>Feature sequence001 510 701 gene locus_tag LOCUS_00010 510 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 698 4951 gene locus_tag LOCUS_00020 698 4951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 4965 6245 gene locus_tag LOCUS_00030 4965 6245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 8485 6284 gene locus_tag LOCUS_00040 8485 6284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 11540 8718 gene locus_tag LOCUS_00050 11540 8718 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704676.1 protein_id gnl|my_center|LOCUS_00050 11773 14151 gene locus_tag LOCUS_00060 11773 14151 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265961.1 protein_id gnl|my_center|LOCUS_00060 14628 17435 gene locus_tag LOCUS_00070 14628 17435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 17526 20267 gene locus_tag LOCUS_00080 17526 20267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 20750 20286 gene locus_tag LOCUS_00090 gene bfr 20750 20286 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7W0G1 protein_id gnl|my_center|LOCUS_00090 22424 21234 gene locus_tag LOCUS_00100 22424 21234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031788.1 protein_id gnl|my_center|LOCUS_00100 24035 22596 gene locus_tag LOCUS_00110 24035 22596 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940551.1 protein_id gnl|my_center|LOCUS_00110 25904 24054 gene locus_tag LOCUS_00120 25904 24054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 27054 25918 gene locus_tag LOCUS_00130 gene dapE 27054 25918 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIB5 protein_id gnl|my_center|LOCUS_00130 27875 27051 gene locus_tag LOCUS_00140 gene dapD 27875 27051 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CHB9 protein_id gnl|my_center|LOCUS_00140 30508 27878 gene locus_tag LOCUS_00150 gene glnD 30508 27878 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z9H0 protein_id gnl|my_center|LOCUS_00150 31275 30508 gene locus_tag LOCUS_00160 gene map 31275 30508 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUS3 protein_id gnl|my_center|LOCUS_00160 31667 32764 gene locus_tag LOCUS_00170 31667 32764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 32884 33747 gene locus_tag LOCUS_00180 gene tsf 32884 33747 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHX9 protein_id gnl|my_center|LOCUS_00180 33740 34462 gene locus_tag LOCUS_00190 gene pyrH 33740 34462 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59009 protein_id gnl|my_center|LOCUS_00190 34612 35169 gene locus_tag LOCUS_00200 gene frr 34612 35169 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JC7 protein_id gnl|my_center|LOCUS_00200 35262 35915 gene locus_tag LOCUS_00210 gene uppS 35262 35915 CDS product ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886N9 protein_id gnl|my_center|LOCUS_00210 35908 36708 gene locus_tag LOCUS_00220 gene cdsA 35908 36708 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAV8 protein_id gnl|my_center|LOCUS_00220 36952 38745 gene locus_tag LOCUS_00230 36952 38745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 38869 41712 gene locus_tag LOCUS_00240 38869 41712 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529751.1 protein_id gnl|my_center|LOCUS_00240 41870 42502 gene locus_tag LOCUS_00250 41870 42502 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142016.1 protein_id gnl|my_center|LOCUS_00250 42521 42964 gene locus_tag LOCUS_00260 42521 42964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 43059 44183 gene locus_tag LOCUS_00270 gene dnaJ 43059 44183 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NHB7 protein_id gnl|my_center|LOCUS_00270 44429 45214 gene locus_tag LOCUS_00280 44429 45214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 45211 46620 gene locus_tag LOCUS_00290 45211 46620 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459330.1 protein_id gnl|my_center|LOCUS_00290 46628 47230 gene locus_tag LOCUS_00300 46628 47230 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267143.1 protein_id gnl|my_center|LOCUS_00300 47230 47640 gene locus_tag LOCUS_00310 47230 47640 CDS product biopolymer transporter protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707897.1 protein_id gnl|my_center|LOCUS_00310 47640 48278 gene locus_tag LOCUS_00320 47640 48278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 48304 49479 gene locus_tag LOCUS_00330 48304 49479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 50133 49537 gene locus_tag LOCUS_00340 gene napC 50133 49537 CDS product cytochrome c-type protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4G5 protein_id gnl|my_center|LOCUS_00340 50579 50130 gene locus_tag LOCUS_00350 gene napB 50579 50130 CDS product periplasmic nitrate reductase, electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89EN4 protein_id gnl|my_center|LOCUS_00350 53086 50591 gene locus_tag LOCUS_00360 gene napA 53086 50591 CDS product periplasmic nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MJ79 protein_id gnl|my_center|LOCUS_00360 53349 53083 gene locus_tag LOCUS_00370 gene napD 53349 53083 CDS product sorbose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071139.1 protein_id gnl|my_center|LOCUS_00370 53361 53927 gene locus_tag LOCUS_00380 53361 53927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 54099 53896 gene locus_tag LOCUS_00390 54099 53896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 54209 54628 gene locus_tag LOCUS_00400 54209 54628 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105972.1 protein_id gnl|my_center|LOCUS_00400 54720 55592 gene locus_tag LOCUS_00410 54720 55592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 55663 56436 gene locus_tag LOCUS_00420 55663 56436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 56761 56420 gene locus_tag LOCUS_00430 56761 56420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037243.1 protein_id gnl|my_center|LOCUS_00430 57191 57589 gene locus_tag LOCUS_00440 57191 57589 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316411.1 protein_id gnl|my_center|LOCUS_00440 57796 58770 gene locus_tag LOCUS_00450 gene xylR 57796 58770 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920901.1 protein_id gnl|my_center|LOCUS_00450 59659 58799 gene locus_tag LOCUS_00460 59659 58799 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RDP4 protein_id gnl|my_center|LOCUS_00460 61125 59776 gene locus_tag LOCUS_00470 gene xylA2 61125 59776 CDS product xylose isomerase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3H1 protein_id gnl|my_center|LOCUS_00470 62635 61139 gene locus_tag LOCUS_00480 62635 61139 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036931.1 protein_id gnl|my_center|LOCUS_00480 65033 62643 gene locus_tag LOCUS_00490 65033 62643 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920890.1 protein_id gnl|my_center|LOCUS_00490 65249 66919 gene locus_tag LOCUS_00500 65249 66919 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_00500 67168 67761 gene locus_tag LOCUS_00510 gene mtnB 67168 67761 CDS product methylthioribulose-1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9N3 protein_id gnl|my_center|LOCUS_00510 67758 68300 gene locus_tag LOCUS_00520 gene mtnD 67758 68300 CDS product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JP10 protein_id gnl|my_center|LOCUS_00520 68300 68989 gene locus_tag LOCUS_00530 gene mtnC 68300 68989 CDS product enolase-phosphatase E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67786 protein_id gnl|my_center|LOCUS_00530 68986 70143 gene locus_tag LOCUS_00540 68986 70143 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106648.1 protein_id gnl|my_center|LOCUS_00540 70161 70661 gene locus_tag LOCUS_00550 70161 70661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192577.1 protein_id gnl|my_center|LOCUS_00550 71010 73850 gene locus_tag LOCUS_00560 71010 73850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268876.1 protein_id gnl|my_center|LOCUS_00560 73882 75756 gene locus_tag LOCUS_00570 73882 75756 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E191 protein_id gnl|my_center|LOCUS_00570 78030 75925 gene locus_tag LOCUS_00580 78030 75925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 78197 79525 gene locus_tag LOCUS_00590 78197 79525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 81034 79580 gene locus_tag LOCUS_00600 81034 79580 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528231.1 protein_id gnl|my_center|LOCUS_00600 82344 81031 gene locus_tag LOCUS_00610 82344 81031 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038748.1 protein_id gnl|my_center|LOCUS_00610 82397 82960 gene locus_tag LOCUS_00620 82397 82960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 82957 83274 gene locus_tag LOCUS_00630 82957 83274 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090236.1 protein_id gnl|my_center|LOCUS_00630 83278 83709 gene locus_tag LOCUS_00640 83278 83709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143823.1 protein_id gnl|my_center|LOCUS_00640 83706 84470 gene locus_tag LOCUS_00650 83706 84470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 84599 85312 gene locus_tag LOCUS_00660 84599 85312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 85339 86076 gene locus_tag LOCUS_00670 85339 86076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 86241 86672 gene locus_tag LOCUS_00680 86241 86672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 86768 87328 gene locus_tag LOCUS_00690 86768 87328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 88824 87493 gene locus_tag LOCUS_00700 88824 87493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 89066 90175 gene locus_tag LOCUS_00710 89066 90175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 90305 91558 gene locus_tag LOCUS_00720 90305 91558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 >Feature sequence002 4791 2056 gene locus_tag LOCUS_00730 4791 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 5538 5681 gene locus_tag LOCUS_00740 5538 5681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 6195 5647 gene locus_tag LOCUS_00750 6195 5647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 6605 7516 gene locus_tag LOCUS_00760 6605 7516 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895522.1 protein_id gnl|my_center|LOCUS_00760 8475 11333 gene locus_tag LOCUS_00770 8475 11333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 11858 12724 gene locus_tag LOCUS_00780 11858 12724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 13575 14798 gene locus_tag LOCUS_00790 13575 14798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 15104 15448 gene locus_tag LOCUS_00800 15104 15448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 15663 17498 gene locus_tag LOCUS_00810 15663 17498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 17498 17785 gene locus_tag LOCUS_00820 17498 17785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 19246 17924 gene locus_tag LOCUS_00830 19246 17924 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405165.1 protein_id gnl|my_center|LOCUS_00830 19310 19471 gene locus_tag LOCUS_00840 19310 19471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 20082 19429 gene locus_tag LOCUS_00850 20082 19429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 20733 20125 gene locus_tag LOCUS_00860 20733 20125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 21116 20730 gene locus_tag LOCUS_00870 21116 20730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 21669 21109 gene locus_tag LOCUS_00880 gene rpoE 21669 21109 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XF4 protein_id gnl|my_center|LOCUS_00880 21813 22148 gene locus_tag LOCUS_00890 21813 22148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 22213 23607 gene locus_tag LOCUS_00900 22213 23607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 25150 23609 gene locus_tag LOCUS_00910 25150 23609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918439.1 protein_id gnl|my_center|LOCUS_00910 25274 26731 gene locus_tag LOCUS_00920 25274 26731 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640003.1 protein_id gnl|my_center|LOCUS_00920 26713 26892 gene locus_tag LOCUS_00930 26713 26892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 26996 27190 gene locus_tag LOCUS_00940 26996 27190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 27488 27688 gene locus_tag LOCUS_00950 27488 27688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 27891 27679 gene locus_tag LOCUS_00960 27891 27679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 27939 28148 gene locus_tag LOCUS_00970 27939 28148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 28219 29442 gene locus_tag LOCUS_00980 28219 29442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 29542 32748 gene locus_tag LOCUS_00990 29542 32748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031312.1 protein_id gnl|my_center|LOCUS_00990 32798 34126 gene locus_tag LOCUS_01000 32798 34126 CDS product toxin secretion, membrane fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074383.1 protein_id gnl|my_center|LOCUS_01000 34123 36225 gene locus_tag LOCUS_01010 34123 36225 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074382.1 protein_id gnl|my_center|LOCUS_01010 36392 36958 gene locus_tag LOCUS_01020 36392 36958 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_01020 36977 37591 gene locus_tag LOCUS_01030 36977 37591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 39829 37586 gene locus_tag LOCUS_01040 39829 37586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 41211 40003 gene locus_tag LOCUS_01050 41211 40003 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707906.1 protein_id gnl|my_center|LOCUS_01050 41408 41845 gene locus_tag LOCUS_01060 41408 41845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 42032 42841 gene locus_tag LOCUS_01070 42032 42841 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707968.1 protein_id gnl|my_center|LOCUS_01070 43031 45067 gene locus_tag LOCUS_01080 43031 45067 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942299.1 protein_id gnl|my_center|LOCUS_01080 45256 47079 gene locus_tag LOCUS_01090 45256 47079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 47408 47127 gene locus_tag LOCUS_01100 47408 47127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 48048 48722 gene locus_tag LOCUS_01110 48048 48722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 48719 49831 gene locus_tag LOCUS_01120 48719 49831 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768762.1 protein_id gnl|my_center|LOCUS_01120 50041 50553 gene locus_tag LOCUS_01130 50041 50553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 50676 50909 gene locus_tag LOCUS_01140 50676 50909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 50952 51353 gene locus_tag LOCUS_01150 50952 51353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 55312 51332 gene locus_tag LOCUS_01160 55312 51332 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_01160 55660 55388 gene locus_tag LOCUS_01170 55660 55388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 56311 57069 gene locus_tag LOCUS_01180 56311 57069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 57066 57962 gene locus_tag LOCUS_01190 57066 57962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 58562 58146 gene locus_tag LOCUS_01200 58562 58146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 59723 58614 gene locus_tag LOCUS_01210 59723 58614 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087109.1 protein_id gnl|my_center|LOCUS_01210 60332 59748 gene locus_tag LOCUS_01220 60332 59748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 61193 60516 gene locus_tag LOCUS_01230 61193 60516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 62089 61190 gene locus_tag LOCUS_01240 62089 61190 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392678.1 protein_id gnl|my_center|LOCUS_01240 62474 62076 gene locus_tag LOCUS_01250 62474 62076 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392679.1 protein_id gnl|my_center|LOCUS_01250 62735 63331 gene locus_tag LOCUS_01260 62735 63331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 63328 66180 gene locus_tag LOCUS_01270 63328 66180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 66694 66209 gene locus_tag LOCUS_01280 66694 66209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 66937 67500 gene locus_tag LOCUS_01290 66937 67500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 67580 68044 gene locus_tag LOCUS_01300 67580 68044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113784.1 protein_id gnl|my_center|LOCUS_01300 68771 68031 gene locus_tag LOCUS_01310 68771 68031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258569.1 protein_id gnl|my_center|LOCUS_01310 69463 68771 gene locus_tag LOCUS_01320 69463 68771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 70311 69460 gene locus_tag LOCUS_01330 70311 69460 CDS product putative ABC transporter antibiotic-transport ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702595.1 protein_id gnl|my_center|LOCUS_01330 70491 70880 gene locus_tag LOCUS_01340 70491 70880 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986713.1 protein_id gnl|my_center|LOCUS_01340 71070 72020 gene locus_tag LOCUS_01350 71070 72020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 72013 72963 gene locus_tag LOCUS_01360 gene desC3 72013 72963 CDS product delta-9 desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057556.1 protein_id gnl|my_center|LOCUS_01360 73033 73482 gene locus_tag LOCUS_01370 73033 73482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 73492 73944 gene locus_tag LOCUS_01380 73492 73944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 74558 73980 gene locus_tag LOCUS_01390 74558 73980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 74895 75176 gene locus_tag LOCUS_01400 74895 75176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 75340 76851 gene locus_tag LOCUS_01410 75340 76851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073515.1 protein_id gnl|my_center|LOCUS_01410 77688 76819 gene locus_tag LOCUS_01420 77688 76819 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102328.1 protein_id gnl|my_center|LOCUS_01420 >Feature sequence003 768 160 gene locus_tag LOCUS_01430 gene coaE 768 160 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJP9 protein_id gnl|my_center|LOCUS_01430 1609 773 gene locus_tag LOCUS_01440 gene pilD 1609 773 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJP8 protein_id gnl|my_center|LOCUS_01440 2841 1609 gene locus_tag LOCUS_01450 gene pilC 2841 1609 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038215.1 protein_id gnl|my_center|LOCUS_01450 4553 2844 gene locus_tag LOCUS_01460 gene pilB 4553 2844 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038212.1 protein_id gnl|my_center|LOCUS_01460 4683 5750 gene locus_tag LOCUS_01470 4683 5750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 5735 6574 gene locus_tag LOCUS_01480 5735 6574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 6936 7478 gene locus_tag LOCUS_01490 6936 7478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 7475 8155 gene locus_tag LOCUS_01500 7475 8155 CDS product acylneuraminate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143764.1 protein_id gnl|my_center|LOCUS_01500 8152 9081 gene locus_tag LOCUS_01510 8152 9081 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143765.1 protein_id gnl|my_center|LOCUS_01510 9078 9830 gene locus_tag LOCUS_01520 9078 9830 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143766.1 protein_id gnl|my_center|LOCUS_01520 11161 9875 gene locus_tag LOCUS_01530 11161 9875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143771.1 protein_id gnl|my_center|LOCUS_01530 11394 11239 gene locus_tag LOCUS_01540 11394 11239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 11713 12498 gene locus_tag LOCUS_01550 11713 12498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143772.1 protein_id gnl|my_center|LOCUS_01550 12506 13240 gene locus_tag LOCUS_01560 12506 13240 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922020.1 protein_id gnl|my_center|LOCUS_01560 13372 14082 gene locus_tag LOCUS_01570 13372 14082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 15382 14096 gene locus_tag LOCUS_01580 15382 14096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 17277 15403 gene locus_tag LOCUS_01590 17277 15403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 18728 17274 gene locus_tag LOCUS_01600 18728 17274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 20334 18820 gene locus_tag LOCUS_01610 20334 18820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 21102 20665 gene locus_tag LOCUS_01620 gene pilE 21102 20665 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038214.1 protein_id gnl|my_center|LOCUS_01620 21713 21432 gene locus_tag LOCUS_01630 21713 21432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 23324 21969 gene locus_tag LOCUS_01640 gene pilR 23324 21969 CDS product type 4 fimbriae expression regulatory protein PilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00934 protein_id gnl|my_center|LOCUS_01640 23437 24102 gene locus_tag LOCUS_01650 23437 24102 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_01650 25772 24105 gene locus_tag LOCUS_01660 gene pilS 25772 24105 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038210.1 protein_id gnl|my_center|LOCUS_01660 25903 27063 gene locus_tag LOCUS_01670 gene sucC 25903 27063 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P676 protein_id gnl|my_center|LOCUS_01670 27069 27941 gene locus_tag LOCUS_01680 gene sucD 27069 27941 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883Z3 protein_id gnl|my_center|LOCUS_01680 28611 27949 gene locus_tag LOCUS_01690 gene trpF-2 28611 27949 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q728W0 protein_id gnl|my_center|LOCUS_01690 31167 28624 gene locus_tag LOCUS_01700 31167 28624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 32279 31155 gene locus_tag LOCUS_01710 32279 31155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 33125 32367 gene locus_tag LOCUS_01720 33125 32367 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888014.1 protein_id gnl|my_center|LOCUS_01720 34150 33125 gene locus_tag LOCUS_01730 34150 33125 CDS product L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RS46 protein_id gnl|my_center|LOCUS_01730 34201 34725 gene locus_tag LOCUS_01740 gene greB 34201 34725 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7P8 protein_id gnl|my_center|LOCUS_01740 34715 35569 gene locus_tag LOCUS_01750 34715 35569 CDS product NADP oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403665.1 protein_id gnl|my_center|LOCUS_01750 35790 36029 gene locus_tag LOCUS_01760 35790 36029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 36036 36362 gene locus_tag LOCUS_01770 gene yisB 36036 36362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O06715 protein_id gnl|my_center|LOCUS_01770 36493 37206 gene locus_tag LOCUS_01780 36493 37206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 37299 38093 gene locus_tag LOCUS_01790 gene uppP 37299 38093 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2K6 protein_id gnl|my_center|LOCUS_01790 38152 39630 gene locus_tag LOCUS_01800 38152 39630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 39620 40309 gene locus_tag LOCUS_01810 gene regX 39620 40309 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222396.1 protein_id gnl|my_center|LOCUS_01810 40306 41742 gene locus_tag LOCUS_01820 40306 41742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 41774 42088 gene locus_tag LOCUS_01830 41774 42088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 43203 42094 gene locus_tag LOCUS_01840 43203 42094 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229029.1 protein_id gnl|my_center|LOCUS_01840 43351 44628 gene locus_tag LOCUS_01850 43351 44628 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929105.1 protein_id gnl|my_center|LOCUS_01850 44665 45780 gene locus_tag LOCUS_01860 44665 45780 CDS product isoflavone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706828.1 protein_id gnl|my_center|LOCUS_01860 45777 46754 gene locus_tag LOCUS_01870 45777 46754 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227801.1 protein_id gnl|my_center|LOCUS_01870 47164 46760 gene locus_tag LOCUS_01880 47164 46760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 47292 49049 gene locus_tag LOCUS_01890 47292 49049 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533474.1 protein_id gnl|my_center|LOCUS_01890 50409 49081 gene locus_tag LOCUS_01900 50409 49081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 50677 51582 gene locus_tag LOCUS_01910 50677 51582 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038553.1 protein_id gnl|my_center|LOCUS_01910 52011 51592 gene locus_tag LOCUS_01920 52011 51592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084345.1 protein_id gnl|my_center|LOCUS_01920 52116 52466 gene locus_tag LOCUS_01930 52116 52466 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481072.1 protein_id gnl|my_center|LOCUS_01930 55091 52470 gene locus_tag LOCUS_01940 55091 52470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 55235 55945 gene locus_tag LOCUS_01950 55235 55945 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264517.1 protein_id gnl|my_center|LOCUS_01950 55942 57426 gene locus_tag LOCUS_01960 55942 57426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 57423 59522 gene locus_tag LOCUS_01970 57423 59522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 60381 59494 gene locus_tag LOCUS_01980 60381 59494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 61222 60371 gene locus_tag LOCUS_01990 61222 60371 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963744.1 protein_id gnl|my_center|LOCUS_01990 62252 61311 gene locus_tag LOCUS_02000 62252 61311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 63157 62516 gene locus_tag LOCUS_02010 63157 62516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706996.1 protein_id gnl|my_center|LOCUS_02010 63978 63154 gene locus_tag LOCUS_02020 63978 63154 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351197.1 protein_id gnl|my_center|LOCUS_02020 64646 63978 gene locus_tag LOCUS_02030 64646 63978 CDS product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706994.1 protein_id gnl|my_center|LOCUS_02030 66102 64633 gene locus_tag LOCUS_02040 66102 64633 CDS product long-chain acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706993.1 protein_id gnl|my_center|LOCUS_02040 66698 66099 gene locus_tag LOCUS_02050 66698 66099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 66896 67492 gene locus_tag LOCUS_02060 gene rpoE 66896 67492 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F6U5 protein_id gnl|my_center|LOCUS_02060 67492 68460 gene locus_tag LOCUS_02070 67492 68460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 68884 71304 gene locus_tag LOCUS_02080 68884 71304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 72186 71326 gene locus_tag LOCUS_02090 72186 71326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 72542 72183 gene locus_tag LOCUS_02100 72542 72183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 73630 72794 gene locus_tag LOCUS_02110 gene dpm1 73630 72794 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038929.1 protein_id gnl|my_center|LOCUS_02110 74758 73862 gene locus_tag LOCUS_02120 74758 73862 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027460.1 protein_id gnl|my_center|LOCUS_02120 75306 74761 gene locus_tag LOCUS_02130 75306 74761 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002388825.1 protein_id gnl|my_center|LOCUS_02130 75395 76075 gene locus_tag LOCUS_02140 75395 76075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 76455 76066 gene locus_tag LOCUS_02150 76455 76066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 77824 76568 gene locus_tag LOCUS_02160 gene rho 77824 76568 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83A25 protein_id gnl|my_center|LOCUS_02160 >Feature sequence004 2425 1925 gene locus_tag LOCUS_02170 2425 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 2541 3047 gene locus_tag LOCUS_02180 2541 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 3044 3853 gene locus_tag LOCUS_02190 3044 3853 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266255.1 protein_id gnl|my_center|LOCUS_02190 3819 4424 gene locus_tag LOCUS_02200 gene pdxH 3819 4424 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U6T5 protein_id gnl|my_center|LOCUS_02200 4421 4825 gene locus_tag LOCUS_02210 4421 4825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958049.1 protein_id gnl|my_center|LOCUS_02210 4896 5522 gene locus_tag LOCUS_02220 4896 5522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703220.1 protein_id gnl|my_center|LOCUS_02220 6846 5551 gene locus_tag LOCUS_02230 6846 5551 CDS product carboxyl-terminal protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096067.1 protein_id gnl|my_center|LOCUS_02230 6938 7549 gene locus_tag LOCUS_02240 6938 7549 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038463.1 protein_id gnl|my_center|LOCUS_02240 7724 8014 gene locus_tag LOCUS_02250 gene groS 7724 8014 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXP4 protein_id gnl|my_center|LOCUS_02250 8070 9719 gene locus_tag LOCUS_02260 gene groL 8070 9719 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD23 protein_id gnl|my_center|LOCUS_02260 10022 10381 gene locus_tag LOCUS_02270 10022 10381 CDS product DUF3192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071720.1 protein_id gnl|my_center|LOCUS_02270 11422 11886 gene locus_tag LOCUS_02280 11422 11886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267848.1 protein_id gnl|my_center|LOCUS_02280 13410 12061 gene locus_tag LOCUS_02290 gene yfcY 13410 12061 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035450.1 protein_id gnl|my_center|LOCUS_02290 14170 13415 gene locus_tag LOCUS_02300 14170 13415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 14678 14472 gene locus_tag LOCUS_02310 14678 14472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 15901 14891 gene locus_tag LOCUS_02320 gene fbp 15901 14891 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62LZ0 protein_id gnl|my_center|LOCUS_02320 16521 16105 gene locus_tag LOCUS_02330 16521 16105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 16813 18099 gene locus_tag LOCUS_02340 16813 18099 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405234.1 protein_id gnl|my_center|LOCUS_02340 19964 18141 gene locus_tag LOCUS_02350 19964 18141 CDS product sodium:sulfate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003705.1 protein_id gnl|my_center|LOCUS_02350 20206 20955 gene locus_tag LOCUS_02360 20206 20955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946129.1 protein_id gnl|my_center|LOCUS_02360 20956 22419 gene locus_tag LOCUS_02370 20956 22419 CDS product ribosomal protein S6 modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946128.1 protein_id gnl|my_center|LOCUS_02370 22416 23621 gene locus_tag LOCUS_02380 22416 23621 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946127.1 protein_id gnl|my_center|LOCUS_02380 26304 24232 gene locus_tag LOCUS_02390 26304 24232 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073927.1 protein_id gnl|my_center|LOCUS_02390 26912 26301 gene locus_tag LOCUS_02400 26912 26301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 26926 29157 gene locus_tag LOCUS_02410 26926 29157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 29244 30701 gene locus_tag LOCUS_02420 29244 30701 CDS product flavin-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107859.1 protein_id gnl|my_center|LOCUS_02420 30698 31381 gene locus_tag LOCUS_02430 30698 31381 CDS product acetoacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224746.1 protein_id gnl|my_center|LOCUS_02430 32597 31302 gene locus_tag LOCUS_02440 32597 31302 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920343.1 protein_id gnl|my_center|LOCUS_02440 33626 32652 gene locus_tag LOCUS_02450 33626 32652 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114042.1 protein_id gnl|my_center|LOCUS_02450 34225 33677 gene locus_tag LOCUS_02460 34225 33677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 35709 34222 gene locus_tag LOCUS_02470 35709 34222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 36625 35759 gene locus_tag LOCUS_02480 gene purU 36625 35759 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWY5 protein_id gnl|my_center|LOCUS_02480 37130 36831 gene locus_tag LOCUS_02490 37130 36831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 37305 37592 gene locus_tag LOCUS_02500 37305 37592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 37633 40098 gene locus_tag LOCUS_02510 37633 40098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 40137 40781 gene locus_tag LOCUS_02520 40137 40781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529957.1 protein_id gnl|my_center|LOCUS_02520 40778 40978 gene locus_tag LOCUS_02530 40778 40978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 41093 41530 gene locus_tag LOCUS_02540 gene dps 41093 41530 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811209.1 protein_id gnl|my_center|LOCUS_02540 41760 42506 gene locus_tag LOCUS_02550 41760 42506 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920748.1 protein_id gnl|my_center|LOCUS_02550 42503 43306 gene locus_tag LOCUS_02560 42503 43306 CDS product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097743.1 protein_id gnl|my_center|LOCUS_02560 43310 44533 gene locus_tag LOCUS_02570 43310 44533 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118174.1 protein_id gnl|my_center|LOCUS_02570 44540 46276 gene locus_tag LOCUS_02580 44540 46276 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288137.1 protein_id gnl|my_center|LOCUS_02580 46535 46290 gene locus_tag LOCUS_02590 46535 46290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 47835 46537 gene locus_tag LOCUS_02600 gene gltP 47835 46537 CDS product sodium:dicarboxylate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072045.1 protein_id gnl|my_center|LOCUS_02600 47986 49791 gene locus_tag LOCUS_02610 gene gspE 47986 49791 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039157.1 protein_id gnl|my_center|LOCUS_02610 49788 50477 gene locus_tag LOCUS_02620 gene guaA 49788 50477 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039158.1 protein_id gnl|my_center|LOCUS_02620 50474 52210 gene locus_tag LOCUS_02630 gene dnaG 50474 52210 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P491 protein_id gnl|my_center|LOCUS_02630 52247 52987 gene locus_tag LOCUS_02640 52247 52987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 52990 53604 gene locus_tag LOCUS_02650 52990 53604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 53745 55508 gene locus_tag LOCUS_02660 53745 55508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 57473 55509 gene locus_tag LOCUS_02670 57473 55509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 60638 57801 gene locus_tag LOCUS_02680 gene btuB 60638 57801 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038503.1 protein_id gnl|my_center|LOCUS_02680 61537 60863 gene locus_tag LOCUS_02690 61537 60863 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEM8 protein_id gnl|my_center|LOCUS_02690 61658 62854 gene locus_tag LOCUS_02700 61658 62854 CDS product phosphopantothenate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948190.1 protein_id gnl|my_center|LOCUS_02700 62851 63306 gene locus_tag LOCUS_02710 gene dut 62851 63306 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9M0 protein_id gnl|my_center|LOCUS_02710 63310 65664 gene locus_tag LOCUS_02720 63310 65664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 66053 68038 gene locus_tag LOCUS_02730 66053 68038 CDS product prolyl oligopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072120.1 protein_id gnl|my_center|LOCUS_02730 68045 70243 gene locus_tag LOCUS_02740 68045 70243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 71193 70273 gene locus_tag LOCUS_02750 gene rdgC 71193 70273 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83M63 protein_id gnl|my_center|LOCUS_02750 71364 72239 gene locus_tag LOCUS_02760 71364 72239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038352.1 protein_id gnl|my_center|LOCUS_02760 72258 72875 gene locus_tag LOCUS_02770 gene gmk 72258 72875 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FNB1 protein_id gnl|my_center|LOCUS_02770 72936 73184 gene locus_tag LOCUS_02780 gene rpoZ 72936 73184 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTM1 protein_id gnl|my_center|LOCUS_02780 73291 75450 gene locus_tag LOCUS_02790 gene spoT 73291 75450 CDS product bifunctional GTP diphosphokinase/guanosine-3',5'-bis(diphosphate) 3'-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038350.1 protein_id gnl|my_center|LOCUS_02790 >Feature sequence005 1193 780 gene locus_tag LOCUS_02800 1193 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 1349 1822 gene locus_tag LOCUS_02810 1349 1822 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222817.1 protein_id gnl|my_center|LOCUS_02810 3321 2032 gene locus_tag LOCUS_02820 gene gltA 3321 2032 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5V0 protein_id gnl|my_center|LOCUS_02820 3857 3606 gene locus_tag LOCUS_02830 gene rpmE2 3857 3606 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5U9 protein_id gnl|my_center|LOCUS_02830 4013 4705 gene locus_tag LOCUS_02840 4013 4705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 5744 4689 gene locus_tag LOCUS_02850 5744 4689 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089483.1 protein_id gnl|my_center|LOCUS_02850 7543 5741 gene locus_tag LOCUS_02860 7543 5741 CDS product ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089482.1 protein_id gnl|my_center|LOCUS_02860 9769 7943 gene locus_tag LOCUS_02870 9769 7943 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089481.1 protein_id gnl|my_center|LOCUS_02870 10142 10900 gene locus_tag LOCUS_02880 10142 10900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 10897 11880 gene locus_tag LOCUS_02890 10897 11880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 11873 12439 gene locus_tag LOCUS_02900 11873 12439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 12436 12825 gene locus_tag LOCUS_02910 12436 12825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 13025 13303 gene locus_tag LOCUS_02920 13025 13303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039002.1 protein_id gnl|my_center|LOCUS_02920 13370 14353 gene locus_tag LOCUS_02930 13370 14353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 14350 15279 gene locus_tag LOCUS_02940 14350 15279 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706593.1 protein_id gnl|my_center|LOCUS_02940 15948 15286 gene locus_tag LOCUS_02950 15948 15286 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037632.1 protein_id gnl|my_center|LOCUS_02950 17641 15938 gene locus_tag LOCUS_02960 17641 15938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 17814 19181 gene locus_tag LOCUS_02970 17814 19181 CDS product serine endoprotease DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001894687.1 protein_id gnl|my_center|LOCUS_02970 19215 19547 gene locus_tag LOCUS_02980 19215 19547 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298134.1 protein_id gnl|my_center|LOCUS_02980 19544 19921 gene locus_tag LOCUS_02990 19544 19921 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957854.1 protein_id gnl|my_center|LOCUS_02990 20034 20486 gene locus_tag LOCUS_03000 20034 20486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 20675 21625 gene locus_tag LOCUS_03010 20675 21625 CDS product phosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037419.1 protein_id gnl|my_center|LOCUS_03010 21627 23765 gene locus_tag LOCUS_03020 21627 23765 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037418.1 protein_id gnl|my_center|LOCUS_03020 23802 24359 gene locus_tag LOCUS_03030 23802 24359 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193229.1 protein_id gnl|my_center|LOCUS_03030 24454 25602 gene locus_tag LOCUS_03040 24454 25602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 25599 26285 gene locus_tag LOCUS_03050 25599 26285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 26282 28051 gene locus_tag LOCUS_03060 26282 28051 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073890.1 protein_id gnl|my_center|LOCUS_03060 29052 28039 gene locus_tag LOCUS_03070 29052 28039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 30036 29098 gene locus_tag LOCUS_03080 30036 29098 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038567.1 protein_id gnl|my_center|LOCUS_03080 31536 30079 gene locus_tag LOCUS_03090 gene gatB 31536 30079 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNS6 protein_id gnl|my_center|LOCUS_03090 32954 31536 gene locus_tag LOCUS_03100 gene gatA 32954 31536 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BM9 protein_id gnl|my_center|LOCUS_03100 33279 32956 gene locus_tag LOCUS_03110 gene gatC 33279 32956 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NR18 protein_id gnl|my_center|LOCUS_03110 33719 33327 gene locus_tag LOCUS_03120 33719 33327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122309.1 protein_id gnl|my_center|LOCUS_03120 33861 34796 gene locus_tag LOCUS_03130 33861 34796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 35319 34804 gene locus_tag LOCUS_03140 35319 34804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 36227 35316 gene locus_tag LOCUS_03150 36227 35316 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I583 protein_id gnl|my_center|LOCUS_03150 36275 37207 gene locus_tag LOCUS_03160 36275 37207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 37204 37779 gene locus_tag LOCUS_03170 37204 37779 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036723.1 protein_id gnl|my_center|LOCUS_03170 38899 37730 gene locus_tag LOCUS_03180 38899 37730 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931892.1 protein_id gnl|my_center|LOCUS_03180 39367 38996 gene locus_tag LOCUS_03190 gene pspC 39367 38996 CDS product phage-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263198.1 protein_id gnl|my_center|LOCUS_03190 39591 39364 gene locus_tag LOCUS_03200 gene pspB 39591 39364 CDS product phage shock protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093876.1 protein_id gnl|my_center|LOCUS_03200 40274 39591 gene locus_tag LOCUS_03210 gene pspA 40274 39591 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210975.1 protein_id gnl|my_center|LOCUS_03210 40674 41351 gene locus_tag LOCUS_03220 gene mip 40674 41351 CDS product outer membrane protein MIP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXE0 protein_id gnl|my_center|LOCUS_03220 41410 41625 gene locus_tag LOCUS_03230 41410 41625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 41606 42163 gene locus_tag LOCUS_03240 41606 42163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 42165 42782 gene locus_tag LOCUS_03250 42165 42782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 42766 43635 gene locus_tag LOCUS_03260 42766 43635 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190656.1 protein_id gnl|my_center|LOCUS_03260 43863 44351 gene locus_tag LOCUS_03270 43863 44351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 45811 44453 gene locus_tag LOCUS_03280 45811 44453 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816556.1 protein_id gnl|my_center|LOCUS_03280 45888 47126 gene locus_tag LOCUS_03290 gene hutI 45888 47126 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RUU1 protein_id gnl|my_center|LOCUS_03290 47299 47847 gene locus_tag LOCUS_03300 gene algU 47299 47847 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036499.1 protein_id gnl|my_center|LOCUS_03300 47840 48325 gene locus_tag LOCUS_03310 47840 48325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 48322 49305 gene locus_tag LOCUS_03320 48322 49305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 49565 49951 gene locus_tag LOCUS_03330 49565 49951 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259628.1 protein_id gnl|my_center|LOCUS_03330 52140 50092 gene locus_tag LOCUS_03340 52140 50092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 54373 52124 gene locus_tag LOCUS_03350 54373 52124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 54546 54707 gene locus_tag LOCUS_03360 54546 54707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 54936 56666 gene locus_tag LOCUS_03370 54936 56666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 58119 56707 gene locus_tag LOCUS_03380 58119 56707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095699.1 protein_id gnl|my_center|LOCUS_03380 58789 58157 gene locus_tag LOCUS_03390 gene pcm 58789 58157 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038434.1 protein_id gnl|my_center|LOCUS_03390 59185 59670 gene locus_tag LOCUS_03400 59185 59670 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MM1 protein_id gnl|my_center|LOCUS_03400 59756 60775 gene locus_tag LOCUS_03410 59756 60775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106226.1 protein_id gnl|my_center|LOCUS_03410 61120 60806 gene locus_tag LOCUS_03420 61120 60806 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887716.1 protein_id gnl|my_center|LOCUS_03420 61332 62768 gene locus_tag LOCUS_03430 61332 62768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 62773 63216 gene locus_tag LOCUS_03440 62773 63216 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTM1 protein_id gnl|my_center|LOCUS_03440 63925 63251 gene locus_tag LOCUS_03450 63925 63251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 <64683 64037 gene locus_tag LOCUS_03460 <64683 64037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222252.1:SGNH hydrolase >Feature sequence006 1811 1557 gene locus_tag LOCUS_03470 1811 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 2708 1905 gene locus_tag LOCUS_03480 2708 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071665.1 protein_id gnl|my_center|LOCUS_03480 3202 2705 gene locus_tag LOCUS_03490 gene rimJ 3202 2705 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071953.1 protein_id gnl|my_center|LOCUS_03490 3418 4746 gene locus_tag LOCUS_03500 3418 4746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 5620 4910 gene locus_tag LOCUS_03510 5620 4910 CDS product non-ribosomal peptide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705999.1 protein_id gnl|my_center|LOCUS_03510 6960 5728 gene locus_tag LOCUS_03520 gene ybjZ 6960 5728 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035811.1 protein_id gnl|my_center|LOCUS_03520 8340 6970 gene locus_tag LOCUS_03530 8340 6970 CDS product ABC macrolide family export system permease 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073486.1 protein_id gnl|my_center|LOCUS_03530 9040 8345 gene locus_tag LOCUS_03540 gene ycfV 9040 8345 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035813.1 protein_id gnl|my_center|LOCUS_03540 10388 9099 gene locus_tag LOCUS_03550 gene ybjY 10388 9099 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035814.1 protein_id gnl|my_center|LOCUS_03550 10838 11782 gene locus_tag LOCUS_03560 10838 11782 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173018.1 protein_id gnl|my_center|LOCUS_03560 11775 12545 gene locus_tag LOCUS_03570 11775 12545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 12563 12814 gene locus_tag LOCUS_03580 12563 12814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 12859 13071 gene locus_tag LOCUS_03590 12859 13071 CDS product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089636.1 protein_id gnl|my_center|LOCUS_03590 13166 13849 gene locus_tag LOCUS_03600 13166 13849 CDS product non-ribosomal peptide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525108.1 protein_id gnl|my_center|LOCUS_03600 13914 15944 gene locus_tag LOCUS_03610 13914 15944 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141946.1 protein_id gnl|my_center|LOCUS_03610 15944 17245 gene locus_tag LOCUS_03620 15944 17245 CDS product cytochrome P-450 like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141940.1 protein_id gnl|my_center|LOCUS_03620 17600 20983 gene locus_tag LOCUS_03630 17600 20983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 20980 31770 gene locus_tag LOCUS_03640 20980 31770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 31780 41232 gene locus_tag LOCUS_03650 31780 41232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 41229 44645 gene locus_tag LOCUS_03660 41229 44645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 44648 48991 gene locus_tag LOCUS_03670 44648 48991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 49007 58135 gene locus_tag LOCUS_03680 49007 58135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 58484 58266 gene locus_tag LOCUS_03690 58484 58266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 58365 58742 gene locus_tag LOCUS_03700 58365 58742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 >Feature sequence007 1198 602 gene locus_tag LOCUS_03710 1198 602 CDS product NAD dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902568.1 protein_id gnl|my_center|LOCUS_03710 1863 1300 gene locus_tag LOCUS_03720 1863 1300 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119882.1 protein_id gnl|my_center|LOCUS_03720 3064 2156 gene locus_tag LOCUS_03730 3064 2156 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073536.1 protein_id gnl|my_center|LOCUS_03730 4525 5337 gene locus_tag LOCUS_03740 4525 5337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 6320 5472 gene locus_tag LOCUS_03750 6320 5472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 7938 6883 gene locus_tag LOCUS_03760 7938 6883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 8593 7997 gene locus_tag LOCUS_03770 8593 7997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 9707 8856 gene locus_tag LOCUS_03780 9707 8856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 10951 9701 gene locus_tag LOCUS_03790 10951 9701 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061635.1 protein_id gnl|my_center|LOCUS_03790 12237 10948 gene locus_tag LOCUS_03800 12237 10948 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061635.1 protein_id gnl|my_center|LOCUS_03800 13895 12234 gene locus_tag LOCUS_03810 13895 12234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 14163 14618 gene locus_tag LOCUS_03820 14163 14618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 14634 16349 gene locus_tag LOCUS_03830 14634 16349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106392.1 protein_id gnl|my_center|LOCUS_03830 14813 14731 gene locus_tag LOCUS_t00010 14813 14731 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 16359 17816 gene locus_tag LOCUS_03840 16359 17816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920272.1 protein_id gnl|my_center|LOCUS_03840 17945 18526 gene locus_tag LOCUS_03850 17945 18526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978724.1 protein_id gnl|my_center|LOCUS_03850 18965 18690 gene locus_tag LOCUS_03860 18965 18690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 20523 19036 gene locus_tag LOCUS_03870 20523 19036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 20610 20825 gene locus_tag LOCUS_03880 20610 20825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 22092 20800 gene locus_tag LOCUS_03890 22092 20800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 22199 22954 gene locus_tag LOCUS_03900 22199 22954 CDS product HxlR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530738.1 protein_id gnl|my_center|LOCUS_03900 23036 23203 gene locus_tag LOCUS_03910 23036 23203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 23139 24260 gene locus_tag LOCUS_03920 23139 24260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 25910 24297 gene locus_tag LOCUS_03930 25910 24297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 26064 26303 gene locus_tag LOCUS_03940 26064 26303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 26962 26681 gene locus_tag LOCUS_03950 26962 26681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 27490 27747 gene locus_tag LOCUS_03960 27490 27747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 28307 27792 gene locus_tag LOCUS_03970 28307 27792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 30138 28387 gene locus_tag LOCUS_03980 30138 28387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 32001 30322 gene locus_tag LOCUS_03990 32001 30322 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268974.1 protein_id gnl|my_center|LOCUS_03990 32633 31998 gene locus_tag LOCUS_04000 32633 31998 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089874.1 protein_id gnl|my_center|LOCUS_04000 33423 32929 gene locus_tag LOCUS_04010 gene bioY 33423 32929 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537705.1 protein_id gnl|my_center|LOCUS_04010 33625 34131 gene locus_tag LOCUS_04020 33625 34131 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087869.1 protein_id gnl|my_center|LOCUS_04020 34151 35152 gene locus_tag LOCUS_04030 34151 35152 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097826.1 protein_id gnl|my_center|LOCUS_04030 35158 35637 gene locus_tag LOCUS_04040 35158 35637 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047180.1 protein_id gnl|my_center|LOCUS_04040 35637 37415 gene locus_tag LOCUS_04050 35637 37415 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889509.1 protein_id gnl|my_center|LOCUS_04050 39104 37911 gene locus_tag LOCUS_04060 39104 37911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 39927 39352 gene locus_tag LOCUS_04070 39927 39352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 40716 40267 gene locus_tag LOCUS_04080 40716 40267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 41418 40720 gene locus_tag LOCUS_04090 gene trmH 41418 40720 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z2I1 protein_id gnl|my_center|LOCUS_04090 43169 41415 gene locus_tag LOCUS_04100 43169 41415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 protein_id gnl|my_center|LOCUS_04100 43276 43755 gene locus_tag LOCUS_04110 43276 43755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122230.1 protein_id gnl|my_center|LOCUS_04110 43788 44192 gene locus_tag LOCUS_04120 43788 44192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 44277 44528 gene locus_tag LOCUS_04130 44277 44528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 46607 44793 gene locus_tag LOCUS_04140 46607 44793 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071586.1 protein_id gnl|my_center|LOCUS_04140 47335 46688 gene locus_tag LOCUS_04150 47335 46688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 47843 47328 gene locus_tag LOCUS_04160 47843 47328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 48017 48277 gene locus_tag LOCUS_04170 48017 48277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 49429 48209 gene locus_tag LOCUS_04180 gene aspC 49429 48209 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038462.1 protein_id gnl|my_center|LOCUS_04180 49600 50316 gene locus_tag LOCUS_04190 49600 50316 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196078.1 protein_id gnl|my_center|LOCUS_04190 50316 50606 gene locus_tag LOCUS_04200 50316 50606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 51494 50613 gene locus_tag LOCUS_04210 51494 50613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 53025 51583 gene locus_tag LOCUS_04220 gene htrA 53025 51583 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038973.1 protein_id gnl|my_center|LOCUS_04220 53326 55473 gene locus_tag LOCUS_04230 gene nrdJa 53326 55473 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895708.1 protein_id gnl|my_center|LOCUS_04230 55538 56236 gene locus_tag LOCUS_04240 gene nrdJb 55538 56236 CDS product TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096987.1 protein_id gnl|my_center|LOCUS_04240 56308 58572 gene locus_tag LOCUS_04250 56308 58572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 >Feature sequence008 238 1182 gene locus_tag LOCUS_04260 238 1182 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090277.1 protein_id gnl|my_center|LOCUS_04260 1240 1755 gene locus_tag LOCUS_04270 gene rfaH 1240 1755 CDS product transcription antitermination protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZI5 protein_id gnl|my_center|LOCUS_04270 1916 2284 gene locus_tag LOCUS_04280 1916 2284 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870231.1 protein_id gnl|my_center|LOCUS_04280 2340 2705 gene locus_tag LOCUS_04290 2340 2705 CDS product MarR family EPS-associated transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001968012.1 protein_id gnl|my_center|LOCUS_04290 2814 4145 gene locus_tag LOCUS_04300 gene wbpO 2814 4145 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931326.1 protein_id gnl|my_center|LOCUS_04300 4146 5000 gene locus_tag LOCUS_04310 gene rfbA 4146 5000 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXF9 protein_id gnl|my_center|LOCUS_04310 5023 5844 gene locus_tag LOCUS_04320 5023 5844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 5841 7076 gene locus_tag LOCUS_04330 gene abcT4 5841 7076 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880682.1 protein_id gnl|my_center|LOCUS_04330 7024 7698 gene locus_tag LOCUS_04340 7024 7698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 7703 8728 gene locus_tag LOCUS_04350 7703 8728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 8725 9699 gene locus_tag LOCUS_04360 gene gmd 8725 9699 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJ72 protein_id gnl|my_center|LOCUS_04360 9689 11323 gene locus_tag LOCUS_04370 9689 11323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 11323 12198 gene locus_tag LOCUS_04380 11323 12198 CDS product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889298.1 protein_id gnl|my_center|LOCUS_04380 12220 13191 gene locus_tag LOCUS_04390 12220 13191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 13232 14134 gene locus_tag LOCUS_04400 13232 14134 CDS product putative dTDP-rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704341.1 protein_id gnl|my_center|LOCUS_04400 14127 15080 gene locus_tag LOCUS_04410 14127 15080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 15743 16363 gene locus_tag LOCUS_04420 15743 16363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 16393 17160 gene locus_tag LOCUS_04430 16393 17160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 17172 18485 gene locus_tag LOCUS_04440 17172 18485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 19094 19654 gene locus_tag LOCUS_04450 19094 19654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 20218 21093 gene locus_tag LOCUS_04460 20218 21093 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_04460 21103 21870 gene locus_tag LOCUS_04470 gene wbyL 21103 21870 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331386.1 protein_id gnl|my_center|LOCUS_04470 21863 22975 gene locus_tag LOCUS_04480 gene gmd 21863 22975 