein_id gnl|my_center|LOCUS_15690 12997 12473 gene locus_tag LOCUS_15700 gene rplJ 12997 12473 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MA40 protein_id gnl|my_center|LOCUS_15700 13881 13192 gene locus_tag LOCUS_15710 gene rplA 13881 13192 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q00 protein_id gnl|my_center|LOCUS_15710 14316 13885 gene locus_tag LOCUS_15720 gene rplK 14316 13885 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PAE2 protein_id gnl|my_center|LOCUS_15720 14956 14402 gene locus_tag LOCUS_15730 gene nusG 14956 14402 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQB0 protein_id gnl|my_center|LOCUS_15730 15319 14972 gene locus_tag LOCUS_15740 gene secE 15319 14972 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ET6 protein_id gnl|my_center|LOCUS_15740 15427 15352 gene locus_tag LOCUS_t00350 15427 15352 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence32 1307 468 gene locus_tag LOCUS_15750 1307 468 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393407.1 protein_id gnl|my_center|LOCUS_15750 1898 1605 gene locus_tag LOCUS_15760 1898 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 2378 1911 gene locus_tag LOCUS_15770 2378 1911 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878502.1 protein_id gnl|my_center|LOCUS_15770 3591 2554 gene locus_tag LOCUS_15780 3591 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 6474 3781 gene locus_tag LOCUS_15790 gene polA 6474 3781 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175760.1 protein_id gnl|my_center|LOCUS_15790 6591 7307 gene locus_tag LOCUS_15800 6591 7307 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WCD0 protein_id gnl|my_center|LOCUS_15800 7322 8293 gene locus_tag LOCUS_15810 gene thrB 7322 8293 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4W557 protein_id gnl|my_center|LOCUS_15810 8692 9630 gene locus_tag LOCUS_15820 8692 9630 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582557.1 protein_id gnl|my_center|LOCUS_15820 9761 10843 gene locus_tag LOCUS_15830 gene serC 9761 10843 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80862 protein_id gnl|my_center|LOCUS_15830 10861 12147 gene locus_tag LOCUS_15840 10861 12147 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121162.1 protein_id gnl|my_center|LOCUS_15840 12128 12736 gene locus_tag LOCUS_15850 12128 12736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021157.1 protein_id gnl|my_center|LOCUS_15850 14962 12809 gene locus_tag LOCUS_15860 gene uvrD 14962 12809 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NFB5 protein_id gnl|my_center|LOCUS_15860 >Feature sequence33 246 1412 gene locus_tag LOCUS_15870 246 1412 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086701.1 protein_id gnl|my_center|LOCUS_15870 1425 3008 gene locus_tag LOCUS_15880 1425 3008 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087479.1 protein_id gnl|my_center|LOCUS_15880 3005 3553 gene locus_tag LOCUS_15890 3005 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15890 3550 3957 gene locus_tag LOCUS_15900 3550 3957 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974192.1 protein_id gnl|my_center|LOCUS_15900 4476 4078 gene locus_tag LOCUS_15910 4476 4078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 4810 5253 gene locus_tag LOCUS_15920 4810 5253 CDS product cytochrome c' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P00144 protein_id gnl|my_center|LOCUS_15920 5324 6157 gene locus_tag LOCUS_15930 5324 6157 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088649.1 protein_id gnl|my_center|LOCUS_15930 8015 6171 gene locus_tag LOCUS_15940 gene ilvD1 8015 6171 CDS product dihydroxy-acid dehydratase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89LK8 protein_id gnl|my_center|LOCUS_15940 8868 8104 gene locus_tag LOCUS_15950 8868 8104 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383303.1 protein_id gnl|my_center|LOCUS_15950 10156 9005 gene locus_tag LOCUS_15960 gene ispG 10156 9005 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWC8 protein_id gnl|my_center|LOCUS_15960 10445 11176 gene locus_tag LOCUS_15970 10445 11176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 11173 11919 gene locus_tag LOCUS_15980 11173 11919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15980 12012 12087 gene locus_tag LOCUS_t00360 12012 12087 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 12329 13537 gene locus_tag LOCUS_15990 gene int 12329 13537 