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CNI5 protein_id gnl|my_center|LOCUS_04480 23823 22972 gene locus_tag LOCUS_04490 23823 22972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 23899 24837 gene locus_tag LOCUS_04500 gene wcaG 23899 24837 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72FX3 protein_id gnl|my_center|LOCUS_04500 24994 25338 gene locus_tag LOCUS_04510 gene wzd 24994 25338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073079.1 protein_id gnl|my_center|LOCUS_04510 25457 26800 gene locus_tag LOCUS_04520 25457 26800 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932849.1 protein_id gnl|my_center|LOCUS_04520 26797 27747 gene locus_tag LOCUS_04530 26797 27747 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545566.1 protein_id gnl|my_center|LOCUS_04530 28184 27870 gene locus_tag LOCUS_04540 28184 27870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 28550 28212 gene locus_tag LOCUS_04550 28550 28212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 28685 29068 gene locus_tag LOCUS_04560 28685 29068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 30134 29253 gene locus_tag LOCUS_04570 gene zitB 30134 29253 CDS product cation efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836264.1 protein_id gnl|my_center|LOCUS_04570 30465 30148 gene locus_tag LOCUS_04580 30465 30148 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391570.1 protein_id gnl|my_center|LOCUS_04580 30683 30504 gene locus_tag LOCUS_04590 30683 30504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 32075 30687 gene locus_tag LOCUS_04600 32075 30687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 33241 32072 gene locus_tag LOCUS_04610 33241 32072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 35507 33252 gene locus_tag LOCUS_04620 35507 33252 CDS product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147064.1 protein_id gnl|my_center|LOCUS_04620 36548 35508 gene locus_tag LOCUS_04630 36548 35508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 37789 36566 gene locus_tag LOCUS_04640 37789 36566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 39532 37850 gene locus_tag LOCUS_04650 39532 37850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 40815 39535 gene locus_tag LOCUS_04660 gene arcA2 40815 39535 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I261 protein_id gnl|my_center|LOCUS_04660 40889 42940 gene locus_tag LOCUS_04670 40889 42940 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921025.1 protein_id gnl|my_center|LOCUS_04670 43101 43808 gene locus_tag LOCUS_04680 43101 43808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263126.1 protein_id gnl|my_center|LOCUS_04680 44141 44335 gene locus_tag LOCUS_04690 44141 44335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 44482 45540 gene locus_tag LOCUS_04700 44482 45540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 46743 45715 gene locus_tag LOCUS_04710 gene ada 46743 45715 CDS product 6-O-methylguanine DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971239.1 protein_id gnl|my_center|LOCUS_04710 46859 47617 gene locus_tag LOCUS_04720 46859 47617 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114603.1 protein_id gnl|my_center|LOCUS_04720 48515 47604 gene locus_tag LOCUS_04730 gene ars 48515 47604 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020668.1 protein_id gnl|my_center|LOCUS_04730 48566 49843 gene locus_tag LOCUS_04740 48566 49843 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095114.1 protein_id gnl|my_center|LOCUS_04740 50779 50150 gene locus_tag LOCUS_04750 50779 50150 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186002.1 protein_id gnl|my_center|LOCUS_04750 50881 51846 gene locus_tag LOCUS_04760 gene paaA 50881 51846 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813298.1 protein_id gnl|my_center|LOCUS_04760 51843 52133 gene locus_tag LOCUS_04770 gene paaB 51843 52133 CDS product phenylacetate-CoA oxygenase subunit PaaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902768.1 protein_id gnl|my_center|LOCUS_04770 52130 52897 gene locus_tag LOCUS_04780 gene paaC 52130 52897 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085677.1 protein_id gnl|my_center|LOCUS_04780 52904 53416 gene locus_tag LOCUS_04790 gene paaD 52904 53416 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085678.1 protein_id gnl|my_center|LOCUS_04790 53471 54547 gene locus_tag LOCUS_04800 gene paaE 53471 54547 CDS product phenylacetic acid degradation NADH oxidoreductase PaaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551026.1 protein_id gnl|my_center|LOCUS_04800 54643 55839 gene locus_tag LOCUS_04810 gene aspC 54643 55839 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEH6 protein_id gnl|my_center|LOCUS_04810 55836 56564 gene locus_tag LOCUS_04820 55836 56564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 >Feature sequence009 591 2738 gene locus_tag LOCUS_04830 591 2738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 3361 3756 gene locus_tag LOCUS_04840 3361 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 3810 5222 gene locus_tag LOCUS_04850 3810 5222 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403771.1 protein_id gnl|my_center|LOCUS_04850 5604 9647 gene locus_tag LOCUS_04860 5604 9647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 10389 10075 gene locus_tag LOCUS_04870 10389 10075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 10573 13107 gene locus_tag LOCUS_04880 10573 13107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 13120 14487 gene locus_tag LOCUS_04890 13120 14487 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975253.1 protein_id gnl|my_center|LOCUS_04890 14581 16401 gene locus_tag LOCUS_04900 14581 16401 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527998.1 protein_id gnl|my_center|LOCUS_04900 16557 17462 gene locus_tag LOCUS_04910 16557 17462 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877413.1 protein_id gnl|my_center|LOCUS_04910 17560 19944 gene locus_tag LOCUS_04920 17560 19944 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390090.1 protein_id gnl|my_center|LOCUS_04920 19991 21586 gene locus_tag LOCUS_04930 19991 21586 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530022.1 protein_id gnl|my_center|LOCUS_04930 21583 22776 gene locus_tag LOCUS_04940 21583 22776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 24682 22967 gene locus_tag LOCUS_04950 24682 22967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 25068 26015 gene locus_tag LOCUS_04960 25068 26015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 27781 26345 gene locus_tag LOCUS_04970 27781 26345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 28003 27803 gene locus_tag LOCUS_04980 28003 27803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 29536 28067 gene locus_tag LOCUS_04990 29536 28067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 30329 30796 gene locus_tag LOCUS_05000 30329 30796 CDS product DNA gyrase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226534.1 protein_id gnl|my_center|LOCUS_05000 30846 31139 gene locus_tag LOCUS_05010 30846 31139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 31845 32405 gene locus_tag LOCUS_05020 31845 32405 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_05020 32405 35260 gene locus_tag LOCUS_05030 32405 35260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 38070 35305 gene locus_tag LOCUS_05040 38070 35305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 38989 38258 gene locus_tag LOCUS_05050 38989 38258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 39192 41615 gene locus_tag LOCUS_05060 39192 41615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 42782 41763 gene locus_tag LOCUS_05070 42782 41763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 44169 42988 gene locus_tag LOCUS_05080 44169 42988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 46039 45278 gene locus_tag LOCUS_05090 46039 45278 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403037.1 protein_id gnl|my_center|LOCUS_05090 47064 46027 gene locus_tag LOCUS_05100 47064 46027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 48313 47102 gene locus_tag LOCUS_05110 48313 47102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 49407 48787 gene locus_tag LOCUS_05120 49407 48787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 49847 51631 gene locus_tag LOCUS_05130 49847 51631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 53380 51632 gene locus_tag LOCUS_05140 53380 51632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 >Feature sequence010 892 467 gene locus_tag LOCUS_05150 892 467 CDS product quinol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198617.1 protein_id gnl|my_center|LOCUS_05150 993 1892 gene locus_tag LOCUS_05160 993 1892 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339002.1 protein_id gnl|my_center|LOCUS_05160 3547 1988 gene locus_tag LOCUS_05170 3547 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 3758 5077 gene locus_tag LOCUS_05180 3758 5077 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706404.1 protein_id gnl|my_center|LOCUS_05180 5638 5249 gene locus_tag LOCUS_05190 5638 5249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 6300 5680 gene locus_tag LOCUS_05200 6300 5680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 7990 6509 gene locus_tag LOCUS_05210 7990 6509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095844.1 protein_id gnl|my_center|LOCUS_05210 10281 8065 gene locus_tag LOCUS_05220 10281 8065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 10695 11537 gene locus_tag LOCUS_05230 gene speE 10695 11537 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P447 protein_id gnl|my_center|LOCUS_05230 11623 12888 gene locus_tag LOCUS_05240 gene norM 11623 12888 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783536.1 protein_id gnl|my_center|LOCUS_05240 12918 13826 gene locus_tag LOCUS_05250 12918 13826 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085811.1 protein_id gnl|my_center|LOCUS_05250 14015 14782 gene locus_tag LOCUS_05260 14015 14782 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707199.1 protein_id gnl|my_center|LOCUS_05260 14782 16143 gene locus_tag LOCUS_05270 gene ttpC 14782 16143 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071945.1 protein_id gnl|my_center|LOCUS_05270 16147 16671 gene locus_tag LOCUS_05280 16147 16671 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707201.1 protein_id gnl|my_center|LOCUS_05280 16680 17090 gene locus_tag LOCUS_05290 16680 17090 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458951.1 protein_id gnl|my_center|LOCUS_05290 17094 17702 gene locus_tag LOCUS_05300 17094 17702 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRU0 protein_id gnl|my_center|LOCUS_05300 17706 19025 gene locus_tag LOCUS_05310 17706 19025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707895.1 protein_id gnl|my_center|LOCUS_05310 19159 19779 gene locus_tag LOCUS_05320 19159 19779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 19834 20310 gene locus_tag LOCUS_05330 19834 20310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 21335 20583 gene locus_tag LOCUS_05340 21335 20583 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027504.1 protein_id gnl|my_center|LOCUS_05340 21373 22443 gene locus_tag LOCUS_05350 21373 22443 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528524.1 protein_id gnl|my_center|LOCUS_05350 22848 22327 gene locus_tag LOCUS_05360 22848 22327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 23406 22921 gene locus_tag LOCUS_05370 23406 22921 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038042.1 protein_id gnl|my_center|LOCUS_05370 24503 23514 gene locus_tag LOCUS_05380 gene chpB 24503 23514 CDS product protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD63 protein_id gnl|my_center|LOCUS_05380 31292 24513 gene locus_tag LOCUS_05390 31292 24513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 32212 31289 gene locus_tag LOCUS_05400 gene pilK 32212 31289 CDS product methyltransferase PilK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100938.1 protein_id gnl|my_center|LOCUS_05400 32849 32232 gene locus_tag LOCUS_05410 32849 32232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05410 34268 32850 gene locus_tag LOCUS_05420 34268 32850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05420 34405 34265 gene locus_tag LOCUS_05430 34405 34265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 34962 34420 gene locus_tag LOCUS_05440 gene pilI 34962 34420 CDS product pilus biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038046.1 protein_id gnl|my_center|LOCUS_05440 35329 34964 gene locus_tag LOCUS_05450 gene pilH 35329 34964 CDS product protein PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43501 protein_id gnl|my_center|LOCUS_05450 35760 35350 gene locus_tag LOCUS_05460 gene pilG 35760 35350 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038048.1 protein_id gnl|my_center|LOCUS_05460 36082 37026 gene locus_tag LOCUS_05470 gene gshB 36082 37026 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPT4 protein_id gnl|my_center|LOCUS_05470 37074 37958 gene locus_tag LOCUS_05480 gene tonB 37074 37958 CDS product cell envelope biogenesis protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038050.1 protein_id gnl|my_center|LOCUS_05480 38067 38657 gene locus_tag LOCUS_05490 38067 38657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 38768 39406 gene locus_tag LOCUS_05500 38768 39406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 39406 39801 gene locus_tag LOCUS_05510 39406 39801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525171.1 protein_id gnl|my_center|LOCUS_05510 40302 39808 gene locus_tag LOCUS_05520 40302 39808 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FPL2 protein_id gnl|my_center|LOCUS_05520 41206 40283 gene locus_tag LOCUS_05530 gene thiL 41206 40283 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHZ5 protein_id gnl|my_center|LOCUS_05530 41670 41203 gene locus_tag LOCUS_05540 gene nusB 41670 41203 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCM6 protein_id gnl|my_center|LOCUS_05540 42140 41667 gene locus_tag LOCUS_05550 gene ribH 42140 41667 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMY3 protein_id gnl|my_center|LOCUS_05550 43243 42137 gene locus_tag LOCUS_05560 gene ribA 43243 42137 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035935.1 protein_id gnl|my_center|LOCUS_05560 43884 43240 gene locus_tag LOCUS_05570 gene ribC 43884 43240 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005301612.1 protein_id gnl|my_center|LOCUS_05570 44948 43869 gene locus_tag LOCUS_05580 gene ribD 44948 43869 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCN1 protein_id gnl|my_center|LOCUS_05580 45457 44948 gene locus_tag LOCUS_05590 gene nrdR 45457 44948 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCN3 protein_id gnl|my_center|LOCUS_05590 46710 45457 gene locus_tag LOCUS_05600 gene glyA 46710 45457 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCN4 protein_id gnl|my_center|LOCUS_05600 46835 48892 gene locus_tag LOCUS_05610 46835 48892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 >Feature sequence011 374 2011 gene locus_tag LOCUS_05620 374 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 2763 2047 gene locus_tag LOCUS_05630 2763 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_232567.2 protein_id gnl|my_center|LOCUS_05630 3068 2943 gene locus_tag LOCUS_05640 3068 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 3797 3519 gene locus_tag LOCUS_05650 3797 3519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 3907 5124 gene locus_tag LOCUS_05660 3907 5124 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532243.1 protein_id gnl|my_center|LOCUS_05660 5639 5106 gene locus_tag LOCUS_05670 5639 5106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 6079 5639 gene locus_tag LOCUS_05680 6079 5639 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943873.1 protein_id gnl|my_center|LOCUS_05680 7823 6036 gene locus_tag LOCUS_05690 7823 6036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 8699 8502 gene locus_tag LOCUS_05700 8699 8502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 8742 10244 gene locus_tag LOCUS_05710 8742 10244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 10585 10944 gene locus_tag LOCUS_05720 10585 10944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 11001 12725 gene locus_tag LOCUS_05730 11001 12725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 12795 14441 gene locus_tag LOCUS_05740 12795 14441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027266.1 protein_id gnl|my_center|LOCUS_05740 14470 15105 gene locus_tag LOCUS_05750 14470 15105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 15280 17439 gene locus_tag LOCUS_05760 15280 17439 CDS product chromosome condensation regulator RCC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258200.1 protein_id gnl|my_center|LOCUS_05760 17496 18497 gene locus_tag LOCUS_05770 17496 18497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 19122 18796 gene locus_tag LOCUS_05780 19122 18796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225939.1 protein_id gnl|my_center|LOCUS_05780 19200 20378 gene locus_tag LOCUS_05790 19200 20378 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970762.1 protein_id gnl|my_center|LOCUS_05790 20365 20901 gene locus_tag LOCUS_05800 20365 20901 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403750.1 protein_id gnl|my_center|LOCUS_05800 20898 22247 gene locus_tag LOCUS_05810 20898 22247 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403751.1 protein_id gnl|my_center|LOCUS_05810 24635 22368 gene locus_tag LOCUS_05820 gene katG2 24635 22368 CDS product catalase-peroxidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIV5 protein_id gnl|my_center|LOCUS_05820 28708 25070 gene locus_tag LOCUS_05830 28708 25070 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962267.1 protein_id gnl|my_center|LOCUS_05830 29287 28790 gene locus_tag LOCUS_05840 29287 28790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 30255 29455 gene locus_tag LOCUS_05850 30255 29455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143505.1 protein_id gnl|my_center|LOCUS_05850 30967 30380 gene locus_tag LOCUS_05860 30967 30380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 31695 30964 gene locus_tag LOCUS_05870 31695 30964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 32920 31808 gene locus_tag LOCUS_05880 32920 31808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 33093 34712 gene locus_tag LOCUS_05890 33093 34712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 34815 37409 gene locus_tag LOCUS_05900 gene acnM 34815 37409 CDS product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188189.1 protein_id gnl|my_center|LOCUS_05900 37412 38590 gene locus_tag LOCUS_05910 37412 38590 CDS product putative methylaconitate Delta-isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036236.1 protein_id gnl|my_center|LOCUS_05910 38696 38986 gene locus_tag LOCUS_05920 38696 38986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 39427 41877 gene locus_tag LOCUS_05930 gene thrA 39427 41877 CDS product bifunctional aspartokinase I/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036970.1 protein_id gnl|my_center|LOCUS_05930 41874 42407 gene locus_tag LOCUS_05940 41874 42407 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072653.1 protein_id gnl|my_center|LOCUS_05940 43429 42386 gene locus_tag LOCUS_05950 43429 42386 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028993.1 protein_id gnl|my_center|LOCUS_05950 44043 43429 gene locus_tag LOCUS_05960 44043 43429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941153.1 protein_id gnl|my_center|LOCUS_05960 44689 44030 gene locus_tag LOCUS_05970 44689 44030 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118717.1 protein_id gnl|my_center|LOCUS_05970 45397 44690 gene locus_tag LOCUS_05980 45397 44690 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457207.1 protein_id gnl|my_center|LOCUS_05980 >Feature sequence012 <1 1675 gene locus_tag LOCUS_05990 <1 1675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003402551.1:ATP-dependent DNA helicase RecQ 1800 2825 gene locus_tag LOCUS_06000 1800 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 2804 3856 gene locus_tag LOCUS_06010 gene serC 2804 3856 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QA3 protein_id gnl|my_center|LOCUS_06010 3932 5014 gene locus_tag LOCUS_06020 gene pheA 3932 5014 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036772.1 protein_id gnl|my_center|LOCUS_06020 5119 6336 gene locus_tag LOCUS_06030 5119 6336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 6333 7019 gene locus_tag LOCUS_06040 gene cmk 6333 7019 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEH9 protein_id gnl|my_center|LOCUS_06040 7187 8857 gene locus_tag LOCUS_06050 gene rpsA 7187 8857 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8P5 protein_id gnl|my_center|LOCUS_06050 9033 9329 gene locus_tag LOCUS_06060 gene ihfB 9033 9329 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8P6 protein_id gnl|my_center|LOCUS_06060 9366 9695 gene locus_tag LOCUS_06070 9366 9695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 9688 10854 gene locus_tag LOCUS_06080 gene lapB 9688 10854 CDS product lipopolysaccharide assembly protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E07 protein_id gnl|my_center|LOCUS_06080 10855 11814 gene locus_tag LOCUS_06090 gene wbpL 10855 11814 CDS product glycosyltransferase WbpL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113413.1 protein_id gnl|my_center|LOCUS_06090 11807 13702 gene locus_tag LOCUS_06100 11807 13702 CDS product multidrug MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037335.1 protein_id gnl|my_center|LOCUS_06100 13709 14587 gene locus_tag LOCUS_06110 gene galU 13709 14587 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8Q1 protein_id gnl|my_center|LOCUS_06110 14603 15733 gene locus_tag LOCUS_06120 14603 15733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531927.1 protein_id gnl|my_center|LOCUS_06120 15730 16407 gene locus_tag LOCUS_06130 15730 16407 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287139.1 protein_id gnl|my_center|LOCUS_06130 16426 17817 gene locus_tag LOCUS_06140 16426 17817 CDS product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105412.1 protein_id gnl|my_center|LOCUS_06140 18831 17827 gene locus_tag LOCUS_06150 18831 17827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 19380 18859 gene locus_tag LOCUS_06160 19380 18859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 19919 19356 gene locus_tag LOCUS_06170 19919 19356 CDS product RNA polymerase sigma factor SigZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120749.1 protein_id gnl|my_center|LOCUS_06170 20136 20456 gene locus_tag LOCUS_06180 gene clpS 20136 20456 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P999 protein_id gnl|my_center|LOCUS_06180 20461 20646 gene locus_tag LOCUS_06190 20461 20646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 20636 22909 gene locus_tag LOCUS_06200 gene clpA 20636 22909 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037131.1 protein_id gnl|my_center|LOCUS_06200 23255 23034 gene locus_tag LOCUS_06210 gene infA 23255 23034 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZS2 protein_id gnl|my_center|LOCUS_06210 23451 26096 gene locus_tag LOCUS_06220 gene fadE 23451 26096 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705468.1 protein_id gnl|my_center|LOCUS_06220 26324 26782 gene locus_tag LOCUS_06230 26324 26782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 26779 27282 gene locus_tag LOCUS_06240 26779 27282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 28292 27459 gene locus_tag LOCUS_06250 gene kynA 28292 27459 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDA8 protein_id gnl|my_center|LOCUS_06250 28939 28376 gene locus_tag LOCUS_06260 28939 28376 CDS product elongation factor P-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9M3 protein_id gnl|my_center|LOCUS_06260 29713 28946 gene locus_tag LOCUS_06270 gene hadH2 29713 28946 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037001.1 protein_id gnl|my_center|LOCUS_06270 31720 29750 gene locus_tag LOCUS_06280 gene accC 31720 29750 CDS product 3-methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035499.1 protein_id gnl|my_center|LOCUS_06280 32504 31713 gene locus_tag LOCUS_06290 32504 31713 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037003.1 protein_id gnl|my_center|LOCUS_06290 34114 32507 gene locus_tag LOCUS_06300 gene accB 34114 32507 CDS product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929809.1 protein_id gnl|my_center|LOCUS_06300 35331 34114 gene locus_tag LOCUS_06310 gene ivdA 35331 34114 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071827.1 protein_id gnl|my_center|LOCUS_06310 36509 35355 gene locus_tag LOCUS_06320 36509 35355 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957928.1 protein_id gnl|my_center|LOCUS_06320 37686 36580 gene locus_tag LOCUS_06330 gene leu 37686 36580 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036492.1 protein_id gnl|my_center|LOCUS_06330 38061 38567 gene locus_tag LOCUS_06340 38061 38567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036217.1 protein_id gnl|my_center|LOCUS_06340 38681 38872 gene locus_tag LOCUS_06350 gene rpmF 38681 38872 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBV2 protein_id gnl|my_center|LOCUS_06350 39309 40226 gene locus_tag LOCUS_06360 gene fabH 39309 40226 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBV1 protein_id gnl|my_center|LOCUS_06360 40291 41220 gene locus_tag LOCUS_06370 gene fabD 40291 41220 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKH3 protein_id gnl|my_center|LOCUS_06370 41261 41995 gene locus_tag LOCUS_06380 gene fabG 41261 41995 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036220.1 protein_id gnl|my_center|LOCUS_06380 42130 42366 gene locus_tag LOCUS_06390 gene acpP 42130 42366 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63447 protein_id gnl|my_center|LOCUS_06390 42556 43791 gene locus_tag LOCUS_06400 gene fabF 42556 43791 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDH5 protein_id gnl|my_center|LOCUS_06400 43811 45157 gene locus_tag LOCUS_06410 gene trpE 43811 45157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036222.1 protein_id gnl|my_center|LOCUS_06410 45150 45920 gene locus_tag LOCUS_06420 gene pabC 45150 45920 CDS product 4-amino-4-deoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072564.1 protein_id gnl|my_center|LOCUS_06420 45914 46915 gene locus_tag LOCUS_06430 45914 46915 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036223.1 protein_id gnl|my_center|LOCUS_06430 46912 47544 gene locus_tag LOCUS_06440 gene tmk 46912 47544 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZN8 protein_id gnl|my_center|LOCUS_06440 >Feature sequence013 2400 2080 gene locus_tag LOCUS_06450 2400 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 3124 2567 gene locus_tag LOCUS_06460 3124 2567 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390063.1 protein_id gnl|my_center|LOCUS_06460 3571 3203 gene locus_tag LOCUS_06470 3571 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 3791 4333 gene locus_tag LOCUS_06480 3791 4333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 4330 4536 gene locus_tag LOCUS_06490 4330 4536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 4628 5761 gene locus_tag LOCUS_06500 4628 5761 CDS product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087559.1 protein_id gnl|my_center|LOCUS_06500 5938 6810 gene locus_tag LOCUS_06510 5938 6810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113146.1 protein_id gnl|my_center|LOCUS_06510 8946 7360 gene locus_tag LOCUS_06520 8946 7360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 9538 9338 gene locus_tag LOCUS_06530 9538 9338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 9695 10300 gene locus_tag LOCUS_06540 9695 10300 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088397.1 protein_id gnl|my_center|LOCUS_06540 10297 11409 gene locus_tag LOCUS_06550 10297 11409 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462020.1 protein_id gnl|my_center|LOCUS_06550 11402 12373 gene locus_tag LOCUS_06560 11402 12373 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704458.1 protein_id gnl|my_center|LOCUS_06560 12370 13455 gene locus_tag LOCUS_06570 12370 13455 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFJ3 protein_id gnl|my_center|LOCUS_06570 14028 16241 gene locus_tag LOCUS_06580 gene phuR 14028 16241 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036004.1 protein_id gnl|my_center|LOCUS_06580 16382 17344 gene locus_tag LOCUS_06590 16382 17344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636161.2 protein_id gnl|my_center|LOCUS_06590 18483 17518 gene locus_tag LOCUS_06600 18483 17518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973752.1 protein_id gnl|my_center|LOCUS_06600 18592 19050 gene locus_tag LOCUS_06610 18592 19050 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639856.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06610 19047 21254 gene locus_tag LOCUS_06620 19047 21254 CDS product isoquinoline 1-oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_06620 21660 22667 gene locus_tag LOCUS_06630 21660 22667 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583003.1 protein_id gnl|my_center|LOCUS_06630 22998 22801 gene locus_tag LOCUS_06640 22998 22801 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957320.1 protein_id gnl|my_center|LOCUS_06640 23206 24705 gene locus_tag LOCUS_06650 23206 24705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 26041 25064 gene locus_tag LOCUS_06660 26041 25064 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932741.1 protein_id gnl|my_center|LOCUS_06660 27587 26025 gene locus_tag LOCUS_06670 gene sglT 27587 26025 CDS product sodium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036949.1 protein_id gnl|my_center|LOCUS_06670 27921 28295 gene locus_tag LOCUS_06680 27921 28295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101529.1 protein_id gnl|my_center|LOCUS_06680 28366 30330 gene locus_tag LOCUS_06690 28366 30330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 30895 30344 gene locus_tag LOCUS_06700 30895 30344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 31451 31951 gene locus_tag LOCUS_06710 31451 31951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 32758 31982 gene locus_tag LOCUS_06720 32758 31982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 33139 33735 gene locus_tag LOCUS_06730 gene rfbC 33139 33735 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159758.1 protein_id gnl|my_center|LOCUS_06730 34234 33806 gene locus_tag LOCUS_06740 34234 33806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008474272.1 protein_id gnl|my_center|LOCUS_06740 34944 34231 gene locus_tag LOCUS_06750 34944 34231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 35329 35006 gene locus_tag LOCUS_06760 35329 35006 CDS product competence protein TfoX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975635.1 protein_id gnl|my_center|LOCUS_06760 35735 35379 gene locus_tag LOCUS_06770 35735 35379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 36245 35976 gene locus_tag LOCUS_06780 36245 35976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 36677 36264 gene locus_tag LOCUS_06790 36677 36264 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393351.1 protein_id gnl|my_center|LOCUS_06790 38040 36817 gene locus_tag LOCUS_06800 gene nqrF 38040 36817 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL1 protein_id gnl|my_center|LOCUS_06800 38651 38043 gene locus_tag LOCUS_06810 gene nqrE 38651 38043 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV5 protein_id gnl|my_center|LOCUS_06810 39280 38651 gene locus_tag LOCUS_06820 gene nqrD 39280 38651 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHC9 protein_id gnl|my_center|LOCUS_06820 40008 39283 gene locus_tag LOCUS_06830 gene nqrC 40008 39283 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK8 protein_id gnl|my_center|LOCUS_06830 40884 40018 gene locus_tag LOCUS_06840 40884 40018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 42221 40923 gene locus_tag LOCUS_06850 gene nqrA 42221 40923 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K0M3 protein_id gnl|my_center|LOCUS_06850 42332 43153 gene locus_tag LOCUS_06860 gene dmsE 42332 43153 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071629.1 protein_id gnl|my_center|LOCUS_06860 43150 44997 gene locus_tag LOCUS_06870 43150 44997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 45340 45264 gene locus_tag LOCUS_t00020 45340 45264 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 45762 46070 gene locus_tag LOCUS_06880 45762 46070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 >Feature sequence014 2679 2266 gene locus_tag LOCUS_06890 2679 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 3788 2679 gene locus_tag LOCUS_06900 3788 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 4623 3928 gene locus_tag LOCUS_06910 4623 3928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 4802 6853 gene locus_tag LOCUS_06920 4802 6853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 7098 7643 gene locus_tag LOCUS_06930 7098 7643 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_06930 7643 8116 gene locus_tag LOCUS_06940 7643 8116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06940 8219 9862 gene locus_tag LOCUS_06950 8219 9862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06950 10401 9955 gene locus_tag LOCUS_06960 10401 9955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 10450 11727 gene locus_tag LOCUS_06970 10450 11727 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888067.1 protein_id gnl|my_center|LOCUS_06970 12661 11882 gene locus_tag LOCUS_06980 gene pstB 12661 11882 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU0 protein_id gnl|my_center|LOCUS_06980 13899 12661 gene locus_tag LOCUS_06990 13899 12661 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU1 protein_id gnl|my_center|LOCUS_06990 15268 13886 gene locus_tag LOCUS_07000 15268 13886 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU2 protein_id gnl|my_center|LOCUS_07000 16414 15380 gene locus_tag LOCUS_07010 16414 15380 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_07010 16609 17385 gene locus_tag LOCUS_07020 gene phoU 16609 17385 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG81 protein_id gnl|my_center|LOCUS_07020 17401 18651 gene locus_tag LOCUS_07030 17401 18651 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTY3 protein_id gnl|my_center|LOCUS_07030 18513 18598 gene locus_tag LOCUS_t00030 18513 18598 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 18658 19317 gene locus_tag LOCUS_07040 18658 19317 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114053.1 protein_id gnl|my_center|LOCUS_07040 19328 20713 gene locus_tag LOCUS_07050 19328 20713 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028583.1 protein_id gnl|my_center|LOCUS_07050 21448 21059 gene locus_tag LOCUS_07060 21448 21059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 21585 22658 gene locus_tag LOCUS_07070 21585 22658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 22642 23301 gene locus_tag LOCUS_07080 22642 23301 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876386.1 protein_id gnl|my_center|LOCUS_07080 23359 23991 gene locus_tag LOCUS_07090 23359 23991 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019283.1 protein_id gnl|my_center|LOCUS_07090 24001 25053 gene locus_tag LOCUS_07100 24001 25053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 25088 26302 gene locus_tag LOCUS_07110 25088 26302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 27265 26288 gene locus_tag LOCUS_07120 27265 26288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 27512 28126 gene locus_tag LOCUS_07130 27512 28126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 28197 31127 gene locus_tag LOCUS_07140 28197 31127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 31864 31160 gene locus_tag LOCUS_07150 31864 31160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 31975 32958 gene locus_tag LOCUS_07160 gene gmd 31975 32958 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMK2 protein_id gnl|my_center|LOCUS_07160 33565 33143 gene locus_tag LOCUS_07170 33565 33143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 33792 34238 gene locus_tag LOCUS_07180 33792 34238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104529.1 protein_id gnl|my_center|LOCUS_07180 35579 34248 gene locus_tag LOCUS_07190 35579 34248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 36459 35701 gene locus_tag LOCUS_07200 36459 35701 CDS product carboxyvinyl-carboxyphosphonate phosphorylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706661.1 protein_id gnl|my_center|LOCUS_07200 37582 36536 gene locus_tag LOCUS_07210 37582 36536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918442.1 protein_id gnl|my_center|LOCUS_07210 39538 37586 gene locus_tag LOCUS_07220 39538 37586 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119822.1 protein_id gnl|my_center|LOCUS_07220 42691 39629 gene locus_tag LOCUS_07230 42691 39629 CDS product resistance-nodulation-cell division efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092464.1 protein_id gnl|my_center|LOCUS_07230 43782 42688 gene locus_tag LOCUS_07240 43782 42688 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974634.1 protein_id gnl|my_center|LOCUS_07240 46148 43779 gene locus_tag LOCUS_07250 46148 43779 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402869.1 protein_id gnl|my_center|LOCUS_07250 >Feature sequence015 572 84 gene locus_tag LOCUS_07260 572 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 812 3355 gene locus_tag LOCUS_07270 812 3355 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404296.1 protein_id gnl|my_center|LOCUS_07270 5798 3360 gene locus_tag LOCUS_07280 5798 3360 CDS product CSLREA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256205.1 protein_id gnl|my_center|LOCUS_07280 7922 5835 gene locus_tag LOCUS_07290 7922 5835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 10783 7919 gene locus_tag LOCUS_07300 10783 7919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 12152 10947 gene locus_tag LOCUS_07310 12152 10947 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969697.1 protein_id gnl|my_center|LOCUS_07310 14576 12357 gene locus_tag LOCUS_07320 14576 12357 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083633.1 protein_id gnl|my_center|LOCUS_07320 15101 14643 gene locus_tag LOCUS_07330 15101 14643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 15901 15233 gene locus_tag LOCUS_07340 15901 15233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07340 16657 15905 gene locus_tag LOCUS_07350 16657 15905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07350 16781 18481 gene locus_tag LOCUS_07360 16781 18481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 21558 18502 gene locus_tag LOCUS_07370 21558 18502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 24707 21606 gene locus_tag LOCUS_07380 24707 21606 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403109.1 protein_id gnl|my_center|LOCUS_07380 25741 24704 gene locus_tag LOCUS_07390 25741 24704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 26092 25814 gene locus_tag LOCUS_07400 26092 25814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 26978 26055 gene locus_tag LOCUS_07410 26978 26055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 28010 27120 gene locus_tag LOCUS_07420 28010 27120 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 protein_id gnl|my_center|LOCUS_07420 31368 28003 gene locus_tag LOCUS_07430 31368 28003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 31690 32490 gene locus_tag LOCUS_07440 31690 32490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 33344 32514 gene locus_tag LOCUS_07450 33344 32514 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085663.1 protein_id gnl|my_center|LOCUS_07450 34932 33388 gene locus_tag LOCUS_07460 34932 33388 CDS product diacylglycerol O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MGS2 protein_id gnl|my_center|LOCUS_07460 35385 34939 gene locus_tag LOCUS_07470 35385 34939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 35423 36073 gene locus_tag LOCUS_07480 gene arp 35423 36073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155666.1 protein_id gnl|my_center|LOCUS_07480 36135 37589 gene locus_tag LOCUS_07490 gene dapE 36135 37589 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037909.1 protein_id gnl|my_center|LOCUS_07490 37979 38260 gene locus_tag LOCUS_07500 37979 38260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 39506 38424 gene locus_tag LOCUS_07510 39506 38424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 42246 39499 gene locus_tag LOCUS_07520 42246 39499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 42389 44092 gene locus_tag LOCUS_07530 42389 44092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 >Feature sequence016 <1 1092 gene locus_tag LOCUS_07540 <1 1092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_705964.1:threonine synthase 1255 2700 gene locus_tag LOCUS_07550 1255 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 2672 10993 gene locus_tag LOCUS_07560 2672 10993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 10990 18918 gene locus_tag LOCUS_07570 10990 18918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 18915 25571 gene locus_tag LOCUS_07580 18915 25571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 25574 26347 gene locus_tag LOCUS_07590 25574 26347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 26876 26754 gene locus_tag LOCUS_07600 26876 26754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 29158 26921 gene locus_tag LOCUS_07610 29158 26921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 29663 30676 gene locus_tag LOCUS_07620 29663 30676 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706209.1 protein_id gnl|my_center|LOCUS_07620 30913 31299 gene locus_tag LOCUS_07630 30913 31299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 31305 34913 gene locus_tag LOCUS_07640 31305 34913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 35175 35720 gene locus_tag LOCUS_07650 35175 35720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 35758 36210 gene locus_tag LOCUS_07660 35758 36210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 38451 36253 gene locus_tag LOCUS_07670 38451 36253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 38673 39155 gene locus_tag LOCUS_07680 gene slyD 38673 39155 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7M9 protein_id gnl|my_center|LOCUS_07680 39450 39731 gene locus_tag LOCUS_07690 39450 39731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 39878 40318 gene locus_tag LOCUS_07700 39878 40318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 40427 40849 gene locus_tag LOCUS_07710 40427 40849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 40942 43440 gene locus_tag LOCUS_07720 40942 43440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 <44474 43481 gene locus_tag LOCUS_07730 <44474 43481 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072660.1:TonB-dependent receptor >Feature sequence017 2804 1734 gene locus_tag LOCUS_07740 2804 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 3051 2785 gene locus_tag LOCUS_07750 3051 2785 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JRB1 protein_id gnl|my_center|LOCUS_07750 3212 3370 gene locus_tag LOCUS_07760 3212 3370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 3403 3573 gene locus_tag LOCUS_07770 3403 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 4072 3749 gene locus_tag LOCUS_07780 4072 3749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 4478 4059 gene locus_tag LOCUS_07790 4478 4059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 6718 4526 gene locus_tag LOCUS_07800 6718 4526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638601.2 protein_id gnl|my_center|LOCUS_07800 7119 7613 gene locus_tag LOCUS_07810 gene rppH 7119 7613 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD65 protein_id gnl|my_center|LOCUS_07810 7627 7893 gene locus_tag LOCUS_07820 7627 7893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 9350 7890 gene locus_tag LOCUS_07830 9350 7890 CDS product O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064414.1 protein_id gnl|my_center|LOCUS_07830 9635 11929 gene locus_tag LOCUS_07840 9635 11929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 11922 13316 gene locus_tag LOCUS_07850 gene norM 11922 13316 CDS product putative multidrug resistance protein NorM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4E6 protein_id gnl|my_center|LOCUS_07850 13863 13321 gene locus_tag LOCUS_07860 13863 13321 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918215.1 protein_id gnl|my_center|LOCUS_07860 13981 15738 gene locus_tag LOCUS_07870 13981 15738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 16823 15759 gene locus_tag LOCUS_07880 16823 15759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 17036 18058 gene locus_tag LOCUS_07890 17036 18058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 18980 18138 gene locus_tag LOCUS_07900 18980 18138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 20278 18977 gene locus_tag LOCUS_07910 20278 18977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 20808 20449 gene locus_tag LOCUS_07920 20808 20449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 21572 20937 gene locus_tag LOCUS_07930 21572 20937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083175.1 protein_id gnl|my_center|LOCUS_07930 22169 21759 gene locus_tag LOCUS_07940 22169 21759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 23378 22953 gene locus_tag LOCUS_07950 23378 22953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 23999 23490 gene locus_tag LOCUS_07960 23999 23490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902921.1 protein_id gnl|my_center|LOCUS_07960 24556 24365 gene locus_tag LOCUS_07970 24556 24365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 24863 24567 gene locus_tag LOCUS_07980 24863 24567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 25340 24969 gene locus_tag LOCUS_07990 25340 24969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029235.1 protein_id gnl|my_center|LOCUS_07990 25672 25520 gene locus_tag LOCUS_08000 25672 25520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 27060 26686 gene locus_tag LOCUS_08010 27060 26686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 27564 27331 gene locus_tag LOCUS_08020 27564 27331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 28089 27667 gene locus_tag LOCUS_08030 28089 27667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 29114 28143 gene locus_tag LOCUS_08040 29114 28143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 32585 29262 gene locus_tag LOCUS_08050 32585 29262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 33089 32745 gene locus_tag LOCUS_08060 33089 32745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 33262 33654 gene locus_tag LOCUS_08070 33262 33654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724527.1 protein_id gnl|my_center|LOCUS_08070 33670 35106 gene locus_tag LOCUS_08080 33670 35106 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477390.1 protein_id gnl|my_center|LOCUS_08080 36337 35063 gene locus_tag LOCUS_08090 36337 35063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 37715 36312 gene locus_tag LOCUS_08100 37715 36312 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119569.1 protein_id gnl|my_center|LOCUS_08100 39192 37996 gene locus_tag LOCUS_08110 39192 37996 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817791.1 protein_id gnl|my_center|LOCUS_08110 39302 39874 gene locus_tag LOCUS_08120 39302 39874 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_08120 39871 42432 gene locus_tag LOCUS_08130 39871 42432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 43129 42437 gene locus_tag LOCUS_08140 43129 42437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 43241 43579 gene locus_tag LOCUS_08150 43241 43579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 >Feature sequence018 845 78 gene locus_tag LOCUS_08160 gene xthA1 845 78 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039115.1 protein_id gnl|my_center|LOCUS_08160 2878 845 gene locus_tag LOCUS_08170 2878 845 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070205.1 protein_id gnl|my_center|LOCUS_08170 3053 3583 gene locus_tag LOCUS_08180 3053 3583 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401536.1 protein_id gnl|my_center|LOCUS_08180 5796 3568 gene locus_tag LOCUS_08190 5796 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 5795 7564 gene locus_tag LOCUS_08200 gene aspS 5795 7564 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QV2 protein_id gnl|my_center|LOCUS_08200 7653 9029 gene locus_tag LOCUS_08210 gene phdB 7653 9029 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD06 protein_id gnl|my_center|LOCUS_08210 9053 9559 gene locus_tag LOCUS_08220 9053 9559 CDS product aspartyl protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105246.1 protein_id gnl|my_center|LOCUS_08220 9556 10281 gene locus_tag LOCUS_08230 gene sfsA 9556 10281 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61664 protein_id gnl|my_center|LOCUS_08230 10425 11831 gene locus_tag LOCUS_08240 10425 11831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 12153 12683 gene locus_tag LOCUS_08250 gene aroK 12153 12683 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNV1 protein_id gnl|my_center|LOCUS_08250 12676 13782 gene locus_tag LOCUS_08260 gene aroB 12676 13782 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q57 protein_id gnl|my_center|LOCUS_08260 13782 14036 gene locus_tag LOCUS_08270 13782 14036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 14033 15460 gene locus_tag LOCUS_08280 14033 15460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 15524 16582 gene locus_tag LOCUS_08290 gene hemE 15524 16582 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FMF2 protein_id gnl|my_center|LOCUS_08290 17239 16592 gene locus_tag LOCUS_08300 17239 16592 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267416.1 protein_id gnl|my_center|LOCUS_08300 17238 17915 gene locus_tag LOCUS_08310 17238 17915 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 protein_id gnl|my_center|LOCUS_08310 17912 20386 gene locus_tag LOCUS_08320 17912 20386 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036012.1 protein_id gnl|my_center|LOCUS_08320 20518 23535 gene locus_tag LOCUS_08330 20518 23535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636891.2 protein_id gnl|my_center|LOCUS_08330 23866 24402 gene locus_tag LOCUS_08340 23866 24402 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814464.1 protein_id gnl|my_center|LOCUS_08340 24402 25382 gene locus_tag LOCUS_08350 24402 25382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 25576 27987 gene locus_tag LOCUS_08360 25576 27987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 28112 30808 gene locus_tag LOCUS_08370 28112 30808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 30865 32844 gene locus_tag LOCUS_08380 30865 32844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120805.1 protein_id gnl|my_center|LOCUS_08380 32953 35064 gene locus_tag LOCUS_08390 gene amyA 32953 35064 CDS product putative cyclomaltodextrin glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_269428.1 protein_id gnl|my_center|LOCUS_08390 35679 37127 gene locus_tag LOCUS_08400 35679 37127 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902502.1 protein_id gnl|my_center|LOCUS_08400 37610 38431 gene locus_tag LOCUS_08410 37610 38431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 38474 39439 gene locus_tag LOCUS_08420 38474 39439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 39521 42727 gene locus_tag LOCUS_08430 39521 42727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 42724 43551 gene locus_tag LOCUS_08440 42724 43551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 >Feature sequence019 54 1049 gene locus_tag LOCUS_08450 54 1049 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036484.1 protein_id gnl|my_center|LOCUS_08450 1042 2646 gene locus_tag LOCUS_08460 gene lig2 1042 2646 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036483.1 protein_id gnl|my_center|LOCUS_08460 2630 5092 gene locus_tag LOCUS_08470 2630 5092 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268715.1 protein_id gnl|my_center|LOCUS_08470 5085 5729 gene locus_tag LOCUS_08480 5085 5729 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268716.1 protein_id gnl|my_center|LOCUS_08480 5793 7166 gene locus_tag LOCUS_08490 5793 7166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 7133 10267 gene locus_tag LOCUS_08500 7133 10267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 10808 10353 gene locus_tag LOCUS_08510 10808 10353 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977127.1 protein_id gnl|my_center|LOCUS_08510 10977 12089 gene locus_tag LOCUS_08520 gene prpC 10977 12089 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJW2 protein_id gnl|my_center|LOCUS_08520 12650 12228 gene locus_tag LOCUS_08530 12650 12228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 16011 12754 gene locus_tag LOCUS_08540 16011 12754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_08540 16939 16043 gene locus_tag LOCUS_08550 16939 16043 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123518.1 protein_id gnl|my_center|LOCUS_08550 17494 16943 gene locus_tag LOCUS_08560 17494 16943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120933.1 protein_id gnl|my_center|LOCUS_08560 19857 17758 gene locus_tag LOCUS_08570 19857 17758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 21733 19931 gene locus_tag LOCUS_08580 21733 19931 CDS product flavin monoamine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038380.1 protein_id gnl|my_center|LOCUS_08580 21813 23180 gene locus_tag LOCUS_08590 21813 23180 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022902.1 protein_id gnl|my_center|LOCUS_08590 23862 23170 gene locus_tag LOCUS_08600 23862 23170 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140297.1 protein_id gnl|my_center|LOCUS_08600 24072 24326 gene locus_tag LOCUS_08610 24072 24326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727907.1 protein_id gnl|my_center|LOCUS_08610 25662 24364 gene locus_tag LOCUS_08620 25662 24364 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461637.1 protein_id gnl|my_center|LOCUS_08620 26980 25724 gene locus_tag LOCUS_08630 26980 25724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 27681 26977 gene locus_tag LOCUS_08640 gene colR 27681 26977 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003490678.1 protein_id gnl|my_center|LOCUS_08640 28678 27671 gene locus_tag LOCUS_08650 28678 27671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 28883 29833 gene locus_tag LOCUS_08660 28883 29833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 30375 33080 gene locus_tag LOCUS_08670 30375 33080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 34190 34840 gene locus_tag LOCUS_08680 34190 34840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208448.1 protein_id gnl|my_center|LOCUS_08680 35599 34895 gene locus_tag LOCUS_08690 35599 34895 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265940.1 protein_id gnl|my_center|LOCUS_08690 36141 35788 gene locus_tag LOCUS_08700 36141 35788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 40497 37108 gene locus_tag LOCUS_08710 40497 37108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 41889 40618 gene locus_tag LOCUS_08720 41889 40618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 >Feature sequence020 873 442 gene locus_tag LOCUS_08730 gene stbB 873 442 CDS product plasmid stability protein StbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q52562 protein_id gnl|my_center|LOCUS_08730 1229 864 gene locus_tag LOCUS_08740 1229 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 1343 3574 gene locus_tag LOCUS_08750 gene dpp4 1343 3574 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073719.1 protein_id gnl|my_center|LOCUS_08750 3571 3909 gene locus_tag LOCUS_08760 3571 3909 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635217.1 protein_id gnl|my_center|LOCUS_08760 5779 4103 gene locus_tag LOCUS_08770 5779 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 8422 6146 gene locus_tag LOCUS_08780 8422 6146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 9747 8596 gene locus_tag LOCUS_08790 9747 8596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112812.1 protein_id gnl|my_center|LOCUS_08790 10153 10081 gene locus_tag LOCUS_t00040 10153 10081 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 10760 10368 gene locus_tag LOCUS_08800 10760 10368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 11538 10978 gene locus_tag LOCUS_08810 11538 10978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637786.2 protein_id gnl|my_center|LOCUS_08810 11880 11689 gene locus_tag LOCUS_08820 11880 11689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 12961 11873 gene locus_tag LOCUS_08830 12961 11873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 14393 13194 gene locus_tag LOCUS_08840 gene rtcB 14393 13194 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNA2 protein_id gnl|my_center|LOCUS_08840 15402 15992 gene locus_tag LOCUS_08850 gene tdk 15402 15992 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3C8 protein_id gnl|my_center|LOCUS_08850 16047 17060 gene locus_tag LOCUS_08860 gene tsaD 16047 17060 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMF4 protein_id gnl|my_center|LOCUS_08860 17053 17427 gene locus_tag LOCUS_08870 gene folB 17053 17427 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P495 protein_id gnl|my_center|LOCUS_08870 17451 18206 gene locus_tag LOCUS_08880 17451 18206 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140499.1 protein_id gnl|my_center|LOCUS_08880 18794 18210 gene locus_tag LOCUS_08890 18794 18210 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_08890 19090 19356 gene locus_tag LOCUS_08900 19090 19356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 19425 20303 gene locus_tag LOCUS_08910 19425 20303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 22433 20658 gene locus_tag LOCUS_08920 gene recD 22433 20658 CDS product RecBCD enzyme subunit RecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDI0 protein_id gnl|my_center|LOCUS_08920 25984 22430 gene locus_tag LOCUS_08930 gene recB 25984 22430 CDS product RecBCD enzyme subunit RecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQ58 protein_id gnl|my_center|LOCUS_08930 29301 25981 gene locus_tag LOCUS_08940 gene recC 29301 25981 CDS product RecBCD enzyme subunit RecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQ59 protein_id gnl|my_center|LOCUS_08940 29325 29489 gene locus_tag LOCUS_08950 29325 29489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 29765 29583 gene locus_tag LOCUS_08960 29765 29583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 30159 30371 gene locus_tag LOCUS_08970 30159 30371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 30582 31499 gene locus_tag LOCUS_08980 30582 31499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 32707 31865 gene locus_tag LOCUS_08990 32707 31865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123813.1 protein_id gnl|my_center|LOCUS_08990 33722 32733 gene locus_tag LOCUS_09000 33722 32733 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122373.1 protein_id gnl|my_center|LOCUS_09000 33859 34782 gene locus_tag LOCUS_09010 33859 34782 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974445.1 protein_id gnl|my_center|LOCUS_09010 35094 34717 gene locus_tag LOCUS_09020 35094 34717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 35245 37956 gene locus_tag LOCUS_09030 35245 37956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 37922 38146 gene locus_tag LOCUS_09040 37922 38146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 38683 41550 gene locus_tag LOCUS_09050 38683 41550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 >Feature sequence021 430 771 gene locus_tag LOCUS_09060 430 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 1484 777 gene locus_tag LOCUS_09070 1484 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088487.1 protein_id gnl|my_center|LOCUS_09070 3439 1481 gene locus_tag LOCUS_09080 3439 1481 CDS product acetoacetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113499.1 protein_id gnl|my_center|LOCUS_09080 3591 5225 gene locus_tag LOCUS_09090 3591 5225 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP5 protein_id gnl|my_center|LOCUS_09090 5726 5349 gene locus_tag LOCUS_09100 5726 5349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 6283 5729 gene locus_tag LOCUS_09110 6283 5729 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708362.1 protein_id gnl|my_center|LOCUS_09110 8189 6744 gene locus_tag LOCUS_09120 gene nuoN 8189 6744 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7U4 protein_id gnl|my_center|LOCUS_09120 9710 8193 gene locus_tag LOCUS_09130 gene nuoM 9710 8193 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037648.1 protein_id gnl|my_center|LOCUS_09130 11671 9725 gene locus_tag LOCUS_09140 gene nuoL 11671 9725 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813919.1 protein_id gnl|my_center|LOCUS_09140 11983 11678 gene locus_tag LOCUS_09150 gene nuoK 11983 11678 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CLR2 protein_id gnl|my_center|LOCUS_09150 12603 11980 gene locus_tag LOCUS_09160 gene nuoJ 12603 11980 CDS product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037650.1 protein_id gnl|my_center|LOCUS_09160 13106 12600 gene locus_tag LOCUS_09170 gene nuoI 13106 12600 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7U0 protein_id gnl|my_center|LOCUS_09170 14113 13085 gene locus_tag LOCUS_09180 gene nuoH 14113 13085 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BR2 protein_id gnl|my_center|LOCUS_09180 16349 14103 gene locus_tag LOCUS_09190 gene nuoG 16349 14103 CDS product NADH-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7T8 protein_id gnl|my_center|LOCUS_09190 17665 16346 gene locus_tag LOCUS_09200 gene nuoF 17665 16346 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037654.1 protein_id gnl|my_center|LOCUS_09200 18157 17669 gene locus_tag LOCUS_09210 gene nuoE 18157 17669 CDS product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037655.1 protein_id gnl|my_center|LOCUS_09210 19407 18154 gene locus_tag LOCUS_09220 gene nuoD 19407 18154 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7T5 protein_id gnl|my_center|LOCUS_09220 20107 19412 gene locus_tag LOCUS_09230 gene nuoC 20107 19412 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7T4 protein_id gnl|my_center|LOCUS_09230 20647 20111 gene locus_tag LOCUS_09240 gene nuoB 20647 20111 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7T3 protein_id gnl|my_center|LOCUS_09240 20994 20638 gene locus_tag LOCUS_09250 gene nuoA 20994 20638 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M9S8 protein_id gnl|my_center|LOCUS_09250 21330 21246 gene locus_tag LOCUS_t00050 21330 21246 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 21841 21398 gene locus_tag LOCUS_09260 gene secG 21841 21398 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481580.1 protein_id gnl|my_center|LOCUS_09260 22748 21975 gene locus_tag LOCUS_09270 gene tpiA 22748 21975 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7T0 protein_id gnl|my_center|LOCUS_09270 24169 22832 gene locus_tag LOCUS_09280 24169 22832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 24993 24160 gene locus_tag LOCUS_09290 24993 24160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 26869 24920 gene locus_tag LOCUS_09300 26869 24920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 26848 28605 gene locus_tag LOCUS_09310 26848 28605 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004343881.1 protein_id gnl|my_center|LOCUS_09310 28602 32312 gene locus_tag LOCUS_09320 28602 32312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 33826 32291 gene locus_tag LOCUS_09330 gene ppx 33826 32291 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036174.1 protein_id gnl|my_center|LOCUS_09330 33964 35145 gene locus_tag LOCUS_09340 gene kbl 33964 35145 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC15 protein_id gnl|my_center|LOCUS_09340 35201 35641 gene locus_tag LOCUS_09350 35201 35641 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073267.1 protein_id gnl|my_center|LOCUS_09350 35641 36564 gene locus_tag LOCUS_09360 gene desC 35641 36564 CDS product delta 9 acyl-lipid fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036524.1 protein_id gnl|my_center|LOCUS_09360 36583 37836 gene locus_tag LOCUS_09370 36583 37836 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036523.1 protein_id gnl|my_center|LOCUS_09370 37838 38587 gene locus_tag LOCUS_09380 37838 38587 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036522.1 protein_id gnl|my_center|LOCUS_09380 38584 39837 gene locus_tag LOCUS_09390 gene cfaA 38584 39837 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636703.2 protein_id gnl|my_center|LOCUS_09390 39834 40373 gene locus_tag LOCUS_09400 39834 40373 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036520.1 protein_id gnl|my_center|LOCUS_09400 >Feature sequence022 1436 945 gene locus_tag LOCUS_09410 gene allA 1436 945 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JH1 protein_id gnl|my_center|LOCUS_09410 2377 1436 gene locus_tag LOCUS_09420 gene alc1 2377 1436 CDS product putative allantoicase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63T53 protein_id gnl|my_center|LOCUS_09420 2895 2374 gene locus_tag LOCUS_09430 2895 2374 CDS product OHCU decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061423.1 protein_id gnl|my_center|LOCUS_09430 3728 2895 gene locus_tag LOCUS_09440 3728 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083336.1 protein_id gnl|my_center|LOCUS_09440 3660 3845 gene locus_tag LOCUS_09450 3660 3845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 3890 4237 gene locus_tag LOCUS_09460 3890 4237 CDS product 5-hydroxyisourate hydrolase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92UG5 protein_id gnl|my_center|LOCUS_09460 4237 5697 gene locus_tag LOCUS_09470 gene xdhA2 4237 5697 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975969.1 protein_id gnl|my_center|LOCUS_09470 5684 8005 gene locus_tag LOCUS_09480 gene xdhB 5684 8005 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708904.1 protein_id gnl|my_center|LOCUS_09480 8614 8009 gene locus_tag LOCUS_09490 8614 8009 CDS product electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB6 protein_id gnl|my_center|LOCUS_09490 8731 11538 gene locus_tag LOCUS_09500 8731 11538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 12419 11532 gene locus_tag LOCUS_09510 gene rsgA 12419 11532 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL3 protein_id gnl|my_center|LOCUS_09510 13137 12445 gene locus_tag LOCUS_09520 13137 12445 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262216.1 protein_id gnl|my_center|LOCUS_09520 14563 13220 gene locus_tag LOCUS_09530 14563 13220 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267709.1 protein_id gnl|my_center|LOCUS_09530 14686 16023 gene locus_tag LOCUS_09540 gene rimO 14686 16023 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P8X9 protein_id gnl|my_center|LOCUS_09540 16020 17006 gene locus_tag LOCUS_09550 gene rsmC 16020 17006 CDS product ribosomal RNA small subunit methyltransferase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CG56 protein_id gnl|my_center|LOCUS_09550 17132 18385 gene locus_tag LOCUS_09560 17132 18385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 18382 18873 gene locus_tag LOCUS_09570 18382 18873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 20027 19044 gene locus_tag LOCUS_09580 gene cysK 20027 19044 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P600 protein_id gnl|my_center|LOCUS_09580 20139 20960 gene locus_tag LOCUS_09590 20139 20960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706124.1 protein_id gnl|my_center|LOCUS_09590 21011 21571 gene locus_tag LOCUS_09600 21011 21571 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404669.1 protein_id gnl|my_center|LOCUS_09600 21561 22238 gene locus_tag LOCUS_09610 21561 22238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 22235 23080 gene locus_tag LOCUS_09620 22235 23080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 23085 23882 gene locus_tag LOCUS_09630 23085 23882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 23926 24636 gene locus_tag LOCUS_09640 gene gufA 23926 24636 CDS product divalent cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123018.1 protein_id gnl|my_center|LOCUS_09640 24921 24845 gene locus_tag LOCUS_t00060 24921 24845 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 25092 28412 gene locus_tag LOCUS_09650 25092 28412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 28615 30519 gene locus_tag LOCUS_09660 gene thrS 28615 30519 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZS05 protein_id gnl|my_center|LOCUS_09660 30578 31054 gene locus_tag LOCUS_09670 gene infC 30578 31054 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7Z3 protein_id gnl|my_center|LOCUS_09670 31227 31424 gene locus_tag LOCUS_09680 gene rpmI 31227 31424 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66283 protein_id gnl|my_center|LOCUS_09680 31437 31796 gene locus_tag LOCUS_09690 gene rplT 31437 31796 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7Z4 protein_id gnl|my_center|LOCUS_09690 31911 32921 gene locus_tag LOCUS_09700 gene pheS 31911 32921 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7Z5 protein_id gnl|my_center|LOCUS_09700 33131 32865 gene locus_tag LOCUS_09710 33131 32865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 33024 35333 gene locus_tag LOCUS_09720 gene pheT 33024 35333 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7Z6 protein_id gnl|my_center|LOCUS_09720 35337 35639 gene locus_tag LOCUS_09730 gene ihfA 35337 35639 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A0T9 protein_id gnl|my_center|LOCUS_09730 35617 35973 gene locus_tag LOCUS_09740 35617 35973 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005995911.1 protein_id gnl|my_center|LOCUS_09740 36068 38080 gene locus_tag LOCUS_09750 36068 38080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 38120 39661 gene locus_tag LOCUS_09760 38120 39661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880602.1 protein_id gnl|my_center|LOCUS_09760 >Feature sequence023 510 878 gene locus_tag LOCUS_09770 510 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 906 1802 gene locus_tag LOCUS_09780 906 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 2129 2647 gene locus_tag LOCUS_09790 2129 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 2676 2978 gene locus_tag LOCUS_09800 2676 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 3585 5603 gene locus_tag LOCUS_09810 3585 5603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141384.1 protein_id gnl|my_center|LOCUS_09810 5658 6104 gene locus_tag LOCUS_09820 5658 6104 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524850.1 protein_id gnl|my_center|LOCUS_09820 6433 8007 gene locus_tag LOCUS_09830 gene pntA 6433 8007 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CHR5 protein_id gnl|my_center|LOCUS_09830 8125 9561 gene locus_tag LOCUS_09840 gene PntB 8125 9561 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1C3 protein_id gnl|my_center|LOCUS_09840 9898 9719 gene locus_tag LOCUS_09850 9898 9719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 11170 9983 gene locus_tag LOCUS_09860 11170 9983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 12608 11403 gene locus_tag LOCUS_09870 12608 11403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 14745 12760 gene locus_tag LOCUS_09880 14745 12760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 15324 15067 gene locus_tag LOCUS_09890 15324 15067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 17806 16358 gene locus_tag LOCUS_09900 17806 16358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 18736 18050 gene locus_tag LOCUS_09910 18736 18050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 18905 19573 gene locus_tag LOCUS_09920 18905 19573 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224030.1 protein_id gnl|my_center|LOCUS_09920 19570 21258 gene locus_tag LOCUS_09930 19570 21258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 21441 22886 gene locus_tag LOCUS_09940 21441 22886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 23241 23050 gene locus_tag LOCUS_09950 23241 23050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 23497 24390 gene locus_tag LOCUS_09960 23497 24390 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104144.1 protein_id gnl|my_center|LOCUS_09960 25601 25948 gene locus_tag LOCUS_09970 25601 25948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 25945 26394 gene locus_tag LOCUS_09980 25945 26394 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810241.1 protein_id gnl|my_center|LOCUS_09980 26399 26956 gene locus_tag LOCUS_09990 26399 26956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 27096 26977 gene locus_tag LOCUS_10000 27096 26977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 27719 27258 gene locus_tag LOCUS_10010 27719 27258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 27976 28458 gene locus_tag LOCUS_10020 27976 28458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 28455 28703 gene locus_tag LOCUS_10030 28455 28703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 28734 28919 gene locus_tag LOCUS_10040 28734 28919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 28910 28986 gene locus_tag LOCUS_t00070 28910 28986 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 29424 29194 gene locus_tag LOCUS_10050 29424 29194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 29809 29426 gene locus_tag LOCUS_10060 29809 29426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 30177 31520 gene locus_tag LOCUS_10070 gene miaB 30177 31520 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8B5 protein_id gnl|my_center|LOCUS_10070 31517 32512 gene locus_tag LOCUS_10080 31517 32512 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037472.1 protein_id gnl|my_center|LOCUS_10080 32487 32987 gene locus_tag LOCUS_10090 gene ybeY 32487 32987 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN83 protein_id gnl|my_center|LOCUS_10090 33060 33908 gene locus_tag LOCUS_10100 gene ybeX 33060 33908 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037476.1 protein_id gnl|my_center|LOCUS_10100 33901 35058 gene locus_tag LOCUS_10110 33901 35058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 35112 36578 gene locus_tag LOCUS_10120 35112 36578 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140057.1 protein_id gnl|my_center|LOCUS_10120 36575 37309 gene locus_tag LOCUS_10130 36575 37309 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140056.1 protein_id gnl|my_center|LOCUS_10130 37306 38442 gene locus_tag LOCUS_10140 gene natB 37306 38442 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070482.1 protein_id gnl|my_center|LOCUS_10140 38426 38950 gene locus_tag LOCUS_10150 38426 38950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 38943 39533 gene locus_tag LOCUS_10160 38943 39533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 >Feature sequence024 653 111 gene locus_tag LOCUS_10170 653 111 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083938.1 protein_id gnl|my_center|LOCUS_10170 2618 654 gene locus_tag LOCUS_10180 gene cheA 2618 654 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037054.1 protein_id gnl|my_center|LOCUS_10180 2998 2636 gene locus_tag LOCUS_10190 gene cheY 2998 2636 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806565.1 protein_id gnl|my_center|LOCUS_10190 3207 3470 gene locus_tag LOCUS_10200 3207 3470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112314.1 protein_id gnl|my_center|LOCUS_10200 3474 5852 gene locus_tag LOCUS_10210 3474 5852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 7480 5873 gene locus_tag LOCUS_10220 7480 5873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 8365 7613 gene locus_tag LOCUS_10230 8365 7613 CDS product putative S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB40 protein_id gnl|my_center|LOCUS_10230 8922 8392 gene locus_tag LOCUS_10240 8922 8392 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318214.1 protein_id gnl|my_center|LOCUS_10240 10051 8909 gene locus_tag LOCUS_10250 gene ynaI 10051 8909 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263282.1 protein_id gnl|my_center|LOCUS_10250 11076 10078 gene locus_tag LOCUS_10260 gene nagZ 11076 10078 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB42 protein_id gnl|my_center|LOCUS_10260 11540 11076 gene locus_tag LOCUS_10270 11540 11076 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036473.1 protein_id gnl|my_center|LOCUS_10270 12859 11543 gene locus_tag LOCUS_10280 gene rlmD 12859 11543 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB48 protein_id gnl|my_center|LOCUS_10280 13582 13007 gene locus_tag LOCUS_10290 13582 13007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 15663 13696 gene locus_tag LOCUS_10300 15663 13696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 15665 16414 gene locus_tag LOCUS_10310 15665 16414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 16619 16464 gene locus_tag LOCUS_10320 gene rpmG 16619 16464 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BC7 protein_id gnl|my_center|LOCUS_10320 16868 16632 gene locus_tag LOCUS_10330 gene rpmB 16868 16632 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTN8 protein_id gnl|my_center|LOCUS_10330 17224 17625 gene locus_tag LOCUS_10340 17224 17625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 17672 18499 gene locus_tag LOCUS_10350 17672 18499 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWS2 protein_id gnl|my_center|LOCUS_10350 18505 19251 gene locus_tag LOCUS_10360 18505 19251 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113019.1 protein_id gnl|my_center|LOCUS_10360 19646 19245 gene locus_tag LOCUS_10370 19646 19245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036195.1 protein_id gnl|my_center|LOCUS_10370 20309 19665 gene locus_tag LOCUS_10380 20309 19665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 22531 20324 gene locus_tag LOCUS_10390 22531 20324 CDS product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147064.1 protein_id gnl|my_center|LOCUS_10390 23067 22534 gene locus_tag LOCUS_10400 23067 22534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978825.1 protein_id gnl|my_center|LOCUS_10400 24302 23226 gene locus_tag LOCUS_10410 24302 23226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433346.1 protein_id gnl|my_center|LOCUS_10410 25508 24477 gene locus_tag LOCUS_10420 25508 24477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 26931 25837 gene locus_tag LOCUS_10430 gene wecA 26931 25837 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CTF1 protein_id gnl|my_center|LOCUS_10430 29540 26982 gene locus_tag LOCUS_10440 29540 26982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 29885 29682 gene locus_tag LOCUS_10450 29885 29682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531476.1 protein_id gnl|my_center|LOCUS_10450 30649 30083 gene locus_tag LOCUS_10460 30649 30083 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932674.1 protein_id gnl|my_center|LOCUS_10460 31615 30872 gene locus_tag LOCUS_10470 gene rlmB 31615 30872 CDS product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CEV5 protein_id gnl|my_center|LOCUS_10470 33472 31619 gene locus_tag LOCUS_10480 33472 31619 CDS product peptidase M2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072459.1 protein_id gnl|my_center|LOCUS_10480 33568 34482 gene locus_tag LOCUS_10490 gene ilvA 33568 34482 CDS product threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227667.1 protein_id gnl|my_center|LOCUS_10490 34521 37571 gene locus_tag LOCUS_10500 34521 37571 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_10500 37561 38604 gene locus_tag LOCUS_10510 gene acrE 37561 38604 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038985.1 protein_id gnl|my_center|LOCUS_10510 38620 39159 gene locus_tag LOCUS_10520 38620 39159 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947216.1 protein_id gnl|my_center|LOCUS_10520 >Feature sequence025 83 307 gene locus_tag LOCUS_10530 83 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 304 561 gene locus_tag LOCUS_10540 304 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 693 917 gene locus_tag LOCUS_10550 693 917 CDS product light-harvesting protein B-870 beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ23 protein_id gnl|my_center|LOCUS_10550 929 1141 gene locus_tag LOCUS_10560 929 1141 CDS product light-harvesting protein B-870 alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390724.1 protein_id gnl|my_center|LOCUS_10560 1220 2044 gene locus_tag LOCUS_10570 1220 2044 CDS product reaction center protein L chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390723.1 protein_id gnl|my_center|LOCUS_10570 2055 3026 gene locus_tag LOCUS_10580 2055 3026 CDS product photosynthetic reaction center subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390722.1 protein_id gnl|my_center|LOCUS_10580 3023 4018 gene locus_tag LOCUS_10590 3023 4018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 4175 4501 gene locus_tag LOCUS_10600 4175 4501 CDS product high-potential iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WI43 protein_id gnl|my_center|LOCUS_10600 4929 4606 gene locus_tag LOCUS_10610 4929 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 6625 5327 gene locus_tag LOCUS_10620 6625 5327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057130.1 protein_id gnl|my_center|LOCUS_10620 8093 6612 gene locus_tag LOCUS_10630 8093 6612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057130.1 protein_id gnl|my_center|LOCUS_10630 9740 8265 gene locus_tag LOCUS_10640 9740 8265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 10203 14540 gene locus_tag LOCUS_10650 10203 14540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 14609 16510 gene locus_tag LOCUS_10660 14609 16510 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279209.1 protein_id gnl|my_center|LOCUS_10660 16798 19254 gene locus_tag LOCUS_10670 16798 19254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 20950 19301 gene locus_tag LOCUS_10680 20950 19301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 21029 22843 gene locus_tag LOCUS_10690 21029 22843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 23707 22868 gene locus_tag LOCUS_10700 23707 22868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 24852 23809 gene locus_tag LOCUS_10710 24852 23809 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082450.1 protein_id gnl|my_center|LOCUS_10710 26000 24852 gene locus_tag LOCUS_10720 26000 24852 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134747.1 protein_id gnl|my_center|LOCUS_10720 28144 25997 gene locus_tag LOCUS_10730 28144 25997 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100703.1 protein_id gnl|my_center|LOCUS_10730 29355 28141 gene locus_tag LOCUS_10740 gene fadA 29355 28141 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207598.1 protein_id gnl|my_center|LOCUS_10740 29574 30050 gene locus_tag LOCUS_10750 29574 30050 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064971.1 protein_id gnl|my_center|LOCUS_10750 31168 30137 gene locus_tag LOCUS_10760 31168 30137 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106595.1 protein_id gnl|my_center|LOCUS_10760 31250 32896 gene locus_tag LOCUS_10770 31250 32896 CDS product long-chain acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705768.1 protein_id gnl|my_center|LOCUS_10770 33432 32893 gene locus_tag LOCUS_10780 33432 32893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 33316 34347 gene locus_tag LOCUS_10790 gene rlmJ 33316 34347 CDS product ribosomal RNA large subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XGN2 protein_id gnl|my_center|LOCUS_10790 >Feature sequence026 <1 1020 gene locus_tag LOCUS_10800 <1 1020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036700.1:acyl-CoA dehydrogenase 1383 11294 gene locus_tag LOCUS_10810 1383 11294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 11895 12233 gene locus_tag LOCUS_10820 11895 12233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 12254 12616 gene locus_tag LOCUS_10830 12254 12616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 12682 13011 gene locus_tag LOCUS_10840 12682 13011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 13669 13019 gene locus_tag LOCUS_10850 13669 13019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 14661 13669 gene locus_tag LOCUS_10860 gene msrP 14661 13669 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PA98 protein_id gnl|my_center|LOCUS_10860 15072 14809 gene locus_tag LOCUS_10870 15072 14809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 15200 15634 gene locus_tag LOCUS_10880 15200 15634 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037893.1 protein_id gnl|my_center|LOCUS_10880 15669 17114 gene locus_tag LOCUS_10890 gene sufB 15669 17114 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958177.1 protein_id gnl|my_center|LOCUS_10890 17134 17886 gene locus_tag LOCUS_10900 gene ynhD 17134 17886 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037895.1 protein_id gnl|my_center|LOCUS_10900 17883 19124 gene locus_tag LOCUS_10910 gene sufD 17883 19124 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958176.1 protein_id gnl|my_center|LOCUS_10910 19121 20368 gene locus_tag LOCUS_10920 gene sufS 19121 20368 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H270 protein_id gnl|my_center|LOCUS_10920 20365 22746 gene locus_tag LOCUS_10930 gene phr 20365 22746 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122223.1 protein_id gnl|my_center|LOCUS_10930 23286 22945 gene locus_tag LOCUS_10940 23286 22945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 23736 23287 gene locus_tag LOCUS_10950 23736 23287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 24962 23769 gene locus_tag LOCUS_10960 gene fadA 24962 23769 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037142.1 protein_id gnl|my_center|LOCUS_10960 27500 25134 gene locus_tag LOCUS_10970 gene fadB 27500 25134 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037143.1 protein_id gnl|my_center|LOCUS_10970 29984 27567 gene locus_tag LOCUS_10980 29984 27567 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039380.1 protein_id gnl|my_center|LOCUS_10980 30617 29991 gene locus_tag LOCUS_10990 gene psrA 30617 29991 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037144.1 protein_id gnl|my_center|LOCUS_10990 31093 31503 gene locus_tag LOCUS_11000 gene ndk 31093 31503 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JW1 protein_id gnl|my_center|LOCUS_11000 31509 32645 gene locus_tag LOCUS_11010 gene rlmN 31509 32645 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P984 protein_id gnl|my_center|LOCUS_11010 32642 33382 gene locus_tag LOCUS_11020 gene pilF 32642 33382 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705643.1 protein_id gnl|my_center|LOCUS_11020 33398 34363 gene locus_tag LOCUS_11030 33398 34363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228492.1 protein_id gnl|my_center|LOCUS_11030 34602 34381 gene locus_tag LOCUS_11040 34602 34381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 34631 35881 gene locus_tag LOCUS_11050 gene hisS 34631 35881 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX22 protein_id gnl|my_center|LOCUS_11050 35954 36592 gene locus_tag LOCUS_11060 35954 36592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705647.1 protein_id gnl|my_center|LOCUS_11060 >Feature sequence027 1213 659 gene locus_tag LOCUS_11070 1213 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 1916 4042 gene locus_tag LOCUS_11080 1916 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 7474 4055 gene locus_tag LOCUS_11090 gene icmF 7474 4055 CDS product Fused isobutyryl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F222 protein_id gnl|my_center|LOCUS_11090 10052 7578 gene locus_tag LOCUS_11100 10052 7578 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958551.1 protein_id gnl|my_center|LOCUS_11100 10095 10940 gene locus_tag LOCUS_11110 gene ku 10095 10940 CDS product non-homologous end joining protein Ku inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34859 protein_id gnl|my_center|LOCUS_11110 10947 11735 gene locus_tag LOCUS_11120 10947 11735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 14099 11730 gene locus_tag LOCUS_11130 gene polB 14099 11730 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KK36 protein_id gnl|my_center|LOCUS_11130 15057 14143 gene locus_tag LOCUS_11140 15057 14143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 17976 15133 gene locus_tag LOCUS_11150 gene btuB 17976 15133 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038503.1 protein_id gnl|my_center|LOCUS_11150 18616 18541 gene locus_tag LOCUS_t00080 18616 18541 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 18741 18666 gene locus_tag LOCUS_t00090 18741 18666 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 19350 18799 gene locus_tag LOCUS_11160 19350 18799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 20214 19399 gene locus_tag LOCUS_11170 20214 19399 CDS product putative phosphoenolpyruvate synthase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8S4 protein_id gnl|my_center|LOCUS_11170 20390 22759 gene locus_tag LOCUS_11180 gene ppsA 20390 22759 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2W9 protein_id gnl|my_center|LOCUS_11180 22819 22894 gene locus_tag LOCUS_t00100 22819 22894 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 23022 23690 gene locus_tag LOCUS_11190 23022 23690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 23695 24942 gene locus_tag LOCUS_11200 23695 24942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 24959 25534 gene locus_tag LOCUS_11210 24959 25534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 25531 26733 gene locus_tag LOCUS_11220 25531 26733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 27142 26690 gene locus_tag LOCUS_11230 gene msrB 27142 26690 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4Q6 protein_id gnl|my_center|LOCUS_11230 27753 27139 gene locus_tag LOCUS_11240 gene msrA 27753 27139 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89EN0 protein_id gnl|my_center|LOCUS_11240 28373 27756 gene locus_tag LOCUS_11250 28373 27756 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038983.1 protein_id gnl|my_center|LOCUS_11250 29509 28370 gene locus_tag LOCUS_11260 29509 28370 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640160.1 protein_id gnl|my_center|LOCUS_11260 30261 29506 gene locus_tag LOCUS_11270 30261 29506 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919032.1 protein_id gnl|my_center|LOCUS_11270 31142 30258 gene locus_tag LOCUS_11280 31142 30258 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919031.1 protein_id gnl|my_center|LOCUS_11280 31715 31251 gene locus_tag LOCUS_11290 31715 31251 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035688.1 protein_id gnl|my_center|LOCUS_11290 31787 32824 gene locus_tag LOCUS_11300 31787 32824 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035689.1 protein_id gnl|my_center|LOCUS_11300 34775 32955 gene locus_tag LOCUS_11310 34775 32955 CDS product nodulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975332.1 protein_id gnl|my_center|LOCUS_11310 35208 34789 gene locus_tag LOCUS_11320 35208 34789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 36599 35205 gene locus_tag LOCUS_11330 gene gltX 36599 35205 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FQ37 protein_id gnl|my_center|LOCUS_11330 >Feature sequence028 2258 216 gene locus_tag LOCUS_11340 2258 216 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479820.1 protein_id gnl|my_center|LOCUS_11340 4251 2602 gene locus_tag LOCUS_11350 gene ubiB 4251 2602 CDS product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRH7 protein_id gnl|my_center|LOCUS_11350 4930 4328 gene locus_tag LOCUS_11360 4930 4328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958604.1 protein_id gnl|my_center|LOCUS_11360 5682 4930 gene locus_tag LOCUS_11370 gene ubiE 5682 4930 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P558 protein_id gnl|my_center|LOCUS_11370 6029 5679 gene locus_tag LOCUS_11380 6029 5679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190130.1 protein_id gnl|my_center|LOCUS_11380 6170 8026 gene locus_tag LOCUS_11390 gene uvrC 6170 8026 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8W9 protein_id gnl|my_center|LOCUS_11390 8013 8639 gene locus_tag LOCUS_11400 gene pgsA 8013 8639 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090349.1 protein_id gnl|my_center|LOCUS_11400 8636 9715 gene locus_tag LOCUS_11410 8636 9715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 10340 9684 gene locus_tag LOCUS_11420 10340 9684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 10898 10347 gene locus_tag LOCUS_11430 10898 10347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 11752 11051 gene locus_tag LOCUS_11440 11752 11051 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707362.1 protein_id gnl|my_center|LOCUS_11440 11983 13011 gene locus_tag LOCUS_11450 11983 13011 CDS product deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455969.1 protein_id gnl|my_center|LOCUS_11450 13047 14009 gene locus_tag LOCUS_11460 13047 14009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 14550 14356 gene locus_tag LOCUS_11470 14550 14356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 15962 14670 gene locus_tag LOCUS_11480 gene purA 15962 14670 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYX5 protein_id gnl|my_center|LOCUS_11480 16206 16018 gene locus_tag LOCUS_11490 16206 16018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095647.1 protein_id gnl|my_center|LOCUS_11490 17121 16222 gene locus_tag LOCUS_11500 gene hflC 17121 16222 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VJ7 protein_id gnl|my_center|LOCUS_11500 18284 17121 gene locus_tag LOCUS_11510 gene hflK 18284 17121 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106427.1 protein_id gnl|my_center|LOCUS_11510 19717 18446 gene locus_tag LOCUS_11520 gene hflX 19717 18446 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VJ5 protein_id gnl|my_center|LOCUS_11520 20051 19812 gene locus_tag LOCUS_11530 gene hfq 20051 19812 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM0 protein_id gnl|my_center|LOCUS_11530 21062 20124 gene locus_tag LOCUS_11540 gene miaA 21062 20124 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62HE6 protein_id gnl|my_center|LOCUS_11540 22851 21064 gene locus_tag LOCUS_11550 gene mutL 22851 21064 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL8 protein_id gnl|my_center|LOCUS_11550 24062 22848 gene locus_tag LOCUS_11560 gene tyrS 24062 22848 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHB3 protein_id gnl|my_center|LOCUS_11560 24363 25646 gene locus_tag LOCUS_11570 24363 25646 CDS product family M23 zinc metallopeptidase with OapA domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071525.1 protein_id gnl|my_center|LOCUS_11570 25643 26755 gene locus_tag LOCUS_11580 gene anmK 25643 26755 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P473 protein_id gnl|my_center|LOCUS_11580 26752 27123 gene locus_tag LOCUS_11590 26752 27123 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115263.1 protein_id gnl|my_center|LOCUS_11590 28699 27473 gene locus_tag LOCUS_11600 gene amiB 28699 27473 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123571.1 protein_id gnl|my_center|LOCUS_11600 29352 28888 gene locus_tag LOCUS_11610 29352 28888 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704860.1 protein_id gnl|my_center|LOCUS_11610 30811 29342 gene locus_tag LOCUS_11620 30811 29342 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGR6 protein_id gnl|my_center|LOCUS_11620 30830 31909 gene locus_tag LOCUS_11630 gene queG 30830 31909 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VI8 protein_id gnl|my_center|LOCUS_11630 31968 33335 gene locus_tag LOCUS_11640 gene ffh 31968 33335 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XF48 protein_id gnl|my_center|LOCUS_11640 33425 33501 gene locus_tag LOCUS_t00110 33425 33501 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 33592 34068 gene locus_tag LOCUS_11650 gene rimP 33592 34068 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV53 protein_id gnl|my_center|LOCUS_11650 34072 35571 gene locus_tag LOCUS_11660 gene nusA 34072 35571 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7U6 protein_id gnl|my_center|LOCUS_11660 >Feature sequence029 1722 3464 gene locus_tag LOCUS_11670 gene cysJ 1722 3464 CDS product sulfite reductase [NADPH] flavoprotein alpha-component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAZ9 protein_id gnl|my_center|LOCUS_11670 3454 5097 gene locus_tag LOCUS_11680 gene cysI 3454 5097 CDS product sulfite reductase [NADPH] hemoprotein beta-component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P608 protein_id gnl|my_center|LOCUS_11680 5094 5810 gene locus_tag LOCUS_11690 gene cysH 5094 5810 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNL1 protein_id gnl|my_center|LOCUS_11690 6711 6004 gene locus_tag LOCUS_11700 6711 6004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195184.1 protein_id gnl|my_center|LOCUS_11700 6953 7138 gene locus_tag LOCUS_11710 6953 7138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 7321 9630 gene locus_tag LOCUS_11720 gene maeB-2 7321 9630 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197904.1 protein_id gnl|my_center|LOCUS_11720 9724 10620 gene locus_tag LOCUS_11730 9724 10620 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089371.1 protein_id gnl|my_center|LOCUS_11730 10690 11307 gene locus_tag LOCUS_11740 10690 11307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089373.1 protein_id gnl|my_center|LOCUS_11740 12984 11344 gene locus_tag LOCUS_11750 12984 11344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 13502 12981 gene locus_tag LOCUS_11760 13502 12981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 14413 13499 gene locus_tag LOCUS_11770 14413 13499 CDS product mammalian cell entry protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807132.1 protein_id gnl|my_center|LOCUS_11770 15200 14403 gene locus_tag LOCUS_11780 15200 14403 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064731.1 protein_id gnl|my_center|LOCUS_11780 16186 15197 gene locus_tag LOCUS_11790 16186 15197 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807129.1 protein_id gnl|my_center|LOCUS_11790 16582 17388 gene locus_tag LOCUS_11800 gene apaH 16582 17388 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCE5 protein_id gnl|my_center|LOCUS_11800 17385 18131 gene locus_tag LOCUS_11810 17385 18131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 18193 19104 gene locus_tag LOCUS_11820 18193 19104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 19104 20801 gene locus_tag LOCUS_11830 gene asnB 19104 20801 CDS product asparagine synthetase [glutamine-hydrolyzing] 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54420 protein_id gnl|my_center|LOCUS_11830 21692 20808 gene locus_tag LOCUS_11840 21692 20808 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969533.1 protein_id gnl|my_center|LOCUS_11840 22543 21689 gene locus_tag LOCUS_11850 22543 21689 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 protein_id gnl|my_center|LOCUS_11850 22844 24790 gene locus_tag LOCUS_11860 22844 24790 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389868.1 protein_id gnl|my_center|LOCUS_11860 28354 24878 gene locus_tag LOCUS_11870 28354 24878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 29597 28464 gene locus_tag LOCUS_11880 gene purK 29597 28464 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7V6 protein_id gnl|my_center|LOCUS_11880 30070 29594 gene locus_tag LOCUS_11890 gene purE 30070 29594 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7V5 protein_id gnl|my_center|LOCUS_11890 30337 30612 gene locus_tag LOCUS_11900 30337 30612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037637.1 protein_id gnl|my_center|LOCUS_11900 30697 32136 gene locus_tag LOCUS_11910 30697 32136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 32136 32981 gene locus_tag LOCUS_11920 gene nadC 32136 32981 CDS product nicotinate-nucleotide pyrophosphorylase [carboxylating] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30819 protein_id gnl|my_center|LOCUS_11920 33001 33738 gene locus_tag LOCUS_11930 33001 33738 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477064.1 protein_id gnl|my_center|LOCUS_11930 35475 33760 gene locus_tag LOCUS_11940 35475 33760 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089372.1 protein_id gnl|my_center|LOCUS_11940 <36073 35543 gene locus_tag LOCUS_11950 <36073 35543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921243.1:glutamate--cysteine ligase >Feature sequence030 373 1317 gene locus_tag LOCUS_11960 gene dapA 373 1317 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI24 protein_id gnl|my_center|LOCUS_11960 1352 1933 gene locus_tag LOCUS_11970 1352 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 2631 1963 gene locus_tag LOCUS_11980 2631 1963 CDS product PKHD-type hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AC39 protein_id gnl|my_center|LOCUS_11980 3911 2631 gene locus_tag LOCUS_11990 gene fahA 3911 2631 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962840.1 protein_id gnl|my_center|LOCUS_11990 4760 4029 gene locus_tag LOCUS_12000 4760 4029 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932563.1 protein_id gnl|my_center|LOCUS_12000 4865 5611 gene locus_tag LOCUS_12010 4865 5611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 7513 5687 gene locus_tag LOCUS_12020 gene sppA 7513 5687 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4E7 protein_id gnl|my_center|LOCUS_12020 7683 8177 gene locus_tag LOCUS_12030 7683 8177 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806996.1 protein_id gnl|my_center|LOCUS_12030 8174 8464 gene locus_tag LOCUS_12040 8174 8464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 8461 10704 gene locus_tag LOCUS_12050 8461 10704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 10751 11386 gene locus_tag LOCUS_12060 10751 11386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12060 11280 11549 gene locus_tag LOCUS_12070 11280 11549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12070 12254 11889 gene locus_tag LOCUS_12080 12254 11889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 12769 12230 gene locus_tag LOCUS_12090 gene sigW 12769 12230 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFL5 protein_id gnl|my_center|LOCUS_12090 13671 12787 gene locus_tag LOCUS_12100 13671 12787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 13995 15470 gene locus_tag LOCUS_12110 13995 15470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 15654 16172 gene locus_tag LOCUS_12120 15654 16172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 16813 16181 gene locus_tag LOCUS_12130 16813 16181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 17429 16806 gene locus_tag LOCUS_12140 17429 16806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 18216 17416 gene locus_tag LOCUS_12150 18216 17416 CDS product cytochrome c550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385673.1 protein_id gnl|my_center|LOCUS_12150 19199 18213 gene locus_tag LOCUS_12160 19199 18213 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087312.1 protein_id gnl|my_center|LOCUS_12160 20321 19620 gene locus_tag LOCUS_12170 gene hutG 20321 19620 CDS product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064863.1 protein_id gnl|my_center|LOCUS_12170 21927 20398 gene locus_tag LOCUS_12180 gene hutH 21927 20398 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAA7 protein_id gnl|my_center|LOCUS_12180 23603 21924 gene locus_tag LOCUS_12190 gene hutU 23603 21924 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI08 protein_id gnl|my_center|LOCUS_12190 24340 23606 gene locus_tag LOCUS_12200 gene hutC 24340 23606 CDS product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193766.1 protein_id gnl|my_center|LOCUS_12200 24460 25593 gene locus_tag LOCUS_12210 24460 25593 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408362.1 protein_id gnl|my_center|LOCUS_12210 25654 26661 gene locus_tag LOCUS_12220 25654 26661 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689799.1 protein_id gnl|my_center|LOCUS_12220 26724 27530 gene locus_tag LOCUS_12230 26724 27530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 28488 27538 gene locus_tag LOCUS_12240 28488 27538 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706727.1 protein_id gnl|my_center|LOCUS_12240 29452 28508 gene locus_tag LOCUS_12250 29452 28508 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261697.1 protein_id gnl|my_center|LOCUS_12250 29554 30531 gene locus_tag LOCUS_12260 29554 30531 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038653.1 protein_id gnl|my_center|LOCUS_12260 31973 30849 gene locus_tag LOCUS_12270 gene mopB 31973 30849 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036149.1 protein_id gnl|my_center|LOCUS_12270 35788 32117 gene locus_tag LOCUS_12280 gene metH 35788 32117 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729624.1 protein_id gnl|my_center|LOCUS_12280 >Feature sequence031 1517 186 gene locus_tag LOCUS_12290 gene ntrC 1517 186 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035809.1 protein_id gnl|my_center|LOCUS_12290 2729 1521 gene locus_tag LOCUS_12300 gene ybjZ 2729 1521 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035811.1 protein_id gnl|my_center|LOCUS_12300 4056 2740 gene locus_tag LOCUS_12310 gene ybjZ 4056 2740 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035812.1 protein_id gnl|my_center|LOCUS_12310 4774 4067 gene locus_tag LOCUS_12320 gene ycfV 4774 4067 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035813.1 protein_id gnl|my_center|LOCUS_12320 6103 4823 gene locus_tag LOCUS_12330 6103 4823 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073489.1 protein_id gnl|my_center|LOCUS_12330 6784 6224 gene locus_tag LOCUS_12340 6784 6224 CDS product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104401.1 protein_id gnl|my_center|LOCUS_12340 7437 6781 gene locus_tag LOCUS_12350 7437 6781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 7763 7434 gene locus_tag LOCUS_12360 7763 7434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 7794 9077 gene locus_tag LOCUS_12370 7794 9077 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937797.1 protein_id gnl|my_center|LOCUS_12370 9119 10336 gene locus_tag LOCUS_12380 9119 10336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 11128 10439 gene locus_tag LOCUS_12390 11128 10439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 11317 15516 gene locus_tag LOCUS_12400 11317 15516 CDS product alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257197.1 protein_id gnl|my_center|LOCUS_12400 15792 16373 gene locus_tag LOCUS_12410 15792 16373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 16373 18910 gene locus_tag LOCUS_12420 16373 18910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 18907 19401 gene locus_tag LOCUS_12430 18907 19401 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886918.1 protein_id gnl|my_center|LOCUS_12430 20496 19390 gene locus_tag LOCUS_12440 20496 19390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_12440 21594 20590 gene locus_tag LOCUS_12450 gene cysB 21594 20590 CDS product transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634254.1 protein_id gnl|my_center|LOCUS_12450 21774 23168 gene locus_tag LOCUS_12460 gene cysG3 21774 23168 CDS product siroheme synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQJ4 protein_id gnl|my_center|LOCUS_12460 23260 24174 gene locus_tag LOCUS_12470 gene lpxO1 23260 24174 CDS product LPS biosynthetic protein LpxO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094463.1 protein_id gnl|my_center|LOCUS_12470 24285 25556 gene locus_tag LOCUS_12480 24285 25556 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730128.1 protein_id gnl|my_center|LOCUS_12480 28555 26027 gene locus_tag LOCUS_12490 28555 26027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 29101 29385 gene locus_tag LOCUS_12500 29101 29385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 30010 29561 gene locus_tag LOCUS_12510 30010 29561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 30241 30999 gene locus_tag LOCUS_12520 30241 30999 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122354.1 protein_id gnl|my_center|LOCUS_12520 31185 32411 gene locus_tag LOCUS_12530 gene purT 31185 32411 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72E56 protein_id gnl|my_center|LOCUS_12530 33675 32467 gene locus_tag LOCUS_12540 33675 32467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 34654 33740 gene locus_tag LOCUS_12550 34654 33740 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113964.1 protein_id gnl|my_center|LOCUS_12550 34835 35269 gene locus_tag LOCUS_12560 34835 35269 CDS product hemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466989.1 protein_id gnl|my_center|LOCUS_12560 >Feature sequence032 2687 4060 gene locus_tag LOCUS_12570 2687 4060 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAW0 protein_id gnl|my_center|LOCUS_12570 4374 6788 gene locus_tag LOCUS_12580 gene oma 4374 6788 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAW1 protein_id gnl|my_center|LOCUS_12580 6819 7319 gene locus_tag LOCUS_12590 6819 7319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 7316 8347 gene locus_tag LOCUS_12600 gene lpxD 7316 8347 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAW3 protein_id gnl|my_center|LOCUS_12600 8386 8835 gene locus_tag LOCUS_12610 gene fabZ 8386 8835 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWR7 protein_id gnl|my_center|LOCUS_12610 8832 9602 gene locus_tag LOCUS_12620 gene lpxA 8832 9602 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F5W3 protein_id gnl|my_center|LOCUS_12620 9806 9642 gene locus_tag LOCUS_12630 9806 9642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 9780 10748 gene locus_tag LOCUS_12640 9780 10748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 10742 11317 gene locus_tag LOCUS_12650 gene rnhB 10742 11317 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI71 protein_id gnl|my_center|LOCUS_12650 11314 14790 gene locus_tag LOCUS_12660 gene dnaE 11314 14790 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JP65 protein_id gnl|my_center|LOCUS_12660 15348 16592 gene locus_tag LOCUS_12670 15348 16592 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929105.1 protein_id gnl|my_center|LOCUS_12670 16589 17131 gene locus_tag LOCUS_12680 16589 17131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 17128 17922 gene locus_tag LOCUS_12690 17128 17922 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705155.1 protein_id gnl|my_center|LOCUS_12690 18587 18096 gene locus_tag LOCUS_12700 18587 18096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 19324 18641 gene locus_tag LOCUS_12710 gene kdkA 19324 18641 CDS product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBX3 protein_id gnl|my_center|LOCUS_12710 19747 19325 gene locus_tag LOCUS_12720 19747 19325 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_12720 20183 19734 gene locus_tag LOCUS_12730 gene moaE 20183 19734 CDS product molybdopterin-converting factor chain 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036203.1 protein_id gnl|my_center|LOCUS_12730 20442 20185 gene locus_tag LOCUS_12740 gene moaD 20442 20185 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXJ8 protein_id gnl|my_center|LOCUS_12740 21452 20448 gene locus_tag LOCUS_12750 gene moaA 21452 20448 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBX1 protein_id gnl|my_center|LOCUS_12750 22621 21440 gene locus_tag LOCUS_12760 gene moeA 22621 21440 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057204.1 protein_id gnl|my_center|LOCUS_12760 22703 24103 gene locus_tag LOCUS_12770 gene phr 22703 24103 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036625.1 protein_id gnl|my_center|LOCUS_12770 24142 25338 gene locus_tag LOCUS_12780 24142 25338 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266455.1 protein_id gnl|my_center|LOCUS_12780 25423 26166 gene locus_tag LOCUS_12790 gene dpm1 25423 26166 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038929.1 protein_id gnl|my_center|LOCUS_12790 26159 26518 gene locus_tag LOCUS_12800 26159 26518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 26600 27406 gene locus_tag LOCUS_12810 26600 27406 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144270.1 protein_id gnl|my_center|LOCUS_12810 27435 28712 gene locus_tag LOCUS_12820 27435 28712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038459.1 protein_id gnl|my_center|LOCUS_12820 28850 29785 gene locus_tag LOCUS_12830 gene lip 28850 29785 CDS product lactonizing lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P26876 protein_id gnl|my_center|LOCUS_12830 29782 30825 gene locus_tag LOCUS_12840 gene lifO 29782 30825 CDS product lipase chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WBQ7 protein_id gnl|my_center|LOCUS_12840 31343 30951 gene locus_tag LOCUS_12850 gene rpsI 31343 30951 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD66 protein_id gnl|my_center|LOCUS_12850 31783 31355 gene locus_tag LOCUS_12860 gene rplM 31783 31355 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FKH1 protein_id gnl|my_center|LOCUS_12860 32629 31919 gene locus_tag LOCUS_12870 32629 31919 CDS product salt-induced outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038602.1 protein_id gnl|my_center|LOCUS_12870 32702 33343 gene locus_tag LOCUS_12880 gene coq7 32702 33343 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD67 protein_id gnl|my_center|LOCUS_12880 33789 33337 gene locus_tag LOCUS_12890 33789 33337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 33805 35334 gene locus_tag LOCUS_12900 33805 35334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021220.1 protein_id gnl|my_center|LOCUS_12900 >Feature sequence033 2687 5224 gene locus_tag LOCUS_12910 2687 5224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 7468 5231 gene locus_tag LOCUS_12920 7468 5231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 11619 7663 gene locus_tag LOCUS_12930 11619 7663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 11844 16220 gene locus_tag LOCUS_12940 11844 16220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 16217 16774 gene locus_tag LOCUS_12950 16217 16774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 20205 17047 gene locus_tag LOCUS_12960 20205 17047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 21560 20901 gene locus_tag LOCUS_12970 21560 20901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 21603 21791 gene locus_tag LOCUS_12980 21603 21791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 21911 22870 gene locus_tag LOCUS_12990 21911 22870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 24125 23040 gene locus_tag LOCUS_13000 24125 23040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 26315 24699 gene locus_tag LOCUS_13010 26315 24699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 26484 26654 gene locus_tag LOCUS_13020 26484 26654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 30111 26761 gene locus_tag LOCUS_13030 30111 26761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 30783 30562 gene locus_tag LOCUS_13040 30783 30562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 30985 32574 gene locus_tag LOCUS_13050 30985 32574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976224.1 protein_id gnl|my_center|LOCUS_13050 32980 34332 gene locus_tag LOCUS_13060 32980 34332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13060 34353 34919 gene locus_tag LOCUS_13070 34353 34919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13070 >Feature sequence034 2231 684 gene locus_tag LOCUS_13080 2231 684 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530022.1 protein_id gnl|my_center|LOCUS_13080 3652 2228 gene locus_tag LOCUS_13090 3652 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 3551 4018 gene locus_tag LOCUS_13100 3551 4018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 4734 4030 gene locus_tag LOCUS_13110 4734 4030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 5617 4907 gene locus_tag LOCUS_13120 gene trmJ 5617 4907 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CI4 protein_id gnl|my_center|LOCUS_13120 5940 5596 gene locus_tag LOCUS_13130 5940 5596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 5878 6687 gene locus_tag LOCUS_13140 5878 6687 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709674.1 protein_id gnl|my_center|LOCUS_13140 7171 9201 gene locus_tag LOCUS_13150 7171 9201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 9387 10145 gene locus_tag LOCUS_13160 9387 10145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 10219 13383 gene locus_tag LOCUS_13170 10219 13383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 14927 13392 gene locus_tag LOCUS_13180 14927 13392 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532602.1 protein_id gnl|my_center|LOCUS_13180 15008 15880 gene locus_tag LOCUS_13190 15008 15880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 