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338075.1 protein_id gnl|my_center|LOCUS_15990 13650 14282 gene locus_tag LOCUS_16000 13650 14282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 14353 14625 gene locus_tag LOCUS_16010 14353 14625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 14629 14811 gene locus_tag LOCUS_16020 14629 14811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 >Feature sequence34 376 62 gene locus_tag LOCUS_16030 376 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 1666 443 gene locus_tag LOCUS_16040 gene lapB 1666 443 CDS product lipopolysaccharide assembly protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E07 protein_id gnl|my_center|LOCUS_16040 1971 1666 gene locus_tag LOCUS_16050 1971 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 2420 2139 gene locus_tag LOCUS_16060 gene ihfB 2420 2139 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8P6 protein_id gnl|my_center|LOCUS_16060 4127 2445 gene locus_tag LOCUS_16070 gene rpsA 4127 2445 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ71 protein_id gnl|my_center|LOCUS_16070 4853 4179 gene locus_tag LOCUS_16080 gene cmk 4853 4179 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8P4 protein_id gnl|my_center|LOCUS_16080 6172 4850 gene locus_tag LOCUS_16090 6172 4850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16090 7068 6178 gene locus_tag LOCUS_16100 7068 6178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 8184 7075 gene locus_tag LOCUS_16110 gene hisC2 8184 7075 CDS product histidinol-phosphate aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q57004 protein_id gnl|my_center|LOCUS_16110 9269 8181 gene locus_tag LOCUS_16120 9269 8181 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404232.1 protein_id gnl|my_center|LOCUS_16120 10443 9286 gene locus_tag LOCUS_16130 10443 9286 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958401.1 protein_id gnl|my_center|LOCUS_16130 13133 10578 gene locus_tag LOCUS_16140 gene gyrA 13133 10578 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVM3 protein_id gnl|my_center|LOCUS_16140 <14038 13334 gene locus_tag LOCUS_16150 <14038 13334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZQ92:methylthioribose-1-phosphate isomerase >Feature sequence35 19 1458 gene locus_tag LOCUS_16160 gene dht 19 1458 CDS product D-hydantoinase/dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I676 protein_id gnl|my_center|LOCUS_16160 1576 2934 gene locus_tag LOCUS_16170 1576 2934 CDS product dihydropyrimidine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530893.1 protein_id gnl|my_center|LOCUS_16170 2949 4250 gene locus_tag LOCUS_16180 2949 4250 CDS product dihydropyrimidine dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338051.1 protein_id gnl|my_center|LOCUS_16180 4309 5601 gene locus_tag LOCUS_16190 4309 5601 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222142.1 protein_id gnl|my_center|LOCUS_16190 5620 6528 gene locus_tag LOCUS_16200 5620 6528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087083.1 protein_id gnl|my_center|LOCUS_16200 6575 6865 gene locus_tag LOCUS_16210 6575 6865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 6955 8334 gene locus_tag LOCUS_16220 6955 8334 CDS product pyridoxal-5'-phosphate-dependent protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_16220 8538 10211 gene locus_tag LOCUS_16230 8538 10211 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065145.1 protein_id gnl|my_center|LOCUS_16230 10208 10408 gene locus_tag LOCUS_16240 10208 10408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 10773 10411 gene locus_tag LOCUS_16250 10773 10411 CDS product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44956 protein_id gnl|my_center|LOCUS_16250 10914 11906 gene locus_tag LOCUS_16260 gene yhfP 10914 11906 CDS product putative quinone oxidoreductase YhfP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07615 protein_id gnl|my_center|LOCUS_16260 12451 11981 gene locus_tag LOCUS_16270 12451 11981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 >Feature sequence36 1851 2756 gene locus_tag LOCUS_16280 1851 2756 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088085.1 protein_id gnl|my_center|LOCUS_16280 3030 3599 gene locus_tag LOCUS_16290 3030 3599 CDS product putative 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UAN8 protein_id gnl|my_center|LOCUS_16290 3600 4136 gene locus_tag LOCUS_16300 3600 4136 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJJ7 protein_id gnl|my_center|LOCUS_16300 4859 4149 gene locus_tag LOCUS_16310 gene alaS2 4859 4149 CDS product serine-tRNA(Ala) deacylase AlaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708040.1 protein_id gnl|my_center|LOCUS_16310 6396 5059 gene locus_tag LOCUS_16320 6396 5059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 6701 7621 gene locus_tag LOCUS_16330 6701 7621 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086663.1 protein_id gnl|my_center|LOCUS_16330 7988 9403 gene locus_tag LOCUS_16340 7988 9403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 11283 9604 gene locus_tag LOCUS_16350 11283 9604 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6W1I0 protein_id gnl|my_center|LOCUS_16350 11499 12380 gene locus_tag LOCUS_16360 gene lsrF 11499 12380 CDS product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XZ79 protein_id gnl|my_center|LOCUS_16360 12444 12797 gene locus_tag LOCUS_16370 12444 12797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 >Feature sequence37 1443 466 gene locus_tag LOCUS_16380 gene rfaF 1443 466 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958358.1 protein_id gnl|my_center|LOCUS_16380 1709 1491 gene locus_tag LOCUS_16390 1709 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 2648 1728 gene locus_tag LOCUS_16400 gene ilvE 2648 1728 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86428 protein_id gnl|my_center|LOCUS_16400 5608 2723 gene locus_tag LOCUS_16410 gene glnE 5608 2723 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUF4 protein_id gnl|my_center|LOCUS_16410 7608 5947 gene locus_tag LOCUS_16420 gene groL 7608 5947 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD23 protein_id gnl|my_center|LOCUS_16420 7949 7659 gene locus_tag LOCUS_16430 gene groS 7949 7659 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXP4 protein_id gnl|my_center|LOCUS_16430 8516 8076 gene locus_tag LOCUS_16440 gene fxsA 8516 8076 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483998.1 protein_id gnl|my_center|LOCUS_16440 9327 8536 gene locus_tag LOCUS_16450 9327 8536 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391124.1 protein_id gnl|my_center|LOCUS_16450 9417 10370 gene locus_tag LOCUS_16460 9417 10370 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038567.1 protein_id gnl|my_center|LOCUS_16460 11235 10552 gene locus_tag LOCUS_16470 11235 10552 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897325.1 protein_id gnl|my_center|LOCUS_16470 12019 11255 gene locus_tag LOCUS_16480 12019 11255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 >Feature sequence38 956 141 gene locus_tag LOCUS_16490 956 141 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103280.1 protein_id gnl|my_center|LOCUS_16490 1192 992 gene locus_tag LOCUS_16500 gene rpmE 1192 992 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83D39 protein_id gnl|my_center|LOCUS_16500 2692 1430 gene locus_tag LOCUS_16510 gene rho 2692 1430 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83A25 protein_id gnl|my_center|LOCUS_16510 3179 2856 gene locus_tag LOCUS_16520 gene trxA 3179 2856 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X2T1 protein_id gnl|my_center|LOCUS_16520 3472 5013 gene locus_tag LOCUS_16530 gene rhlB 3472 5013 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4D4 protein_id gnl|my_center|LOCUS_16530 6820 5066 gene locus_tag LOCUS_16540 6820 5066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 6901 8160 gene locus_tag LOCUS_16550 6901 8160 CDS product O-antigen biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816144.1 protein_id gnl|my_center|LOCUS_16550 8157 9944 gene locus_tag LOCUS_16560 gene msbA 8157 9944 CDS product lipid A export ATP-binding/permease protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUG8 protein_id gnl|my_center|LOCUS_16560 11009 10083 gene locus_tag LOCUS_16570 gene lpxL 11009 10083 CDS product lipid A biosynthesis lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ8 protein_id gnl|my_center|LOCUS_16570 <11848 11015 gene locus_tag LOCUS_16580 <11848 11015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012544967.1:UDP-glucose 4-epimerase GalE >Feature sequence39 715 3513 gene locus_tag LOCUS_16590 715 3513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 3832 5037 gene locus_tag LOCUS_16600 3832 5037 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921004.1 protein_id gnl|my_center|LOCUS_16600 5220 4996 