16066 18828 gene locus_tag LOCUS_13200 16066 18828 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533669.1 protein_id gnl|my_center|LOCUS_13200 18825 19559 gene locus_tag LOCUS_13210 18825 19559 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533670.1 protein_id gnl|my_center|LOCUS_13210 19556 20464 gene locus_tag LOCUS_13220 19556 20464 CDS product DMSO reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533671.1 protein_id gnl|my_center|LOCUS_13220 20490 21839 gene locus_tag LOCUS_13230 20490 21839 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256013.1 protein_id gnl|my_center|LOCUS_13230 21836 22528 gene locus_tag LOCUS_13240 21836 22528 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528194.1 protein_id gnl|my_center|LOCUS_13240 22633 23214 gene locus_tag LOCUS_13250 22633 23214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 23488 24978 gene locus_tag LOCUS_13260 23488 24978 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331455.1 protein_id gnl|my_center|LOCUS_13260 24980 25819 gene locus_tag LOCUS_13270 24980 25819 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140509.1 protein_id gnl|my_center|LOCUS_13270 28232 26100 gene locus_tag LOCUS_13280 28232 26100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 29381 28653 gene locus_tag LOCUS_13290 29381 28653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 29632 29360 gene locus_tag LOCUS_13300 29632 29360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 30489 29629 gene locus_tag LOCUS_13310 30489 29629 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114721.1 protein_id gnl|my_center|LOCUS_13310 32171 30486 gene locus_tag LOCUS_13320 gene ggt 32171 30486 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037530.1 protein_id gnl|my_center|LOCUS_13320 32412 32161 gene locus_tag LOCUS_13330 32412 32161 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195247.1 protein_id gnl|my_center|LOCUS_13330 32952 32458 gene locus_tag LOCUS_13340 gene coaD 32952 32458 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P857 protein_id gnl|my_center|LOCUS_13340 33081 34304 gene locus_tag LOCUS_13350 33081 34304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 >Feature sequence035 13123 13629 gene locus_tag LOCUS_13360 gene ppiB 13123 13629 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC26 protein_id gnl|my_center|LOCUS_13360 14991 13891 gene locus_tag LOCUS_13370 14991 13891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 15229 15453 gene locus_tag LOCUS_13380 15229 15453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 16339 15674 gene locus_tag LOCUS_13390 16339 15674 CDS product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704158.1 protein_id gnl|my_center|LOCUS_13390 18168 16510 gene locus_tag LOCUS_13400 18168 16510 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389659.1 protein_id gnl|my_center|LOCUS_13400 18819 18181 gene locus_tag LOCUS_13410 gene cynT 18819 18181 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UP1 protein_id gnl|my_center|LOCUS_13410 18944 19876 gene locus_tag LOCUS_13420 gene oxyR 18944 19876 CDS product hyaluronan synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036667.1 protein_id gnl|my_center|LOCUS_13420 20532 19861 gene locus_tag LOCUS_13430 gene queC 20532 19861 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWK2 protein_id gnl|my_center|LOCUS_13430 21218 20529 gene locus_tag LOCUS_13440 gene queE 21218 20529 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6F5 protein_id gnl|my_center|LOCUS_13440 22208 21246 gene locus_tag LOCUS_13450 22208 21246 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038132.1 protein_id gnl|my_center|LOCUS_13450 22738 22208 gene locus_tag LOCUS_13460 gene ompP6 22738 22208 CDS product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038133.1 protein_id gnl|my_center|LOCUS_13460 24088 22781 gene locus_tag LOCUS_13470 gene tolB 24088 22781 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6F2 protein_id gnl|my_center|LOCUS_13470 24944 24093 gene locus_tag LOCUS_13480 24944 24093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 25372 24941 gene locus_tag LOCUS_13490 gene tolR 25372 24941 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072689.1 protein_id gnl|my_center|LOCUS_13490 26052 25369 gene locus_tag LOCUS_13500 gene tolQ 26052 25369 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038137.1 protein_id gnl|my_center|LOCUS_13500 26522 26115 gene locus_tag LOCUS_13510 26522 26115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 27571 26519 gene locus_tag LOCUS_13520 gene ruvB 27571 26519 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6E7 protein_id gnl|my_center|LOCUS_13520 28173 27571 gene locus_tag LOCUS_13530 gene ruvA 28173 27571 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6E5 protein_id gnl|my_center|LOCUS_13530 28676 28170 gene locus_tag LOCUS_13540 gene ruvC 28676 28170 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6E4 protein_id gnl|my_center|LOCUS_13540 29410 28673 gene locus_tag LOCUS_13550 29410 28673 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NH19 protein_id gnl|my_center|LOCUS_13550 31468 29486 gene locus_tag LOCUS_13560 31468 29486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 31418 31702 gene locus_tag LOCUS_13570 31418 31702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 34405 31784 gene locus_tag LOCUS_13580 34405 31784 CDS product TonB system transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266217.1 protein_id gnl|my_center|LOCUS_13580 >Feature sequence036 1882 1307 gene locus_tag LOCUS_13590 1882 1307 CDS product UPF0312 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I690 protein_id gnl|my_center|LOCUS_13590 2468 1920 gene locus_tag LOCUS_13600 gene yceJ 2468 1920 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073239.1 protein_id gnl|my_center|LOCUS_13600 2982 2596 gene locus_tag LOCUS_13610 2982 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 3059 4429 gene locus_tag LOCUS_13620 3059 4429 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056076.1 protein_id gnl|my_center|LOCUS_13620 4864 4442 gene locus_tag LOCUS_13630 4864 4442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 10980 4888 gene locus_tag LOCUS_13640 10980 4888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 16547 10980 gene locus_tag LOCUS_13650 16547 10980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 19689 16801 gene locus_tag LOCUS_13660 19689 16801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 22856 19755 gene locus_tag LOCUS_13670 22856 19755 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529677.1 protein_id gnl|my_center|LOCUS_13670 24037 22853 gene locus_tag LOCUS_13680 24037 22853 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529678.1 protein_id gnl|my_center|LOCUS_13680 24913 24149 gene locus_tag LOCUS_13690 24913 24149 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461722.1 protein_id gnl|my_center|LOCUS_13690 25141 25965 gene locus_tag LOCUS_13700 25141 25965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13700 25911 26255 gene locus_tag LOCUS_13710 25911 26255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13710 26252 26974 gene locus_tag LOCUS_13720 26252 26974 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958017.1 protein_id gnl|my_center|LOCUS_13720 27132 27311 gene locus_tag LOCUS_13730 27132 27311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 28370 27336 gene locus_tag LOCUS_13740 28370 27336 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89HV6 protein_id gnl|my_center|LOCUS_13740 28531 30909 gene locus_tag LOCUS_13750 28531 30909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142385.1 protein_id gnl|my_center|LOCUS_13750 30987 31130 gene locus_tag LOCUS_13760 30987 31130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 31435 31100 gene locus_tag LOCUS_13770 31435 31100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072400.1 protein_id gnl|my_center|LOCUS_13770 31567 32994 gene locus_tag LOCUS_13780 31567 32994 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RR62 protein_id gnl|my_center|LOCUS_13780 32996 33385 gene locus_tag LOCUS_13790 32996 33385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 33550 33732 gene locus_tag LOCUS_13800 33550 33732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13800 34477 33779 gene locus_tag LOCUS_13810 34477 33779 CDS product serine-tRNA(Ala) deacylase AlaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186399.1 protein_id gnl|my_center|LOCUS_13810 >Feature sequence037 1546 374 gene locus_tag LOCUS_13820 1546 374 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013865.1 protein_id gnl|my_center|LOCUS_13820 1805 1620 gene locus_tag LOCUS_13830 1805 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 1894 3273 gene locus_tag LOCUS_13840 gene sdaA 1894 3273 CDS product L-serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037978.1 protein_id gnl|my_center|LOCUS_13840 3267 4193 gene locus_tag LOCUS_13850 3267 4193 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269387.1 protein_id gnl|my_center|LOCUS_13850 4190 5020 gene locus_tag LOCUS_13860 4190 5020 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8M8 protein_id gnl|my_center|LOCUS_13860 5730 5143 gene locus_tag LOCUS_13870 5730 5143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 5846 7282 gene locus_tag LOCUS_13880 5846 7282 CDS product arginine:ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889838.1 protein_id gnl|my_center|LOCUS_13880 10636 7859 gene locus_tag LOCUS_13890 10636 7859 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071943.1 protein_id gnl|my_center|LOCUS_13890 11299 10784 gene locus_tag LOCUS_13900 11299 10784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 12055 12720 gene locus_tag LOCUS_13910 12055 12720 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920683.1 protein_id gnl|my_center|LOCUS_13910 15715 12782 gene locus_tag LOCUS_13920 15715 12782 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073389.1 protein_id gnl|my_center|LOCUS_13920 19011 15850 gene locus_tag LOCUS_13930 19011 15850 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_13930 20249 19008 gene locus_tag LOCUS_13940 20249 19008 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814733.1 protein_id gnl|my_center|LOCUS_13940 20631 20398 gene locus_tag LOCUS_13950 20631 20398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 21555 20896 gene locus_tag LOCUS_13960 21555 20896 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114053.1 protein_id gnl|my_center|LOCUS_13960 22817 21567 gene locus_tag LOCUS_13970 22817 21567 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTY3 protein_id gnl|my_center|LOCUS_13970 23595 22822 gene locus_tag LOCUS_13980 gene phoU 23595 22822 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM14 protein_id gnl|my_center|LOCUS_13980 24714 23611 gene locus_tag LOCUS_13990 gene oprO 24714 23611 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037719.1 protein_id gnl|my_center|LOCUS_13990 24883 25353 gene locus_tag LOCUS_14000 24883 25353 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207517.1 protein_id gnl|my_center|LOCUS_14000 25405 26265 gene locus_tag LOCUS_14010 gene qmcA 25405 26265 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116544.1 protein_id gnl|my_center|LOCUS_14010 26370 26951 gene locus_tag LOCUS_14020 gene rpoE 26370 26951 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224545.1 protein_id gnl|my_center|LOCUS_14020 26948 29542 gene locus_tag LOCUS_14030 26948 29542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 29557 32532 gene locus_tag LOCUS_14040 29557 32532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 >Feature sequence038 1051 656 gene locus_tag LOCUS_14050 gene xpsG 1051 656 CDS product type II secretion system protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31734 protein_id gnl|my_center|LOCUS_14050 1248 3266 gene locus_tag LOCUS_14060 gene metG 1248 3266 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XYE5 protein_id gnl|my_center|LOCUS_14060 3263 3844 gene locus_tag LOCUS_14070 3263 3844 CDS product electron transport complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JM88 protein_id gnl|my_center|LOCUS_14070 3844 4383 gene locus_tag LOCUS_14080 3844 4383 CDS product electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB9 protein_id gnl|my_center|LOCUS_14080 4380 5879 gene locus_tag LOCUS_14090 4380 5879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 5869 6894 gene locus_tag LOCUS_14100 gene rnfD 5869 6894 CDS product electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLJ5 protein_id gnl|my_center|LOCUS_14100 9796 7079 gene locus_tag LOCUS_14110 gene ppc 9796 7079 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P336 protein_id gnl|my_center|LOCUS_14110 10107 11270 gene locus_tag LOCUS_14120 10107 11270 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141814.1 protein_id gnl|my_center|LOCUS_14120 12049 11276 gene locus_tag LOCUS_14130 gene paaG 12049 11276 CDS product 1,2-epoxyphenylacetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P77467 protein_id gnl|my_center|LOCUS_14130 12468 12049 gene locus_tag LOCUS_14140 12468 12049 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405444.1 protein_id gnl|my_center|LOCUS_14140 13403 12465 gene locus_tag LOCUS_14150 13403 12465 CDS product inosine-uridine preferring nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038340.1 protein_id gnl|my_center|LOCUS_14150 15097 13403 gene locus_tag LOCUS_14160 gene glnS 15097 13403 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q727A5 protein_id gnl|my_center|LOCUS_14160 16436 15435 gene locus_tag LOCUS_14170 16436 15435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 15511 15600 gene locus_tag LOCUS_t00120 15511 15600 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 16327 16542 gene locus_tag LOCUS_14180 16327 16542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 17402 16752 gene locus_tag LOCUS_14190 17402 16752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 17587 18687 gene locus_tag LOCUS_14200 gene metX 17587 18687 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8L2 protein_id gnl|my_center|LOCUS_14200 18753 19337 gene locus_tag LOCUS_14210 18753 19337 CDS product cysteine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954442.1 protein_id gnl|my_center|LOCUS_14210 19831 20745 gene locus_tag LOCUS_14220 19831 20745 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFY4 protein_id gnl|my_center|LOCUS_14220 20850 21338 gene locus_tag LOCUS_14230 20850 21338 CDS product type IV pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704647.1 protein_id gnl|my_center|LOCUS_14230 21335 21757 gene locus_tag LOCUS_14240 21335 21757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 21771 22973 gene locus_tag LOCUS_14250 21771 22973 CDS product pilus assembly protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037627.1 protein_id gnl|my_center|LOCUS_14250 23101 23532 gene locus_tag LOCUS_14260 23101 23532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 23548 27522 gene locus_tag LOCUS_14270 23548 27522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 27584 28000 gene locus_tag LOCUS_14280 27584 28000 CDS product pilus biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103296.1 protein_id gnl|my_center|LOCUS_14280 28674 28015 gene locus_tag LOCUS_14290 28674 28015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 29063 28671 gene locus_tag LOCUS_14300 gene hslR 29063 28671 CDS product heat-shock protein 15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194347.1 protein_id gnl|my_center|LOCUS_14300 30975 29065 gene locus_tag LOCUS_14310 gene htpG 30975 29065 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KL53 protein_id gnl|my_center|LOCUS_14310 31059 32618 gene locus_tag LOCUS_14320 31059 32618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 >Feature sequence039 3576 439 gene locus_tag LOCUS_14330 3576 439 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_14330 4852 3686 gene locus_tag LOCUS_14340 4852 3686 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123111.1 protein_id gnl|my_center|LOCUS_14340 6991 5147 gene locus_tag LOCUS_14350 6991 5147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 7414 7007 gene locus_tag LOCUS_14360 7414 7007 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142971.1 protein_id gnl|my_center|LOCUS_14360 9453 7543 gene locus_tag LOCUS_14370 gene yoaA 9453 7543 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038053.1 protein_id gnl|my_center|LOCUS_14370 10088 9477 gene locus_tag LOCUS_14380 10088 9477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 12157 10085 gene locus_tag LOCUS_14390 12157 10085 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704328.1 protein_id gnl|my_center|LOCUS_14390 12207 12368 gene locus_tag LOCUS_14400 12207 12368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 12488 14230 gene locus_tag LOCUS_14410 12488 14230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073516.1 protein_id gnl|my_center|LOCUS_14410 15059 14463 gene locus_tag LOCUS_14420 15059 14463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120998.1 protein_id gnl|my_center|LOCUS_14420 15092 15706 gene locus_tag LOCUS_14430 15092 15706 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338369.1 protein_id gnl|my_center|LOCUS_14430 15757 16791 gene locus_tag LOCUS_14440 15757 16791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337357.1 protein_id gnl|my_center|LOCUS_14440 16913 17263 gene locus_tag LOCUS_14450 16913 17263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 17313 17621 gene locus_tag LOCUS_14460 17313 17621 CDS product urease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083173.1 protein_id gnl|my_center|LOCUS_14460 17692 19104 gene locus_tag LOCUS_14470 17692 19104 CDS product glycine/betaine ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110490.1 protein_id gnl|my_center|LOCUS_14470 19179 19829 gene locus_tag LOCUS_14480 19179 19829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 20919 19993 gene locus_tag LOCUS_14490 20919 19993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 21010 21738 gene locus_tag LOCUS_14500 gene parA 21010 21738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035431.1 protein_id gnl|my_center|LOCUS_14500 21821 25366 gene locus_tag LOCUS_14510 21821 25366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 25507 28608 gene locus_tag LOCUS_14520 25507 28608 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_14520 28605 29648 gene locus_tag LOCUS_14530 28605 29648 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705255.1 protein_id gnl|my_center|LOCUS_14530 29806 30876 gene locus_tag LOCUS_14540 29806 30876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 30876 31700 gene locus_tag LOCUS_14550 30876 31700 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405557.1 protein_id gnl|my_center|LOCUS_14550 32212 31709 gene locus_tag LOCUS_14560 32212 31709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 >Feature sequence040 516 313 gene locus_tag LOCUS_14570 516 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 624 914 gene locus_tag LOCUS_14580 624 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 1537 956 gene locus_tag LOCUS_14590 1537 956 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037993.1 protein_id gnl|my_center|LOCUS_14590 1745 4216 gene locus_tag LOCUS_14600 gene fadE 1745 4216 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037995.1 protein_id gnl|my_center|LOCUS_14600 4360 5007 gene locus_tag LOCUS_14610 gene minC 4360 5007 CDS product putative septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JRB5 protein_id gnl|my_center|LOCUS_14610 5023 5835 gene locus_tag LOCUS_14620 gene minD 5023 5835 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ6 protein_id gnl|my_center|LOCUS_14620 5835 6089 gene locus_tag LOCUS_14630 gene minE 5835 6089 CDS product cell division topological specificity factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ5 protein_id gnl|my_center|LOCUS_14630 6095 6577 gene locus_tag LOCUS_14640 6095 6577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 6574 7497 gene locus_tag LOCUS_14650 6574 7497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 9007 7520 gene locus_tag LOCUS_14660 9007 7520 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361740.1 protein_id gnl|my_center|LOCUS_14660 9124 9366 gene locus_tag LOCUS_14670 9124 9366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 9363 9767 gene locus_tag LOCUS_14680 9363 9767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 10678 9716 gene locus_tag LOCUS_14690 gene gtrB 10678 9716 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037988.1 protein_id gnl|my_center|LOCUS_14690 11163 10675 gene locus_tag LOCUS_14700 gene cumB 11163 10675 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P2C1 protein_id gnl|my_center|LOCUS_14700 11502 12050 gene locus_tag LOCUS_14710 11502 12050 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088106.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14710 12444 12073 gene locus_tag LOCUS_14720 12444 12073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082795.1 protein_id gnl|my_center|LOCUS_14720 12956 12471 gene locus_tag LOCUS_14730 12956 12471 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528038.1 protein_id gnl|my_center|LOCUS_14730 13765 12953 gene locus_tag LOCUS_14740 13765 12953 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970229.1 protein_id gnl|my_center|LOCUS_14740 14144 13755 gene locus_tag LOCUS_14750 14144 13755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036378.1 protein_id gnl|my_center|LOCUS_14750 14672 14262 gene locus_tag LOCUS_14760 14672 14262 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530666.1 protein_id gnl|my_center|LOCUS_14760 16016 14769 gene locus_tag LOCUS_14770 16016 14769 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082803.1 protein_id gnl|my_center|LOCUS_14770 17657 16089 gene locus_tag LOCUS_14780 gene guaA 17657 16089 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886X5 protein_id gnl|my_center|LOCUS_14780 19114 17654 gene locus_tag LOCUS_14790 gene guaB 19114 17654 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VVM3 protein_id gnl|my_center|LOCUS_14790 19187 20659 gene locus_tag LOCUS_14800 gene xseA 19187 20659 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTW4 protein_id gnl|my_center|LOCUS_14800 20797 21330 gene locus_tag LOCUS_14810 gene algU 20797 21330 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WIP2 protein_id gnl|my_center|LOCUS_14810 21327 21998 gene locus_tag LOCUS_14820 21327 21998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 21985 23511 gene locus_tag LOCUS_14830 21985 23511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 23508 24434 gene locus_tag LOCUS_14840 23508 24434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 24504 25328 gene locus_tag LOCUS_14850 gene speD 24504 25328 CDS product S-adenosylmethionine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X4I6 protein_id gnl|my_center|LOCUS_14850 25390 26400 gene locus_tag LOCUS_14860 25390 26400 CDS product 2-hydroxy-3-carboxy-6-oxo-7-methylocta-2,4-dienoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731314.1 protein_id gnl|my_center|LOCUS_14860 26393 27676 gene locus_tag LOCUS_14870 gene kynU 26393 27676 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAD2 protein_id gnl|my_center|LOCUS_14870 27673 29034 gene locus_tag LOCUS_14880 gene kmo 27673 29034 CDS product kynurenine 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAD3 protein_id gnl|my_center|LOCUS_14880 29092 30111 gene locus_tag LOCUS_14890 29092 30111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 31156 30371 gene locus_tag LOCUS_14900 gene sdhB 31156 30371 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CHJ9 protein_id gnl|my_center|LOCUS_14900 <32519 31178 gene locus_tag LOCUS_14910 <32519 31178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P8V4:succinate dehydrogenase flavoprotein subunit >Feature sequence041 4241 3894 gene locus_tag LOCUS_14920 4241 3894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 4537 4731 gene locus_tag LOCUS_14930 4537 4731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 4797 5204 gene locus_tag LOCUS_14940 4797 5204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 5316 6497 gene locus_tag LOCUS_14950 5316 6497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 7264 6449 gene locus_tag LOCUS_14960 7264 6449 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091874.1 protein_id gnl|my_center|LOCUS_14960 7323 7799 gene locus_tag LOCUS_14970 gene ysnE 7323 7799 CDS product putative N-acetyltransferase YsnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94562 protein_id gnl|my_center|LOCUS_14970 7796 8179 gene locus_tag LOCUS_14980 7796 8179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 8392 8868 gene locus_tag LOCUS_14990 8392 8868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114652.1 protein_id gnl|my_center|LOCUS_14990 8972 9517 gene locus_tag LOCUS_15000 8972 9517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073723.1 protein_id gnl|my_center|LOCUS_15000 10643 9633 gene locus_tag LOCUS_15010 10643 9633 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525265.1 protein_id gnl|my_center|LOCUS_15010 11039 10683 gene locus_tag LOCUS_15020 11039 10683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 11133 13265 gene locus_tag LOCUS_15030 11133 13265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 14401 13292 gene locus_tag LOCUS_15040 14401 13292 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038953.1 protein_id gnl|my_center|LOCUS_15040 15507 14404 gene locus_tag LOCUS_15050 15507 14404 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038954.1 protein_id gnl|my_center|LOCUS_15050 15675 16271 gene locus_tag LOCUS_15060 15675 16271 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038955.1 protein_id gnl|my_center|LOCUS_15060 17401 16304 gene locus_tag LOCUS_15070 17401 16304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919845.1 protein_id gnl|my_center|LOCUS_15070 18783 17401 gene locus_tag LOCUS_15080 18783 17401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 18991 21021 gene locus_tag LOCUS_15090 18991 21021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 21202 21588 gene locus_tag LOCUS_15100 21202 21588 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142971.1 protein_id gnl|my_center|LOCUS_15100 21590 23674 gene locus_tag LOCUS_15110 21590 23674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919512.1 protein_id gnl|my_center|LOCUS_15110 25399 23729 gene locus_tag LOCUS_15120 25399 23729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 25462 28170 gene locus_tag LOCUS_15130 25462 28170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 30027 28171 gene locus_tag LOCUS_15140 30027 28171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 32207 30045 gene locus_tag LOCUS_15150 32207 30045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 >Feature sequence042 2806 3138 gene locus_tag LOCUS_15160 2806 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 3539 3141 gene locus_tag LOCUS_15170 gene sspB 3539 3141 CDS product stringent starvation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377610.1 protein_id gnl|my_center|LOCUS_15170 4159 3536 gene locus_tag LOCUS_15180 4159 3536 CDS product stringent starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098965.1 protein_id gnl|my_center|LOCUS_15180 5030 4269 gene locus_tag LOCUS_15190 5030 4269 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262642.1 protein_id gnl|my_center|LOCUS_15190 6273 5023 gene locus_tag LOCUS_15200 6273 5023 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY5 protein_id gnl|my_center|LOCUS_15200 6875 6270 gene locus_tag LOCUS_15210 gene petA 6875 6270 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPZ1 protein_id gnl|my_center|LOCUS_15210 7194 8321 gene locus_tag LOCUS_15220 7194 8321 CDS product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340656.1 protein_id gnl|my_center|LOCUS_15220 9815 8331 gene locus_tag LOCUS_15230 gene lysS 9815 8331 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y6S5 protein_id gnl|my_center|LOCUS_15230 10864 9821 gene locus_tag LOCUS_15240 gene prfB 10864 9821 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EN98 protein_id gnl|my_center|LOCUS_15240 11009 10842 gene locus_tag LOCUS_15250 11009 10842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 12666 11041 gene locus_tag LOCUS_15260 gene pruA 12666 11041 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404266.1 protein_id gnl|my_center|LOCUS_15260 13138 13362 gene locus_tag LOCUS_15270 13138 13362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 13944 13366 gene locus_tag LOCUS_15280 13944 13366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 15206 13941 gene locus_tag LOCUS_15290 15206 13941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 17306 15210 gene locus_tag LOCUS_15300 gene asmA 17306 15210 CDS product cell envelope biogenesis protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262294.1 protein_id gnl|my_center|LOCUS_15300 17487 17762 gene locus_tag LOCUS_15310 17487 17762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 17759 18865 gene locus_tag LOCUS_15320 17759 18865 CDS product T-protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CQ99 protein_id gnl|my_center|LOCUS_15320 19152 18880 gene locus_tag LOCUS_15330 gene acyP 19152 18880 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC73 protein_id gnl|my_center|LOCUS_15330 19610 19155 gene locus_tag LOCUS_15340 19610 19155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 20944 19607 gene locus_tag LOCUS_15350 20944 19607 CDS product UPF0761 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC75 protein_id gnl|my_center|LOCUS_15350 21040 21393 gene locus_tag LOCUS_15360 gene arsC 21040 21393 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED91 protein_id gnl|my_center|LOCUS_15360 21390 21953 gene locus_tag LOCUS_15370 21390 21953 CDS product Trp repressor-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623699.1 protein_id gnl|my_center|LOCUS_15370 21950 22309 gene locus_tag LOCUS_15380 21950 22309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 25040 22212 gene locus_tag LOCUS_15390 25040 22212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 25308 27005 gene locus_tag LOCUS_15400 25308 27005 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090623.1 protein_id gnl|my_center|LOCUS_15400 27688 27032 gene locus_tag LOCUS_15410 gene rnt 27688 27032 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAG3 protein_id gnl|my_center|LOCUS_15410 27749 27958 gene locus_tag LOCUS_15420 27749 27958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 28022 29080 gene locus_tag LOCUS_15430 gene obg 28022 29080 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBH0 protein_id gnl|my_center|LOCUS_15430 29478 29215 gene locus_tag LOCUS_15440 gene rpsT 29478 29215 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ED6 protein_id gnl|my_center|LOCUS_15440 29659 30150 gene locus_tag LOCUS_15450 29659 30150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 30125 30589 gene locus_tag LOCUS_15460 30125 30589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 30589 31434 gene locus_tag LOCUS_15470 30589 31434 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6V0 protein_id gnl|my_center|LOCUS_15470 >Feature sequence043 823 1764 gene locus_tag LOCUS_15480 823 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 2395 1736 gene locus_tag LOCUS_15490 2395 1736 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478128.1 protein_id gnl|my_center|LOCUS_15490 2641 2565 gene locus_tag LOCUS_t00130 2641 2565 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3033 2740 gene locus_tag LOCUS_15500 3033 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 2956 3297 gene locus_tag LOCUS_15510 2956 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 3758 3309 gene locus_tag LOCUS_15520 3758 3309 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173892.1 protein_id gnl|my_center|LOCUS_15520 4054 3839 gene locus_tag LOCUS_15530 gene rpsU 4054 3839 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66536 protein_id gnl|my_center|LOCUS_15530 4951 4325 gene locus_tag LOCUS_15540 4951 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035281.1 protein_id gnl|my_center|LOCUS_15540 5033 5662 gene locus_tag LOCUS_15550 gene alkB 5033 5662 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035874.1 protein_id gnl|my_center|LOCUS_15550 5821 6642 gene locus_tag LOCUS_15560 5821 6642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 6643 7551 gene locus_tag LOCUS_15570 6643 7551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 7765 11289 gene locus_tag LOCUS_15580 7765 11289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 11544 11281 gene locus_tag LOCUS_15590 11544 11281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 11804 11610 gene locus_tag LOCUS_15600 11804 11610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 11835 12749 gene locus_tag LOCUS_15610 11835 12749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 12760 13956 gene locus_tag LOCUS_15620 12760 13956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 13953 16100 gene locus_tag LOCUS_15630 13953 16100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 19155 16243 gene locus_tag LOCUS_15640 19155 16243 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071943.1 protein_id gnl|my_center|LOCUS_15640 20084 19230 gene locus_tag LOCUS_15650 20084 19230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 20280 20771 gene locus_tag LOCUS_15660 20280 20771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 20771 23431 gene locus_tag LOCUS_15670 20771 23431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 23946 23521 gene locus_tag LOCUS_15680 23946 23521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15680 24516 24130 gene locus_tag LOCUS_15690 24516 24130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 25261 24875 gene locus_tag LOCUS_15700 25261 24875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 25512 25868 gene locus_tag LOCUS_15710 25512 25868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 26682 26428 gene locus_tag LOCUS_15720 26682 26428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 28361 26697 gene locus_tag LOCUS_15730 28361 26697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 29742 28885 gene locus_tag LOCUS_15740 29742 28885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 30008 30433 gene locus_tag LOCUS_15750 30008 30433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 30620 30913 gene locus_tag LOCUS_15760 30620 30913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 31007 31270 gene locus_tag LOCUS_15770 31007 31270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 >Feature sequence044 1882 2895 gene locus_tag LOCUS_15780 gene moxR 1882 2895 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038330.1 protein_id gnl|my_center|LOCUS_15780 2897 3802 gene locus_tag LOCUS_15790 2897 3802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948544.1 protein_id gnl|my_center|LOCUS_15790 3807 4274 gene locus_tag LOCUS_15800 3807 4274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 4267 5244 gene locus_tag LOCUS_15810 4267 5244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113946.1 protein_id gnl|my_center|LOCUS_15810 5244 6938 gene locus_tag LOCUS_15820 5244 6938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 6938 8614 gene locus_tag LOCUS_15830 6938 8614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267197.1 protein_id gnl|my_center|LOCUS_15830 8671 10212 gene locus_tag LOCUS_15840 8671 10212 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403922.1 protein_id gnl|my_center|LOCUS_15840 12119 10272 gene locus_tag LOCUS_15850 gene rpoD 12119 10272 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P26480 protein_id gnl|my_center|LOCUS_15850 12129 12428 gene locus_tag LOCUS_15860 12129 12428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 12803 12558 gene locus_tag LOCUS_15870 12803 12558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958608.1 protein_id gnl|my_center|LOCUS_15870 13422 12796 gene locus_tag LOCUS_15880 gene engB 13422 12796 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5E4 protein_id gnl|my_center|LOCUS_15880 13595 14221 gene locus_tag LOCUS_15890 gene cc4 13595 14221 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P00106 protein_id gnl|my_center|LOCUS_15890 14439 14242 gene locus_tag LOCUS_15900 14439 14242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 14356 15033 gene locus_tag LOCUS_15910 gene dsbA 14356 15033 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C2B2 protein_id gnl|my_center|LOCUS_15910 15114 15926 gene locus_tag LOCUS_15920 15114 15926 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038499.1 protein_id gnl|my_center|LOCUS_15920 15931 17913 gene locus_tag LOCUS_15930 15931 17913 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113975.1 protein_id gnl|my_center|LOCUS_15930 17910 18857 gene locus_tag LOCUS_15940 17910 18857 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065041.1 protein_id gnl|my_center|LOCUS_15940 18869 20107 gene locus_tag LOCUS_15950 gene cca 18869 20107 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5V3 protein_id gnl|my_center|LOCUS_15950 20423 20070 gene locus_tag LOCUS_15960 20423 20070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 21550 20432 gene locus_tag LOCUS_15970 21550 20432 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958470.1 protein_id gnl|my_center|LOCUS_15970 22413 21571 gene locus_tag LOCUS_15980 22413 21571 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930427.1 protein_id gnl|my_center|LOCUS_15980 23250 22504 gene locus_tag LOCUS_15990 23250 22504 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195790.1 protein_id gnl|my_center|LOCUS_15990 23787 23281 gene locus_tag LOCUS_16000 23787 23281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 25853 23775 gene locus_tag LOCUS_16010 25853 23775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 25967 26719 gene locus_tag LOCUS_16020 25967 26719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 26764 31137 gene locus_tag LOCUS_16030 26764 31137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 >Feature sequence045 1135 221 gene locus_tag LOCUS_16040 1135 221 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958093.1 protein_id gnl|my_center|LOCUS_16040 1902 1132 gene locus_tag LOCUS_16050 gene nadK 1902 1132 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX24 protein_id gnl|my_center|LOCUS_16050 6830 1899 gene locus_tag LOCUS_16060 6830 1899 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037508.1 protein_id gnl|my_center|LOCUS_16060 7867 6989 gene locus_tag LOCUS_16070 7867 6989 CDS product PPK2 family polyphosphate--nucleotide phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789758.1 protein_id gnl|my_center|LOCUS_16070 7952 8860 gene locus_tag LOCUS_16080 gene purC 7952 8860 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WHQ9 protein_id gnl|my_center|LOCUS_16080 8857 9330 gene locus_tag LOCUS_16090 8857 9330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843542.1 protein_id gnl|my_center|LOCUS_16090 9360 10592 gene locus_tag LOCUS_16100 9360 10592 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087741.1 protein_id gnl|my_center|LOCUS_16100 11811 11038 gene locus_tag LOCUS_16110 11811 11038 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403708.1 protein_id gnl|my_center|LOCUS_16110 13228 11825 gene locus_tag LOCUS_16120 gene asnS 13228 11825 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZT80 protein_id gnl|my_center|LOCUS_16120 13737 13381 gene locus_tag LOCUS_16130 gene rplS 13737 13381 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LT1 protein_id gnl|my_center|LOCUS_16130 14514 13774 gene locus_tag LOCUS_16140 gene trmD 14514 13774 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUF8 protein_id gnl|my_center|LOCUS_16140 15005 14514 gene locus_tag LOCUS_16150 gene rimM 15005 14514 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFY2 protein_id gnl|my_center|LOCUS_16150 15312 15034 gene locus_tag LOCUS_16160 gene rpsP 15312 15034 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBC3 protein_id gnl|my_center|LOCUS_16160 16071 15541 gene locus_tag LOCUS_16170 16071 15541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036882.1 protein_id gnl|my_center|LOCUS_16170 16626 17405 gene locus_tag LOCUS_16180 gene surE 16626 17405 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9Y7 protein_id gnl|my_center|LOCUS_16180 17402 18064 gene locus_tag LOCUS_16190 gene pcm 17402 18064 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9Y6 protein_id gnl|my_center|LOCUS_16190 18061 18642 gene locus_tag LOCUS_16200 18061 18642 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036885.1 protein_id gnl|my_center|LOCUS_16200 19173 19496 gene locus_tag LOCUS_16210 19173 19496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 19512 20381 gene locus_tag LOCUS_16220 gene rpoS 19512 20381 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45684 protein_id gnl|my_center|LOCUS_16220 22375 20441 gene locus_tag LOCUS_16230 22375 20441 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810859.1 protein_id gnl|my_center|LOCUS_16230 24161 22470 gene locus_tag LOCUS_16240 gene aceK 24161 22470 CDS product isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4D0 protein_id gnl|my_center|LOCUS_16240 25315 24209 gene locus_tag LOCUS_16250 gene uptC 25315 24209 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035837.1 protein_id gnl|my_center|LOCUS_16250 26274 25456 gene locus_tag LOCUS_16260 gene cysQ 26274 25456 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638230.2 protein_id gnl|my_center|LOCUS_16260 26822 26271 gene locus_tag LOCUS_16270 gene nudE 26822 26271 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038008.1 protein_id gnl|my_center|LOCUS_16270 27585 26815 gene locus_tag LOCUS_16280 27585 26815 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907861.1 protein_id gnl|my_center|LOCUS_16280 28340 27579 gene locus_tag LOCUS_16290 28340 27579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 28823 28344 gene locus_tag LOCUS_16300 28823 28344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 29974 28820 gene locus_tag LOCUS_16310 gene gspL 29974 28820 CDS product type II secretion system protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKC1 protein_id gnl|my_center|LOCUS_16310 <30808 30026 gene locus_tag LOCUS_16320 <30808 30026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096805.1:ABC transporter ATP-binding protein >Feature sequence046 281 1657 gene locus_tag LOCUS_16330 281 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 2544 1666 gene locus_tag LOCUS_16340 2544 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 3776 2541 gene locus_tag LOCUS_16350 3776 2541 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258073.1 protein_id gnl|my_center|LOCUS_16350 3940 4761 gene locus_tag LOCUS_16360 3940 4761 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593361.1 protein_id gnl|my_center|LOCUS_16360 5888 4767 gene locus_tag LOCUS_16370 5888 4767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 6662 7786 gene locus_tag LOCUS_16380 6662 7786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 8349 7900 gene locus_tag LOCUS_16390 8349 7900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 11002 8402 gene locus_tag LOCUS_16400 gene pepN 11002 8402 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 protein_id gnl|my_center|LOCUS_16400 11920 11012 gene locus_tag LOCUS_16410 11920 11012 CDS product acetoin utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036031.1 protein_id gnl|my_center|LOCUS_16410 12480 11929 gene locus_tag LOCUS_16420 12480 11929 CDS product ATP--cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036032.1 protein_id gnl|my_center|LOCUS_16420 13138 12632 gene locus_tag LOCUS_16430 13138 12632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 15444 13189 gene locus_tag LOCUS_16440 15444 13189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729998.1 protein_id gnl|my_center|LOCUS_16440 15823 15449 gene locus_tag LOCUS_16450 15823 15449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 16671 15820 gene locus_tag LOCUS_16460 gene fdhD 16671 15820 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBW0 protein_id gnl|my_center|LOCUS_16460 16838 18874 gene locus_tag LOCUS_16470 16838 18874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 19749 19057 gene locus_tag LOCUS_16480 19749 19057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 21474 19861 gene locus_tag LOCUS_16490 21474 19861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 21951 21589 gene locus_tag LOCUS_16500 21951 21589 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088099.1 protein_id gnl|my_center|LOCUS_16500 22382 21948 gene locus_tag LOCUS_16510 22382 21948 CDS product NIPSNAP family containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528650.1 protein_id gnl|my_center|LOCUS_16510 22279 23037 gene locus_tag LOCUS_16520 22279 23037 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707130.1 protein_id gnl|my_center|LOCUS_16520 23171 23935 gene locus_tag LOCUS_16530 23171 23935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 23935 24618 gene locus_tag LOCUS_16540 23935 24618 CDS product phytanoyl-CoA dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122357.1 protein_id gnl|my_center|LOCUS_16540 25960 24626 gene locus_tag LOCUS_16550 25960 24626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 26129 26437 gene locus_tag LOCUS_16560 26129 26437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 27690 26674 gene locus_tag LOCUS_16570 27690 26674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 27823 28038 gene locus_tag LOCUS_16580 27823 28038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 <30789 28035 gene locus_tag LOCUS_16590 <30789 28035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918005.1:amidohydrolase >Feature sequence047 670 479 gene locus_tag LOCUS_16600 670 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 1613 771 gene locus_tag LOCUS_16610 1613 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 2678 1701 gene locus_tag LOCUS_16620 2678 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 2748 2824 gene locus_tag LOCUS_t00140 2748 2824 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3868 5211 gene locus_tag LOCUS_16630 3868 5211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 5411 6934 gene locus_tag LOCUS_16640 5411 6934 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064509.1 protein_id gnl|my_center|LOCUS_16640 6927 7385 gene locus_tag LOCUS_16650 6927 7385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 8528 7437 gene locus_tag LOCUS_16660 8528 7437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 8952 10673 gene locus_tag LOCUS_16670 8952 10673 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140057.1 protein_id gnl|my_center|LOCUS_16670 10745 10945 gene locus_tag LOCUS_16680 10745 10945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 11001 21644 gene locus_tag LOCUS_16690 11001 21644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 22957 21968 gene locus_tag LOCUS_16700 22957 21968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539523.1 protein_id gnl|my_center|LOCUS_16700 23404 23132 gene locus_tag LOCUS_16710 23404 23132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 24663 23533 gene locus_tag LOCUS_16720 24663 23533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 26396 24771 gene locus_tag LOCUS_16730 26396 24771 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205070.1 protein_id gnl|my_center|LOCUS_16730 26637 26413 gene locus_tag LOCUS_16740 26637 26413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 28093 26786 gene locus_tag LOCUS_16750 28093 26786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 28257 28078 gene locus_tag LOCUS_16760 28257 28078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 >Feature sequence048 776 1702 gene locus_tag LOCUS_16770 776 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 2678 1755 gene locus_tag LOCUS_16780 2678 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 3094 2675 gene locus_tag LOCUS_16790 3094 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 4405 3101 gene locus_tag LOCUS_16800 4405 3101 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727955.1 protein_id gnl|my_center|LOCUS_16800 4559 6175 gene locus_tag LOCUS_16810 4559 6175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 6449 6877 gene locus_tag LOCUS_16820 6449 6877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 6907 7398 gene locus_tag LOCUS_16830 6907 7398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968171.1 protein_id gnl|my_center|LOCUS_16830 7677 7435 gene locus_tag LOCUS_16840 7677 7435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 7825 8040 gene locus_tag LOCUS_16850 7825 8040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 8350 10914 gene locus_tag LOCUS_16860 8350 10914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 11153 11470 gene locus_tag LOCUS_16870 11153 11470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 11470 13581 gene locus_tag LOCUS_16880 11470 13581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 14638 13631 gene locus_tag LOCUS_16890 14638 13631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256204.1 protein_id gnl|my_center|LOCUS_16890 15338 14715 gene locus_tag LOCUS_16900 15338 14715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 15390 16028 gene locus_tag LOCUS_16910 15390 16028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339247.1 protein_id gnl|my_center|LOCUS_16910 16015 16470 gene locus_tag LOCUS_16920 16015 16470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 17030 16440 gene locus_tag LOCUS_16930 17030 16440 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123671.1 protein_id gnl|my_center|LOCUS_16930 17199 19904 gene locus_tag LOCUS_16940 17199 19904 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141097.1 protein_id gnl|my_center|LOCUS_16940 20047 21906 gene locus_tag LOCUS_16950 20047 21906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 22515 21943 gene locus_tag LOCUS_16960 22515 21943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 23639 22737 gene locus_tag LOCUS_16970 23639 22737 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106415.1 protein_id gnl|my_center|LOCUS_16970 23805 24221 gene locus_tag LOCUS_16980 23805 24221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 24218 24436 gene locus_tag LOCUS_16990 24218 24436 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920093.1 protein_id gnl|my_center|LOCUS_16990 24433 26172 gene locus_tag LOCUS_17000 24433 26172 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405428.1 protein_id gnl|my_center|LOCUS_17000 29516 26238 gene locus_tag LOCUS_17010 29516 26238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 >Feature sequence049 1693 683 gene locus_tag LOCUS_17020 1693 683 CDS product Mg-protoporphyrin IX chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX55 protein_id gnl|my_center|LOCUS_17020 2618 1740 gene locus_tag LOCUS_17030 2618 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388372.1 protein_id gnl|my_center|LOCUS_17030 3685 2624 gene locus_tag LOCUS_17040 gene acsF 3685 2624 CDS product aerobic magnesium-protoporphyrin IX monomethyl ester [oxidative] cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J166 protein_id gnl|my_center|LOCUS_17040 4185 3682 gene locus_tag LOCUS_17050 4185 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 4853 4182 gene locus_tag LOCUS_17060 4853 4182 CDS product photosynthetic complex assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388374.1 protein_id gnl|my_center|LOCUS_17060 5626 4850 gene locus_tag LOCUS_17070 5626 4850 CDS product photosynthetic reaction center subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388375.1 protein_id gnl|my_center|LOCUS_17070 7141 5720 gene locus_tag LOCUS_17080 7141 5720 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388376.1 protein_id gnl|my_center|LOCUS_17080 7839 7138 gene locus_tag LOCUS_17090 7839 7138 CDS product magnesium protoporphyrin IX methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388377.1 protein_id gnl|my_center|LOCUS_17090 8669 7839 gene locus_tag LOCUS_17100 gene bchL 8669 7839 CDS product light-independent protochlorophyllide reductase iron-sulfur ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWS1 protein_id gnl|my_center|LOCUS_17100 12406 8747 gene locus_tag LOCUS_17110 gene bchH 12406 8747 CDS product magnesium chelatase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388379.1 protein_id gnl|my_center|LOCUS_17110 13964 12396 gene locus_tag LOCUS_17120 gene bchB 13964 12396 CDS product light-independent protochlorophyllide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWR9 protein_id gnl|my_center|LOCUS_17120 15232 13964 gene locus_tag LOCUS_17130 gene bchN 15232 13964 CDS product light-independent protochlorophyllide reductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWR8 protein_id gnl|my_center|LOCUS_17130 15744 15229 gene locus_tag LOCUS_17140 15744 15229 CDS product 2-vinyl bacteriochlorophyllide hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388382.1 protein_id gnl|my_center|LOCUS_17140 15981 16844 gene locus_tag LOCUS_17150 gene ppaA 15981 16844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720447.1 protein_id gnl|my_center|LOCUS_17150 16939 18321 gene locus_tag LOCUS_17160 16939 18321 CDS product transcriptional regulator PpsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388384.1 protein_id gnl|my_center|LOCUS_17160 18402 19301 gene locus_tag LOCUS_17170 18402 19301 CDS product bacteriochlorophyll/chlorophyll a synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388385.1 protein_id gnl|my_center|LOCUS_17170 19298 20638 gene locus_tag LOCUS_17180 19298 20638 CDS product bacteriochlorophyll synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388386.1 protein_id gnl|my_center|LOCUS_17180 20841 21815 gene locus_tag LOCUS_17190 gene bchP 20841 21815 CDS product geranylgeranyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720441.1 protein_id gnl|my_center|LOCUS_17190 21887 22345 gene locus_tag LOCUS_17200 21887 22345 CDS product sensory protein TspO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061381.1 protein_id gnl|my_center|LOCUS_17200 22389 22871 gene locus_tag LOCUS_17210 gene smpB 22389 22871 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAL7 protein_id gnl|my_center|LOCUS_17210 23124 23702 gene locus_tag LOCUS_17220 23124 23702 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926777.1 protein_id gnl|my_center|LOCUS_17220 23686 24318 gene locus_tag LOCUS_17230 23686 24318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 24347 24946 gene locus_tag LOCUS_17240 24347 24946 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930523.1 protein_id gnl|my_center|LOCUS_17240 24936 26705 gene locus_tag LOCUS_17250 24936 26705 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337351.1 protein_id gnl|my_center|LOCUS_17250 26903 27196 gene locus_tag LOCUS_17260 26903 27196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 27210 28232 gene locus_tag LOCUS_17270 gene truD 27210 28232 CDS product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9Y9 protein_id gnl|my_center|LOCUS_17270 28766 29200 gene locus_tag LOCUS_17280 28766 29200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 <30016 29294 gene locus_tag LOCUS_17290 <30016 29294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P7Q6:phosphatidylserine decarboxylase proenzyme >Feature sequence050 <1 916 gene locus_tag LOCUS_17300 <1 916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122128.1:RTX toxin 2285 972 gene locus_tag LOCUS_17310 2285 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119919.1 protein_id gnl|my_center|LOCUS_17310 5010 2623 gene locus_tag LOCUS_17320 5010 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 5208 6233 gene locus_tag LOCUS_17330 5208 6233 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266300.1 protein_id gnl|my_center|LOCUS_17330 6335 7960 gene locus_tag LOCUS_17340 gene tldD 6335 7960 CDS product TldD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035352.1 protein_id gnl|my_center|LOCUS_17340 7979 9295 gene locus_tag LOCUS_17350 gene tldD 7979 9295 CDS product TldD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035351.1 protein_id gnl|my_center|LOCUS_17350 9366 10235 gene locus_tag LOCUS_17360 9366 10235 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNQ6 protein_id gnl|my_center|LOCUS_17360 10257 11231 gene locus_tag LOCUS_17370 10257 11231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 11297 16762 gene locus_tag LOCUS_17380 11297 16762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17380 16799 17092 gene locus_tag LOCUS_17390 16799 17092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 17532 17852 gene locus_tag LOCUS_17400 17532 17852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 19814 18285 gene locus_tag LOCUS_17410 gene speE1 19814 18285 CDS product polyamine aminopropyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZP1 protein_id gnl|my_center|LOCUS_17410 20145 19807 gene locus_tag LOCUS_17420 20145 19807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 20371 20132 gene locus_tag LOCUS_17430 20371 20132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 21867 20368 gene locus_tag LOCUS_17440 21867 20368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 22492 21890 gene locus_tag LOCUS_17450 22492 21890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 23502 22489 gene locus_tag LOCUS_17460 23502 22489 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173870.1 protein_id gnl|my_center|LOCUS_17460 24428 23607 gene locus_tag LOCUS_17470 24428 23607 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777022.1 protein_id gnl|my_center|LOCUS_17470 26230 24443 gene locus_tag LOCUS_17480 26230 24443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637660.2 protein_id gnl|my_center|LOCUS_17480 27296 26349 gene locus_tag LOCUS_17490 gene cmoB 27296 26349 CDS product tRNA U34 carboxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3G2T3 protein_id gnl|my_center|LOCUS_17490 28024 27293 gene locus_tag LOCUS_17500 gene cmoA 28024 27293 CDS product carboxy-S-adenosyl-L-methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CKB7 protein_id gnl|my_center|LOCUS_17500 29733 28033 gene locus_tag LOCUS_17510 gene recJ 29733 28033 CDS product ssDNA exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173449.1 protein_id gnl|my_center|LOCUS_17510 >Feature sequence051 14289 12451 gene locus_tag LOCUS_17520 14289 12451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 14676 14416 gene