gene locus_tag LOCUS_16610 5220 4996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 5257 5925 gene locus_tag LOCUS_16620 5257 5925 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704163.1 protein_id gnl|my_center|LOCUS_16620 5925 7373 gene locus_tag LOCUS_16630 5925 7373 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704162.1 protein_id gnl|my_center|LOCUS_16630 7476 8723 gene locus_tag LOCUS_16640 7476 8723 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091472.1 protein_id gnl|my_center|LOCUS_16640 8806 9720 gene locus_tag LOCUS_16650 8806 9720 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091471.1 protein_id gnl|my_center|LOCUS_16650 9713 10585 gene locus_tag LOCUS_16660 9713 10585 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185577.1 protein_id gnl|my_center|LOCUS_16660 >Feature sequence40 184 591 gene locus_tag LOCUS_16670 184 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 1678 710 gene locus_tag LOCUS_16680 1678 710 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083692.1 protein_id gnl|my_center|LOCUS_16680 1853 1779 gene locus_tag LOCUS_t00370 1853 1779 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2391 2179 gene locus_tag LOCUS_16690 2391 2179 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065663.1 protein_id gnl|my_center|LOCUS_16690 2757 2566 gene locus_tag LOCUS_16700 2757 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 2688 4100 gene locus_tag LOCUS_16710 gene gltX1 2688 4100 CDS product glutamate--tRNA ligase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83EV3 protein_id gnl|my_center|LOCUS_16710 4137 4212 gene locus_tag LOCUS_t00380 4137 4212 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4247 4323 gene locus_tag LOCUS_t00390 4247 4323 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4490 5722 gene locus_tag LOCUS_16720 4490 5722 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703417.1 protein_id gnl|my_center|LOCUS_16720 5959 6339 gene locus_tag LOCUS_16730 5959 6339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 6466 7260 gene locus_tag LOCUS_16740 6466 7260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 7408 7253 gene locus_tag LOCUS_16750 7408 7253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 7353 7586 gene locus_tag LOCUS_16760 7353 7586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 7579 9852 gene locus_tag LOCUS_16770 7579 9852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 9852 10229 gene locus_tag LOCUS_16780 9852 10229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 10210 10440 gene locus_tag LOCUS_16790 10210 10440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 10485 10967 gene locus_tag LOCUS_16800 10485 10967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 >Feature sequence41 163 1140 gene locus_tag LOCUS_16810 gene deoC 163 1140 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CW11 protein_id gnl|my_center|LOCUS_16810 1146 3524 gene locus_tag LOCUS_16820 1146 3524 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887384.1 protein_id gnl|my_center|LOCUS_16820 3517 4854 gene locus_tag LOCUS_16830 gene deoA 3517 4854 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPE3 protein_id gnl|my_center|LOCUS_16830 4856 6073 gene locus_tag LOCUS_16840 gene deoB 4856 6073 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJ99 protein_id gnl|my_center|LOCUS_16840 6070 6240 gene locus_tag LOCUS_16850 6070 6240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 6215 7192 gene locus_tag LOCUS_16860 gene add 6215 7192 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946317.1 protein_id gnl|my_center|LOCUS_16860 7355 8383 gene locus_tag LOCUS_16870 7355 8383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 >Feature sequence42 1068 2024 gene locus_tag LOCUS_16880 gene trxB 1068 2024 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FW4 protein_id gnl|my_center|LOCUS_16880 2024 2566 gene locus_tag LOCUS_16890 2024 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 3084 2608 gene locus_tag LOCUS_16900 gene ispF 3084 2608 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747A0 protein_id gnl|my_center|LOCUS_16900 3797 3081 gene locus_tag LOCUS_16910 gene ispD 3797 3081 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57707 protein_id gnl|my_center|LOCUS_16910 4102 7482 gene locus_tag LOCUS_16920 gene mfd 4102 7482 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK3 protein_id gnl|my_center|LOCUS_16920 