locus_tag LOCUS_17530 14676 14416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 15612 14764 gene locus_tag LOCUS_17540 15612 14764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 15777 15628 gene locus_tag LOCUS_17550 15777 15628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 16640 15888 gene locus_tag LOCUS_17560 16640 15888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527732.1 protein_id gnl|my_center|LOCUS_17560 16730 17005 gene locus_tag LOCUS_17570 16730 17005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 17016 17504 gene locus_tag LOCUS_17580 17016 17504 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81E75 protein_id gnl|my_center|LOCUS_17580 20083 17501 gene locus_tag LOCUS_17590 20083 17501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 20625 20080 gene locus_tag LOCUS_17600 20625 20080 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_17600 20650 24480 gene locus_tag LOCUS_17610 20650 24480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 24571 26577 gene locus_tag LOCUS_17620 24571 26577 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140180.1 protein_id gnl|my_center|LOCUS_17620 26574 26780 gene locus_tag LOCUS_17630 26574 26780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 29771 26814 gene locus_tag LOCUS_17640 29771 26814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 >Feature sequence052 40 249 gene locus_tag LOCUS_17650 40 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 4794 280 gene locus_tag LOCUS_17660 4794 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 6223 5261 gene locus_tag LOCUS_17670 6223 5261 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338826.1 protein_id gnl|my_center|LOCUS_17670 7455 6595 gene locus_tag LOCUS_17680 7455 6595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 9087 7732 gene locus_tag LOCUS_17690 9087 7732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 9968 9066 gene locus_tag LOCUS_17700 9968 9066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 11143 10922 gene locus_tag LOCUS_17710 11143 10922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 11167 11982 gene locus_tag LOCUS_17720 11167 11982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 13162 11969 gene locus_tag LOCUS_17730 13162 11969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 14400 13159 gene locus_tag LOCUS_17740 14400 13159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 14561 15340 gene locus_tag LOCUS_17750 14561 15340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 15376 16047 gene locus_tag LOCUS_17760 15376 16047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 16171 17358 gene locus_tag LOCUS_17770 16171 17358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 17744 17595 gene locus_tag LOCUS_17780 17744 17595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 17743 18351 gene locus_tag LOCUS_17790 17743 18351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 18631 18837 gene locus_tag LOCUS_17800 18631 18837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 20621 20085 gene locus_tag LOCUS_17810 20621 20085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403820.1 protein_id gnl|my_center|LOCUS_17810 21151 20618 gene locus_tag LOCUS_17820 21151 20618 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403827.1 protein_id gnl|my_center|LOCUS_17820 21495 21929 gene locus_tag LOCUS_17830 21495 21929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 22287 22550 gene locus_tag LOCUS_17840 22287 22550 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144325.1 protein_id gnl|my_center|LOCUS_17840 22547 22948 gene locus_tag LOCUS_17850 gene vapC 22547 22948 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND93 protein_id gnl|my_center|LOCUS_17850 25889 23451 gene locus_tag LOCUS_17860 25889 23451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 27301 29136 gene locus_tag LOCUS_17870 27301 29136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 >Feature sequence053 3141 2119 gene locus_tag LOCUS_17880 3141 2119 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877828.1 protein_id gnl|my_center|LOCUS_17880 5348 3168 gene locus_tag LOCUS_17890 5348 3168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 5788 6795 gene locus_tag LOCUS_17900 5788 6795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 7746 6994 gene locus_tag LOCUS_17910 7746 6994 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071857.1 protein_id gnl|my_center|LOCUS_17910 7992 9029 gene locus_tag LOCUS_17920 7992 9029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 11615 9042 gene locus_tag LOCUS_17930 11615 9042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 13509 11698 gene locus_tag LOCUS_17940 13509 11698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 14254 13580 gene locus_tag LOCUS_17950 14254 13580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 14660 14241 gene locus_tag LOCUS_17960 14660 14241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 15937 14657 gene locus_tag LOCUS_17970 15937 14657 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229161.1 protein_id gnl|my_center|LOCUS_17970 16866 15937 gene locus_tag LOCUS_17980 16866 15937 CDS product NADH(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229196.1 protein_id gnl|my_center|LOCUS_17980 17603 16866 gene locus_tag LOCUS_17990 17603 16866 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931863.1 protein_id gnl|my_center|LOCUS_17990 18872 17607 gene locus_tag LOCUS_18000 18872 17607 CDS product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267577.1 protein_id gnl|my_center|LOCUS_18000 20362 18932 gene locus_tag LOCUS_18010 20362 18932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55585 protein_id gnl|my_center|LOCUS_18010 22333 20441 gene locus_tag LOCUS_18020 22333 20441 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946359.1 protein_id gnl|my_center|LOCUS_18020 22574 24238 gene locus_tag LOCUS_18030 22574 24238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 25856 24819 gene locus_tag LOCUS_18040 25856 24819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 26675 25857 gene locus_tag LOCUS_18050 26675 25857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 27849 26689 gene locus_tag LOCUS_18060 27849 26689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 29411 27849 gene locus_tag LOCUS_18070 29411 27849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 >Feature sequence054 831 187 gene locus_tag LOCUS_18080 831 187 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940928.1 protein_id gnl|my_center|LOCUS_18080 1015 4656 gene locus_tag LOCUS_18090 1015 4656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 5016 6233 gene locus_tag LOCUS_18100 5016 6233 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941411.1 protein_id gnl|my_center|LOCUS_18100 6850 11148 gene locus_tag LOCUS_18110 6850 11148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 11135 11572 gene locus_tag LOCUS_18120 11135 11572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 12140 11781 gene locus_tag LOCUS_18130 12140 11781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 12407 12141 gene locus_tag LOCUS_18140 gene ccdA 12407 12141 CDS product antitoxin CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P62553 protein_id gnl|my_center|LOCUS_18140 12673 13356 gene locus_tag LOCUS_18150 12673 13356 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143439.1 protein_id gnl|my_center|LOCUS_18150 13340 13558 gene locus_tag LOCUS_18160 13340 13558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 13574 13858 gene locus_tag LOCUS_18170 13574 13858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 14850 14113 gene locus_tag LOCUS_18180 14850 14113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 15653 15036 gene locus_tag LOCUS_18190 15653 15036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 15942 15867 gene locus_tag LOCUS_t00150 15942 15867 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 17131 16349 gene locus_tag LOCUS_18200 17131 16349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 17287 19404 gene locus_tag LOCUS_18210 17287 19404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 19409 19858 gene locus_tag LOCUS_18220 19409 19858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 20772 19918 gene locus_tag LOCUS_18230 20772 19918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 20902 22119 gene locus_tag LOCUS_18240 gene yliI 20902 22119 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038894.1 protein_id gnl|my_center|LOCUS_18240 22437 22174 gene locus_tag LOCUS_18250 22437 22174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 24050 22434 gene locus_tag LOCUS_18260 24050 22434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 24258 25742 gene locus_tag LOCUS_18270 gene malT 24258 25742 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072433.1 protein_id gnl|my_center|LOCUS_18270 25745 27334 gene locus_tag LOCUS_18280 gene cgt 25745 27334 CDS product cyclomaltodextrin glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037602.1 protein_id gnl|my_center|LOCUS_18280 >Feature sequence055 43 555 gene locus_tag LOCUS_18290 gene rpsE 43 555 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66587 protein_id gnl|my_center|LOCUS_18290 548 745 gene locus_tag LOCUS_18300 gene rpmD 548 745 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83EQ8 protein_id gnl|my_center|LOCUS_18300 759 1190 gene locus_tag LOCUS_18310 gene rplO 759 1190 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JS08 protein_id gnl|my_center|LOCUS_18310 1194 2537 gene locus_tag LOCUS_18320 gene secY 1194 2537 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AGA4 protein_id gnl|my_center|LOCUS_18320 2633 2989 gene locus_tag LOCUS_18330 gene rpsM 2633 2989 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHU6 protein_id gnl|my_center|LOCUS_18330 3007 3396 gene locus_tag LOCUS_18340 gene rpsK 3007 3396 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PAB5 protein_id gnl|my_center|LOCUS_18340 3407 4033 gene locus_tag LOCUS_18350 gene rpsD 3407 4033 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A0X9 protein_id gnl|my_center|LOCUS_18350 4043 5032 gene locus_tag LOCUS_18360 gene rpoA 4043 5032 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52760 protein_id gnl|my_center|LOCUS_18360 5150 5443 gene locus_tag LOCUS_18370 5150 5443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 5528 6028 gene locus_tag LOCUS_18380 gene dsbB 5528 6028 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC32 protein_id gnl|my_center|LOCUS_18380 6035 6403 gene locus_tag LOCUS_18390 6035 6403 CDS product cytochrome c554 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706159.1 protein_id gnl|my_center|LOCUS_18390 6400 7128 gene locus_tag LOCUS_18400 gene djlA 6400 7128 CDS product co-chaperone protein DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45885 protein_id gnl|my_center|LOCUS_18400 7174 8556 gene locus_tag LOCUS_18410 gene fumC 7174 8556 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAI9 protein_id gnl|my_center|LOCUS_18410 8618 9919 gene locus_tag LOCUS_18420 8618 9919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 10001 11554 gene locus_tag LOCUS_18430 10001 11554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 12983 11586 gene locus_tag LOCUS_18440 12983 11586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637104.2 protein_id gnl|my_center|LOCUS_18440 13408 13208 gene locus_tag LOCUS_18450 13408 13208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 13682 15457 gene locus_tag LOCUS_18460 13682 15457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 17465 15714 gene locus_tag LOCUS_18470 17465 15714 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_18470 19188 17506 gene locus_tag LOCUS_18480 19188 17506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527135.1 protein_id gnl|my_center|LOCUS_18480 20103 19219 gene locus_tag LOCUS_18490 20103 19219 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527134.1 protein_id gnl|my_center|LOCUS_18490 21004 20336 gene locus_tag LOCUS_18500 21004 20336 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389000.1 protein_id gnl|my_center|LOCUS_18500 21206 21481 gene locus_tag LOCUS_18510 21206 21481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 22267 21779 gene locus_tag LOCUS_18520 22267 21779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 22878 22492 gene locus_tag LOCUS_18530 22878 22492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880355.1 protein_id gnl|my_center|LOCUS_18530 23761 23210 gene locus_tag LOCUS_18540 23761 23210 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112597.1 protein_id gnl|my_center|LOCUS_18540 24006 24347 gene locus_tag LOCUS_18550 24006 24347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 24472 24699 gene locus_tag LOCUS_18560 24472 24699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 25075 24827 gene locus_tag LOCUS_18570 25075 24827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 25016 28936 gene locus_tag LOCUS_18580 25016 28936 CDS product SWF/SNF family helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122252.1 protein_id gnl|my_center|LOCUS_18580 >Feature sequence056 117 9440 gene locus_tag LOCUS_18590 117 9440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 10155 9658 gene locus_tag LOCUS_18600 10155 9658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 10642 10142 gene locus_tag LOCUS_18610 10642 10142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 11023 14049 gene locus_tag LOCUS_18620 11023 14049 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640599.1 protein_id gnl|my_center|LOCUS_18620 14589 14218 gene locus_tag LOCUS_18630 14589 14218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 15268 14735 gene locus_tag LOCUS_18640 15268 14735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18640 15553 15912 gene locus_tag LOCUS_18650 15553 15912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 16382 16215 gene locus_tag LOCUS_18660 16382 16215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 16391 17776 gene locus_tag LOCUS_18670 gene dbpA 16391 17776 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113273.1 protein_id gnl|my_center|LOCUS_18670 17914 18183 gene locus_tag LOCUS_18680 17914 18183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 18912 18415 gene locus_tag LOCUS_18690 18912 18415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 19801 19070 gene locus_tag LOCUS_18700 19801 19070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 19924 20421 gene locus_tag LOCUS_18710 19924 20421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 24512 20769 gene locus_tag LOCUS_18720 24512 20769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 24909 25550 gene locus_tag LOCUS_18730 24909 25550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 25951 25619 gene locus_tag LOCUS_18740 25951 25619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 27641 26859 gene locus_tag LOCUS_18750 27641 26859 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 protein_id gnl|my_center|LOCUS_18750 27834 28868 gene locus_tag LOCUS_18760 27834 28868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 >Feature sequence057 1033 332 gene locus_tag LOCUS_18770 1033 332 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958575.1 protein_id gnl|my_center|LOCUS_18770 1272 2087 gene locus_tag LOCUS_18780 gene dapF 1272 2087 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F9Q4 protein_id gnl|my_center|LOCUS_18780 2084 2761 gene locus_tag LOCUS_18790 2084 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038590.1 protein_id gnl|my_center|LOCUS_18790 2751 3668 gene locus_tag LOCUS_18800 gene xerC 2751 3668 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P550 protein_id gnl|my_center|LOCUS_18800 4696 4004 gene locus_tag LOCUS_18810 4696 4004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 5603 6286 gene locus_tag LOCUS_18820 5603 6286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 6315 6959 gene locus_tag LOCUS_18830 6315 6959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 7734 6949 gene locus_tag LOCUS_18840 7734 6949 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262121.1 protein_id gnl|my_center|LOCUS_18840 13487 7776 gene locus_tag LOCUS_18850 13487 7776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 15435 13474 gene locus_tag LOCUS_18860 gene asnB 15435 13474 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976178.1 protein_id gnl|my_center|LOCUS_18860 22033 15404 gene locus_tag LOCUS_18870 22033 15404 CDS product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123515.1 protein_id gnl|my_center|LOCUS_18870 26664 22030 gene locus_tag LOCUS_18880 26664 22030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 28979 26658 gene locus_tag LOCUS_18890 28979 26658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 >Feature sequence058 497 1039 gene locus_tag LOCUS_18900 497 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 1115 1741 gene locus_tag LOCUS_18910 1115 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 2951 2379 gene locus_tag LOCUS_18920 2951 2379 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456472.1 protein_id gnl|my_center|LOCUS_18920 6352 2963 gene locus_tag LOCUS_18930 6352 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 7741 6428 gene locus_tag LOCUS_18940 gene mnmE 7741 6428 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JT87 protein_id gnl|my_center|LOCUS_18940 9440 7749 gene locus_tag LOCUS_18950 gene yidC 9440 7749 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT06 protein_id gnl|my_center|LOCUS_18950 9805 9443 gene locus_tag LOCUS_18960 gene rnpA 9805 9443 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQZ9 protein_id gnl|my_center|LOCUS_18960 10396 11163 gene locus_tag LOCUS_18970 10396 11163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103688.1 protein_id gnl|my_center|LOCUS_18970 11160 12116 gene locus_tag LOCUS_18980 11160 12116 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730493.1 protein_id gnl|my_center|LOCUS_18980 12200 12736 gene locus_tag LOCUS_18990 gene hslV 12200 12736 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXU1 protein_id gnl|my_center|LOCUS_18990 12733 14070 gene locus_tag LOCUS_19000 gene hslU 12733 14070 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P552 protein_id gnl|my_center|LOCUS_19000 14292 14089 gene locus_tag LOCUS_19010 14292 14089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 14368 15198 gene locus_tag LOCUS_19020 gene ttcA 14368 15198 CDS product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKM7 protein_id gnl|my_center|LOCUS_19020 15305 15826 gene locus_tag LOCUS_19030 15305 15826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 15908 16129 gene locus_tag LOCUS_19040 15908 16129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 16139 19123 gene locus_tag LOCUS_19050 16139 19123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 19130 20479 gene locus_tag LOCUS_19060 19130 20479 CDS product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704293.1 protein_id gnl|my_center|LOCUS_19060 20945 20430 gene locus_tag LOCUS_19070 20945 20430 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RT56 protein_id gnl|my_center|LOCUS_19070 22127 20979 gene locus_tag LOCUS_19080 gene pilU 22127 20979 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005990431.1 protein_id gnl|my_center|LOCUS_19080 23182 22145 gene locus_tag LOCUS_19090 gene pilT 23182 22145 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003489919.1 protein_id gnl|my_center|LOCUS_19090 23389 24072 gene locus_tag LOCUS_19100 23389 24072 CDS product UPF0001 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24562 protein_id gnl|my_center|LOCUS_19100 24128 24691 gene locus_tag LOCUS_19110 24128 24691 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404543.1 protein_id gnl|my_center|LOCUS_19110 24774 28691 gene locus_tag LOCUS_19120 24774 28691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 >Feature sequence059 780 172 gene locus_tag LOCUS_19130 780 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 1037 2911 gene locus_tag LOCUS_19140 1037 2911 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103096.1 protein_id gnl|my_center|LOCUS_19140 3240 3890 gene locus_tag LOCUS_19150 3240 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 6495 4285 gene locus_tag LOCUS_19160 gene prc 6495 4285 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038548.1 protein_id gnl|my_center|LOCUS_19160 6850 9168 gene locus_tag LOCUS_19170 6850 9168 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064553.1 protein_id gnl|my_center|LOCUS_19170 9165 9623 gene locus_tag LOCUS_19180 9165 9623 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561349.1 protein_id gnl|my_center|LOCUS_19180 9647 10768 gene locus_tag LOCUS_19190 9647 10768 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104643.1 protein_id gnl|my_center|LOCUS_19190 11127 10708 gene locus_tag LOCUS_19200 11127 10708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 13727 11367 gene locus_tag LOCUS_19210 13727 11367 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405440.1 protein_id gnl|my_center|LOCUS_19210 14812 13862 gene locus_tag LOCUS_19220 14812 13862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 15384 14809 gene locus_tag LOCUS_19230 15384 14809 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404669.1 protein_id gnl|my_center|LOCUS_19230 15492 18887 gene locus_tag LOCUS_19240 15492 18887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 19617 18997 gene locus_tag LOCUS_19250 gene ompW 19617 18997 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038301.1 protein_id gnl|my_center|LOCUS_19250 20694 19708 gene locus_tag LOCUS_19260 20694 19708 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964789.1 protein_id gnl|my_center|LOCUS_19260 21248 20748 gene locus_tag LOCUS_19270 21248 20748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 21461 21796 gene locus_tag LOCUS_19280 21461 21796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 24513 21844 gene locus_tag LOCUS_19290 24513 21844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 24401 24652 gene locus_tag LOCUS_19300 24401 24652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 24814 25161 gene locus_tag LOCUS_19310 24814 25161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 26920 25202 gene locus_tag LOCUS_19320 26920 25202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 27162 27365 gene locus_tag LOCUS_19330 27162 27365 CDS product UPF0337 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV61 protein_id gnl|my_center|LOCUS_19330 27499 28149 gene locus_tag LOCUS_19340 27499 28149 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071590.1 protein_id gnl|my_center|LOCUS_19340 >Feature sequence060 1470 2699 gene locus_tag LOCUS_19350 1470 2699 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107426.1 protein_id gnl|my_center|LOCUS_19350 3578 2799 gene locus_tag LOCUS_19360 3578 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 5196 3925 gene locus_tag LOCUS_19370 5196 3925 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720129.1 protein_id gnl|my_center|LOCUS_19370 6052 5444 gene locus_tag LOCUS_19380 6052 5444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 6197 7516 gene locus_tag LOCUS_19390 6197 7516 CDS product putative amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705460.1 protein_id gnl|my_center|LOCUS_19390 7947 10748 gene locus_tag LOCUS_19400 7947 10748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 10738 15495 gene locus_tag LOCUS_19410 10738 15495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 15878 16438 gene locus_tag LOCUS_19420 15878 16438 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_19420 16499 19258 gene locus_tag LOCUS_19430 16499 19258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 19420 21366 gene locus_tag LOCUS_19440 19420 21366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 22867 21491 gene locus_tag LOCUS_19450 22867 21491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 23079 25739 gene locus_tag LOCUS_19460 23079 25739 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036620.1 protein_id gnl|my_center|LOCUS_19460 26365 25811 gene locus_tag LOCUS_19470 26365 25811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 27210 26458 gene locus_tag LOCUS_19480 27210 26458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 27470 27760 gene locus_tag LOCUS_19490 27470 27760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 >Feature sequence061 891 565 gene locus_tag LOCUS_19500 gene trxA 891 565 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y7V6 protein_id gnl|my_center|LOCUS_19500 1046 2440 gene locus_tag LOCUS_19510 1046 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 2497 3399 gene locus_tag LOCUS_19520 gene gspC 2497 3399 CDS product type II secretion system protein GspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070562.1 protein_id gnl|my_center|LOCUS_19520 3396 5384 gene locus_tag LOCUS_19530 gene xcpQ 3396 5384 CDS product type II secretion system protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35818 protein_id gnl|my_center|LOCUS_19530 5385 6857 gene locus_tag LOCUS_19540 gene xcpR 5385 6857 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00512 protein_id gnl|my_center|LOCUS_19540 6879 8090 gene locus_tag LOCUS_19550 gene gspF 6879 8090 CDS product type II secretion system protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704542.1 protein_id gnl|my_center|LOCUS_19550 8087 8758 gene locus_tag LOCUS_19560 gene ftsE 8087 8758 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704349.1 protein_id gnl|my_center|LOCUS_19560 8755 9696 gene locus_tag LOCUS_19570 gene ftsX 8755 9696 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8S7 protein_id gnl|my_center|LOCUS_19570 9693 10511 gene locus_tag LOCUS_19580 9693 10511 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038855.1 protein_id gnl|my_center|LOCUS_19580 10515 11198 gene locus_tag LOCUS_19590 gene ung 10515 11198 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LU5 protein_id gnl|my_center|LOCUS_19590 11301 11789 gene locus_tag LOCUS_19600 11301 11789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 11789 12031 gene locus_tag LOCUS_19610 11789 12031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 12696 14405 gene locus_tag LOCUS_19620 gene proS 12696 14405 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPA5 protein_id gnl|my_center|LOCUS_19620 14408 15226 gene locus_tag LOCUS_19630 gene prmC 14408 15226 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC99 protein_id gnl|my_center|LOCUS_19630 15220 15975 gene locus_tag LOCUS_19640 15220 15975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 16971 16024 gene locus_tag LOCUS_19650 16971 16024 CDS product depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389460.1 protein_id gnl|my_center|LOCUS_19650 17702 16968 gene locus_tag LOCUS_19660 17702 16968 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259468.1 protein_id gnl|my_center|LOCUS_19660 18058 17699 gene locus_tag LOCUS_19670 18058 17699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259469.1 protein_id gnl|my_center|LOCUS_19670 18423 18055 gene locus_tag LOCUS_19680 18423 18055 CDS product dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259467.1 protein_id gnl|my_center|LOCUS_19680 19934 18420 gene locus_tag LOCUS_19690 19934 18420 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259464.1 protein_id gnl|my_center|LOCUS_19690 20550 19939 gene locus_tag LOCUS_19700 20550 19939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 20608 21462 gene locus_tag LOCUS_19710 gene ydjP 20608 21462 CDS product AB hydrolase superfamily protein YdjP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34592 protein_id gnl|my_center|LOCUS_19710 21480 23816 gene locus_tag LOCUS_19720 21480 23816 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265529.1 protein_id gnl|my_center|LOCUS_19720 23894 25204 gene locus_tag LOCUS_19730 23894 25204 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918225.1 protein_id gnl|my_center|LOCUS_19730 25206 25985 gene locus_tag LOCUS_19740 gene bdhA2 25206 25985 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708902.1 protein_id gnl|my_center|LOCUS_19740 25990 26925 gene locus_tag LOCUS_19750 25990 26925 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923326.1 protein_id gnl|my_center|LOCUS_19750 26976 27608 gene locus_tag LOCUS_19760 26976 27608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 27586 27798 gene locus_tag LOCUS_19770 27586 27798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 >Feature sequence062 1906 284 gene locus_tag LOCUS_19780 1906 284 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539668.1 protein_id gnl|my_center|LOCUS_19780 1959 2216 gene locus_tag LOCUS_19790 1959 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 2251 2997 gene locus_tag LOCUS_19800 2251 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 3028 3759 gene locus_tag LOCUS_19810 3028 3759 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813919.1 protein_id gnl|my_center|LOCUS_19810 7784 3798 gene locus_tag LOCUS_19820 7784 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 7903 8898 gene locus_tag LOCUS_19830 7903 8898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 8895 10820 gene locus_tag LOCUS_19840 8895 10820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 10817 20170 gene locus_tag LOCUS_19850 10817 20170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 20181 22466 gene locus_tag LOCUS_19860 20181 22466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 26748 22624 gene locus_tag LOCUS_19870 26748 22624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 >Feature sequence063 1666 473 gene locus_tag LOCUS_19880 1666 473 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5X8 protein_id gnl|my_center|LOCUS_19880 2064 1663 gene locus_tag LOCUS_19890 gene blaI 2064 1663 CDS product BlaI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038312.1 protein_id gnl|my_center|LOCUS_19890 2173 3324 gene locus_tag LOCUS_19900 2173 3324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 3546 4091 gene locus_tag LOCUS_19910 3546 4091 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387373.1 protein_id gnl|my_center|LOCUS_19910 5055 6101 gene locus_tag LOCUS_19920 5055 6101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141310.1 protein_id gnl|my_center|LOCUS_19920 6595 7722 gene locus_tag LOCUS_19930 6595 7722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 7759 8988 gene locus_tag LOCUS_19940 7759 8988 CDS product 4-O-beta-D-mannosyl-D-glucose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Y28 protein_id gnl|my_center|LOCUS_19940 9440 10603 gene locus_tag LOCUS_19950 9440 10603 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266545.1 protein_id gnl|my_center|LOCUS_19950 10856 11464 gene locus_tag LOCUS_19960 10856 11464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 12560 11625 gene locus_tag LOCUS_19970 gene acT 12560 11625 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597928.1 protein_id gnl|my_center|LOCUS_19970 12592 12771 gene locus_tag LOCUS_19980 12592 12771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 13193 13948 gene locus_tag LOCUS_19990 13193 13948 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705784.1 protein_id gnl|my_center|LOCUS_19990 14002 14625 gene locus_tag LOCUS_20000 14002 14625 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808648.1 protein_id gnl|my_center|LOCUS_20000 14689 14910 gene locus_tag LOCUS_20010 14689 14910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 14907 15392 gene locus_tag LOCUS_20020 14907 15392 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141194.1 protein_id gnl|my_center|LOCUS_20020 16030 15554 gene locus_tag LOCUS_20030 16030 15554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 16623 18062 gene locus_tag LOCUS_20040 gene cls 16623 18062 CDS product cardiolipin synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122347.1 protein_id gnl|my_center|LOCUS_20040 18117 19433 gene locus_tag LOCUS_20050 18117 19433 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013994.1 protein_id gnl|my_center|LOCUS_20050 19633 22371 gene locus_tag LOCUS_20060 gene acnA 19633 22371 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884S2 protein_id gnl|my_center|LOCUS_20060 22549 23787 gene locus_tag LOCUS_20070 22549 23787 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529233.1 protein_id gnl|my_center|LOCUS_20070 24347 23934 gene locus_tag LOCUS_20080 gene rnk 24347 23934 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706600.1 protein_id gnl|my_center|LOCUS_20080 24858 24643 gene locus_tag LOCUS_20090 24858 24643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 25772 25023 gene locus_tag LOCUS_20100 25772 25023 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144054.1 protein_id gnl|my_center|LOCUS_20100 27225 25765 gene locus_tag LOCUS_20110 27225 25765 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084518.1 protein_id gnl|my_center|LOCUS_20110 >Feature sequence064 1168 2667 gene locus_tag LOCUS_20120 1168 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 2772 3269 gene locus_tag LOCUS_20130 2772 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 3287 4204 gene locus_tag LOCUS_20140 3287 4204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 4280 5002 gene locus_tag LOCUS_20150 4280 5002 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087759.1 protein_id gnl|my_center|LOCUS_20150 5404 7065 gene locus_tag LOCUS_20160 5404 7065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 7138 9078 gene locus_tag LOCUS_20170 7138 9078 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969907.1 protein_id gnl|my_center|LOCUS_20170 10503 9115 gene locus_tag LOCUS_20180 10503 9115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 12249 10585 gene locus_tag LOCUS_20190 12249 10585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 13643 12654 gene locus_tag LOCUS_20200 13643 12654 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710628.1 protein_id gnl|my_center|LOCUS_20200 14075 13914 gene locus_tag LOCUS_20210 14075 13914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427864.1 protein_id gnl|my_center|LOCUS_20210 14435 15205 gene locus_tag LOCUS_20220 14435 15205 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531940.1 protein_id gnl|my_center|LOCUS_20220 15450 20285 gene locus_tag LOCUS_20230 15450 20285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 22597 20321 gene locus_tag LOCUS_20240 22597 20321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 22783 23505 gene locus_tag LOCUS_20250 22783 23505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143584.1 protein_id gnl|my_center|LOCUS_20250 23897 26596 gene locus_tag LOCUS_20260 23897 26596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 >Feature sequence065 516 2006 gene locus_tag LOCUS_20270 516 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 2286 4454 gene locus_tag LOCUS_20280 2286 4454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 4464 6308 gene locus_tag LOCUS_20290 4464 6308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 6377 7741 gene locus_tag LOCUS_20300 6377 7741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 9022 9393 gene locus_tag LOCUS_20310 9022 9393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 10250 9786 gene locus_tag LOCUS_20320 10250 9786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 10579 11166 gene locus_tag LOCUS_20330 10579 11166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 12012 13067 gene locus_tag LOCUS_20340 12012 13067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105922.1 protein_id gnl|my_center|LOCUS_20340 13092 13499 gene locus_tag LOCUS_20350 13092 13499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 13569 15605 gene locus_tag LOCUS_20360 13569 15605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 17671 15878 gene locus_tag LOCUS_20370 17671 15878 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073617.1 protein_id gnl|my_center|LOCUS_20370 18210 19046 gene locus_tag LOCUS_20380 18210 19046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 19700 19089 gene locus_tag LOCUS_20390 19700 19089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 19947 21182 gene locus_tag LOCUS_20400 19947 21182 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141814.1 protein_id gnl|my_center|LOCUS_20400 21478 21227 gene locus_tag LOCUS_20410 21478 21227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 21548 23053 gene locus_tag LOCUS_20420 21548 23053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 24128 23721 gene locus_tag LOCUS_20430 gene vapC9 24128 23721 CDS product ribonuclease VapC9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WFA9 protein_id gnl|my_center|LOCUS_20430 24364 24125 gene locus_tag LOCUS_20440 24364 24125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 25096 24563 gene locus_tag LOCUS_20450 25096 24563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 26264 25317 gene locus_tag LOCUS_20460 26264 25317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 27082 26267 gene locus_tag LOCUS_20470 27082 26267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 >Feature sequence066 175 1044 gene locus_tag LOCUS_20480 gene cheR 175 1044 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P270 protein_id gnl|my_center|LOCUS_20480 1041 1706 gene locus_tag LOCUS_20490 gene cheD 1041 1706 CDS product putative chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KKL4 protein_id gnl|my_center|LOCUS_20490 1703 2776 gene locus_tag LOCUS_20500 gene cheB1 1703 2776 CDS product chemotaxis response regulator protein-glutamate methylesterase of group 1 operon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9J7 protein_id gnl|my_center|LOCUS_20500 2790 3875 gene locus_tag LOCUS_20510 gene mcp 2790 3875 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037126.1 protein_id gnl|my_center|LOCUS_20510 3878 5089 gene locus_tag LOCUS_20520 3878 5089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 5086 7218 gene locus_tag LOCUS_20530 5086 7218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 7247 7633 gene locus_tag LOCUS_20540 7247 7633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 7806 8177 gene locus_tag LOCUS_20550 7806 8177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 8206 8577 gene locus_tag LOCUS_20560 8206 8577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 9252 8590 gene locus_tag LOCUS_20570 9252 8590 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229715.1 protein_id gnl|my_center|LOCUS_20570 9373 10377 gene locus_tag LOCUS_20580 9373 10377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 10480 12633 gene locus_tag LOCUS_20590 10480 12633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 12635 14395 gene locus_tag LOCUS_20600 12635 14395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 14410 15975 gene locus_tag LOCUS_20610 14410 15975 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_20610 15985 16836 gene locus_tag LOCUS_20620 15985 16836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 18235 16871 gene locus_tag LOCUS_20630 18235 16871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 19873 18239 gene locus_tag LOCUS_20640 19873 18239 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_20640 21636 19972 gene locus_tag LOCUS_20650 21636 19972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 22574 21717 gene locus_tag LOCUS_20660 22574 21717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309798.1 protein_id gnl|my_center|LOCUS_20660 22701 24248 gene locus_tag LOCUS_20670 22701 24248 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_600860.1 protein_id gnl|my_center|LOCUS_20670 24351 25547 gene locus_tag LOCUS_20680 24351 25547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 <27080 25598 gene locus_tag LOCUS_20690 <27080 25598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007330113.1:RNA-binding protein >Feature sequence067 1815 115 gene locus_tag LOCUS_20700 1815 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 2981 1815 gene locus_tag LOCUS_20710 2981 1815 CDS product 2-octaprenyl-6-methoxyphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705607.1 protein_id gnl|my_center|LOCUS_20710 4192 2978 gene locus_tag LOCUS_20720 4192 2978 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703430.1 protein_id gnl|my_center|LOCUS_20720 5490 4189 gene locus_tag LOCUS_20730 gene pepP 5490 4189 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038361.1 protein_id gnl|my_center|LOCUS_20730 6058 5501 gene locus_tag LOCUS_20740 gene ygfB 6058 5501 CDS product UPF0149 protein YgfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32BX1 protein_id gnl|my_center|LOCUS_20740 6273 6497 gene locus_tag LOCUS_20750 6273 6497 CDS product TIGR02449 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038363.1 protein_id gnl|my_center|LOCUS_20750 6494 6793 gene locus_tag LOCUS_20760 gene zapA 6494 6793 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTW3 protein_id gnl|my_center|LOCUS_20760 6890 6965 gene locus_tag LOCUS_t00160 6890 6965 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 7352 10345 gene locus_tag LOCUS_20770 7352 10345 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881117.1 protein_id gnl|my_center|LOCUS_20770 10647 10997 gene locus_tag LOCUS_20780 10647 10997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360043.1 protein_id gnl|my_center|LOCUS_20780 11044 11424 gene locus_tag LOCUS_20790 11044 11424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 12134 11670 gene locus_tag LOCUS_20800 12134 11670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 12309 12707 gene locus_tag LOCUS_20810 12309 12707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 12795 13619 gene locus_tag LOCUS_20820 gene yafB 12795 13619 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973722.1 protein_id gnl|my_center|LOCUS_20820 13743 15824 gene locus_tag LOCUS_20830 13743 15824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 17626 15863 gene locus_tag LOCUS_20840 gene kefC 17626 15863 CDS product portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071668.1 protein_id gnl|my_center|LOCUS_20840 19016 17628 gene locus_tag LOCUS_20850 19016 17628 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932285.1 protein_id gnl|my_center|LOCUS_20850 19131 19787 gene locus_tag LOCUS_20860 gene rlmE 19131 19787 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNQ4 protein_id gnl|my_center|LOCUS_20860 19847 21799 gene locus_tag LOCUS_20870 gene ftsH 19847 21799 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRT2 protein_id gnl|my_center|LOCUS_20870 21887 23032 gene locus_tag LOCUS_20880 21887 23032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244116.1 protein_id gnl|my_center|LOCUS_20880 23114 25156 gene locus_tag LOCUS_20890 gene fadH1 23114 25156 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113937.1 protein_id gnl|my_center|LOCUS_20890 25236 26396 gene locus_tag LOCUS_20900 gene smf 25236 26396 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038833.1 protein_id gnl|my_center|LOCUS_20900 26393 26869 gene locus_tag LOCUS_20910 gene smg 26393 26869 CDS product protein Smg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4F6 protein_id gnl|my_center|LOCUS_20910 >Feature sequence068 727 882 gene locus_tag LOCUS_20920 727 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 879 1166 gene locus_tag LOCUS_20930 879 1166 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811141.1 protein_id gnl|my_center|LOCUS_20930 1917 2156 gene locus_tag LOCUS_20940 1917 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 2365 3351 gene locus_tag LOCUS_20950 2365 3351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 3806 3363 gene locus_tag LOCUS_20960 gene trx 3806 3363 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036377.1 protein_id gnl|my_center|LOCUS_20960 6344 3813 gene locus_tag LOCUS_20970 6344 3813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 7820 6411 gene locus_tag LOCUS_20980 7820 6411 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_20980 11633 7917 gene locus_tag LOCUS_20990 11633 7917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 11875 12840 gene locus_tag LOCUS_21000 11875 12840 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931881.1 protein_id gnl|my_center|LOCUS_21000 13429 12845 gene locus_tag LOCUS_21010 13429 12845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 14582 13497 gene locus_tag LOCUS_21020 14582 13497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 15570 14689 gene locus_tag LOCUS_21030 15570 14689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 16957 15800 gene locus_tag LOCUS_21040 16957 15800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 19260 17290 gene locus_tag LOCUS_21050 19260 17290 CDS product peptidase S9 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140278.1 protein_id gnl|my_center|LOCUS_21050 19495 19689 gene locus_tag LOCUS_21060 19495 19689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 19673 21703 gene locus_tag LOCUS_21070 19673 21703 CDS product acyl-peptide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404763.1 protein_id gnl|my_center|LOCUS_21070 22039 22746 gene locus_tag LOCUS_21080 22039 22746 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967585.1 protein_id gnl|my_center|LOCUS_21080 22740 25109 gene locus_tag LOCUS_21090 22740 25109 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967586.1 protein_id gnl|my_center|LOCUS_21090 25114 26328 gene locus_tag LOCUS_21100 25114 26328 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967587.1 protein_id gnl|my_center|LOCUS_21100 >Feature sequence069 1168 173 gene locus_tag LOCUS_21110 gene paaX 1168 173 CDS product phenylacetic acid degradation operon negative regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931077.1 protein_id gnl|my_center|LOCUS_21110 1263 3341 gene locus_tag LOCUS_21120 1263 3341 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887243.1 protein_id gnl|my_center|LOCUS_21120 3343 4803 gene locus_tag LOCUS_21130 gene sucB1 3343 4803 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KR89 protein_id gnl|my_center|LOCUS_21130 9461 5298 gene locus_tag LOCUS_21140 9461 5298 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147933.1 protein_id gnl|my_center|LOCUS_21140 9526 10014 gene locus_tag LOCUS_21150 9526 10014 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788990.1 protein_id gnl|my_center|LOCUS_21150 10011 10595 gene locus_tag LOCUS_21160 10011 10595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 10592 12205 gene locus_tag LOCUS_21170 10592 12205 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921318.1 protein_id gnl|my_center|LOCUS_21170 13637 12261 gene locus_tag LOCUS_21180 13637 12261 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122056.1 protein_id gnl|my_center|LOCUS_21180 14272 13658 gene locus_tag LOCUS_21190 gene pnuT 14272 13658 CDS product nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072658.1 protein_id gnl|my_center|LOCUS_21190 14542 14282 gene locus_tag LOCUS_21200 14542 14282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 15333 14539 gene locus_tag LOCUS_21210 gene thyA 15333 14539 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F732 protein_id gnl|my_center|LOCUS_21210 16168 15326 gene locus_tag LOCUS_21220 gene lgt 16168 15326 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCE8 protein_id gnl|my_center|LOCUS_21220 17383 16184 gene locus_tag LOCUS_21230 17383 16184 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763607.1 protein_id gnl|my_center|LOCUS_21230 17521 18180 gene locus_tag LOCUS_21240 17521 18180 CDS product phage shock protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459937.1 protein_id gnl|my_center|LOCUS_21240 19520 18216 gene locus_tag LOCUS_21250 gene dadA 19520 18216 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120365.1 protein_id gnl|my_center|LOCUS_21250 20006 19536 gene locus_tag LOCUS_21260 gene mscL 20006 19536 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD14 protein_id gnl|my_center|LOCUS_21260 21390 20134 gene locus_tag LOCUS_21270 21390 20134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 21960 21499 gene locus_tag LOCUS_21280 21960 21499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 22898 21990 gene locus_tag LOCUS_21290 22898 21990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 23096 23749 gene locus_tag LOCUS_21300 23096 23749 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393713.1 protein_id gnl|my_center|LOCUS_21300 23746 24147 gene locus_tag LOCUS_21310 23746 24147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 24462 24274 gene locus_tag LOCUS_21320 24462 24274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 24430 25326 gene locus_tag LOCUS_21330 gene mtfC 24430 25326 CDS product mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880300.1 protein_id gnl|my_center|LOCUS_21330 26165 25302 gene locus_tag LOCUS_21340 26165 25302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 >Feature sequence070 565 170 gene locus_tag LOCUS_21350 565 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 3177 577 gene locus_tag LOCUS_21360 3177 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073740.1 protein_id gnl|my_center|LOCUS_21360 3079 3372 gene locus_tag LOCUS_21370 3079 3372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 4187 3339 gene locus_tag LOCUS_21380 4187 3339 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY02 protein_id gnl|my_center|LOCUS_21380 5293 4187 gene locus_tag LOCUS_21390 gene adhC3 5293 4187 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6W1Z5 protein_id gnl|my_center|LOCUS_21390 5363 5752 gene locus_tag LOCUS_21400 5363 5752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 8191 5756 gene locus_tag LOCUS_21410 8191 5756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 8469 9353 gene locus_tag LOCUS_21420 8469 9353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 10186 9368 gene locus_tag LOCUS_21430 10186 9368 CDS product TatD-related deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389390.1 protein_id gnl|my_center|LOCUS_21430 10302 11258 gene locus_tag LOCUS_21440 gene accA 10302 11258 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ2 protein_id gnl|my_center|LOCUS_21440 11342 12505 gene locus_tag LOCUS_21450 gene tilS 11342 12505 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7L3 protein_id gnl|my_center|LOCUS_21450 14267 12477 gene locus_tag LOCUS_21460 gene mnmC 14267 12477 CDS product tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYF0 protein_id gnl|my_center|LOCUS_21460 15181 14264 gene locus_tag LOCUS_21470 15181 14264 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038688.1 protein_id gnl|my_center|LOCUS_21470 15350 15565 gene locus_tag LOCUS_21480 15350 15565 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038440.1 protein_id gnl|my_center|LOCUS_21480 15576 16667 gene locus_tag LOCUS_21490 15576 16667 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038439.1 protein_id gnl|my_center|LOCUS_21490 16832 19309 gene locus_tag LOCUS_21500 16832 19309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 19555 19292 gene locus_tag LOCUS_21510 19555 19292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 19703 21889 gene locus_tag LOCUS_21520 19703 21889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 21957 23054 gene locus_tag LOCUS_21530 21957 23054 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257747.1 protein_id gnl|my_center|LOCUS_21530 23605 23060 gene locus_tag LOCUS_21540 23605 23060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 23777 25579 gene locus_tag LOCUS_21550 gene lepA 23777 25579 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB55 protein_id gnl|my_center|LOCUS_21550 >Feature sequence071 2590 140 gene locus_tag LOCUS_21560 gene lon 2590 140 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBY4 protein_id gnl|my_center|LOCUS_21560 4116 2836 gene locus_tag LOCUS_21570 gene clpX 4116 2836 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBY5 protein_id gnl|my_center|LOCUS_21570 4295 4146 gene locus_tag LOCUS_21580 4295 4146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 4990 4295 gene locus_tag LOCUS_21590 gene clpP 4990 4295 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBY6 protein_id gnl|my_center|LOCUS_21590 6337 5024 gene locus_tag LOCUS_21600 gene tig 6337 5024 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66933 protein_id gnl|my_center|LOCUS_21600 6509 6435 gene locus_tag LOCUS_t00170 6509 6435 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 6716 6640 gene locus_tag LOCUS_t00180 6716 6640 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6826 6902 gene locus_tag LOCUS_t00190 6826 6902 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8930 7431 gene locus_tag LOCUS_21610 8930 7431 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938023.1 protein_id gnl|my_center|LOCUS_21610 9114 10280 gene locus_tag LOCUS_21620 9114 10280 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257610.1 protein_id gnl|my_center|LOCUS_21620 11075 10266 gene locus_tag LOCUS_21630 11075 10266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 11850 11119 gene locus_tag LOCUS_21640 11850 11119 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V65 protein_id gnl|my_center|LOCUS_21640 13109 11847 gene locus_tag LOCUS_21650 gene bioA 13109 11847 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I693 protein_id gnl|my_center|LOCUS_21650 14103 13198 gene locus_tag LOCUS_21660 gene rimK 14103 13198 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPT1 protein_id gnl|my_center|LOCUS_21660 14263 14700 gene locus_tag LOCUS_21670 gene gspG 14263 14700 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947092.1 protein_id gnl|my_center|LOCUS_21670 14706 15200 gene locus_tag LOCUS_21680 gene xcpU 14706 15200 CDS product type II secretion system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00515 protein_id gnl|my_center|LOCUS_21680 15197 15589 gene locus_tag LOCUS_21690 15197 15589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 15582 16220 gene locus_tag LOCUS_21700 15582 16220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 16541 16245 gene locus_tag LOCUS_21710 16541 16245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 16874 16569 gene locus_tag LOCUS_21720 16874 16569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 17028 20930 gene locus_tag LOCUS_21730 17028 20930 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108776.1 protein_id gnl|my_center|LOCUS_21730 21477 20938 gene locus_tag LOCUS_21740 21477 20938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 21666 22217 gene locus_tag LOCUS_21750 21666 22217 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_21750 22223 24673 gene locus_tag LOCUS_21760 22223 24673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 >Feature sequence072 3092 615 gene locus_tag LOCUS_21770 3092 615 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039503.1 protein_id gnl|my_center|LOCUS_21770 3815 3177 gene locus_tag LOCUS_21780 3815 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 6845 3831 gene locus_tag LOCUS_21790 6845 3831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 6948 7862 gene locus_tag LOCUS_21800 6948 7862 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537480.1 protein_id gnl|my_center|LOCUS_21800 8106 7936 gene locus_tag LOCUS_21810 8106 7936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 8257 8084 gene locus_tag LOCUS_21820 8257 8084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 10605 8530 gene locus_tag LOCUS_21830 10605 8530 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071523.1 protein_id gnl|my_center|LOCUS_21830 11074 15813 gene locus_tag LOCUS_21840 11074 15813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 15831 20933 gene locus_tag LOCUS_21850 15831 20933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 20990 21340 gene locus_tag LOCUS_21860 20990 21340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 21351 21770 gene locus_tag LOCUS_21870 21351 21770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 22397 22227 gene locus_tag LOCUS_21880 22397 22227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 22857 23021 gene locus_tag LOCUS_21890 22857 23021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 >Feature sequence073 2293 254 gene locus_tag LOCUS_21900 gene pnp 2293 254 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7V1 protein_id gnl|my_center|LOCUS_21900 2738 2469 gene locus_tag LOCUS_21910 gene rpsO 2738 2469 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72ER5 protein_id gnl|my_center|LOCUS_21910 3799 2870 gene locus_tag LOCUS_21920 3799 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 3973 4749 gene locus_tag LOCUS_21930 3973 4749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405037.1 protein_id gnl|my_center|LOCUS_21930 5404 4703 gene locus_tag LOCUS_21940 5404 4703 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927121.1 protein_id gnl|my_center|LOCUS_21940 5916 5401 gene locus_tag LOCUS_21950 5916 5401 CDS product 6-pyruvoyl tetrahydrobiopterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948551.1 protein_id gnl|my_center|LOCUS_21950 6473 5916 gene locus_tag LOCUS_21960 gene folE2 6473 5916 CDS product GTP cyclohydrolase 1 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I351 protein_id gnl|my_center|LOCUS_21960 7522 6500 gene locus_tag LOCUS_21970 7522 6500 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529667.1 protein_id gnl|my_center|LOCUS_21970 7679 8344 gene locus_tag LOCUS_21980 7679 8344 CDS product BAX inhibitor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946684.1 protein_id gnl|my_center|LOCUS_21980 9155 8463 gene locus_tag LOCUS_21990 9155 8463 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640625.1 protein_id gnl|my_center|LOCUS_21990 10060 9215 gene locus_tag LOCUS_22000 10060 9215 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204290.1 protein_id gnl|my_center|LOCUS_22000 10293 11492 gene locus_tag LOCUS_22010 10293 11492 CDS product cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948334.1 protein_id gnl|my_center|LOCUS_22010 13876 11549 gene locus_tag LOCUS_22020 13876 11549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266649.1 protein_id gnl|my_center|LOCUS_22020 14317 13955 gene locus_tag LOCUS_22030 14317 13955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 17086 14501 gene locus_tag LOCUS_22040 gene clpB 17086 14501 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUP3 protein_id gnl|my_center|LOCUS_22040 17264 17872 gene locus_tag LOCUS_22050 17264 17872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 18786 17842 gene locus_tag LOCUS_22060 gene rluD 18786 17842 CDS product ribosomal large subunit pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P682 protein_id gnl|my_center|LOCUS_22060 18853 