8004 7483 gene locus_tag LOCUS_16930 gene def1 8004 7483 CDS product peptide deformylase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7W0Q0 protein_id gnl|my_center|LOCUS_16930 8144 8743 gene locus_tag LOCUS_16940 8144 8743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 >Feature sequence43 514 1029 gene locus_tag LOCUS_16950 514 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 1140 1982 gene locus_tag LOCUS_16960 1140 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 2089 2361 gene locus_tag LOCUS_16970 2089 2361 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369179.1 protein_id gnl|my_center|LOCUS_16970 2354 4354 gene locus_tag LOCUS_16980 2354 4354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 4399 6672 gene locus_tag LOCUS_16990 4399 6672 CDS product guanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090647.1 protein_id gnl|my_center|LOCUS_16990 >Feature sequence44 <1 771 gene locus_tag LOCUS_17000 <1 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704627.1:transporter 784 993 gene locus_tag LOCUS_17010 784 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 990 1526 gene locus_tag LOCUS_17020 990 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 2306 1605 gene locus_tag LOCUS_17030 2306 1605 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266959.1 protein_id gnl|my_center|LOCUS_17030 4203 2296 gene locus_tag LOCUS_17040 gene yoaA 4203 2296 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262264.1 protein_id gnl|my_center|LOCUS_17040 5065 4187 gene locus_tag LOCUS_17050 5065 4187 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266715.1 protein_id gnl|my_center|LOCUS_17050 5614 5072 gene locus_tag LOCUS_17060 gene rmlC 5614 5072 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU21 protein_id gnl|my_center|LOCUS_17060 7028 5895 gene locus_tag LOCUS_17070 gene dnaJ 7028 5895 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV44 protein_id gnl|my_center|LOCUS_17070 <8237 7155 gene locus_tag LOCUS_17080 <8237 7155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O87712:chaperone protein DnaK >Feature sequence45 3665 1245 gene locus_tag LOCUS_17090 3665 1245 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533447.1 protein_id gnl|my_center|LOCUS_17090 5101 3662 gene locus_tag LOCUS_17100 5101 3662 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976326.1 protein_id gnl|my_center|LOCUS_17100 5525 6697 gene locus_tag LOCUS_17110 5525 6697 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256286.1 protein_id gnl|my_center|LOCUS_17110 >Feature sequence46 771 1670 gene locus_tag LOCUS_17120 gene argF 771 1670 CDS product ornithine carbamoyltransferase, catabolic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGE2 protein_id gnl|my_center|LOCUS_17120 2576 1707 gene locus_tag LOCUS_17130 gene rpoH 2576 1707 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H9L4M9 protein_id gnl|my_center|LOCUS_17130 3862 2933 gene locus_tag LOCUS_17140 3862 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 4014 4595 gene locus_tag LOCUS_17150 4014 4595 CDS product ribosomal RNA small subunit methyltransferase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF77 protein_id gnl|my_center|LOCUS_17150 4666 5151 gene locus_tag LOCUS_17160 gene coaD 4666 5151 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEN4 protein_id gnl|my_center|LOCUS_17160 5185 5433 gene locus_tag LOCUS_17170 gene fdx1 5185 5433 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084462.1 protein_id gnl|my_center|LOCUS_17170 6586 6395 gene locus_tag LOCUS_17180 6586 6395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 6683 7360 gene locus_tag LOCUS_17190 6683 7360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 7797 7357 gene locus_tag LOCUS_17200 7797 7357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 >Feature sequence47 417 734 gene locus_tag LOCUS_17210 417 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 1826 858 gene locus_tag LOCUS_17220 gene dusA 1826 858 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUX9 protein_id gnl|my_center|LOCUS_17220 2282 1863 gene locus_tag LOCUS_17230 2282 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958049.1 protein_id gnl|my_center|LOCUS_17230 2447 4015 gene locus_tag LOCUS_17240 gene gshA 2447 4015 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTY6 protein_id gnl|my_center|LOCUS_17240 5018 4101 gene locus_tag LOCUS_17250 gene gshB 5018 4101 