19665 gene locus_tag LOCUS_22070 gene bamD 18853 19665 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYH9 protein_id gnl|my_center|LOCUS_22070 19789 20865 gene locus_tag LOCUS_22080 19789 20865 CDS product farnesyl-diphosphate farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144046.1 protein_id gnl|my_center|LOCUS_22080 20862 21473 gene locus_tag LOCUS_22090 gene idi 20862 21473 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1C1 protein_id gnl|my_center|LOCUS_22090 22761 21922 gene locus_tag LOCUS_22100 22761 21922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 23020 23760 gene locus_tag LOCUS_22110 23020 23760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 23757 24656 gene locus_tag LOCUS_22120 23757 24656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 24769 25227 gene locus_tag LOCUS_22130 24769 25227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 >Feature sequence074 624 145 gene locus_tag LOCUS_22140 624 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 1130 3673 gene locus_tag LOCUS_22150 1130 3673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 3833 3648 gene locus_tag LOCUS_22160 3833 3648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 3793 5877 gene locus_tag LOCUS_22170 gene relA 3793 5877 CDS product ATP--GTP 3'-pyrophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038059.1 protein_id gnl|my_center|LOCUS_22170 6869 6102 gene locus_tag LOCUS_22180 6869 6102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 7334 6996 gene locus_tag LOCUS_22190 7334 6996 CDS product UPF0339 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAL4 protein_id gnl|my_center|LOCUS_22190 7892 7407 gene locus_tag LOCUS_22200 7892 7407 CDS product putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883Q6 protein_id gnl|my_center|LOCUS_22200 8025 8615 gene locus_tag LOCUS_22210 8025 8615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 9467 8637 gene locus_tag LOCUS_22220 9467 8637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 9616 10320 gene locus_tag LOCUS_22230 9616 10320 CDS product prolyl 4-hydroxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072041.1 protein_id gnl|my_center|LOCUS_22230 10341 10916 gene locus_tag LOCUS_22240 gene msrA 10341 10916 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AK8 protein_id gnl|my_center|LOCUS_22240 10913 11185 gene locus_tag LOCUS_22250 10913 11185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261432.1 protein_id gnl|my_center|LOCUS_22250 11249 12619 gene locus_tag LOCUS_22260 11249 12619 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405481.1 protein_id gnl|my_center|LOCUS_22260 12622 13812 gene locus_tag LOCUS_22270 12622 13812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 13816 14247 gene locus_tag LOCUS_22280 13816 14247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 16084 14510 gene locus_tag LOCUS_22290 gene pgi 16084 14510 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABK5 protein_id gnl|my_center|LOCUS_22290 16467 16087 gene locus_tag LOCUS_22300 gene panD 16467 16087 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF03 protein_id gnl|my_center|LOCUS_22300 17874 17017 gene locus_tag LOCUS_22310 gene panC 17874 17017 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY87 protein_id gnl|my_center|LOCUS_22310 18797 17871 gene locus_tag LOCUS_22320 gene panB 18797 17871 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CG8 protein_id gnl|my_center|LOCUS_22320 18863 21490 gene locus_tag LOCUS_22330 18863 21490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 22617 21523 gene locus_tag LOCUS_22340 22617 21523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 22549 22755 gene locus_tag LOCUS_22350 22549 22755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 22925 24217 gene locus_tag LOCUS_22360 22925 24217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 24244 25191 gene locus_tag LOCUS_22370 gene tal 24244 25191 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLL7 protein_id gnl|my_center|LOCUS_22370 >Feature sequence075 673 539 gene locus_tag LOCUS_22380 673 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 892 1410 gene locus_tag LOCUS_22390 892 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 1515 4157 gene locus_tag LOCUS_22400 gene glnE 1515 4157 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3ENX0 protein_id gnl|my_center|LOCUS_22400 5172 4165 gene locus_tag LOCUS_22410 gene glk 5172 4165 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXF8 protein_id gnl|my_center|LOCUS_22410 5831 5169 gene locus_tag LOCUS_22420 5831 5169 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530235.1 protein_id gnl|my_center|LOCUS_22420 7264 5828 gene locus_tag LOCUS_22430 gene zwf 7264 5828 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TM53 protein_id gnl|my_center|LOCUS_22430 7455 9275 gene locus_tag LOCUS_22440 gene edd 7455 9275 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31961 protein_id gnl|my_center|LOCUS_22440 9288 9917 gene locus_tag LOCUS_22450 gene eda 9288 9917 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225133.1 protein_id gnl|my_center|LOCUS_22450 10209 11957 gene locus_tag LOCUS_22460 10209 11957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 12106 12642 gene locus_tag LOCUS_22470 12106 12642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120910.1 protein_id gnl|my_center|LOCUS_22470 14135 12906 gene locus_tag LOCUS_22480 14135 12906 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 protein_id gnl|my_center|LOCUS_22480 14532 14137 gene locus_tag LOCUS_22490 14532 14137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 14671 16323 gene locus_tag LOCUS_22500 gene pyrG 14671 16323 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CP05 protein_id gnl|my_center|LOCUS_22500 16320 17153 gene locus_tag LOCUS_22510 gene kdsA 16320 17153 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9Z5 protein_id gnl|my_center|LOCUS_22510 17150 18442 gene locus_tag LOCUS_22520 gene eno 17150 18442 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9Z3 protein_id gnl|my_center|LOCUS_22520 18474 18875 gene locus_tag LOCUS_22530 18474 18875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 20002 18986 gene locus_tag LOCUS_22540 20002 18986 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940611.1 protein_id gnl|my_center|LOCUS_22540 21447 19999 gene locus_tag LOCUS_22550 21447 19999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 21523 22896 gene locus_tag LOCUS_22560 gene glmU 21523 22896 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCZ1 protein_id gnl|my_center|LOCUS_22560 22896 23111 gene locus_tag LOCUS_22570 22896 23111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 23115 24950 gene locus_tag LOCUS_22580 gene glmS 23115 24950 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y7M8 protein_id gnl|my_center|LOCUS_22580 >Feature sequence076 1598 1368 gene locus_tag LOCUS_22590 1598 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 2671 2288 gene locus_tag LOCUS_22600 2671 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 4276 3020 gene locus_tag LOCUS_22610 4276 3020 CDS product CSLREA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256201.1 protein_id gnl|my_center|LOCUS_22610 4590 5036 gene locus_tag LOCUS_22620 4590 5036 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496534.1 protein_id gnl|my_center|LOCUS_22620 8663 5184 gene locus_tag LOCUS_22630 8663 5184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 9218 10333 gene locus_tag LOCUS_22640 9218 10333 CDS product FeaR-family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265602.1 protein_id gnl|my_center|LOCUS_22640 10608 11726 gene locus_tag LOCUS_22650 10608 11726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 11727 13307 gene locus_tag LOCUS_22660 11727 13307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 14156 13464 gene locus_tag LOCUS_22670 14156 13464 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930688.1 protein_id gnl|my_center|LOCUS_22670 14536 14156 gene locus_tag LOCUS_22680 14536 14156 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039401.1 protein_id gnl|my_center|LOCUS_22680 15215 14613 gene locus_tag LOCUS_22690 15215 14613 CDS product exported protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810192.1 protein_id gnl|my_center|LOCUS_22690 15537 16019 gene locus_tag LOCUS_22700 15537 16019 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191066.1 protein_id gnl|my_center|LOCUS_22700 16023 16376 gene locus_tag LOCUS_22710 16023 16376 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082989.1 protein_id gnl|my_center|LOCUS_22710 16402 17568 gene locus_tag LOCUS_22720 gene nnrS 16402 17568 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072738.1 protein_id gnl|my_center|LOCUS_22720 18012 18869 gene locus_tag LOCUS_22730 18012 18869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 18940 20310 gene locus_tag LOCUS_22740 gene norB 18940 20310 CDS product nitric oxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085999.1 protein_id gnl|my_center|LOCUS_22740 20310 21125 gene locus_tag LOCUS_22750 gene norQ 20310 21125 CDS product nitric oxide reductase NorQ protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973800.1 protein_id gnl|my_center|LOCUS_22750 21286 23205 gene locus_tag LOCUS_22760 gene norD 21286 23205 CDS product protein norD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967670.1 protein_id gnl|my_center|LOCUS_22760 23688 23341 gene locus_tag LOCUS_22770 23688 23341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 24130 23726 gene locus_tag LOCUS_22780 24130 23726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 >Feature sequence077 <1 677 gene locus_tag LOCUS_22790 <1 677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000859695.1:alpha/beta hydrolase 674 1828 gene locus_tag LOCUS_22800 674 1828 CDS product aldehyde oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967289.1 protein_id gnl|my_center|LOCUS_22800 1962 2909 gene locus_tag LOCUS_22810 1962 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 3005 5905 gene locus_tag LOCUS_22820 3005 5905 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138082.1 protein_id gnl|my_center|LOCUS_22820 6449 6087 gene locus_tag LOCUS_22830 6449 6087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 8377 6563 gene locus_tag LOCUS_22840 8377 6563 CDS product sodium/hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100653.1 protein_id gnl|my_center|LOCUS_22840 8536 10155 gene locus_tag LOCUS_22850 8536 10155 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074280.1 protein_id gnl|my_center|LOCUS_22850 10233 10469 gene locus_tag LOCUS_22860 10233 10469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 10472 10831 gene locus_tag LOCUS_22870 10472 10831 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036686.1 protein_id gnl|my_center|LOCUS_22870 10843 11700 gene locus_tag LOCUS_22880 gene nodI 10843 11700 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036685.1 protein_id gnl|my_center|LOCUS_22880 11697 12659 gene locus_tag LOCUS_22890 11697 12659 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036684.1 protein_id gnl|my_center|LOCUS_22890 14936 12921 gene locus_tag LOCUS_22900 gene uvrB 14936 12921 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7X1 protein_id gnl|my_center|LOCUS_22900 15092 16198 gene locus_tag LOCUS_22910 gene aspB 15092 16198 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E19 protein_id gnl|my_center|LOCUS_22910 16301 16846 gene locus_tag LOCUS_22920 gene fimT 16301 16846 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037622.1 protein_id gnl|my_center|LOCUS_22920 17447 17253 gene locus_tag LOCUS_22930 17447 17253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 17672 17487 gene locus_tag LOCUS_22940 17672 17487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 18470 19309 gene locus_tag LOCUS_22950 18470 19309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 19653 19910 gene locus_tag LOCUS_22960 19653 19910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 20705 19977 gene locus_tag LOCUS_22970 gene mip 20705 19977 CDS product outer membrane protein MIP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXE0 protein_id gnl|my_center|LOCUS_22970 20871 21779 gene locus_tag LOCUS_22980 20871 21779 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259484.1 protein_id gnl|my_center|LOCUS_22980 23322 21787 gene locus_tag LOCUS_22990 23322 21787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 24426 23413 gene locus_tag LOCUS_23000 gene opsX 24426 23413 CDS product ADP-heptose--LPS heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036196.1 protein_id gnl|my_center|LOCUS_23000 >Feature sequence078 1795 284 gene locus_tag LOCUS_23010 1795 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337186.1 protein_id gnl|my_center|LOCUS_23010 2754 1939 gene locus_tag LOCUS_23020 2754 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 3389 2877 gene locus_tag LOCUS_23030 3389 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 4364 3399 gene locus_tag LOCUS_23040 4364 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 4504 5577 gene locus_tag LOCUS_23050 4504 5577 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140271.1 protein_id gnl|my_center|LOCUS_23050 5587 6081 gene locus_tag LOCUS_23060 5587 6081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 7093 7410 gene locus_tag LOCUS_23070 7093 7410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 8771 7461 gene locus_tag LOCUS_23080 8771 7461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 9352 10311 gene locus_tag LOCUS_23090 9352 10311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 10296 12317 gene locus_tag LOCUS_23100 10296 12317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 12314 13651 gene locus_tag LOCUS_23110 12314 13651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 14779 13961 gene locus_tag LOCUS_23120 14779 13961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 14984 14763 gene locus_tag LOCUS_23130 14984 14763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 15437 15036 gene locus_tag LOCUS_23140 15437 15036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 15815 15606 gene locus_tag LOCUS_23150 15815 15606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 15855 16079 gene locus_tag LOCUS_23160 15855 16079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 17106 16105 gene locus_tag LOCUS_23170 17106 16105 CDS product heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705827.1 protein_id gnl|my_center|LOCUS_23170 17486 18082 gene locus_tag LOCUS_23180 17486 18082 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117941.1 protein_id gnl|my_center|LOCUS_23180 18079 19044 gene locus_tag LOCUS_23190 18079 19044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 19122 21542 gene locus_tag LOCUS_23200 19122 21542 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403520.1 protein_id gnl|my_center|LOCUS_23200 22412 21564 gene locus_tag LOCUS_23210 22412 21564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118774.1 protein_id gnl|my_center|LOCUS_23210 22786 22421 gene locus_tag LOCUS_23220 22786 22421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 23863 23393 gene locus_tag LOCUS_23230 23863 23393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23230 >Feature sequence079 1863 1252 gene locus_tag LOCUS_23240 1863 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 2045 3109 gene locus_tag LOCUS_23250 gene proB 2045 3109 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCG4 protein_id gnl|my_center|LOCUS_23250 3106 4356 gene locus_tag LOCUS_23260 gene proA 3106 4356 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCE9 protein_id gnl|my_center|LOCUS_23260 5963 4362 gene locus_tag LOCUS_23270 5963 4362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 6465 5965 gene locus_tag LOCUS_23280 6465 5965 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902983.1 protein_id gnl|my_center|LOCUS_23280 6706 9225 gene locus_tag LOCUS_23290 gene bfeA 6706 9225 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038158.1 protein_id gnl|my_center|LOCUS_23290 11912 9408 gene locus_tag LOCUS_23300 11912 9408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 12744 11971 gene locus_tag LOCUS_23310 gene xth 12744 11971 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957486.1 protein_id gnl|my_center|LOCUS_23310 14212 12884 gene locus_tag LOCUS_23320 gene phoR 14212 12884 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036176.1 protein_id gnl|my_center|LOCUS_23320 15022 14333 gene locus_tag LOCUS_23330 gene phoB 15022 14333 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036177.1 protein_id gnl|my_center|LOCUS_23330 15182 15511 gene locus_tag LOCUS_23340 15182 15511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 15542 15964 gene locus_tag LOCUS_23350 15542 15964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 15949 16272 gene locus_tag LOCUS_23360 gene tusE 15949 16272 CDS product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XEZ7 protein_id gnl|my_center|LOCUS_23360 16304 16579 gene locus_tag LOCUS_23370 16304 16579 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918714.1 protein_id gnl|my_center|LOCUS_23370 18449 16599 gene locus_tag LOCUS_23380 18449 16599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033190.1 protein_id gnl|my_center|LOCUS_23380 19650 18538 gene locus_tag LOCUS_23390 19650 18538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 20582 19734 gene locus_tag LOCUS_23400 20582 19734 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035527.1 protein_id gnl|my_center|LOCUS_23400 21979 20681 gene locus_tag LOCUS_23410 21979 20681 CDS product dihydropyrimidine dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066584.1 protein_id gnl|my_center|LOCUS_23410 23312 21972 gene locus_tag LOCUS_23420 gene gltB2 23312 21972 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708991.1 protein_id gnl|my_center|LOCUS_23420 <23861 23309 gene locus_tag LOCUS_23430 <23861 23309 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I676:D-hydantoinase/dihydropyrimidinase >Feature sequence080 1 234 gene locus_tag LOCUS_23440 1 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 330 656 gene locus_tag LOCUS_23450 gene spbA 330 656 CDS product trans-acting regulatory protein hvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722219.1 protein_id gnl|my_center|LOCUS_23450 1114 1986 gene locus_tag LOCUS_23460 1114 1986 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963181.1 protein_id gnl|my_center|LOCUS_23460 2180 2389 gene locus_tag LOCUS_23470 2180 2389 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003365337.1 protein_id gnl|my_center|LOCUS_23470 2540 3982 gene locus_tag LOCUS_23480 2540 3982 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6N6 protein_id gnl|my_center|LOCUS_23480 4072 4422 gene locus_tag LOCUS_23490 4072 4422 CDS product HesB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550200.1 protein_id gnl|my_center|LOCUS_23490 4566 7148 gene locus_tag LOCUS_23500 4566 7148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 7214 8014 gene locus_tag LOCUS_23510 7214 8014 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084226.1 protein_id gnl|my_center|LOCUS_23510 8029 8697 gene locus_tag LOCUS_23520 8029 8697 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113600.1 protein_id gnl|my_center|LOCUS_23520 8706 9068 gene locus_tag LOCUS_23530 8706 9068 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771057.1 protein_id gnl|my_center|LOCUS_23530 9105 9180 gene locus_tag LOCUS_t00200 9105 9180 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 9292 9365 gene locus_tag LOCUS_t00210 9292 9365 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 9697 9783 gene locus_tag LOCUS_t00220 9697 9783 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10446 10871 gene locus_tag LOCUS_23540 10446 10871 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027943.1 protein_id gnl|my_center|LOCUS_23540 10886 11743 gene locus_tag LOCUS_23550 10886 11743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 11837 13954 gene locus_tag LOCUS_23560 11837 13954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 14803 13949 gene locus_tag LOCUS_23570 14803 13949 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090981.1 protein_id gnl|my_center|LOCUS_23570 16559 14793 gene locus_tag LOCUS_23580 16559 14793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 17530 16556 gene locus_tag LOCUS_23590 17530 16556 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891823.1 protein_id gnl|my_center|LOCUS_23590 18869 17958 gene locus_tag LOCUS_23600 gene xcpX 18869 17958 CDS product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMD0 protein_id gnl|my_center|LOCUS_23600 20352 18949 gene locus_tag LOCUS_23610 20352 18949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 21992 21210 gene locus_tag LOCUS_23620 21992 21210 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970475.1 protein_id gnl|my_center|LOCUS_23620 23521 21989 gene locus_tag LOCUS_23630 23521 21989 CDS product putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q50700 protein_id gnl|my_center|LOCUS_23630 >Feature sequence081 <1 3548 gene locus_tag LOCUS_23640 <1 3548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HXN2:phosphoribosylformylglycinamidine synthase 3545 4153 gene locus_tag LOCUS_23650 3545 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 4169 5935 gene locus_tag LOCUS_23660 gene xpsE 4169 5935 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31742 protein_id gnl|my_center|LOCUS_23660 5935 7152 gene locus_tag LOCUS_23670 gene xpsF 5935 7152 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31744 protein_id gnl|my_center|LOCUS_23670 7186 7608 gene locus_tag LOCUS_23680 7186 7608 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317918.1 protein_id gnl|my_center|LOCUS_23680 7611 8063 gene locus_tag LOCUS_23690 gene xpsH 7611 8063 CDS product type II secretion system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31736 protein_id gnl|my_center|LOCUS_23690 8066 8569 gene locus_tag LOCUS_23700 8066 8569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 8566 9234 gene locus_tag LOCUS_23710 8566 9234 CDS product general secretion pathway protein GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405015.1 protein_id gnl|my_center|LOCUS_23710 9231 10109 gene locus_tag LOCUS_23720 gene pefK 9231 10109 CDS product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P34026 protein_id gnl|my_center|LOCUS_23720 10115 11230 gene locus_tag LOCUS_23730 gene pefL 10115 11230 CDS product type II secretion system protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P34027 protein_id gnl|my_center|LOCUS_23730 11230 11838 gene locus_tag LOCUS_23740 11230 11838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 11835 12551 gene locus_tag LOCUS_23750 11835 12551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 12694 14763 gene locus_tag LOCUS_23760 gene xpsD 12694 14763 CDS product type II secretion system protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29041 protein_id gnl|my_center|LOCUS_23760 14838 15290 gene locus_tag LOCUS_23770 14838 15290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 15475 17127 gene locus_tag LOCUS_23780 15475 17127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 17311 18387 gene locus_tag LOCUS_23790 17311 18387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 18389 19843 gene locus_tag LOCUS_23800 18389 19843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 19865 20641 gene locus_tag LOCUS_23810 19865 20641 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXZ7 protein_id gnl|my_center|LOCUS_23810 20638 21642 gene locus_tag LOCUS_23820 20638 21642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 21633 22454 gene locus_tag LOCUS_23830 21633 22454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 22459 23319 gene locus_tag LOCUS_23840 22459 23319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 >Feature sequence082 3134 441 gene locus_tag LOCUS_23850 gene plsB 3134 441 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3E3 protein_id gnl|my_center|LOCUS_23850 3203 3937 gene locus_tag LOCUS_23860 3203 3937 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 protein_id gnl|my_center|LOCUS_23860 3921 4847 gene locus_tag LOCUS_23870 gene ilvE2 3921 4847 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338795.1 protein_id gnl|my_center|LOCUS_23870 4902 5147 gene locus_tag LOCUS_23880 4902 5147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 5157 5750 gene locus_tag LOCUS_23890 5157 5750 CDS product methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072123.1 protein_id gnl|my_center|LOCUS_23890 5928 6701 gene locus_tag LOCUS_23900 5928 6701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 6832 8529 gene locus_tag LOCUS_23910 6832 8529 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192099.1 protein_id gnl|my_center|LOCUS_23910 9145 8597 gene locus_tag LOCUS_23920 gene ppa 9145 8597 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5M4 protein_id gnl|my_center|LOCUS_23920 9425 11569 gene locus_tag LOCUS_23930 gene hppA 9425 11569 CDS product putative K(+)-stimulated pyrophosphate-energized sodium pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F641 protein_id gnl|my_center|LOCUS_23930 11789 13975 gene locus_tag LOCUS_23940 gene ppk 11789 13975 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747E4 protein_id gnl|my_center|LOCUS_23940 14967 14530 gene locus_tag LOCUS_23950 14967 14530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 15118 15681 gene locus_tag LOCUS_23960 gene adk 15118 15681 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5P5 protein_id gnl|my_center|LOCUS_23960 15982 15668 gene locus_tag LOCUS_23970 15982 15668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 16021 16545 gene locus_tag LOCUS_23980 16021 16545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 16542 17879 gene locus_tag LOCUS_23990 gene mpl 16542 17879 CDS product UDP-N-acetylmuramate--L-alanyl-gamma-D-glutamyl-meso-2,6-diaminoheptandioate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX07 protein_id gnl|my_center|LOCUS_23990 20377 18329 gene locus_tag LOCUS_24000 20377 18329 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038389.1 protein_id gnl|my_center|LOCUS_24000 21682 20402 gene locus_tag LOCUS_24010 gene hemL 21682 20402 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNY9 protein_id gnl|my_center|LOCUS_24010 21829 22740 gene locus_tag LOCUS_24020 21829 22740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 >Feature sequence083 804 559 gene locus_tag LOCUS_24030 804 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 712 915 gene locus_tag LOCUS_24040 gene cspC1 712 915 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221949.1 protein_id gnl|my_center|LOCUS_24040 1154 2398 gene locus_tag LOCUS_24050 gene argG 1154 2398 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X2A1 protein_id gnl|my_center|LOCUS_24050 2525 2686 gene locus_tag LOCUS_24060 2525 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 3009 3299 gene locus_tag LOCUS_24070 3009 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 3399 4778 gene locus_tag LOCUS_24080 gene dosC 3399 4778 CDS product diguanylate cyclase DosC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AA90 protein_id gnl|my_center|LOCUS_24080 5261 7237 gene locus_tag LOCUS_24090 5261 7237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 7366 9597 gene locus_tag LOCUS_24100 7366 9597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 9939 9679 gene locus_tag LOCUS_24110 9939 9679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 10224 10003 gene locus_tag LOCUS_24120 10224 10003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 10404 10880 gene locus_tag LOCUS_24130 10404 10880 CDS product oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523768.1 protein_id gnl|my_center|LOCUS_24130 10873 13152 gene locus_tag LOCUS_24140 10873 13152 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538095.1 protein_id gnl|my_center|LOCUS_24140 13392 14156 gene locus_tag LOCUS_24150 13392 14156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 17359 14252 gene locus_tag LOCUS_24160 17359 14252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 18978 17359 gene locus_tag LOCUS_24170 18978 17359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551694.1 protein_id gnl|my_center|LOCUS_24170 <22877 18975 gene locus_tag LOCUS_24180 <22877 18975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268607.1:non-ribosomal peptide synthetase >Feature sequence084 420 238 gene locus_tag LOCUS_24190 420 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 756 1571 gene locus_tag LOCUS_24200 756 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 2385 1579 gene locus_tag LOCUS_24210 gene mazG 2385 1579 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038006.1 protein_id gnl|my_center|LOCUS_24210 3723 2416 gene locus_tag LOCUS_24220 gene phoQ 3723 2416 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039015.1 protein_id gnl|my_center|LOCUS_24220 4444 3761 gene locus_tag LOCUS_24230 gene phoP 4444 3761 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002808458.1 protein_id gnl|my_center|LOCUS_24230 4705 4475 gene locus_tag LOCUS_24240 4705 4475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 5715 4768 gene locus_tag LOCUS_24250 gene thrB 5715 4768 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9Q0 protein_id gnl|my_center|LOCUS_24250 6755 5796 gene locus_tag LOCUS_24260 gene dusA 6755 5796 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUX9 protein_id gnl|my_center|LOCUS_24260 6802 7698 gene locus_tag LOCUS_24270 6802 7698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 7937 9922 gene locus_tag LOCUS_24280 7937 9922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 10762 9983 gene locus_tag LOCUS_24290 10762 9983 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836184.1 protein_id gnl|my_center|LOCUS_24290 11208 11834 gene locus_tag LOCUS_24300 11208 11834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 12547 11873 gene locus_tag LOCUS_24310 12547 11873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 13311 12592 gene locus_tag LOCUS_24320 13311 12592 CDS product type 12 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532722.1 protein_id gnl|my_center|LOCUS_24320 13576 14217 gene locus_tag LOCUS_24330 13576 14217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 14220 15074 gene locus_tag LOCUS_24340 14220 15074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 15111 16103 gene locus_tag LOCUS_24350 15111 16103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 16126 17013 gene locus_tag LOCUS_24360 16126 17013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 19456 18161 gene locus_tag LOCUS_24370 19456 18161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 19628 21235 gene locus_tag LOCUS_24380 19628 21235 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_24380 21235 22749 gene locus_tag LOCUS_24390 21235 22749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 >Feature sequence085 518 1102 gene locus_tag LOCUS_24400 518 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 1686 3296 gene locus_tag LOCUS_24410 1686 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 3332 4360 gene locus_tag LOCUS_24420 3332 4360 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970138.1 protein_id gnl|my_center|LOCUS_24420 5126 6316 gene locus_tag LOCUS_24430 5126 6316 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022500.1 protein_id gnl|my_center|LOCUS_24430 6322 7593 gene locus_tag LOCUS_24440 6322 7593 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258492.1 protein_id gnl|my_center|LOCUS_24440 8005 10530 gene locus_tag LOCUS_24450 8005 10530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 11998 10559 gene locus_tag LOCUS_24460 11998 10559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 12267 11998 gene locus_tag LOCUS_24470 12267 11998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 12908 12489 gene locus_tag LOCUS_24480 12908 12489 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073406.1 protein_id gnl|my_center|LOCUS_24480 13016 13465 gene locus_tag LOCUS_24490 gene soxR 13016 13465 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412424.1 protein_id gnl|my_center|LOCUS_24490 13884 13525 gene locus_tag LOCUS_24500 13884 13525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 14909 14340 gene locus_tag LOCUS_24510 14909 14340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 15179 15904 gene locus_tag LOCUS_24520 15179 15904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 17893 16175 gene locus_tag LOCUS_24530 17893 16175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 18395 20107 gene locus_tag LOCUS_24540 18395 20107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 22059 20602 gene locus_tag LOCUS_24550 22059 20602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 22494 22201 gene locus_tag LOCUS_24560 22494 22201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 >Feature sequence086 777 220 gene locus_tag LOCUS_24570 gene lolB 777 220 CDS product outer-membrane lipoprotein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42812 protein_id gnl|my_center|LOCUS_24570 2390 777 gene locus_tag LOCUS_24580 2390 777 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036105.1 protein_id gnl|my_center|LOCUS_24580 2822 4075 gene locus_tag LOCUS_24590 gene hemA 2822 4075 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMZ9 protein_id gnl|my_center|LOCUS_24590 4087 5157 gene locus_tag LOCUS_24600 gene prfA 4087 5157 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NIA8 protein_id gnl|my_center|LOCUS_24600 5162 7231 gene locus_tag LOCUS_24610 5162 7231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 7239 7550 gene locus_tag LOCUS_24620 7239 7550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463615.1 protein_id gnl|my_center|LOCUS_24620 7635 9383 gene locus_tag LOCUS_24630 7635 9383 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036666.1 protein_id gnl|my_center|LOCUS_24630 9386 10423 gene locus_tag LOCUS_24640 9386 10423 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036665.1 protein_id gnl|my_center|LOCUS_24640 10420 11826 gene locus_tag LOCUS_24650 10420 11826 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036664.1 protein_id gnl|my_center|LOCUS_24650 11908 12990 gene locus_tag LOCUS_24660 11908 12990 CDS product MoxR-like ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208437.1 protein_id gnl|my_center|LOCUS_24660 12963 15341 gene locus_tag LOCUS_24670 12963 15341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084336.1 protein_id gnl|my_center|LOCUS_24670 15338 16510 gene locus_tag LOCUS_24680 15338 16510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786824.1 protein_id gnl|my_center|LOCUS_24680 16507 18102 gene locus_tag LOCUS_24690 16507 18102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 18099 18395 gene locus_tag LOCUS_24700 18099 18395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 18531 22331 gene locus_tag LOCUS_24710 18531 22331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 >Feature sequence087 2003 1818 gene locus_tag LOCUS_24720 2003 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 2800 5424 gene locus_tag LOCUS_24730 2800 5424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 5430 7433 gene locus_tag LOCUS_24740 5430 7433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920964.1 protein_id gnl|my_center|LOCUS_24740 7606 8967 gene locus_tag LOCUS_24750 7606 8967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 9063 10880 gene locus_tag LOCUS_24760 9063 10880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033190.1 protein_id gnl|my_center|LOCUS_24760 12223 10877 gene locus_tag LOCUS_24770 12223 10877 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202701.1 protein_id gnl|my_center|LOCUS_24770 13593 12220 gene locus_tag LOCUS_24780 13593 12220 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202702.1 protein_id gnl|my_center|LOCUS_24780 13764 15020 gene locus_tag LOCUS_24790 13764 15020 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762307.1 protein_id gnl|my_center|LOCUS_24790 15052 15759 gene locus_tag LOCUS_24800 15052 15759 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761529.1 protein_id gnl|my_center|LOCUS_24800 15752 18199 gene locus_tag LOCUS_24810 15752 18199 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_24810 19016 18249 gene locus_tag LOCUS_24820 19016 18249 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918910.1 protein_id gnl|my_center|LOCUS_24820 19920 19282 gene locus_tag LOCUS_24830 19920 19282 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035367.1 protein_id gnl|my_center|LOCUS_24830 21113 19917 gene locus_tag LOCUS_24840 21113 19917 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035366.1 protein_id gnl|my_center|LOCUS_24840 21782 21225 gene locus_tag LOCUS_24850 21782 21225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 21735 21980 gene locus_tag LOCUS_24860 21735 21980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 >Feature sequence088 3286 1907 gene locus_tag LOCUS_24870 3286 1907 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119251.1 protein_id gnl|my_center|LOCUS_24870 3454 5625 gene locus_tag LOCUS_24880 3454 5625 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072838.1 protein_id gnl|my_center|LOCUS_24880 5687 7486 gene locus_tag LOCUS_24890 5687 7486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102337.1 protein_id gnl|my_center|LOCUS_24890 7487 8872 gene locus_tag LOCUS_24900 7487 8872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072546.1 protein_id gnl|my_center|LOCUS_24900 9005 10081 gene locus_tag LOCUS_24910 9005 10081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072545.1 protein_id gnl|my_center|LOCUS_24910 10123 12606 gene locus_tag LOCUS_24920 10123 12606 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072544.1 protein_id gnl|my_center|LOCUS_24920 13076 12666 gene locus_tag LOCUS_24930 13076 12666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24930 13286 13077 gene locus_tag LOCUS_24940 13286 13077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24940 14833 13343 gene locus_tag LOCUS_24950 gene glsF 14833 13343 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071057.1 protein_id gnl|my_center|LOCUS_24950 16362 14911 gene locus_tag LOCUS_24960 gene prpD 16362 14911 CDS product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706120.1 protein_id gnl|my_center|LOCUS_24960 17257 16373 gene locus_tag LOCUS_24970 gene prpB 17257 16373 CDS product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5E2 protein_id gnl|my_center|LOCUS_24970 18296 17319 gene locus_tag LOCUS_24980 gene mdh 18296 17319 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SKV7 protein_id gnl|my_center|LOCUS_24980 18464 20158 gene locus_tag LOCUS_24990 gene ggt 18464 20158 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038421.1 protein_id gnl|my_center|LOCUS_24990 21756 20206 gene locus_tag LOCUS_25000 gene mviN 21756 20206 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ED5 protein_id gnl|my_center|LOCUS_25000 >Feature sequence089 962 5512 gene locus_tag LOCUS_25010 962 5512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 5841 7151 gene locus_tag LOCUS_25020 5841 7151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 7293 8663 gene locus_tag LOCUS_25030 7293 8663 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771604.1 protein_id gnl|my_center|LOCUS_25030 9681 8884 gene locus_tag LOCUS_25040 9681 8884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 10516 9719 gene locus_tag LOCUS_25050 10516 9719 CDS product TIGR03084 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731630.1 protein_id gnl|my_center|LOCUS_25050 11663 10521 gene locus_tag LOCUS_25060 11663 10521 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892418.1 protein_id gnl|my_center|LOCUS_25060 13612 11660 gene locus_tag LOCUS_25070 gene mccC1 13612 11660 CDS product 3-methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207705.1 protein_id gnl|my_center|LOCUS_25070 15228 13609 gene locus_tag LOCUS_25080 gene mccB 15228 13609 CDS product acetyl-CoA carboxylase carboxyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083806.1 protein_id gnl|my_center|LOCUS_25080 17045 15225 gene locus_tag LOCUS_25090 17045 15225 CDS product terpene utilization protein AtuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207710.1 protein_id gnl|my_center|LOCUS_25090 17341 18483 gene locus_tag LOCUS_25100 17341 18483 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083801.1 protein_id gnl|my_center|LOCUS_25100 18494 20008 gene locus_tag LOCUS_25110 18494 20008 CDS product acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083800.1 protein_id gnl|my_center|LOCUS_25110 20034 20756 gene locus_tag LOCUS_25120 20034 20756 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817154.1 protein_id gnl|my_center|LOCUS_25120 21793 20945 gene locus_tag LOCUS_25130 21793 20945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 >Feature sequence090 640 140 gene locus_tag LOCUS_25140 640 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 2581 701 gene locus_tag LOCUS_25150 gene parE 2581 701 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9Z8 protein_id gnl|my_center|LOCUS_25150 2752 3660 gene locus_tag LOCUS_25160 2752 3660 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090628.1 protein_id gnl|my_center|LOCUS_25160 3932 4753 gene locus_tag LOCUS_25170 gene cphB 3932 4753 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016692.1 protein_id gnl|my_center|LOCUS_25170 5855 4719 gene locus_tag LOCUS_25180 5855 4719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 6109 5840 gene locus_tag LOCUS_25190 6109 5840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 6039 7235 gene locus_tag LOCUS_25200 6039 7235 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038438.1 protein_id gnl|my_center|LOCUS_25200 7232 7996 gene locus_tag LOCUS_25210 gene lpsC 7232 7996 CDS product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207637.1 protein_id gnl|my_center|LOCUS_25210 7993 8895 gene locus_tag LOCUS_25220 gene ddg 7993 8895 CDS product lipid A biosynthesis palmitoleoyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210042.1 protein_id gnl|my_center|LOCUS_25220 8982 9818 gene locus_tag LOCUS_25230 8982 9818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070552.1 protein_id gnl|my_center|LOCUS_25230 10258 10635 gene locus_tag LOCUS_25240 10258 10635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 10639 12180 gene locus_tag LOCUS_25250 gene purH 10639 12180 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z335 protein_id gnl|my_center|LOCUS_25250 12180 13451 gene locus_tag LOCUS_25260 gene purD 12180 13451 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD48 protein_id gnl|my_center|LOCUS_25260 13456 13818 gene locus_tag LOCUS_25270 gene ptps 13456 13818 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCW2 protein_id gnl|my_center|LOCUS_25270 13815 15599 gene locus_tag LOCUS_25280 13815 15599 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144121.1 protein_id gnl|my_center|LOCUS_25280 15868 15578 gene locus_tag LOCUS_25290 15868 15578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 16650 16390 gene locus_tag LOCUS_25300 16650 16390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 17683 16856 gene locus_tag LOCUS_25310 17683 16856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 18050 17790 gene locus_tag LOCUS_25320 18050 17790 CDS product cell division protein BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037355.1 protein_id gnl|my_center|LOCUS_25320 18483 18052 gene locus_tag LOCUS_25330 18483 18052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233674.1 protein_id gnl|my_center|LOCUS_25330 18716 19375 gene locus_tag LOCUS_25340 18716 19375 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221014.1 protein_id gnl|my_center|LOCUS_25340 20303 19554 gene locus_tag LOCUS_25350 20303 19554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 20187 20486 gene locus_tag LOCUS_25360 20187 20486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 20908 20585 gene locus_tag LOCUS_25370 20908 20585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 <21496 20973 gene locus_tag LOCUS_25380 <21496 20973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058144.1:cysteine synthase A >Feature sequence091 <1 640 gene locus_tag LOCUS_25390 <1 640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3FNA5:orotate phosphoribosyltransferase 940 1611 gene locus_tag LOCUS_25400 940 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 2290 1646 gene locus_tag LOCUS_25410 2290 1646 CDS product DUF2959 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074052.1 protein_id gnl|my_center|LOCUS_25410 3035 2370 gene locus_tag LOCUS_25420 3035 2370 CDS product class GN sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083796.1 protein_id gnl|my_center|LOCUS_25420 4931 3057 gene locus_tag LOCUS_25430 4931 3057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 5115 5804 gene locus_tag LOCUS_25440 5115 5804 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072225.1 protein_id gnl|my_center|LOCUS_25440 5852 7837 gene locus_tag LOCUS_25450 5852 7837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 7881 9449 gene locus_tag LOCUS_25460 7881 9449 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKT5 protein_id gnl|my_center|LOCUS_25460 10800 9865 gene locus_tag LOCUS_25470 10800 9865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 10815 11996 gene locus_tag LOCUS_25480 10815 11996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 12064 13596 gene locus_tag LOCUS_25490 12064 13596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 13603 16773 gene locus_tag LOCUS_25500 13603 16773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 17182 17829 gene locus_tag LOCUS_25510 17182 17829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 18781 17927 gene locus_tag LOCUS_25520 18781 17927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 19977 19693 gene locus_tag LOCUS_25530 19977 19693 CDS product toxin ParE1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409896.1 protein_id gnl|my_center|LOCUS_25530 20206 19964 gene locus_tag LOCUS_25540 20206 19964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 20383 20538 gene locus_tag LOCUS_25550 20383 20538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 >Feature sequence092 1885 887 gene locus_tag LOCUS_25560 gene egtD 1885 887 CDS product histidine N-alpha-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MFS1 protein_id gnl|my_center|LOCUS_25560 3411 2020 gene locus_tag LOCUS_25570 gene dhs1 3411 2020 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC31 protein_id gnl|my_center|LOCUS_25570 5144 3507 gene locus_tag LOCUS_25580 5144 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 7897 5156 gene locus_tag LOCUS_25590 7897 5156 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918466.1 protein_id gnl|my_center|LOCUS_25590 8659 10311 gene locus_tag LOCUS_25600 8659 10311 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404041.1 protein_id gnl|my_center|LOCUS_25600 10330 13758 gene locus_tag LOCUS_25610 gene mfd 10330 13758 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7B3 protein_id gnl|my_center|LOCUS_25610 13748 14212 gene locus_tag LOCUS_25620 13748 14212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 14300 14479 gene locus_tag LOCUS_25630 14300 14479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 14476 16044 gene locus_tag LOCUS_25640 14476 16044 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036964.1 protein_id gnl|my_center|LOCUS_25640 16048 17064 gene locus_tag LOCUS_25650 gene pyrD 16048 17064 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9R0 protein_id gnl|my_center|LOCUS_25650 17061 18065 gene locus_tag LOCUS_25660 gene murB 17061 18065 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZM7 protein_id gnl|my_center|LOCUS_25660 19000 18287 gene locus_tag LOCUS_25670 19000 18287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 19213 19437 gene locus_tag LOCUS_25680 19213 19437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140805.1 protein_id gnl|my_center|LOCUS_25680 <20294 19484 gene locus_tag LOCUS_25690 <20294 19484 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RLT7:magnesium transport protein CorA >Feature sequence093 354 1103 gene locus_tag LOCUS_25700 354 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 1688 1332 gene locus_tag LOCUS_25710 1688 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 1772 1990 gene locus_tag LOCUS_25720 1772 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 2043 2255 gene locus_tag LOCUS_25730 2043 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 2504 2755 gene locus_tag LOCUS_25740 2504 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 3102 3308 gene locus_tag LOCUS_25750 3102 3308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 4291 3407 gene locus_tag LOCUS_25760 gene rssA 4291 3407 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262323.1 protein_id gnl|my_center|LOCUS_25760 6718 4862 gene locus_tag LOCUS_25770 gene ogt 6718 4862 CDS product O-GlcNAc transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_25770 7143 7448 gene locus_tag LOCUS_25780 7143 7448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 >Feature sequence094 641 1846 gene locus_tag LOCUS_25790 gene desA 641 1846 CDS product delta-9 fatty acid desaturase DesA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104496.1 protein_id gnl|my_center|LOCUS_25790 1846 2697 gene locus_tag LOCUS_25800 gene tesB 1846 2697 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036345.1 protein_id gnl|my_center|LOCUS_25800 2869 3126 gene locus_tag LOCUS_25810 2869 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 3130 3873 gene locus_tag LOCUS_25820 3130 3873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 3893 6286 gene locus_tag LOCUS_25830 gene tex 3893 6286 CDS product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037300.1 protein_id gnl|my_center|LOCUS_25830 6283 6609 gene locus_tag LOCUS_25840 gene cutA 6283 6609 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7SIA8 protein_id gnl|my_center|LOCUS_25840 6695 8977 gene locus_tag LOCUS_25850 gene dsbD 6695 8977 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDH5 protein_id gnl|my_center|LOCUS_25850 8974 9495 gene locus_tag LOCUS_25860 8974 9495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 9596 10177 gene locus_tag LOCUS_25870 9596 10177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 10174 11550 gene locus_tag LOCUS_25880 10174 11550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 11705 14158 gene locus_tag LOCUS_25890 11705 14158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 14174 15283 gene locus_tag LOCUS_25900 gene yqiG 14174 15283 CDS product putative NADH-dependent flavin oxidoreductase YqiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54524 protein_id gnl|my_center|LOCUS_25900 15312 15482 gene locus_tag LOCUS_25910 15312 15482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 15650 16216 gene locus_tag LOCUS_25920 15650 16216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 16213 18207 gene locus_tag LOCUS_25930 16213 18207 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073927.1 protein_id gnl|my_center|LOCUS_25930 18663 18220 gene locus_tag LOCUS_25940 18663 18220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 18727 18891 gene locus_tag LOCUS_25950 18727 18891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 19411 18992 gene locus_tag LOCUS_25960 19411 18992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 >Feature sequence095 1894 878 gene locus_tag LOCUS_25970 1894 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 2071 2673 gene locus_tag LOCUS_25980 2071 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 2670 3545 gene locus_tag LOCUS_25990 2670 3545 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187219.1 protein_id gnl|my_center|LOCUS_25990 3679 4713 gene locus_tag LOCUS_26000 3679 4713 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404758.1 protein_id gnl|my_center|LOCUS_26000 4802 5398 gene locus_tag LOCUS_26010 gene rpoE 4802 5398 CDS product ECF RNA polymerase sigma-E factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A2F1 protein_id gnl|my_center|LOCUS_26010 6107 5559 gene locus_tag LOCUS_26020 6107 5559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 6997 6215 gene locus_tag LOCUS_26030 6997 6215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 8637 7321 gene locus_tag LOCUS_26040 8637 7321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 9788 8643 gene locus_tag LOCUS_26050 9788 8643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 9988 10980 gene locus_tag LOCUS_26060 9988 10980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 11817 11128 gene locus_tag LOCUS_26070 11817 11128 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118330.1 protein_id gnl|my_center|LOCUS_26070 11919 14015 gene locus_tag LOCUS_26080 11919 14015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 14864 14088 gene locus_tag LOCUS_26090 14864 14088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036548.1 protein_id gnl|my_center|LOCUS_26090 17660 14928 gene locus_tag LOCUS_26100 gene rapA 17660 14928 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44781 protein_id gnl|my_center|LOCUS_26100 17809 19302 gene locus_tag LOCUS_26110 gene calB 17809 19302 CDS product putative coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A777 protein_id gnl|my_center|LOCUS_26110 >Feature sequence096 3 254 gene locus_tag LOCUS_26120 3 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 1391 780 gene locus_tag LOCUS_26130 1391 780 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_26130 1487 3793 gene locus_tag LOCUS_26140 1487 3793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 3975 3787 gene locus_tag LOCUS_26150 3975 3787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 5564 4299 gene locus_tag LOCUS_26160 5564 4299 CDS product peptidyl-Asp metalloendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC00 protein_id gnl|my_center|LOCUS_26160 5723 7393 gene locus_tag LOCUS_26170 5723 7393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 7360 8286 gene locus_tag LOCUS_26180 7360 8286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 8368 9633 gene locus_tag LOCUS_26190 gene paaA 8368 9633 CDS product phenylacetate-coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QH8 protein_id gnl|my_center|LOCUS_26190 9921 10589 gene locus_tag LOCUS_26200 9921 10589 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887304.1 protein_id gnl|my_center|LOCUS_26200 11881 10616 gene locus_tag LOCUS_26210 11881 10616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 12067 13257 gene locus_tag LOCUS_26220 12067 13257 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405047.1 protein_id gnl|my_center|LOCUS_26220 13254 14015 gene locus_tag LOCUS_26230 13254 14015 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405557.1 protein_id gnl|my_center|LOCUS_26230 14241 14942 gene locus_tag LOCUS_26240 14241 14942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 14952 15113 gene locus_tag LOCUS_26250 14952 15113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 15118 15630 gene locus_tag LOCUS_26260 15118 15630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 15630 16241 gene locus_tag LOCUS_26270 15630 16241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938827.1 protein_id gnl|my_center|LOCUS_26270 16238 16759 gene locus_tag LOCUS_26280 16238 16759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 16773 18140 gene locus_tag LOCUS_26290 16773 18140 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021945.1 protein_id gnl|my_center|LOCUS_26290 19046 18135 gene locus_tag LOCUS_26300 19046 18135 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490825.1 protein_id gnl|my_center|LOCUS_26300 >Feature sequence097 457 71 gene locus_tag LOCUS_26310 457 71 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217718.1 protein_id gnl|my_center|LOCUS_26310 1447 575 gene locus_tag LOCUS_26320 1447 575 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039165.1 protein_id gnl|my_center|LOCUS_26320 2580 1453 gene locus_tag LOCUS_26330 2580 1453 CDS product carotenoid 1,2-hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942826.1 protein_id gnl|my_center|LOCUS_26330 4973 2577 gene locus_tag LOCUS_26340 4973 2577 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255972.1 protein_id gnl|my_center|LOCUS_26340 5644 4976 gene locus_tag LOCUS_26350 5644 4976 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942828.1 protein_id gnl|my_center|LOCUS_26350 6708 5641 gene locus_tag LOCUS_26360 gene hemH2 6708 5641 CDS product ferrochelatase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBZ7 protein_id gnl|my_center|LOCUS_26360 7039 7914 gene locus_tag LOCUS_26370 7039 7914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 8243 8467 gene locus_tag LOCUS_26380 gene tatA 8243 8467 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TH1 protein_id gnl|my_center|LOCUS_26380 8509 8847 gene locus_tag LOCUS_26390 8509 8847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 8831 9598 gene locus_tag LOCUS_26400 gene tatC 8831 9598 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8V0 protein_id gnl|my_center|LOCUS_26400 10836 9586 gene locus_tag LOCUS_26410 gene pfp 10836 9586 CDS product pyrophosphate--fructose 6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZU94 protein_id gnl|my_center|LOCUS_26410 12718 11450 gene locus_tag LOCUS_26420 12718 11450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 13236 12715 gene locus_tag LOCUS_26430 13236 12715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 14238 13240 gene locus_tag LOCUS_26440 14238 13240 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099147.1 protein_id gnl|my_center|LOCUS_26440 15307 14411 gene locus_tag LOCUS_26450 15307 14411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 16247 15393 gene locus_tag LOCUS_26460 gene folD 16247 15393 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FPP7 protein_id gnl|my_center|LOCUS_26460 16300 16893 gene locus_tag LOCUS_26470 gene maf-2 16300 16893 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKG5 protein_id gnl|my_center|LOCUS_26470 18021 17161 gene locus_tag LOCUS_26480 gene rpoH 18021 17161 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H9L4M9 protein_id gnl|my_center|LOCUS_26480 18398 19024 gene locus_tag LOCUS_26490 18398 19024 CDS product UPF0502 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3D5 protein_id gnl|my_center|LOCUS_26490 >Feature sequence098 346 1143 gene locus_tag LOCUS_26500 346 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 1140 2468 gene locus_tag LOCUS_26510 1140 