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NF44 protein_id gnl|my_center|LOCUS_17250 6018 5086 gene locus_tag LOCUS_17260 6018 5086 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390826.1 protein_id gnl|my_center|LOCUS_17260 6767 6018 gene locus_tag LOCUS_17270 gene etfB 6767 6018 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53575 protein_id gnl|my_center|LOCUS_17270 >Feature sequence48 2071 173 gene locus_tag LOCUS_17280 2071 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 2560 3405 gene locus_tag LOCUS_17290 2560 3405 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087972.1 protein_id gnl|my_center|LOCUS_17290 3463 5499 gene locus_tag LOCUS_17300 3463 5499 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267166.1 protein_id gnl|my_center|LOCUS_17300 5540 6574 gene locus_tag LOCUS_17310 gene oruR 5540 6574 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207597.1 protein_id gnl|my_center|LOCUS_17310 >Feature sequence49 198 1094 gene locus_tag LOCUS_17320 gene xerD 198 1094 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXQ6 protein_id gnl|my_center|LOCUS_17320 1110 2471 gene locus_tag LOCUS_17330 gene ffh 1110 2471 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH73 protein_id gnl|my_center|LOCUS_17330 2767 3105 gene locus_tag LOCUS_17340 2767 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 3244 3393 gene locus_tag LOCUS_17350 3244 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 3553 3795 gene locus_tag LOCUS_17360 gene rpsP 3553 3795 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LS8 protein_id gnl|my_center|LOCUS_17360 3819 4328 gene locus_tag LOCUS_17370 gene rimM 3819 4328 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH71 protein_id gnl|my_center|LOCUS_17370 4383 4733 gene locus_tag LOCUS_17380 gene rplS 4383 4733 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG26 protein_id gnl|my_center|LOCUS_17380 4861 5547 gene locus_tag LOCUS_17390 gene trmD 4861 5547 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXQ1 protein_id gnl|my_center|LOCUS_17390 >Feature sequence50 777 310 gene locus_tag LOCUS_17400 777 310 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880874.1 protein_id gnl|my_center|LOCUS_17400 2452 782 gene locus_tag LOCUS_17410 gene recN 2452 782 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WN8 protein_id gnl|my_center|LOCUS_17410 3313 2456 gene locus_tag LOCUS_17420 gene nadK 3313 2456 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YK2 protein_id gnl|my_center|LOCUS_17420 3480 4538 gene locus_tag LOCUS_17430 gene hrcA 3480 4538 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R42 protein_id gnl|my_center|LOCUS_17430 4685 5296 gene locus_tag LOCUS_17440 gene grpE 4685 5296 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMI7 protein_id gnl|my_center|LOCUS_17440 >Feature sequence51 1560 82 gene locus_tag LOCUS_17450 1560 82 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528279.1 protein_id gnl|my_center|LOCUS_17450 3104 1878 gene locus_tag LOCUS_17460 gene argD 3104 1878 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5Q4 protein_id gnl|my_center|LOCUS_17460 4299 3163 gene locus_tag LOCUS_17470 gene dapE 4299 3163 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4H5 protein_id gnl|my_center|LOCUS_17470 >Feature sequence52 1654 1391 gene locus_tag LOCUS_17480 1654 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 1716 2165 gene locus_tag LOCUS_17490 1716 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 2167 2901 gene locus_tag LOCUS_17500 2167 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 3557 2982 gene locus_tag LOCUS_17510 3557 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 4542 3577 gene locus_tag LOCUS_17520 4542 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 <5500 4612 gene locus_tag LOCUS_17530 <5500 4612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H2WF11:50S ribosomal protein L3 glutamine methyltransferase >Feature sequence53 98 847 gene locus_tag LOCUS_17540 98 847 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089900.1 protein_id gnl|my_center|LOCUS_17540 1329 2825 gene locus_tag LOCUS_17550 1329 2825 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919511.1 protein_id gnl|my_center|LOCUS_17550 2822 3250 gene locus_tag LOCUS_17560 2822 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 4906 3422 gene locus_tag LOCUS_17570 4906 3422 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MQ0 