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 2449 3549 gene locus_tag LOCUS_26520 2449 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 3546 4547 gene locus_tag LOCUS_26530 3546 4547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 5192 4689 gene locus_tag LOCUS_26540 5192 4689 CDS product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036864.1 protein_id gnl|my_center|LOCUS_26540 6849 5575 gene locus_tag LOCUS_26550 6849 5575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 7167 6886 gene locus_tag LOCUS_26560 7167 6886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 7316 7669 gene locus_tag LOCUS_26570 7316 7669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 8248 7679 gene locus_tag LOCUS_26580 8248 7679 CDS product putative transcriptional regulator, TetR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705348.1 protein_id gnl|my_center|LOCUS_26580 8294 8671 gene locus_tag LOCUS_26590 8294 8671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 8809 12162 gene locus_tag LOCUS_26600 8809 12162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 12257 13033 gene locus_tag LOCUS_26610 12257 13033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26610 13021 14433 gene locus_tag LOCUS_26620 13021 14433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 14576 15121 gene locus_tag LOCUS_26630 gene btuE 14576 15121 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAI2 protein_id gnl|my_center|LOCUS_26630 15701 15222 gene locus_tag LOCUS_26640 15701 15222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 15922 16524 gene locus_tag LOCUS_26650 15922 16524 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706087.1 protein_id gnl|my_center|LOCUS_26650 17490 16687 gene locus_tag LOCUS_26660 17490 16687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 18038 17487 gene locus_tag LOCUS_26670 18038 17487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 18997 18155 gene locus_tag LOCUS_26680 18997 18155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 >Feature sequence099 359 3358 gene locus_tag LOCUS_26690 359 3358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 3352 4599 gene locus_tag LOCUS_26700 3352 4599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 5140 6579 gene locus_tag LOCUS_26710 5140 6579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 6718 7887 gene locus_tag LOCUS_26720 gene metK 6718 7887 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCH3 protein_id gnl|my_center|LOCUS_26720 8286 9707 gene locus_tag LOCUS_26730 gene ahcY 8286 9707 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62G22 protein_id gnl|my_center|LOCUS_26730 9776 10615 gene locus_tag LOCUS_26740 gene metF 9776 10615 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63PT4 protein_id gnl|my_center|LOCUS_26740 11510 10743 gene locus_tag LOCUS_26750 11510 10743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 11771 12586 gene locus_tag LOCUS_26760 11771 12586 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000500433.1 protein_id gnl|my_center|LOCUS_26760 12623 14809 gene locus_tag LOCUS_26770 12623 14809 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038749.1 protein_id gnl|my_center|LOCUS_26770 14912 18109 gene locus_tag LOCUS_26780 14912 18109 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TJ3 protein_id gnl|my_center|LOCUS_26780 >Feature sequence100 275 5572 gene locus_tag LOCUS_26790 275 5572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 5732 7147 gene locus_tag LOCUS_26800 5732 7147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 7930 7202 gene locus_tag LOCUS_26810 7930 7202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 8094 12164 gene locus_tag LOCUS_26820 8094 12164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 12273 13565 gene locus_tag LOCUS_26830 12273 13565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 13613 15136 gene locus_tag LOCUS_26840 13613 15136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 15193 15999 gene locus_tag LOCUS_26850 15193 15999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 17333 15981 gene locus_tag LOCUS_26860 17333 15981 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976064.1 protein_id gnl|my_center|LOCUS_26860 18193 17330 gene locus_tag LOCUS_26870 18193 17330 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978272.1 protein_id gnl|my_center|LOCUS_26870 >Feature sequence101 2177 717 gene locus_tag LOCUS_26880 2177 717 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084674.1 protein_id gnl|my_center|LOCUS_26880 3055 2183 gene locus_tag LOCUS_26890 3055 2183 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228419.1 protein_id gnl|my_center|LOCUS_26890 4600 3083 gene locus_tag LOCUS_26900 gene mmsA-1 4600 3083 CDS product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704254.1 protein_id gnl|my_center|LOCUS_26900 6020 4704 gene locus_tag LOCUS_26910 6020 4704 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708886.1 protein_id gnl|my_center|LOCUS_26910 6148 7032 gene locus_tag LOCUS_26920 gene ada 6148 7032 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020273.1 protein_id gnl|my_center|LOCUS_26920 8355 6997 gene locus_tag LOCUS_26930 gene mgtE 8355 6997 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P704 protein_id gnl|my_center|LOCUS_26930 10535 8745 gene locus_tag LOCUS_26940 gene lpdA 10535 8745 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD04 protein_id gnl|my_center|LOCUS_26940 10685 11632 gene locus_tag LOCUS_26950 10685 11632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 11629 13602 gene locus_tag LOCUS_26960 gene rep 11629 13602 CDS product ATP-dependent DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TM8 protein_id gnl|my_center|LOCUS_26960 14192 13728 gene locus_tag LOCUS_26970 gene rlmH 14192 13728 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6V2 protein_id gnl|my_center|LOCUS_26970 14594 14211 gene locus_tag LOCUS_26980 gene rsfS 14594 14211 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7J6 protein_id gnl|my_center|LOCUS_26980 15296 14673 gene locus_tag LOCUS_26990 gene nadD 15296 14673 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VV7 protein_id gnl|my_center|LOCUS_26990 16300 15293 gene locus_tag LOCUS_27000 gene holA 16300 15293 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114330.1 protein_id gnl|my_center|LOCUS_27000 16779 16297 gene locus_tag LOCUS_27010 16779 16297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 18836 16779 gene locus_tag LOCUS_27020 gene leuS 18836 16779 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RQ0 protein_id gnl|my_center|LOCUS_27020 >Feature sequence102 1491 364 gene locus_tag LOCUS_27030 1491 364 CDS product sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 protein_id gnl|my_center|LOCUS_27030 3506 1488 gene locus_tag LOCUS_27040 3506 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 4401 3571 gene locus_tag LOCUS_27050 4401 3571 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035437.1 protein_id gnl|my_center|LOCUS_27050 5351 4539 gene locus_tag LOCUS_27060 5351 4539 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035436.1 protein_id gnl|my_center|LOCUS_27060 6375 5353 gene locus_tag LOCUS_27070 gene srkA 6375 5353 CDS product stress response kinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZM98 protein_id gnl|my_center|LOCUS_27070 6360 7418 gene locus_tag LOCUS_27080 6360 7418 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185343.1 protein_id gnl|my_center|LOCUS_27080 7425 7769 gene locus_tag LOCUS_27090 7425 7769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 9103 7754 gene locus_tag LOCUS_27100 9103 7754 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704803.1 protein_id gnl|my_center|LOCUS_27100 10884 9217 gene locus_tag LOCUS_27110 10884 9217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 12727 10988 gene locus_tag LOCUS_27120 12727 10988 CDS product phosphoenolpyruvate-protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63XV0 protein_id gnl|my_center|LOCUS_27120 12993 12724 gene locus_tag LOCUS_27130 gene ptsH 12993 12724 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198013.1 protein_id gnl|my_center|LOCUS_27130 13376 12990 gene locus_tag LOCUS_27140 13376 12990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 14233 13373 gene locus_tag LOCUS_27150 14233 13373 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVV3 protein_id gnl|my_center|LOCUS_27150 15215 14223 gene locus_tag LOCUS_27160 gene hprK 15215 14223 CDS product HPr kinase/phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P709 protein_id gnl|my_center|LOCUS_27160 15750 15271 gene locus_tag LOCUS_27170 15750 15271 CDS product PTS IIA-like nitrogen-regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400244.1 protein_id gnl|my_center|LOCUS_27170 16204 15881 gene locus_tag LOCUS_27180 gene yfiA-2 16204 15881 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305957.1 protein_id gnl|my_center|LOCUS_27180 17918 16536 gene locus_tag LOCUS_27190 gene rpoN 17918 16536 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P49988 protein_id gnl|my_center|LOCUS_27190 <18748 18010 gene locus_tag LOCUS_27200 <18748 18010 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222328.1:pyridine nucleotide-disulfide oxidoreductase >Feature sequence103 249 911 gene locus_tag LOCUS_27210 249 911 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369547.1 protein_id gnl|my_center|LOCUS_27210 960 1973 gene locus_tag LOCUS_27220 960 1973 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_27220 1970 2671 gene locus_tag LOCUS_27230 gene truC 1970 2671 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261357.1 protein_id gnl|my_center|LOCUS_27230 3848 2721 gene locus_tag LOCUS_27240 3848 2721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 4047 4433 gene locus_tag LOCUS_27250 4047 4433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 4453 6054 gene locus_tag LOCUS_27260 gene nadE 4453 6054 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038206.1 protein_id gnl|my_center|LOCUS_27260 6041 7102 gene locus_tag LOCUS_27270 6041 7102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113385.1 protein_id gnl|my_center|LOCUS_27270 7293 7108 gene locus_tag LOCUS_27280 7293 7108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 8157 7450 gene locus_tag LOCUS_27290 gene adh2 8157 7450 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880787.1 protein_id gnl|my_center|LOCUS_27290 9815 8154 gene locus_tag LOCUS_27300 9815 8154 CDS product alkylglycerone-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000500125.1 protein_id gnl|my_center|LOCUS_27300 10732 9812 gene locus_tag LOCUS_27310 10732 9812 CDS product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808357.1 protein_id gnl|my_center|LOCUS_27310 11198 11917 gene locus_tag LOCUS_27320 11198 11917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 13413 11959 gene locus_tag LOCUS_27330 13413 11959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 15119 13560 gene locus_tag LOCUS_27340 15119 13560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 17155 15116 gene locus_tag LOCUS_27350 17155 15116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 17383 18570 gene locus_tag LOCUS_27360 17383 18570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 >Feature sequence104 1252 617 gene locus_tag LOCUS_27370 1252 617 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036299.1 protein_id gnl|my_center|LOCUS_27370 2921 1536 gene locus_tag LOCUS_27380 gene pbeF 2921 1536 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038543.1 protein_id gnl|my_center|LOCUS_27380 4132 2990 gene locus_tag LOCUS_27390 4132 2990 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038544.1 protein_id gnl|my_center|LOCUS_27390 4107 4772 gene locus_tag LOCUS_27400 4107 4772 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206820.1 protein_id gnl|my_center|LOCUS_27400 4842 5192 gene locus_tag LOCUS_27410 4842 5192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 7334 5250 gene locus_tag LOCUS_27420 gene rlmL 7334 5250 CDS product ribosomal RNA large subunit methyltransferase K/L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFW4 protein_id gnl|my_center|LOCUS_27420 7496 8422 gene locus_tag LOCUS_27430 gene oxyR 7496 8422 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036068.1 protein_id gnl|my_center|LOCUS_27430 8690 8902 gene locus_tag LOCUS_27440 8690 8902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 9209 10579 gene locus_tag LOCUS_27450 gene cysB 9209 10579 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035841.1 protein_id gnl|my_center|LOCUS_27450 10576 11742 gene locus_tag LOCUS_27460 gene metB 10576 11742 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035842.1 protein_id gnl|my_center|LOCUS_27460 13251 12001 gene locus_tag LOCUS_27470 13251 12001 CDS product ammonium transporter channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071065.1 protein_id gnl|my_center|LOCUS_27470 13591 13253 gene locus_tag LOCUS_27480 gene glnB 13591 13253 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64250 protein_id gnl|my_center|LOCUS_27480 14223 13588 gene locus_tag LOCUS_27490 14223 13588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070887.1 protein_id gnl|my_center|LOCUS_27490 14476 14661 gene locus_tag LOCUS_27500 14476 14661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 14755 14925 gene locus_tag LOCUS_27510 14755 14925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 14919 16595 gene locus_tag LOCUS_27520 gene ilvD 14919 16595 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SIY0 protein_id gnl|my_center|LOCUS_27520 16592 17608 gene locus_tag LOCUS_27530 gene ilvC 16592 17608 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5L5 protein_id gnl|my_center|LOCUS_27530 17626 18675 gene locus_tag LOCUS_27540 17626 18675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 >Feature sequence105 132 842 gene locus_tag LOCUS_27550 132 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 727 1617 gene locus_tag LOCUS_27560 727 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 1764 3902 gene locus_tag LOCUS_27570 1764 3902 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074066.1 protein_id gnl|my_center|LOCUS_27570 3953 5029 gene locus_tag LOCUS_27580 3953 5029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919650.1 protein_id gnl|my_center|LOCUS_27580 5571 5026 gene locus_tag LOCUS_27590 5571 5026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 6138 5743 gene locus_tag LOCUS_27600 6138 5743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459713.1 protein_id gnl|my_center|LOCUS_27600 6277 6738 gene locus_tag LOCUS_27610 6277 6738 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918284.1 protein_id gnl|my_center|LOCUS_27610 6735 7490 gene locus_tag LOCUS_27620 6735 7490 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090678.1 protein_id gnl|my_center|LOCUS_27620 8564 7494 gene locus_tag LOCUS_27630 8564 7494 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532914.1 protein_id gnl|my_center|LOCUS_27630 11668 8561 gene locus_tag LOCUS_27640 11668 8561 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_27640 11816 12253 gene locus_tag LOCUS_27650 11816 12253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 12363 13013 gene locus_tag LOCUS_27660 gene hly3 12363 13013 CDS product hemolysin III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037985.1 protein_id gnl|my_center|LOCUS_27660 13087 13512 gene locus_tag LOCUS_27670 13087 13512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 14780 13560 gene locus_tag LOCUS_27680 gene fabF 14780 13560 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074037.1 protein_id gnl|my_center|LOCUS_27680 15511 14777 gene locus_tag LOCUS_27690 gene fabG 15511 14777 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074036.1 protein_id gnl|my_center|LOCUS_27690 15935 15498 gene locus_tag LOCUS_27700 15935 15498 CDS product 3-hydroxylacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346295.1 protein_id gnl|my_center|LOCUS_27700 16344 15928 gene locus_tag LOCUS_27710 16344 15928 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765450.1 protein_id gnl|my_center|LOCUS_27710 17093 16341 gene locus_tag LOCUS_27720 17093 16341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 17482 17090 gene locus_tag LOCUS_27730 17482 17090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 18081 17479 gene locus_tag LOCUS_27740 18081 17479 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074024.1 protein_id gnl|my_center|LOCUS_27740 18332 18078 gene locus_tag LOCUS_27750 gene acpP 18332 18078 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NE89 protein_id gnl|my_center|LOCUS_27750 >Feature sequence106 1884 3020 gene locus_tag LOCUS_27760 1884 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224715.1 protein_id gnl|my_center|LOCUS_27760 3230 3964 gene locus_tag LOCUS_27770 3230 3964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 5065 3863 gene locus_tag LOCUS_27780 5065 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 5888 5322 gene locus_tag LOCUS_27790 5888 5322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 6484 5885 gene locus_tag LOCUS_27800 gene rpoE 6484 5885 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036842.1 protein_id gnl|my_center|LOCUS_27800 8300 6681 gene locus_tag LOCUS_27810 8300 6681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 8505 10052 gene locus_tag LOCUS_27820 8505 10052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 10058 10951 gene locus_tag LOCUS_27830 10058 10951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 12308 10932 gene locus_tag LOCUS_27840 12308 10932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 13607 12348 gene locus_tag LOCUS_27850 13607 12348 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704205.1 protein_id gnl|my_center|LOCUS_27850 13777 14364 gene locus_tag LOCUS_27860 13777 14364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 14361 16808 gene locus_tag LOCUS_27870 14361 16808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 >Feature sequence107 601 1167 gene locus_tag LOCUS_27880 gene efp 601 1167 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AR4 protein_id gnl|my_center|LOCUS_27880 1177 2133 gene locus_tag LOCUS_27890 gene epmA 1177 2133 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNS6 protein_id gnl|my_center|LOCUS_27890 2164 3477 gene locus_tag LOCUS_27900 2164 3477 CDS product N-ethylammeline chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037414.1 protein_id gnl|my_center|LOCUS_27900 3470 4186 gene locus_tag LOCUS_27910 gene ubiG 3470 4186 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63RZ8 protein_id gnl|my_center|LOCUS_27910 4183 4833 gene locus_tag LOCUS_27920 gene gph-1 4183 4833 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706174.1 protein_id gnl|my_center|LOCUS_27920 4830 6116 gene locus_tag LOCUS_27930 4830 6116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776294.1 protein_id gnl|my_center|LOCUS_27930 6109 6831 gene locus_tag LOCUS_27940 6109 6831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 6895 7494 gene locus_tag LOCUS_27950 6895 7494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 7571 8512 gene locus_tag LOCUS_27960 gene folE2 7571 8512 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT35 protein_id gnl|my_center|LOCUS_27960 8527 10224 gene locus_tag LOCUS_27970 8527 10224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 10270 10644 gene locus_tag LOCUS_27980 10270 10644 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKD5 protein_id gnl|my_center|LOCUS_27980 10659 11255 gene locus_tag LOCUS_27990 gene recR 10659 11255 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBW4 protein_id gnl|my_center|LOCUS_27990 11287 11625 gene locus_tag LOCUS_28000 11287 11625 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036207.1 protein_id gnl|my_center|LOCUS_28000 11733 12002 gene locus_tag LOCUS_28010 11733 12002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 12026 13315 gene locus_tag LOCUS_28020 12026 13315 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103171.1 protein_id gnl|my_center|LOCUS_28020 14636 13281 gene locus_tag LOCUS_28030 14636 13281 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107842.1 protein_id gnl|my_center|LOCUS_28030 15997 14633 gene locus_tag LOCUS_28040 15997 14633 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762237.1 protein_id gnl|my_center|LOCUS_28040 17175 15994 gene locus_tag LOCUS_28050 17175 15994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 18426 17179 gene locus_tag LOCUS_28060 18426 17179 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202444.1 protein_id gnl|my_center|LOCUS_28060 >Feature sequence108 12 659 gene locus_tag LOCUS_28070 gene nfi 12 659 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGM4 protein_id gnl|my_center|LOCUS_28070 656 1681 gene locus_tag LOCUS_28080 656 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 1737 2171 gene locus_tag LOCUS_28090 1737 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 2790 2200 gene locus_tag LOCUS_28100 2790 2200 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266598.1 protein_id gnl|my_center|LOCUS_28100 2885 3313 gene locus_tag LOCUS_28110 2885 3313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 3357 3599 gene locus_tag LOCUS_28120 3357 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803898.1 protein_id gnl|my_center|LOCUS_28120 5728 3614 gene locus_tag LOCUS_28130 5728 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 5825 6046 gene locus_tag LOCUS_28140 5825 6046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 6117 7859 gene locus_tag LOCUS_28150 6117 7859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 7943 8290 gene locus_tag LOCUS_28160 7943 8290 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EJR1 protein_id gnl|my_center|LOCUS_28160 8296 9066 gene locus_tag LOCUS_28170 gene ddaH 8296 9066 CDS product N(G),N(G)-dimethylarginine dimethylaminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X7M4 protein_id gnl|my_center|LOCUS_28170 9462 9073 gene locus_tag LOCUS_28180 9462 9073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 10389 9532 gene locus_tag LOCUS_28190 10389 9532 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947363.1 protein_id gnl|my_center|LOCUS_28190 13094 10461 gene locus_tag LOCUS_28200 13094 10461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 13323 13147 gene locus_tag LOCUS_28210 13323 13147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 13843 13316 gene locus_tag LOCUS_28220 13843 13316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 13942 14328 gene locus_tag LOCUS_28230 13942 14328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701975.1 protein_id gnl|my_center|LOCUS_28230 18028 14852 gene locus_tag LOCUS_28240 18028 14852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 >Feature sequence109 505 257 gene locus_tag LOCUS_28250 505 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 1458 547 gene locus_tag LOCUS_28260 1458 547 CDS product Cbb3-type cytochrome c oxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VWN5 protein_id gnl|my_center|LOCUS_28260 1631 1455 gene locus_tag LOCUS_28270 gene ccoQ 1631 1455 CDS product cytochrome oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072349.1 protein_id gnl|my_center|LOCUS_28270 2259 1633 gene locus_tag LOCUS_28280 gene ccoO2 2259 1633 CDS product cbb3-type cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087318.1 protein_id gnl|my_center|LOCUS_28280 3683 2256 gene locus_tag LOCUS_28290 3683 2256 CDS product cytochrome c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881190.1 protein_id gnl|my_center|LOCUS_28290 4037 3696 gene locus_tag LOCUS_28300 4037 3696 CDS product high-potential iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63YE1 protein_id gnl|my_center|LOCUS_28300 5500 4307 gene locus_tag LOCUS_28310 5500 4307 CDS product heme transporter CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707628.1 protein_id gnl|my_center|LOCUS_28310 5570 6244 gene locus_tag LOCUS_28320 gene dnr 5570 6244 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113234.1 protein_id gnl|my_center|LOCUS_28320 8587 6314 gene locus_tag LOCUS_28330 8587 6314 CDS product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527410.1 protein_id gnl|my_center|LOCUS_28330 9958 8747 gene locus_tag LOCUS_28340 9958 8747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918495.1 protein_id gnl|my_center|LOCUS_28340 12087 9958 gene locus_tag LOCUS_28350 gene nirS 12087 9958 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24474 protein_id gnl|my_center|LOCUS_28350 14258 12102 gene locus_tag LOCUS_28360 gene phuR 14258 12102 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036004.1 protein_id gnl|my_center|LOCUS_28360 14732 14340 gene locus_tag LOCUS_28370 14732 14340 CDS product SirB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704321.1 protein_id gnl|my_center|LOCUS_28370 15249 14737 gene locus_tag LOCUS_28380 15249 14737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28380 16115 15276 gene locus_tag LOCUS_28390 16115 15276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28390 16597 16181 gene locus_tag LOCUS_28400 16597 16181 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404691.1 protein_id gnl|my_center|LOCUS_28400 16911 16687 gene locus_tag LOCUS_28410 16911 16687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 17345 16908 gene locus_tag LOCUS_28420 17345 16908 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763606.1 protein_id gnl|my_center|LOCUS_28420 18321 17368 gene locus_tag LOCUS_28430 18321 17368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112778.1 protein_id gnl|my_center|LOCUS_28430 >Feature sequence110 239 2410 gene locus_tag LOCUS_28440 gene uvrD 239 2410 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJJ6 protein_id gnl|my_center|LOCUS_28440 2407 3282 gene locus_tag LOCUS_28450 gene ubiA 2407 3282 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F93 protein_id gnl|my_center|LOCUS_28450 4668 3385 gene locus_tag LOCUS_28460 gene pepB 4668 3385 CDS product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071165.1 protein_id gnl|my_center|LOCUS_28460 6509 4752 gene locus_tag LOCUS_28470 6509 4752 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267570.1 protein_id gnl|my_center|LOCUS_28470 8377 6566 gene locus_tag LOCUS_28480 gene typA 8377 6566 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704285.1 protein_id gnl|my_center|LOCUS_28480 8756 9478 gene locus_tag LOCUS_28490 gene colR 8756 9478 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036015.1 protein_id gnl|my_center|LOCUS_28490 9475 10761 gene locus_tag LOCUS_28500 gene colS 9475 10761 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036016.1 protein_id gnl|my_center|LOCUS_28500 11011 12057 gene locus_tag LOCUS_28510 gene mreB 11011 12057 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003482734.1 protein_id gnl|my_center|LOCUS_28510 12209 13093 gene locus_tag LOCUS_28520 gene mreC 12209 13093 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFA8 protein_id gnl|my_center|LOCUS_28520 13090 13578 gene locus_tag LOCUS_28530 gene mreD 13090 13578 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFA9 protein_id gnl|my_center|LOCUS_28530 13578 15440 gene locus_tag LOCUS_28540 13578 15440 CDS product peptidoglycan glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399770.1 protein_id gnl|my_center|LOCUS_28540 15437 16546 gene locus_tag LOCUS_28550 gene mrdB 15437 16546 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071398.1 protein_id gnl|my_center|LOCUS_28550 16566 17591 gene locus_tag LOCUS_28560 16566 17591 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399773.1 protein_id gnl|my_center|LOCUS_28560 >Feature sequence111 623 2050 gene locus_tag LOCUS_28570 623 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 2096 3415 gene locus_tag LOCUS_28580 2096 3415 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119920.1 protein_id gnl|my_center|LOCUS_28580 3688 3479 gene locus_tag LOCUS_28590 3688 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 4314 3943 gene locus_tag LOCUS_28600 4314 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 4481 4317 gene locus_tag LOCUS_28610 4481 4317 CDS product UPF0391 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CLW2 protein_id gnl|my_center|LOCUS_28610 4743 5357 gene locus_tag LOCUS_28620 4743 5357 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967149.1 protein_id gnl|my_center|LOCUS_28620 7365 5530 gene locus_tag LOCUS_28630 7365 5530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 7466 8026 gene locus_tag LOCUS_28640 7466 8026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 8064 9101 gene locus_tag LOCUS_28650 8064 9101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 9098 9448 gene locus_tag LOCUS_28660 9098 9448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 10368 9493 gene locus_tag LOCUS_28670 10368 9493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 11651 10425 gene locus_tag LOCUS_28680 11651 10425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 11794 13383 gene locus_tag LOCUS_28690 11794 13383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 13352 14245 gene locus_tag LOCUS_28700 13352 14245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 14932 14255 gene locus_tag LOCUS_28710 14932 14255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 15003 17117 gene locus_tag LOCUS_28720 15003 17117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 >Feature sequence112 351 2786 gene locus_tag LOCUS_28730 351 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 3309 4802 gene locus_tag LOCUS_28740 3309 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 5206 5550 gene locus_tag LOCUS_28750 5206 5550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 6437 6159 gene locus_tag LOCUS_28760 6437 6159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 8313 6553 gene locus_tag LOCUS_28770 8313 6553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 9073 8414 gene locus_tag LOCUS_28780 9073 8414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 9973 9137 gene locus_tag LOCUS_28790 9973 9137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 10366 10001 gene locus_tag LOCUS_28800 10366 10001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 10737 11060 gene locus_tag LOCUS_28810 10737 11060 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165196.1 protein_id gnl|my_center|LOCUS_28810 11469 11957 gene locus_tag LOCUS_28820 11469 11957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28820 12964 15396 gene locus_tag LOCUS_28830 12964 15396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 16637 16323 gene locus_tag LOCUS_28840 16637 16323 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261951.1 protein_id gnl|my_center|LOCUS_28840 16888 16634 gene locus_tag LOCUS_28850 16888 16634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 17589 17149 gene locus_tag LOCUS_28860 17589 17149 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071530.1 protein_id gnl|my_center|LOCUS_28860 >Feature sequence113 10085 9438 gene locus_tag LOCUS_28870 10085 9438 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704391.1 protein_id gnl|my_center|LOCUS_28870 10702 10082 gene locus_tag LOCUS_28880 gene tpm 10702 10082 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJ86 protein_id gnl|my_center|LOCUS_28880 11508 10699 gene locus_tag LOCUS_28890 11508 10699 CDS product 5-carboxymethyl-2-hydroxymuconate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088041.1 protein_id gnl|my_center|LOCUS_28890 11586 12965 gene locus_tag LOCUS_28900 11586 12965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 12937 13740 gene locus_tag LOCUS_28910 12937 13740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 13795 14787 gene locus_tag LOCUS_28920 13795 14787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 14793 17156 gene locus_tag LOCUS_28930 gene hrpB 14793 17156 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035530.1 protein_id gnl|my_center|LOCUS_28930 17921 17151 gene locus_tag LOCUS_28940 gene yadH 17921 17151 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2T0 protein_id gnl|my_center|LOCUS_28940 18057 17914 gene locus_tag LOCUS_28950 18057 17914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 >Feature sequence114 758 964 gene locus_tag LOCUS_28960 758 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 1836 2216 gene locus_tag LOCUS_28970 1836 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 2993 3157 gene locus_tag LOCUS_28980 2993 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 3716 3916 gene locus_tag LOCUS_28990 3716 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 4026 4406 gene locus_tag LOCUS_29000 4026 4406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 4570 5019 gene locus_tag LOCUS_29010 4570 5019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 5113 5496 gene locus_tag LOCUS_29020 5113 5496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 6071 6364 gene locus_tag LOCUS_29030 6071 6364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 6808 8985 gene locus_tag LOCUS_29040 6808 8985 CDS product iron transport outer membrane receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112850.1 protein_id gnl|my_center|LOCUS_29040 9117 9803 gene locus_tag LOCUS_29050 9117 9803 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMI1 protein_id gnl|my_center|LOCUS_29050 10424 9918 gene locus_tag LOCUS_29060 10424 9918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 10795 10944 gene locus_tag LOCUS_29070 10795 10944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 10941 11522 gene locus_tag LOCUS_29080 10941 11522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 11596 12123 gene locus_tag LOCUS_29090 11596 12123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 13141 12389 gene locus_tag LOCUS_29100 13141 12389 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206915.1 protein_id gnl|my_center|LOCUS_29100 14178 13141 gene locus_tag LOCUS_29110 14178 13141 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206917.1 protein_id gnl|my_center|LOCUS_29110 14965 14171 gene locus_tag LOCUS_29120 14965 14171 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767607.1 protein_id gnl|my_center|LOCUS_29120 16200 14962 gene locus_tag LOCUS_29130 16200 14962 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206918.1 protein_id gnl|my_center|LOCUS_29130 16303 17202 gene locus_tag LOCUS_29140 16303 17202 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112416.1 protein_id gnl|my_center|LOCUS_29140 <17898 17163 gene locus_tag LOCUS_29150 <17898 17163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KEY5:adenosine deaminase >Feature sequence115 823 1068 gene locus_tag LOCUS_29160 823 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 1509 4889 gene locus_tag LOCUS_29170 1509 4889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 5961 5638 gene locus_tag LOCUS_29180 5961 5638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 6602 6177 gene locus_tag LOCUS_29190 6602 6177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 7048 6674 gene locus_tag LOCUS_29200 7048 6674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 7837 7064 gene locus_tag LOCUS_29210 7837 7064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 9403 9137 gene locus_tag LOCUS_29220 9403 9137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 10660 9545 gene locus_tag LOCUS_29230 10660 9545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 11440 12132 gene locus_tag LOCUS_29240 11440 12132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 12355 14334 gene locus_tag LOCUS_29250 12355 14334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 14942 15241 gene locus_tag LOCUS_29260 14942 15241 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266541.1 protein_id gnl|my_center|LOCUS_29260 15241 16083 gene locus_tag LOCUS_29270 15241 16083 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266542.1 protein_id gnl|my_center|LOCUS_29270 16344 17066 gene locus_tag LOCUS_29280 16344 17066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 17095 17544 gene locus_tag LOCUS_29290 17095 17544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 >Feature sequence116 3673 575 gene locus_tag LOCUS_29300 3673 575 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_29300 3886 4554 gene locus_tag LOCUS_29310 3886 4554 CDS product methyltransferase type 12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037565.1 protein_id gnl|my_center|LOCUS_29310 4564 4974 gene locus_tag LOCUS_29320 4564 4974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 5508 5035 gene locus_tag LOCUS_29330 gene dksA 5508 5035 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8I6 protein_id gnl|my_center|LOCUS_29330 6066 5749 gene locus_tag LOCUS_29340 6066 5749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 5947 7218 gene locus_tag LOCUS_29350 5947 7218 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLG1 protein_id gnl|my_center|LOCUS_29350 7221 7658 gene locus_tag LOCUS_29360 7221 7658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 8186 10117 gene locus_tag LOCUS_29370 gene phuR 8186 10117 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037788.1 protein_id gnl|my_center|LOCUS_29370 10204 11088 gene locus_tag LOCUS_29380 10204 11088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037847.1 protein_id gnl|my_center|LOCUS_29380 11861 11097 gene locus_tag LOCUS_29390 11861 11097 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390517.1 protein_id gnl|my_center|LOCUS_29390 12334 11858 gene locus_tag LOCUS_29400 gene trmL 12334 11858 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UH4 protein_id gnl|my_center|LOCUS_29400 13312 12338 gene locus_tag LOCUS_29410 13312 12338 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_29410 15152 13476 gene locus_tag LOCUS_29420 gene recN 15152 13476 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WN8 protein_id gnl|my_center|LOCUS_29420 15257 16294 gene locus_tag LOCUS_29430 gene hrcA 15257 16294 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAL1 protein_id gnl|my_center|LOCUS_29430 16395 16955 gene locus_tag LOCUS_29440 gene grpE 16395 16955 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RX5 protein_id gnl|my_center|LOCUS_29440 >Feature sequence117 <1 765 gene locus_tag LOCUS_29450 <1 765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704239.1:restriction modification system DNA specificity domain-containing protein 768 1826 gene locus_tag LOCUS_29460 768 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 1891 2226 gene locus_tag LOCUS_29470 1891 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 2467 5607 gene locus_tag LOCUS_29480 2467 5607 CDS product type I restriction-modification system, restriction (R) subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704238.1 protein_id gnl|my_center|LOCUS_29480 5604 6101 gene locus_tag LOCUS_29490 5604 6101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 6159 6863 gene locus_tag LOCUS_29500 6159 6863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 6800 7297 gene locus_tag LOCUS_29510 6800 7297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 7518 8009 gene locus_tag LOCUS_29520 7518 8009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 8790 8416 gene locus_tag LOCUS_29530 8790 8416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 9937 8783 gene locus_tag LOCUS_29540 9937 8783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 10353 9934 gene locus_tag LOCUS_29550 gene cheY-2 10353 9934 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939351.1 protein_id gnl|my_center|LOCUS_29550 11751 11308 gene locus_tag LOCUS_29560 11751 11308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 12581 12327 gene locus_tag LOCUS_29570 12581 12327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 14382 12802 gene locus_tag LOCUS_29580 14382 12802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 14983 14417 gene locus_tag LOCUS_29590 14983 14417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 15285 14998 gene locus_tag LOCUS_29600 15285 14998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 16989 15565 gene locus_tag LOCUS_29610 16989 15565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 >Feature sequence118 <1 576 gene locus_tag LOCUS_29620 <1 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023003705.1:sodium:sulfate symporter 617 1852 gene locus_tag LOCUS_29630 617 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 2422 1976 gene locus_tag LOCUS_29640 2422 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 3797 2724 gene locus_tag LOCUS_29650 3797 2724 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918776.1 protein_id gnl|my_center|LOCUS_29650 3993 4820 gene locus_tag LOCUS_29660 3993 4820 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918777.1 protein_id gnl|my_center|LOCUS_29660 5239 4883 gene locus_tag LOCUS_29670 5239 4883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 6422 5460 gene locus_tag LOCUS_29680 6422 5460 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957564.1 protein_id gnl|my_center|LOCUS_29680 7492 6470 gene locus_tag LOCUS_29690 7492 6470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 7437 8066 gene locus_tag LOCUS_29700 7437 8066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 8423 9391 gene locus_tag LOCUS_29710 8423 9391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 9388 10218 gene locus_tag LOCUS_29720 9388 10218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 10348 11001 gene locus_tag LOCUS_29730 10348 11001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 11760 11005 gene locus_tag LOCUS_29740 11760 11005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 11879 12610 gene locus_tag LOCUS_29750 11879 12610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102692.1 protein_id gnl|my_center|LOCUS_29750 12607 13110 gene locus_tag LOCUS_29760 12607 13110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 13107 14369 gene locus_tag LOCUS_29770 13107 14369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 14437 15201 gene locus_tag LOCUS_29780 14437 15201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 15265 15501 gene locus_tag LOCUS_29790 15265 15501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 15767 15597 gene locus_tag LOCUS_29800 15767 15597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 16875 15832 gene locus_tag LOCUS_29810 16875 15832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 >Feature sequence119 1576 2448 gene locus_tag LOCUS_29820 1576 2448 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946515.1 protein_id gnl|my_center|LOCUS_29820 2445 3299 gene locus_tag LOCUS_29830 2445 3299 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035700.1 protein_id gnl|my_center|LOCUS_29830 3408 4190 gene locus_tag LOCUS_29840 gene pssA 3408 4190 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035883.1 protein_id gnl|my_center|LOCUS_29840 4193 5446 gene locus_tag LOCUS_29850 4193 5446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 5450 5863 gene locus_tag LOCUS_29860 5450 5863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 5863 6201 gene locus_tag LOCUS_29870 5863 6201 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ91 protein_id gnl|my_center|LOCUS_29870 6201 6989 gene locus_tag LOCUS_29880 6201 6989 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390658.1 protein_id gnl|my_center|LOCUS_29880 6986 7789 gene locus_tag LOCUS_29890 6986 7789 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390659.1 protein_id gnl|my_center|LOCUS_29890 7827 8771 gene locus_tag LOCUS_29900 7827 8771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390660.1 protein_id gnl|my_center|LOCUS_29900 8768 9379 gene locus_tag LOCUS_29910 8768 9379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 9376 9855 gene locus_tag LOCUS_29920 9376 9855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 9852 10340 gene locus_tag LOCUS_29930 gene rimI 9852 10340 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCS0 protein_id gnl|my_center|LOCUS_29930 10470 11468 gene locus_tag LOCUS_29940 10470 11468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 11465 12586 gene locus_tag LOCUS_29950 11465 12586 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388828.1 protein_id gnl|my_center|LOCUS_29950 12765 13481 gene locus_tag LOCUS_29960 12765 13481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29960 13560 14990 gene locus_tag LOCUS_29970 13560 14990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 16110 15046 gene locus_tag LOCUS_29980 16110 15046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 >Feature sequence120 1715 102 gene locus_tag LOCUS_29990 1715 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 2642 1851 gene locus_tag LOCUS_30000 2642 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 3528 2620 gene locus_tag LOCUS_30010 3528 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 4538 3555 gene locus_tag LOCUS_30020 gene mvaD 4538 3555 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921869.1 protein_id gnl|my_center|LOCUS_30020 5350 4535 gene locus_tag LOCUS_30030 5350 4535 CDS product putative isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I073 protein_id gnl|my_center|LOCUS_30030 5382 5825 gene locus_tag LOCUS_30040 5382 5825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 6117 5770 gene locus_tag LOCUS_30050 6117 5770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 8683 6140 gene locus_tag LOCUS_30060 8683 6140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 8770 9165 gene locus_tag LOCUS_30070 8770 9165 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070678.1 protein_id gnl|my_center|LOCUS_30070 9656 9150 gene locus_tag LOCUS_30080 9656 9150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 9766 11175 gene locus_tag LOCUS_30090 9766 11175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 12074 11196 gene locus_tag LOCUS_30100 gene exo 12074 11196 CDS product exodeoxyribonuclease IX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036075.1 protein_id gnl|my_center|LOCUS_30100 12631 12077 gene locus_tag LOCUS_30110 12631 12077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637786.2 protein_id gnl|my_center|LOCUS_30110 15794 12870 gene locus_tag LOCUS_30120 gene btuB 15794 12870 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037992.1 protein_id gnl|my_center|LOCUS_30120 16690 16034 gene locus_tag LOCUS_30130 16690 16034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 >Feature sequence121 123 5435 gene locus_tag LOCUS_30140 123 5435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 5606 6157 gene locus_tag LOCUS_30150 5606 6157 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_30150 6150 8903 gene locus_tag LOCUS_30160 6150 8903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 8900 9109 gene locus_tag LOCUS_30170 8900 9109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 9141 10454 gene locus_tag LOCUS_30180 9141 10454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 11732 11304 gene locus_tag LOCUS_30190 11732 11304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 11817 12005 gene locus_tag LOCUS_30200 11817 12005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 12849 12283 gene locus_tag LOCUS_30210 12849 12283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 13142 12858 gene locus_tag LOCUS_30220 13142 12858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 14571 14134 gene locus_tag LOCUS_30230 gene vapC37 14571 14134 CDS product ribonuclease VapC37 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O53501 protein_id gnl|my_center|LOCUS_30230 14804 14568 gene locus_tag LOCUS_30240 14804 14568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 15530 14943 gene locus_tag LOCUS_30250 gene fic 15530 14943 CDS product cell filamentation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974878.1 protein_id gnl|my_center|LOCUS_30250 15991 15527 gene locus_tag LOCUS_30260 15991 15527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 >Feature sequence122 351 2822 gene locus_tag LOCUS_30270 351 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 2827 3723 gene locus_tag LOCUS_30280 2827 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 3729 5471 gene locus_tag LOCUS_30290 3729 5471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 5577 7553 gene locus_tag LOCUS_30300 5577 7553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 7612 9366 gene locus_tag LOCUS_30310 7612 9366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 9378 13253 gene locus_tag LOCUS_30320 9378 13253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 13418 13681 gene locus_tag LOCUS_30330 13418 13681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 15338 13701 gene locus_tag LOCUS_30340 15338 13701 CDS product long-chain acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705768.1 protein_id gnl|my_center|LOCUS_30340 15472 15936 gene locus_tag LOCUS_30350 15472 15936 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948527.1 protein_id gnl|my_center|LOCUS_30350 16357 16491 gene locus_tag LOCUS_30360 16357 16491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 >Feature sequence123 2648 3511 gene locus_tag LOCUS_30370 2648 3511 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086558.1 protein_id gnl|my_center|LOCUS_30370 3545 4417 gene locus_tag LOCUS_30380 3545 4417 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463614.1 protein_id gnl|my_center|LOCUS_30380 4612 5034 gene locus_tag LOCUS_30390 4612 5034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 5330 5055 gene locus_tag LOCUS_30400 5330 5055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 7782 5785 gene locus_tag LOCUS_30410 7782 5785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 8142 8501 gene locus_tag LOCUS_30420 8142 8501 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098837.1 protein_id gnl|my_center|LOCUS_30420 8498 8923 gene locus_tag LOCUS_30430 8498 8923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 9315 9743 gene locus_tag LOCUS_30440 9315 9743 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889463.1 protein_id gnl|my_center|LOCUS_30440 9762 10871 gene locus_tag LOCUS_30450 9762 10871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 11928 10873 gene locus_tag LOCUS_30460 11928 10873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 11993 12364 gene locus_tag LOCUS_30470 11993 12364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 14862 13630 gene locus_tag LOCUS_30480 14862 13630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 15923 14862 gene locus_tag LOCUS_30490 15923 14862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 16285 15989 gene locus_tag LOCUS_30500 16285 15989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 >Feature sequence124 2 712 gene locus_tag LOCUS_30510 2 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 1304 729 gene locus_tag LOCUS_30520 1304 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 2611 1316 gene locus_tag LOCUS_30530 gene amaA 2611 1316 CDS product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 protein_id gnl|my_center|LOCUS_30530 4537 2708 gene locus_tag LOCUS_30540 4537 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 4693 6582 gene locus_tag LOCUS_30550 gene uup 4693 6582 CDS product heme ABC transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941581.1 protein_id gnl|my_center|LOCUS_30550 7381 6587 gene locus_tag LOCUS_30560 7381 6587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071665.1 protein_id gnl|my_center|LOCUS_30560 9150 7378 gene locus_tag LOCUS_30570 9150 7378 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071667.1 protein_id gnl|my_center|LOCUS_30570 9375 9166 gene locus_tag LOCUS_30580 9375 9166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 10849 9521 gene locus_tag LOCUS_30590 10849 9521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 12192 11146 gene locus_tag LOCUS_30600 12192 11146 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070874.1 protein_id gnl|my_center|LOCUS_30600 12629 12285 gene locus_tag LOCUS_30610 12629 12285 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888244.1 protein_id gnl|my_center|LOCUS_30610 12757 13083 gene locus_tag LOCUS_30620 12757 13083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 13120 13722 gene locus_tag LOCUS_30630 13120 13722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 13975 14358 gene locus_tag LOCUS_30640 13975 14358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 14363 14866 gene locus_tag LOCUS_30650 14363 14866 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406573.1 protein_id gnl|my_center|LOCUS_30650 14891 15124 gene locus_tag LOCUS_30660 14891 15124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 15599 15156 gene locus_tag LOCUS_30670 15599 15156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 15718 16095 gene locus_tag LOCUS_30680 15718 16095 CDS product endoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_30680 >Feature sequence125 3195 946 gene locus_tag LOCUS_30690 3195 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 3771 3202 gene locus_tag LOCUS_30700 gene rpoE 3771 3202 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325155.1 protein_id gnl|my_center|LOCUS_30700 4006 5403 gene locus_tag LOCUS_30710 4006 5403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 7685 5484 gene locus_tag LOCUS_30720 gene actII-3 7685 5484 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039076.1 protein_id gnl|my_center|LOCUS_30720 8254 7682 gene locus_tag LOCUS_30730 8254 7682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 9146 8235 gene locus_tag LOCUS_30740 9146 8235 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039079.1 protein_id gnl|my_center|LOCUS_30740 10447 9143 gene locus_tag LOCUS_30750 10447 9143 CDS product AMP-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039086.1 protein_id gnl|my_center|LOCUS_30750 10700 10434 gene locus_tag LOCUS_30760 gene acpC 10700 10434 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639351.2 protein_id gnl|my_center|LOCUS_30760 11017 12330 gene locus_tag LOCUS_30770 11017 12330 CDS product hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039084.1 protein_id gnl|my_center|LOCUS_30770 13915 12308 gene locus_tag LOCUS_30780 13915 12308 CDS product halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039072.1 protein_id gnl|my_center|LOCUS_30780 14660 13905 gene locus_tag LOCUS_30790 14660 13905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039070.1 protein_id gnl|my_center|LOCUS_30790 15826 14657 gene locus_tag LOCUS_30800 gene fabF 15826 14657 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039069.1 protein_id gnl|my_center|LOCUS_30800 >Feature sequence126 333 2015 gene locus_tag LOCUS_30810 gene dagA 333 2015 CDS product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122885.1 protein_id gnl|my_center|LOCUS_30810 2083 3357 gene locus_tag LOCUS_30820 gene yeiM 2083 3357 CDS product nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036001.1 protein_id gnl|my_center|LOCUS_30820 3398 5332 gene locus_tag LOCUS_30830 3398 5332 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091605.1 protein_id gnl|my_center|LOCUS_30830 5310 6299 gene locus_tag LOCUS_30840 5310 6299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 7208 6414 gene locus_tag LOCUS_30850 7208 6414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 7363 7551 gene locus_tag LOCUS_30860 7363 7551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 10706 8301 gene locus_tag LOCUS_30870 10706 8301 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035312.1 protein_id gnl|my_center|LOCUS_30870 10860 11234 gene locus_tag LOCUS_30880 10860 11234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 11345 12574 gene locus_tag LOCUS_30890 gene serA 11345 12574 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071152.1 protein_id gnl|my_center|LOCUS_30890 12574 13470 gene locus_tag LOCUS_30900 12574 13470 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226336.1 protein_id gnl|my_center|LOCUS_30900 13448 13798 gene locus_tag LOCUS_30910 13448 13798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 13780 14598 gene locus_tag LOCUS_30920 13780 14598 CDS product cytochrome c assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266932.1 protein_id gnl|my_center|LOCUS_30920 14645 15937 gene locus_tag LOCUS_30930 14645 15937 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071563.1 protein_id gnl|my_center|LOCUS_30930 16025 16111 gene locus_tag LOCUS_t00230 16025 16111 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence127 1926 232 gene locus_tag LOCUS_30940 1926 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 2062 4089 gene locus_tag LOCUS_30950 2062 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 4274 5371 gene locus_tag LOCUS_30960 4274 5371 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_30960 5474 6730 gene locus_tag LOCUS_30970 5474 6730 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 protein_id gnl|my_center|LOCUS_30970 6894 7463 gene locus_tag LOCUS_30980 6894 7463 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066604.1 protein_id gnl|my_center|LOCUS_30980 7736 7560 gene locus_tag LOCUS_30990 7736 7560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552853.1 protein_id gnl|my_center|LOCUS_30990 8858 8115 gene locus_tag LOCUS_31000 8858 8115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 8954 10387 gene locus_tag LOCUS_31010 8954 10387 CDS product phospholipase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207627.1 protein_id gnl|my_center|LOCUS_31010 12172 10484 gene locus_tag LOCUS_31020 gene algA 12172 10484 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072238.1 protein_id gnl|my_center|LOCUS_31020 12400 13908 gene locus_tag LOCUS_31030 12400 13908 CDS product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918672.1 protein_id gnl|my_center|LOCUS_31030 13905 14927 gene locus_tag LOCUS_31040 13905 14927 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039037.1 protein_id gnl|my_center|LOCUS_31040 15357 14911 gene locus_tag LOCUS_31050 15357 14911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 >Feature sequence128 237 431 gene locus_tag LOCUS_31060 237 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 635 1177 gene locus_tag LOCUS_31070 635 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 4077 1513 gene locus_tag LOCUS_31080 4077 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 8390 4074 gene locus_tag LOCUS_31090 8390 4074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 8864 8427 gene locus_tag LOCUS_31100 8864 8427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528796.1 protein_id gnl|my_center|LOCUS_31100 9178 8861 gene locus_tag LOCUS_31110 9178 8861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 9597 9292 gene locus_tag LOCUS_31120 9597 9292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 10255 9590 gene locus_tag LOCUS_31130 10255 9590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 10347 10949 gene locus_tag LOCUS_31140 10347 10949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 10946 11692 gene locus_tag LOCUS_31150 10946 11692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 14216 12069 gene locus_tag LOCUS_31160 14216 12069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 14774 14313 gene locus_tag LOCUS_31170 14774 14313 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532284.1 protein_id gnl|my_center|LOCUS_31170 14893 15480 gene locus_tag LOCUS_31180 14893 15480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 <16300 15683 gene locus_tag LOCUS_31190 <16300 15683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005079343.1:type II secretion system protein F >Feature sequence129 806 1222 gene locus_tag LOCUS_31200 gene mraZ 806 1222 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCK8 protein_id gnl|my_center|LOCUS_31200 1413 2342 gene locus_tag LOCUS_31210 gene rsmH 1413 2342 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60390 protein_id gnl|my_center|LOCUS_31210 2339 2605 gene locus_tag LOCUS_31220 2339 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 2602 4314 gene locus_tag LOCUS_31230 gene ftsI 2602 4314 CDS product penicillin-binding protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035957.1 protein_id gnl|my_center|LOCUS_31230 4311 5246 gene locus_tag LOCUS_31240 4311 5246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_31240 5339 5761 gene locus_tag LOCUS_31250 5339 5761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_31250 5758 7110 gene locus_tag LOCUS_31260 gene murF 5758 7110 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F27 protein_id gnl|my_center|LOCUS_31260 7101 8183 gene locus_tag LOCUS_31270 gene mraY 7101 8183 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ8 protein_id gnl|my_center|LOCUS_31270 8183 9352 gene locus_tag LOCUS_31280 gene ftsW 8183 9352 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCK1 protein_id gnl|my_center|LOCUS_31280 9349 10389 gene locus_tag LOCUS_31290 gene murG 9349 10389 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCK0 protein_id gnl|my_center|LOCUS_31290 10386 11789 gene locus_tag LOCUS_31300 gene murC 10386 11789 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW02 protein_id gnl|my_center|LOCUS_31300 11786 12718 gene locus_tag LOCUS_31310 gene ddlB 11786 12718 CDS product D-alanine--D-alanine ligase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9LCT6 protein_id gnl|my_center|LOCUS_31310 12715 13461 gene locus_tag LOCUS_31320 gene ftsQ 12715 13461 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCJ7 protein_id gnl|my_center|LOCUS_31320 13458 14687 gene locus_tag LOCUS_31330 gene ftsA 13458 14687 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WY9 protein_id gnl|my_center|LOCUS_31330 14841 16025 gene locus_tag LOCUS_31340 gene ftsZ 14841 16025 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCJ6 protein_id gnl|my_center|LOCUS_31340 >Feature sequence130 1233 2249 gene locus_tag LOCUS_31350 1233 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 3231 2260 gene locus_tag LOCUS_31360 3231 2260 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037668.1 protein_id gnl|my_center|LOCUS_31360 4565 3228 gene locus_tag LOCUS_31370 gene glmM 4565 3228 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7S2 protein_id gnl|my_center|LOCUS_31370 5737 4580 gene locus_tag LOCUS_31380 5737 4580 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403681.1 protein_id gnl|my_center|LOCUS_31380 5959 6423 gene locus_tag LOCUS_31390 5959 6423 CDS product heat-shock protein IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709372.1 protein_id gnl|my_center|LOCUS_31390 7553 6675 gene locus_tag LOCUS_31400 gene malR 7553 6675 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072259.