protein_id gnl|my_center|LOCUS_17570 >Feature sequence54 260 129 gene locus_tag LOCUS_17580 260 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 245 1210 gene locus_tag LOCUS_17590 245 1210 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089324.1 protein_id gnl|my_center|LOCUS_17590 2168 1515 gene locus_tag LOCUS_17600 2168 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 2524 2165 gene locus_tag LOCUS_17610 2524 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 3243 3779 gene locus_tag LOCUS_17620 3243 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230876.1 protein_id gnl|my_center|LOCUS_17620 4009 4551 gene locus_tag LOCUS_17630 gene btuE 4009 4551 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAI2 protein_id gnl|my_center|LOCUS_17630 >Feature sequence55 456 319 gene locus_tag LOCUS_17640 456 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 795 2288 gene locus_tag LOCUS_17650 795 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 3382 2684 gene locus_tag LOCUS_17660 3382 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 >Feature sequence56 316 17 gene locus_tag LOCUS_17670 gene yfjF 316 17 CDS product UPF0125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3A1 protein_id gnl|my_center|LOCUS_17670 740 303 gene locus_tag LOCUS_17680 740 303 CDS product ubiquinone-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001341638.1 protein_id gnl|my_center|LOCUS_17680 867 1343 gene locus_tag LOCUS_17690 gene smpB 867 1343 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MIN9 protein_id gnl|my_center|LOCUS_17690 1376 1727 gene locus_tag LOCUS_tm00010 1376 1727 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 1891 3108 gene locus_tag LOCUS_17700 1891 3108 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938819.1 protein_id gnl|my_center|LOCUS_17700 >Feature sequence57 160 681 gene locus_tag LOCUS_17710 gene cobP 160 681 CDS product bifunctional adenosylcobalamin biosynthesis protein CobP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I466 protein_id gnl|my_center|LOCUS_17710 678 1748 gene locus_tag LOCUS_17720 gene cobT 678 1748 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I465 protein_id gnl|my_center|LOCUS_17720 1774 2556 gene locus_tag LOCUS_17730 gene cobS 1774 2556 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EI17 protein_id gnl|my_center|LOCUS_17730 2541 3068 gene locus_tag LOCUS_17740 gene gpmA 2541 3068 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963576.1 protein_id gnl|my_center|LOCUS_17740 >Feature sequence58 45 191 gene locus_tag LOCUS_17750 45 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 203 1459 gene locus_tag LOCUS_17760 gene lysA 203 1459 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44316 protein_id gnl|my_center|LOCUS_17760 2253 1471 gene locus_tag LOCUS_17770 2253 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144051.1 protein_id gnl|my_center|LOCUS_17770 2769 2269 gene locus_tag LOCUS_17780 gene ppiB 2769 2269 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG23 protein_id gnl|my_center|LOCUS_17780 3055 2924 gene locus_tag LOCUS_17790 3055 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 >Feature sequence59 486 1697 gene locus_tag LOCUS_17800 gene argG 486 1697 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPK0 protein_id gnl|my_center|LOCUS_17800 >Feature sequence60 2090 924 gene locus_tag LOCUS_17810 2090 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 <2827 2110 gene locus_tag LOCUS_17820 <2827 2110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073973.1:uroporphyrinogen III methyltransferase >Feature sequence61 2792 2067 gene locus_tag LOCUS_17830 2792 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 >Feature sequence62 709 1596 gene locus_tag LOCUS_17840 gene mtnP 709 1596 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXH9 protein_id gnl|my_center|LOCUS_17840 1611 2138 gene locus_tag LOCUS_17850 gene apt 1611 2138 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UBS2 protein_id gnl|my_center|LOCUS_17850 >Feature sequence63 <1 873 gene locus_tag LOCUS_17860 <1 873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390664.1:two-component sensor histidine kinase 987 1532 gene locus_tag LOCUS_17870 987 1532 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100571.1 protein_id gnl|my_center|LOCUS_17870 2021 1635 gene locus_tag LOCUS_17880 2021 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 >Feature sequence64