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31400 9914 7623 gene locus_tag LOCUS_31410 9914 7623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 9931 10287 gene locus_tag LOCUS_31420 9931 10287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 11324 10224 gene locus_tag LOCUS_31430 11324 10224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 12454 11333 gene locus_tag LOCUS_31440 12454 11333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 12518 12784 gene locus_tag LOCUS_31450 12518 12784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 12807 14978 gene locus_tag LOCUS_31460 12807 14978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 >Feature sequence131 2336 915 gene locus_tag LOCUS_31470 gene ldp 2336 915 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAJ8 protein_id gnl|my_center|LOCUS_31470 3583 2345 gene locus_tag LOCUS_31480 gene sucB 3583 2345 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZY40 protein_id gnl|my_center|LOCUS_31480 6417 3586 gene locus_tag LOCUS_31490 gene sucA 6417 3586 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946279.1 protein_id gnl|my_center|LOCUS_31490 8507 6666 gene locus_tag LOCUS_31500 gene sac1 8507 6666 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038259.1 protein_id gnl|my_center|LOCUS_31500 9229 8582 gene locus_tag LOCUS_31510 gene trmB 9229 8582 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNV5 protein_id gnl|my_center|LOCUS_31510 9485 10258 gene locus_tag LOCUS_31520 9485 10258 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761555.1 protein_id gnl|my_center|LOCUS_31520 10268 11104 gene locus_tag LOCUS_31530 10268 11104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 11086 11859 gene locus_tag LOCUS_31540 11086 11859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 11859 12788 gene locus_tag LOCUS_31550 11859 12788 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_599638.1 protein_id gnl|my_center|LOCUS_31550 13085 13834 gene locus_tag LOCUS_31560 gene colR 13085 13834 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003490678.1 protein_id gnl|my_center|LOCUS_31560 13963 15285 gene locus_tag LOCUS_31570 gene colS 13963 15285 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038221.1 protein_id gnl|my_center|LOCUS_31570 15297 15935 gene locus_tag LOCUS_31580 gene dsbA 15297 15935 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C2B2 protein_id gnl|my_center|LOCUS_31580 15925 16113 gene locus_tag LOCUS_31590 15925 16113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 >Feature sequence132 2485 311 gene locus_tag LOCUS_31600 gene ctpA 2485 311 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400679.1 protein_id gnl|my_center|LOCUS_31600 3126 2548 gene locus_tag LOCUS_31610 3126 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 3743 3123 gene locus_tag LOCUS_31620 3743 3123 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403102.1 protein_id gnl|my_center|LOCUS_31620 5386 3740 gene locus_tag LOCUS_31630 5386 3740 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403101.1 protein_id gnl|my_center|LOCUS_31630 6730 5474 gene locus_tag LOCUS_31640 gene rpoE 6730 5474 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223908.1 protein_id gnl|my_center|LOCUS_31640 7140 6730 gene locus_tag LOCUS_31650 7140 6730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 8092 7265 gene locus_tag LOCUS_31660 8092 7265 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249195.1 protein_id gnl|my_center|LOCUS_31660 10121 8085 gene locus_tag LOCUS_31670 10121 8085 CDS product alanyl dipeptidyl peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636480.2 protein_id gnl|my_center|LOCUS_31670 10378 11070 gene locus_tag LOCUS_31680 10378 11070 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226808.1 protein_id gnl|my_center|LOCUS_31680 11140 14460 gene locus_tag LOCUS_31690 11140 14460 CDS product bifunctional TolB-family protein/amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070433.1 protein_id gnl|my_center|LOCUS_31690 14611 15048 gene locus_tag LOCUS_31700 14611 15048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 15654 15064 gene locus_tag LOCUS_31710 15654 15064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 >Feature sequence133 757 5 gene locus_tag LOCUS_31720 gene prs 757 5 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC63 protein_id gnl|my_center|LOCUS_31720 891 816 gene locus_tag LOCUS_t00240 891 816 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1661 1113 gene locus_tag LOCUS_31730 gene pgpB 1661 1113 CDS product phosphatidylglycerophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208337.1 protein_id gnl|my_center|LOCUS_31730 2812 1736 gene locus_tag LOCUS_31740 gene gtrB 2812 1736 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036173.1 protein_id gnl|my_center|LOCUS_31740 3335 2958 gene locus_tag LOCUS_31750 3335 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 4370 3357 gene locus_tag LOCUS_31760 gene ispB 4370 3357 CDS product octaprenyl-diphosphate synthase IspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073452.1 protein_id gnl|my_center|LOCUS_31760 4664 5209 gene locus_tag LOCUS_31770 gene ssb 4664 5209 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83EP4 protein_id gnl|my_center|LOCUS_31770 5213 6034 gene locus_tag LOCUS_31780 gene rfbB 5213 6034 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C7J0 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31780 6274 7149 gene locus_tag LOCUS_31790 gene rmlA 6274 7149 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C7J4 protein_id gnl|my_center|LOCUS_31790 7146 7694 gene locus_tag LOCUS_31800 gene rmlC 7146 7694 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035866.1 protein_id gnl|my_center|LOCUS_31800 7691 8725 gene locus_tag LOCUS_31810 gene rmlD 7691 8725 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035867.1 protein_id gnl|my_center|LOCUS_31810 8716 9912 gene locus_tag LOCUS_31820 gene pslB 8716 9912 CDS product biofilm formation protein PslB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113717.1 protein_id gnl|my_center|LOCUS_31820 9919 10926 gene locus_tag LOCUS_31830 9919 10926 CDS product PSP operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705753.1 protein_id gnl|my_center|LOCUS_31830 12064 10949 gene locus_tag LOCUS_31840 gene alr 12064 10949 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JRS1 protein_id gnl|my_center|LOCUS_31840 13430 12042 gene locus_tag LOCUS_31850 gene dnaB 13430 12042 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAP5 protein_id gnl|my_center|LOCUS_31850 13893 13441 gene locus_tag LOCUS_31860 gene rplI 13893 13441 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAC0 protein_id gnl|my_center|LOCUS_31860 14882 13977 gene locus_tag LOCUS_31870 14882 13977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095630.1 protein_id gnl|my_center|LOCUS_31870 15164 14940 gene locus_tag LOCUS_31880 gene rpsR 15164 14940 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN0 protein_id gnl|my_center|LOCUS_31880 15592 15182 gene locus_tag LOCUS_31890 15592 15182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 15479 15721 gene locus_tag LOCUS_31900 15479 15721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 >Feature sequence134 430 1011 gene locus_tag LOCUS_31910 430 1011 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478674.1 protein_id gnl|my_center|LOCUS_31910 1067 1240 gene locus_tag LOCUS_31920 1067 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 1369 1644 gene locus_tag LOCUS_31930 1369 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 1731 2813 gene locus_tag LOCUS_31940 1731 2813 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391267.1 protein_id gnl|my_center|LOCUS_31940 2803 3948 gene locus_tag LOCUS_31950 2803 3948 CDS product cardiolipin synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972063.1 protein_id gnl|my_center|LOCUS_31950 4179 4006 gene locus_tag LOCUS_31960 4179 4006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 5426 4368 gene locus_tag LOCUS_31970 5426 4368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 7228 5423 gene locus_tag LOCUS_31980 gene ade 7228 5423 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NQW3 protein_id gnl|my_center|LOCUS_31980 7343 8620 gene locus_tag LOCUS_31990 7343 8620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265931.1 protein_id gnl|my_center|LOCUS_31990 8617 9114 gene locus_tag LOCUS_32000 gene dfrA 8617 9114 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P11045 protein_id gnl|my_center|LOCUS_32000 10000 9308 gene locus_tag LOCUS_32010 gene yjdF 10000 9308 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071153.1 protein_id gnl|my_center|LOCUS_32010 10076 11857 gene locus_tag LOCUS_32020 10076 11857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 13910 12039 gene locus_tag LOCUS_32030 13910 12039 CDS product alkaline serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473082.1 protein_id gnl|my_center|LOCUS_32030 14228 14836 gene locus_tag LOCUS_32040 14228 14836 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF67 protein_id gnl|my_center|LOCUS_32040 >Feature sequence135 243 941 gene locus_tag LOCUS_32050 243 941 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172242.1 protein_id gnl|my_center|LOCUS_32050 938 2275 gene locus_tag LOCUS_32060 gene cpxA 938 2275 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947166.1 protein_id gnl|my_center|LOCUS_32060 3913 2261 gene locus_tag LOCUS_32070 3913 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114085.1 protein_id gnl|my_center|LOCUS_32070 3983 4939 gene locus_tag LOCUS_32080 3983 4939 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083422.1 protein_id gnl|my_center|LOCUS_32080 5794 5108 gene locus_tag LOCUS_32090 5794 5108 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479958.1 protein_id gnl|my_center|LOCUS_32090 5861 6514 gene locus_tag LOCUS_32100 gene gst-2 5861 6514 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197522.1 protein_id gnl|my_center|LOCUS_32100 7582 6590 gene locus_tag LOCUS_32110 7582 6590 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200039.1 protein_id gnl|my_center|LOCUS_32110 7756 8640 gene locus_tag LOCUS_32120 7756 8640 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943748.1 protein_id gnl|my_center|LOCUS_32120 8995 10968 gene locus_tag LOCUS_32130 8995 10968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 11178 11996 gene locus_tag LOCUS_32140 gene legD1 11178 11996 CDS product phytanoyl-CoA dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948394.1 protein_id gnl|my_center|LOCUS_32140 13000 12110 gene locus_tag LOCUS_32150 13000 12110 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089804.1 protein_id gnl|my_center|LOCUS_32150 13817 13173 gene locus_tag LOCUS_32160 gene bioD 13817 13173 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I614 protein_id gnl|my_center|LOCUS_32160 14662 13814 gene locus_tag LOCUS_32170 gene bioC1 14662 13814 CDS product malonyl-[acyl-carrier protein] O-methyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E64 protein_id gnl|my_center|LOCUS_32170 15390 14659 gene locus_tag LOCUS_32180 gene bioH 15390 14659 CDS product pimeloyl-[acyl-carrier protein] methyl ester esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDF3 protein_id gnl|my_center|LOCUS_32180 <15976 15387 gene locus_tag LOCUS_32190 <15976 15387 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0E0Y1R9:8-amino-7-oxononanoate synthase >Feature sequence136 <1 4462 gene locus_tag LOCUS_32200 <1 4462 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098386.1:type I secretion C-terminal target domain-containing protein 4459 14889 gene locus_tag LOCUS_32210 4459 14889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 6429 6515 gene locus_tag LOCUS_t00250 6429 6515 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 14892 15134 gene locus_tag LOCUS_32220 14892 15134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 15225 15479 gene locus_tag LOCUS_32230 15225 15479 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074342.1 protein_id gnl|my_center|LOCUS_32230 15451 15846 gene locus_tag LOCUS_32240 15451 15846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 >Feature sequence137 <1 701 gene locus_tag LOCUS_32250 <1 701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KNI2:acetyl-coenzyme A synthetase 698 970 gene locus_tag LOCUS_32260 698 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458022.1 protein_id gnl|my_center|LOCUS_32260 970 2712 gene locus_tag LOCUS_32270 970 2712 CDS product sodium/solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_232332.2 protein_id gnl|my_center|LOCUS_32270 6130 4088 gene locus_tag LOCUS_32280 6130 4088 CDS product bifunctional aldehyde dehydrogenase/enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889007.1 protein_id gnl|my_center|LOCUS_32280 6755 6141 gene locus_tag LOCUS_32290 6755 6141 CDS product phenylacetic acid degradation protein PaaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705605.1 protein_id gnl|my_center|LOCUS_32290 6849 7652 gene locus_tag LOCUS_32300 6849 7652 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096756.1 protein_id gnl|my_center|LOCUS_32300 7649 8104 gene locus_tag LOCUS_32310 gene paaI 7649 8104 CDS product phenylacetic acid degradation protein PaaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813284.1 protein_id gnl|my_center|LOCUS_32310 8116 9324 gene locus_tag LOCUS_32320 8116 9324 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039581.1 protein_id gnl|my_center|LOCUS_32320 9534 10160 gene locus_tag LOCUS_32330 9534 10160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 10713 10904 gene locus_tag LOCUS_32340 10713 10904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 10898 11575 gene locus_tag LOCUS_32350 10898 11575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 11937 11713 gene locus_tag LOCUS_32360 11937 11713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 12301 12059 gene locus_tag LOCUS_32370 12301 12059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 12932 14974 gene locus_tag LOCUS_32380 12932 14974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 15336 15073 gene locus_tag LOCUS_32390 15336 15073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 >Feature sequence138 451 143 gene locus_tag LOCUS_32400 451 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 2561 456 gene locus_tag LOCUS_32410 2561 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 4665 2635 gene locus_tag LOCUS_32420 4665 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 5894 4674 gene locus_tag LOCUS_32430 5894 4674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 6611 5907 gene locus_tag LOCUS_32440 6611 5907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 6739 7023 gene locus_tag LOCUS_32450 6739 7023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 7645 8265 gene locus_tag LOCUS_32460 7645 8265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 8262 8909 gene locus_tag LOCUS_32470 8262 8909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 9032 11407 gene locus_tag LOCUS_32480 9032 11407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 11404 11949 gene locus_tag LOCUS_32490 11404 11949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 11936 12472 gene locus_tag LOCUS_32500 11936 12472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 12508 14433 gene locus_tag LOCUS_32510 gene pepN 12508 14433 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038579.1 protein_id gnl|my_center|LOCUS_32510 14430 15623 gene locus_tag LOCUS_32520 14430 15623 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706206.1 protein_id gnl|my_center|LOCUS_32520 >Feature sequence139 198 3992 gene locus_tag LOCUS_32530 198 3992 CDS product DUF3971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037738.1 protein_id gnl|my_center|LOCUS_32530 3976 5487 gene locus_tag LOCUS_32540 gene tldD 3976 5487 CDS product TldD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037736.1 protein_id gnl|my_center|LOCUS_32540 5489 6637 gene locus_tag LOCUS_32550 5489 6637 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459665.1 protein_id gnl|my_center|LOCUS_32550 6637 7737 gene locus_tag LOCUS_32560 6637 7737 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582967.1 protein_id gnl|my_center|LOCUS_32560 8095 8811 gene locus_tag LOCUS_32570 8095 8811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389565.1 protein_id gnl|my_center|LOCUS_32570 10095 8887 gene locus_tag LOCUS_32580 10095 8887 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038832.1 protein_id gnl|my_center|LOCUS_32580 10299 10895 gene locus_tag LOCUS_32590 10299 10895 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947974.1 protein_id gnl|my_center|LOCUS_32590 10948 11448 gene locus_tag LOCUS_32600 gene def 10948 11448 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJY9 protein_id gnl|my_center|LOCUS_32600 11451 12362 gene locus_tag LOCUS_32610 gene fmt 11451 12362 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B42 protein_id gnl|my_center|LOCUS_32610 12367 13647 gene locus_tag LOCUS_32620 gene rsmB 12367 13647 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVU5 protein_id gnl|my_center|LOCUS_32620 13644 14207 gene locus_tag LOCUS_32630 13644 14207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 15321 14191 gene locus_tag LOCUS_32640 15321 14191 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804287.1 protein_id gnl|my_center|LOCUS_32640 >Feature sequence140 499 1965 gene locus_tag LOCUS_32650 499 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 1970 3214 gene locus_tag LOCUS_32660 1970 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 5565 4051 gene locus_tag LOCUS_32670 5565 4051 CDS product putative beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW80 protein_id gnl|my_center|LOCUS_32670 5986 5684 gene locus_tag LOCUS_32680 5986 5684 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038260.1 protein_id gnl|my_center|LOCUS_32680 6930 6013 gene locus_tag LOCUS_32690 gene cbpA 6930 6013 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947972.1 protein_id gnl|my_center|LOCUS_32690 7148 7627 gene locus_tag LOCUS_32700 7148 7627 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 protein_id gnl|my_center|LOCUS_32700 8310 7870 gene locus_tag LOCUS_32710 8310 7870 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444695.1 protein_id gnl|my_center|LOCUS_32710 10501 8303 gene locus_tag LOCUS_32720 gene gyrA 10501 8303 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVM3 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32720 10936 10514 gene locus_tag LOCUS_32730 10936 10514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32730 11219 12376 gene locus_tag LOCUS_32740 11219 12376 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088493.1 protein_id gnl|my_center|LOCUS_32740 13206 12664 gene locus_tag LOCUS_32750 13206 12664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 13723 13367 gene locus_tag LOCUS_32760 13723 13367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 14372 13740 gene locus_tag LOCUS_32770 14372 13740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 14795 14448 gene locus_tag LOCUS_32780 14795 14448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 15270 14812 gene locus_tag LOCUS_32790 15270 14812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 >Feature sequence141 2783 87 gene locus_tag LOCUS_32800 2783 87 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072815.1 protein_id gnl|my_center|LOCUS_32800 3286 3786 gene locus_tag LOCUS_32810 3286 3786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 5229 3787 gene locus_tag LOCUS_32820 5229 3787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113004.1 protein_id gnl|my_center|LOCUS_32820 5440 6372 gene locus_tag LOCUS_32830 5440 6372 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244060.1 protein_id gnl|my_center|LOCUS_32830 6516 7190 gene locus_tag LOCUS_32840 6516 7190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 7411 9063 gene locus_tag LOCUS_32850 7411 9063 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225606.1 protein_id gnl|my_center|LOCUS_32850 10168 9050 gene locus_tag LOCUS_32860 10168 9050 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114567.1 protein_id gnl|my_center|LOCUS_32860 10203 11375 gene locus_tag LOCUS_32870 10203 11375 CDS product alkane monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538099.1 protein_id gnl|my_center|LOCUS_32870 11430 11927 gene locus_tag LOCUS_32880 11430 11927 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404452.1 protein_id gnl|my_center|LOCUS_32880 11924 12436 gene locus_tag LOCUS_32890 11924 12436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 12433 12957 gene locus_tag LOCUS_32900 12433 12957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 13180 13407 gene locus_tag LOCUS_32910 gene xseB 13180 13407 CDS product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E63 protein_id gnl|my_center|LOCUS_32910 13394 14287 gene locus_tag LOCUS_32920 gene ispA 13394 14287 CDS product geranyltranstransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114915.1 protein_id gnl|my_center|LOCUS_32920 14287 14571 gene locus_tag LOCUS_32930 14287 14571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 14911 14588 gene locus_tag LOCUS_32940 14911 14588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023310.1 protein_id gnl|my_center|LOCUS_32940 15168 14932 gene locus_tag LOCUS_32950 15168 14932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 >Feature sequence142 1017 712 gene locus_tag LOCUS_32960 1017 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 1340 981 gene locus_tag LOCUS_32970 1340 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 1498 1797 gene locus_tag LOCUS_32980 1498 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 1952 3253 gene locus_tag LOCUS_32990 gene czcC 1952 3253 CDS product outer membrane protein CzcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113317.1 protein_id gnl|my_center|LOCUS_32990 3264 4433 gene locus_tag LOCUS_33000 3264 4433 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942781.1 protein_id gnl|my_center|LOCUS_33000 4446 7547 gene locus_tag LOCUS_33010 gene czcA 4446 7547 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524131.1 protein_id gnl|my_center|LOCUS_33010 7694 7843 gene locus_tag LOCUS_33020 7694 7843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 8057 10534 gene locus_tag LOCUS_33030 8057 10534 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039503.1 protein_id gnl|my_center|LOCUS_33030 10607 10975 gene locus_tag LOCUS_33040 10607 10975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 11067 11720 gene locus_tag LOCUS_33050 11067 11720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 11710 13251 gene locus_tag LOCUS_33060 11710 13251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 13248 14549 gene locus_tag LOCUS_33070 13248 14549 CDS product exported copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538040.1 protein_id gnl|my_center|LOCUS_33070 14585 15091 gene locus_tag LOCUS_33080 14585 15091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 >Feature sequence143 605 183 gene locus_tag LOCUS_33090 gene atpC 605 183 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCZ4 protein_id gnl|my_center|LOCUS_33090 2018 627 gene locus_tag LOCUS_33100 gene atpD 2018 627 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCZ5 protein_id gnl|my_center|LOCUS_33100 2921 2052 gene locus_tag LOCUS_33110 gene atpG 2921 2052 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCZ6 protein_id gnl|my_center|LOCUS_33110 4536 2989 gene locus_tag LOCUS_33120 gene atpA 4536 2989 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCZ7 protein_id gnl|my_center|LOCUS_33120 5195 4665 gene locus_tag LOCUS_33130 gene atpH 5195 4665 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCZ8 protein_id gnl|my_center|LOCUS_33130 5671 5198 gene locus_tag LOCUS_33140 gene atpF 5671 5198 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KA4 protein_id gnl|my_center|LOCUS_33140 5984 5721 gene locus_tag LOCUS_33150 gene atpE 5984 5721 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZR96 protein_id gnl|my_center|LOCUS_33150 6813 6043 gene locus_tag LOCUS_33160 gene atpB 6813 6043 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQY4 protein_id gnl|my_center|LOCUS_33160 7253 6825 gene locus_tag LOCUS_33170 7253 6825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 7578 8639 gene locus_tag LOCUS_33180 7578 8639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 8618 9637 gene locus_tag LOCUS_33190 8618 9637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 10811 9666 gene locus_tag LOCUS_33200 gene hemY 10811 9666 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948436.1 protein_id gnl|my_center|LOCUS_33200 12025 10808 gene locus_tag LOCUS_33210 12025 10808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 12794 12048 gene locus_tag LOCUS_33220 12794 12048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 13702 12791 gene locus_tag LOCUS_33230 gene hemC 13702 12791 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VVU9 protein_id gnl|my_center|LOCUS_33230 14427 13699 gene locus_tag LOCUS_33240 gene algR 14427 13699 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038604.1 protein_id gnl|my_center|LOCUS_33240 <15167 14424 gene locus_tag LOCUS_33250 <15167 14424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007247213.1:alginate O-acetyltransferase >Feature sequence144 1706 405 gene locus_tag LOCUS_33260 1706 405 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222287.1 protein_id gnl|my_center|LOCUS_33260 1773 2537 gene locus_tag LOCUS_33270 1773 2537 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113172.1 protein_id gnl|my_center|LOCUS_33270 3816 2545 gene locus_tag LOCUS_33280 3816 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035976.1 protein_id gnl|my_center|LOCUS_33280 5390 3828 gene locus_tag LOCUS_33290 5390 3828 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766062.1 protein_id gnl|my_center|LOCUS_33290 7660 5387 gene locus_tag LOCUS_33300 7660 5387 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259699.1 protein_id gnl|my_center|LOCUS_33300 8680 7667 gene locus_tag LOCUS_33310 8680 7667 CDS product repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705456.1 protein_id gnl|my_center|LOCUS_33310 10028 8682 gene locus_tag LOCUS_33320 gene bglB 10028 8682 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D8I7 protein_id gnl|my_center|LOCUS_33320 11652 10162 gene locus_tag LOCUS_33330 gene prnA 11652 10162 CDS product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039038.1 protein_id gnl|my_center|LOCUS_33330 12617 11649 gene locus_tag LOCUS_33340 12617 11649 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039037.1 protein_id gnl|my_center|LOCUS_33340 13333 12614 gene locus_tag LOCUS_33350 13333 12614 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039036.1 protein_id gnl|my_center|LOCUS_33350 14913 13330 gene locus_tag LOCUS_33360 14913 13330 CDS product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073349.1 protein_id gnl|my_center|LOCUS_33360 >Feature sequence145 5382 2005 gene locus_tag LOCUS_33370 5382 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 7366 5912 gene locus_tag LOCUS_33380 7366 5912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 7782 8150 gene locus_tag LOCUS_33390 7782 8150 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265654.1 protein_id gnl|my_center|LOCUS_33390 10974 8194 gene locus_tag LOCUS_33400 gene valS 10974 8194 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXL2 protein_id gnl|my_center|LOCUS_33400 12455 10977 gene locus_tag LOCUS_33410 gene pepA 12455 10977 CDS product cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68822 protein_id gnl|my_center|LOCUS_33410 12563 13678 gene locus_tag LOCUS_33420 12563 13678 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035891.1 protein_id gnl|my_center|LOCUS_33420 13675 14754 gene locus_tag LOCUS_33430 13675 14754 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035892.1 protein_id gnl|my_center|LOCUS_33430 >Feature sequence146 403 1680 gene locus_tag LOCUS_33440 403 1680 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118166.1 protein_id gnl|my_center|LOCUS_33440 1751 2764 gene locus_tag LOCUS_33450 1751 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112360.1 protein_id gnl|my_center|LOCUS_33450 3320 2880 gene locus_tag LOCUS_33460 3320 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 3808 3449 gene locus_tag LOCUS_33470 3808 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 4924 3821 gene locus_tag LOCUS_33480 4924 3821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 5799 5140 gene locus_tag LOCUS_33490 5799 5140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 6521 5796 gene locus_tag LOCUS_33500 gene coaX 6521 5796 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC1 protein_id gnl|my_center|LOCUS_33500 7453 6518 gene locus_tag LOCUS_33510 gene birA 7453 6518 CDS product bifunctional ligase/repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E226 protein_id gnl|my_center|LOCUS_33510 8079 7450 gene locus_tag LOCUS_33520 gene plsY 8079 7450 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66905 protein_id gnl|my_center|LOCUS_33520 9917 8076 gene locus_tag LOCUS_33530 9917 8076 CDS product dihydroxyacetone kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939228.1 protein_id gnl|my_center|LOCUS_33530 10011 10256 gene locus_tag LOCUS_33540 10011 10256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 10308 10676 gene locus_tag LOCUS_33550 10308 10676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 12125 10713 gene locus_tag LOCUS_33560 gene radA 12125 10713 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96963 protein_id gnl|my_center|LOCUS_33560 12576 12295 gene locus_tag LOCUS_33570 12576 12295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 12796 14202 gene locus_tag LOCUS_33580 12796 14202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 14440 14742 gene locus_tag LOCUS_33590 14440 14742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 >Feature sequence147 <1 1206 gene locus_tag LOCUS_33600 <1 1206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036463.1:peptidase S1 1216 1641 gene locus_tag LOCUS_33610 1216 1641 CDS product TIGR00701 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113170.1 protein_id gnl|my_center|LOCUS_33610 3396 1669 gene locus_tag LOCUS_33620 3396 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 3545 6733 gene locus_tag LOCUS_33630 3545 6733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_33630 6730 8208 gene locus_tag LOCUS_33640 6730 8208 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920331.1 protein_id gnl|my_center|LOCUS_33640 9489 8182 gene locus_tag LOCUS_33650 9489 8182 CDS product putative amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705460.1 protein_id gnl|my_center|LOCUS_33650 9608 10879 gene locus_tag LOCUS_33660 gene serS 9608 10879 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M6 protein_id gnl|my_center|LOCUS_33660 11410 11009 gene locus_tag LOCUS_33670 11410 11009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 13929 11647 gene locus_tag LOCUS_33680 13929 11647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 14661 14110 gene locus_tag LOCUS_33690 14661 14110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 >Feature sequence148 164 994 gene locus_tag LOCUS_33700 164 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 991 2469 gene locus_tag LOCUS_33710 991 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 3307 2603 gene locus_tag LOCUS_33720 3307 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 4023 3304 gene locus_tag LOCUS_33730 4023 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 4834 4013 gene locus_tag LOCUS_33740 4834 4013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33740 5811 4831 gene locus_tag LOCUS_33750 gene gsiC 5811 4831 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069490.1 protein_id gnl|my_center|LOCUS_33750 7613 5823 gene locus_tag LOCUS_33760 gene oppA 7613 5823 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206613.1 protein_id gnl|my_center|LOCUS_33760 11883 7663 gene locus_tag LOCUS_33770 11883 7663 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258114.1 protein_id gnl|my_center|LOCUS_33770 12137 13501 gene locus_tag LOCUS_33780 gene cysS 12137 13501 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWK2 protein_id gnl|my_center|LOCUS_33780 13498 13917 gene locus_tag LOCUS_33790 13498 13917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037396.1 protein_id gnl|my_center|LOCUS_33790 14003 14305 gene locus_tag LOCUS_33800 14003 14305 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530549.1 protein_id gnl|my_center|LOCUS_33800 >Feature sequence149 <1 3498 gene locus_tag LOCUS_33810 <1 3498 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064383.1:type I secretion C-terminal target domain-containing protein 3595 4113 gene locus_tag LOCUS_33820 3595 4113 CDS product tail Collar domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528764.1 protein_id gnl|my_center|LOCUS_33820 4129 4647 gene locus_tag LOCUS_33830 4129 4647 CDS product microcystin dependent MdpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070581.1 protein_id gnl|my_center|LOCUS_33830 4659 5186 gene locus_tag LOCUS_33840 4659 5186 CDS product tail Collar domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528766.1 protein_id gnl|my_center|LOCUS_33840 5210 5755 gene locus_tag LOCUS_33850 5210 5755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 5767 6903 gene locus_tag LOCUS_33860 5767 6903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 6896 7195 gene locus_tag LOCUS_33870 6896 7195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 7192 7671 gene locus_tag LOCUS_33880 7192 7671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 8612 7686 gene locus_tag LOCUS_33890 8612 7686 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705985.1 protein_id gnl|my_center|LOCUS_33890 9459 8659 gene locus_tag LOCUS_33900 gene proC 9459 8659 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2A0 protein_id gnl|my_center|LOCUS_33900 11480 9456 gene locus_tag LOCUS_33910 gene ligA 11480 9456 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3L1 protein_id gnl|my_center|LOCUS_33910 12148 11480 gene locus_tag LOCUS_33920 gene zipA 12148 11480 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAB7 protein_id gnl|my_center|LOCUS_33920 <14667 12171 gene locus_tag LOCUS_33930 <14667 12171 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8PAB8:chromosome partition protein Smc >Feature sequence150 1501 3030 gene locus_tag LOCUS_33940 1501 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 3192 3545 gene locus_tag LOCUS_33950 3192 3545 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7V8 protein_id gnl|my_center|LOCUS_33950 4245 3553 gene locus_tag LOCUS_33960 4245 3553 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073517.1 protein_id gnl|my_center|LOCUS_33960 5930 4242 gene locus_tag LOCUS_33970 5930 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 6525 6016 gene locus_tag LOCUS_33980 6525 6016 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035509.1 protein_id gnl|my_center|LOCUS_33980 6659 6931 gene locus_tag LOCUS_33990 6659 6931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 7003 7803 gene locus_tag LOCUS_34000 7003 7803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 10791 8005 gene locus_tag LOCUS_34010 10791 8005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 11726 11010 gene locus_tag LOCUS_34020 11726 11010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 11903 13117 gene locus_tag LOCUS_34030 11903 13117 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706126.1 protein_id gnl|my_center|LOCUS_34030 <14594 13277 gene locus_tag LOCUS_34040 <14594 13277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H2V132:GTPase Der >Feature sequence151 <1 981 gene locus_tag LOCUS_34050 <1 981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_769363.2:indolepyruvate ferredoxin oxidoreductase 1725 1087 gene locus_tag LOCUS_34060 1725 1087 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092468.1 protein_id gnl|my_center|LOCUS_34060 1958 1803 gene locus_tag LOCUS_34070 1958 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 1924 2991 gene locus_tag LOCUS_34080 1924 2991 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073161.1 protein_id gnl|my_center|LOCUS_34080 2988 6149 gene locus_tag LOCUS_34090 2988 6149 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073162.1 protein_id gnl|my_center|LOCUS_34090 6953 6156 gene locus_tag LOCUS_34100 6953 6156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 8544 7219 gene locus_tag LOCUS_34110 gene kdtA 8544 7219 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038436.1 protein_id gnl|my_center|LOCUS_34110 9945 8584 gene locus_tag LOCUS_34120 gene gcvPA 9945 8584 CDS product putative glycine dehydrogenase (decarboxylating) subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZ95 protein_id gnl|my_center|LOCUS_34120 10334 9945 gene locus_tag LOCUS_34130 gene gcvH 10334 9945 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6T9 protein_id gnl|my_center|LOCUS_34130 11490 10450 gene locus_tag LOCUS_34140 gene gcvT 11490 10450 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6T8 protein_id gnl|my_center|LOCUS_34140 12772 11630 gene locus_tag LOCUS_34150 12772 11630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 13520 12900 gene locus_tag LOCUS_34160 13520 12900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 >Feature sequence152 1094 174 gene locus_tag LOCUS_34170 1094 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 1038 1268 gene locus_tag LOCUS_34180 1038 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 3109 2633 gene locus_tag LOCUS_34190 3109 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 3967 6597 gene locus_tag LOCUS_34200 3967 6597 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090817.1 protein_id gnl|my_center|LOCUS_34200 6687 8762 gene locus_tag LOCUS_34210 6687 8762 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123230.1 protein_id gnl|my_center|LOCUS_34210 9002 10069 gene locus_tag LOCUS_34220 gene hsdS 9002 10069 CDS product specificity protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968693.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34220 10085 13333 gene locus_tag LOCUS_34230 gene hsdR 10085 13333 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968692.1 protein_id gnl|my_center|LOCUS_34230 13626 13961 gene locus_tag LOCUS_34240 13626 13961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 14223 13981 gene locus_tag LOCUS_34250 14223 13981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 >Feature sequence153 121 1320 gene locus_tag LOCUS_34260 121 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 1367 2578 gene locus_tag LOCUS_34270 1367 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 2638 4425 gene locus_tag LOCUS_34280 2638 4425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 6713 4671 gene locus_tag LOCUS_34290 gene susB 6713 4671 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072426.1 protein_id gnl|my_center|LOCUS_34290 8545 6710 gene locus_tag LOCUS_34300 gene susA 8545 6710 CDS product neopullulanase SusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1G0 protein_id gnl|my_center|LOCUS_34300 8741 11497 gene locus_tag LOCUS_34310 gene malA 8741 11497 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920148.1 protein_id gnl|my_center|LOCUS_34310 11647 13167 gene locus_tag LOCUS_34320 11647 13167 CDS product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920149.1 protein_id gnl|my_center|LOCUS_34320 13542 13958 gene locus_tag LOCUS_34330 13542 13958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 14073 14351 gene locus_tag LOCUS_34340 14073 14351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 >Feature sequence154 1681 341 gene locus_tag LOCUS_34350 1681 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 2758 1703 gene locus_tag LOCUS_34360 2758 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 4671 2827 gene locus_tag LOCUS_34370 4671 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 6583 4709 gene locus_tag LOCUS_34380 6583 4709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 7017 6580 gene locus_tag LOCUS_34390 7017 6580 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229349.1 protein_id gnl|my_center|LOCUS_34390 9328 6995 gene locus_tag LOCUS_34400 9328 6995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 10074 9739 gene locus_tag LOCUS_34410 10074 9739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 12170 10077 gene locus_tag LOCUS_34420 12170 10077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 >Feature sequence155 1469 1116 gene locus_tag LOCUS_34430 1469 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 1642 1923 gene locus_tag LOCUS_34440 1642 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 4308 1942 gene locus_tag LOCUS_34450 4308 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 4427 5245 gene locus_tag LOCUS_34460 4427 5245 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y832 protein_id gnl|my_center|LOCUS_34460 6084 5656 gene locus_tag LOCUS_34470 gene ohr 6084 5656 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104171.1 protein_id gnl|my_center|LOCUS_34470 6224 7735 gene locus_tag LOCUS_34480 gene ggt 6224 7735 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142355.1 protein_id gnl|my_center|LOCUS_34480 7732 8760 gene locus_tag LOCUS_34490 7732 8760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404145.1 protein_id gnl|my_center|LOCUS_34490 11942 8817 gene locus_tag LOCUS_34500 11942 8817 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_34500 12595 11942 gene locus_tag LOCUS_34510 12595 11942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 12527 12904 gene locus_tag LOCUS_34520 12527 12904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 13791 13072 gene locus_tag LOCUS_34530 13791 13072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704659.1 protein_id gnl|my_center|LOCUS_34530 <14336 13811 gene locus_tag LOCUS_34540 <14336 13811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EIK2:beta-lactamase >Feature sequence156 37 943 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcttcaatgaggccgaggccgaagcctcggaataac 1438 1145 gene locus_tag LOCUS_34550 gene cas2-1 1438 1145 CDS product CRISPR-associated endoribonuclease Cas2 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY12 protein_id gnl|my_center|LOCUS_34550 3123 1435 gene locus_tag LOCUS_34560 gene cas4-cas1 3123 1435 CDS product CRISPR-associated exonuclease Cas4/endonuclease Cas1 fusion inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H36 protein_id gnl|my_center|LOCUS_34560 4621 3143 gene locus_tag LOCUS_34570 4621 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 5545 4625 gene locus_tag LOCUS_34580 5545 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 5974 5564 gene locus_tag LOCUS_34590 5974 5564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 8489 7980 gene locus_tag LOCUS_34600 8489 7980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545294.1 protein_id gnl|my_center|LOCUS_34600 10855 8492 gene locus_tag LOCUS_34610 10855 8492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 11194 11673 gene locus_tag LOCUS_34620 11194 11673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480550.1 protein_id gnl|my_center|LOCUS_34620 12090 12166 gene locus_tag LOCUS_t00260 12090 12166 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 13125 12610 gene locus_tag LOCUS_34630 13125 12610 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J441 protein_id gnl|my_center|LOCUS_34630 13225 13674 gene locus_tag LOCUS_34640 13225 13674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 >Feature sequence157 132 1706 gene locus_tag LOCUS_34650 132 1706 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530022.1 protein_id gnl|my_center|LOCUS_34650 2164 1802 gene locus_tag LOCUS_34660 2164 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 2577 2161 gene locus_tag LOCUS_34670 2577 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 3032 2589 gene locus_tag LOCUS_34680 3032 2589 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479368.1 protein_id gnl|my_center|LOCUS_34680 3900 3016 gene locus_tag LOCUS_34690 3900 3016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 protein_id gnl|my_center|LOCUS_34690 4103 3915 gene locus_tag LOCUS_34700 4103 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 4039 4323 gene locus_tag LOCUS_34710 gene hlyU 4039 4323 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261241.1 protein_id gnl|my_center|LOCUS_34710 4504 5598 gene locus_tag LOCUS_34720 4504 5598 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481721.1 protein_id gnl|my_center|LOCUS_34720 5591 6376 gene locus_tag LOCUS_34730 gene algR 5591 6376 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038759.1 protein_id gnl|my_center|LOCUS_34730 6489 6911 gene locus_tag LOCUS_34740 6489 6911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 6938 7732 gene locus_tag LOCUS_34750 6938 7732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918522.1 protein_id gnl|my_center|LOCUS_34750 10315 7946 gene locus_tag LOCUS_34760 10315 7946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 >Feature sequence158 1513 2724 gene locus_tag LOCUS_34770 gene carA 1513 2724 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38098 protein_id gnl|my_center|LOCUS_34770 2798 3379 gene locus_tag LOCUS_34780 2798 3379 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423733.1 protein_id gnl|my_center|LOCUS_34780 3381 3812 gene locus_tag LOCUS_34790 3381 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 3809 5242 gene locus_tag LOCUS_34800 gene dur3 3809 5242 CDS product urea transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124139.1 protein_id gnl|my_center|LOCUS_34800 5242 5364 gene locus_tag LOCUS_34810 5242 5364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 5358 6446 gene locus_tag LOCUS_34820 gene pyrB 5358 6446 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329097.1 protein_id gnl|my_center|LOCUS_34820 6532 8445 gene locus_tag LOCUS_34830 gene asnB 6532 8445 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124141.1 protein_id gnl|my_center|LOCUS_34830 8442 9710 gene locus_tag LOCUS_34840 gene amaB 8442 9710 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124142.1 protein_id gnl|my_center|LOCUS_34840 9707 10492 gene locus_tag LOCUS_34850 9707 10492 CDS product N-carbamoylsarcosine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333956.1 protein_id gnl|my_center|LOCUS_34850 10602 13823 gene locus_tag LOCUS_34860 gene carB 10602 13823 CDS product carbamoyl-phosphate synthase large chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58943 protein_id gnl|my_center|LOCUS_34860 >Feature sequence159 715 9228 gene locus_tag LOCUS_34870 715 9228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 9283 13596 gene locus_tag LOCUS_34880 9283 13596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 13601 13831 gene locus_tag LOCUS_34890 13601 13831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 >Feature sequence160 3491 1293 gene locus_tag LOCUS_34900 3491 1293 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266377.1 protein_id gnl|my_center|LOCUS_34900 4103 3558 gene locus_tag LOCUS_34910 gene pilP 4103 3558 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038332.1 protein_id gnl|my_center|LOCUS_34910 4705 4100 gene locus_tag LOCUS_34920 gene pilO 4705 4100 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038333.1 protein_id gnl|my_center|LOCUS_34920 5277 4702 gene locus_tag LOCUS_34930 gene pilN 5277 4702 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038334.1 protein_id gnl|my_center|LOCUS_34930 6335 5277 gene locus_tag LOCUS_34940 gene pilM 6335 5277 CDS product fimbrial assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038335.1 protein_id gnl|my_center|LOCUS_34940 6782 9058 gene locus_tag LOCUS_34950 gene mrcA 6782 9058 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q07806 protein_id gnl|my_center|LOCUS_34950 9036 9659 gene locus_tag LOCUS_34960 9036 9659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 9915 9661 gene locus_tag LOCUS_34970 9915 9661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 9983 10963 gene locus_tag LOCUS_34980 9983 10963 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 protein_id gnl|my_center|LOCUS_34980 12261 10903 gene locus_tag LOCUS_34990 12261 10903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 13235 12258 gene locus_tag LOCUS_35000 13235 12258 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038601.1 protein_id gnl|my_center|LOCUS_35000 13308 13853 gene locus_tag LOCUS_35010 13308 13853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 >Feature sequence161 479 3055 gene locus_tag LOCUS_35020 479 3055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 3102 3572 gene locus_tag LOCUS_35030 3102 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385570.1 protein_id gnl|my_center|LOCUS_35030 4073 3582 gene locus_tag LOCUS_35040 4073 3582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 5479 4070 gene locus_tag LOCUS_35050 5479 4070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 6791 5871 gene locus_tag LOCUS_35060 6791 5871 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090893.1 protein_id gnl|my_center|LOCUS_35060 7776 6901 gene locus_tag LOCUS_35070 7776 6901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073605.1 protein_id gnl|my_center|LOCUS_35070 8332 7778 gene locus_tag LOCUS_35080 8332 7778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 8888 8325 gene locus_tag LOCUS_35090 gene algU 8888 8325 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036499.1 protein_id gnl|my_center|LOCUS_35090 9872 8946 gene locus_tag LOCUS_35100 9872 8946 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257729.1 protein_id gnl|my_center|LOCUS_35100 11652 9898 gene locus_tag LOCUS_35110 gene pckG 11652 9898 CDS product phosphoenolpyruvate carboxykinase [GTP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Y3 protein_id gnl|my_center|LOCUS_35110 11857 11570 gene locus_tag LOCUS_35120 11857 11570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 11844 12548 gene locus_tag LOCUS_35130 gene pyrF 11844 12548 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3D7 protein_id gnl|my_center|LOCUS_35130 12545 13651 gene locus_tag LOCUS_35140 12545 13651 CDS product ring-hydroxylating oxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704973.1 protein_id gnl|my_center|LOCUS_35140 >Feature sequence162 4368 1408 gene locus_tag LOCUS_35150 4368 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636891.2 protein_id gnl|my_center|LOCUS_35150 6370 4430 gene locus_tag LOCUS_35160 6370 4430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 8190 6367 gene locus_tag LOCUS_35170 8190 6367 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_35170 9746 8187 gene locus_tag LOCUS_35180 9746 8187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 9950 11686 gene locus_tag LOCUS_35190 9950 11686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 >Feature sequence163 361 1344 gene locus_tag LOCUS_35200 361 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267343.1 protein_id gnl|my_center|LOCUS_35200 1344 5696 gene locus_tag LOCUS_35210 1344 5696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 5710 8967 gene locus_tag LOCUS_35220 5710 8967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35220 8964 12065 gene locus_tag LOCUS_35230 8964 12065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35230 >Feature sequence164 288 1445 gene locus_tag LOCUS_35240 288 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 2352 1621 gene locus_tag LOCUS_35250 2352 1621 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459933.1 protein_id gnl|my_center|LOCUS_35250 2771 3076 gene locus_tag LOCUS_35260 2771 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 3122 3550 gene locus_tag LOCUS_35270 3122 3550 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809130.1 protein_id gnl|my_center|LOCUS_35270 3611 4042 gene locus_tag LOCUS_35280 3611 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 4576 4082 gene locus_tag LOCUS_35290 4576 4082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 4724 5212 gene locus_tag LOCUS_35300 4724 5212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 5212 5892 gene locus_tag LOCUS_35310 5212 5892 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086801.1 protein_id gnl|my_center|LOCUS_35310 5997 6908 gene locus_tag LOCUS_35320 5997 6908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 7002 9581 gene locus_tag LOCUS_35330 gene ape1 7002 9581 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207265.1 protein_id gnl|my_center|LOCUS_35330 9787 10350 gene locus_tag LOCUS_35340 9787 10350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 10424 11359 gene locus_tag LOCUS_35350 10424 11359 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103243.1 protein_id gnl|my_center|LOCUS_35350 >Feature sequence165 1 792 gene locus_tag LOCUS_35360 1 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 874 1464 gene locus_tag LOCUS_35370 874 1464 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KT91 protein_id gnl|my_center|LOCUS_35370 1461 2105 gene locus_tag LOCUS_35380 gene nth 1461 2105 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB4 protein_id gnl|my_center|LOCUS_35380 3236 2115 gene locus_tag LOCUS_35390 gene tgt 3236 2115 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECM3 protein_id gnl|my_center|LOCUS_35390 4273 3233 gene locus_tag LOCUS_35400 gene queA 4273 3233 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXH8 protein_id gnl|my_center|LOCUS_35400 4349 5515 gene locus_tag LOCUS_35410 4349 5515 CDS product sodium:hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947236.1 protein_id gnl|my_center|LOCUS_35410 7097 5637 gene locus_tag LOCUS_35420 gene dniR 7097 5637 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037687.1 protein_id gnl|my_center|LOCUS_35420 8328 7174 gene locus_tag LOCUS_35430 8328 7174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 8511 8825 gene locus_tag LOCUS_35440 8511 8825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 10150 9410 gene locus_tag LOCUS_35450 gene trmJ 10150 9410 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CI4 protein_id gnl|my_center|LOCUS_35450 10149 11045 gene locus_tag LOCUS_35460 gene suhB 10149 11045 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958026.1 protein_id gnl|my_center|LOCUS_35460 11045 11533 gene locus_tag LOCUS_35470 gene aspG 11045 11533 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036092.1 protein_id gnl|my_center|LOCUS_35470 11626 11934 gene locus_tag LOCUS_35480 11626 11934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 12192 13262 gene locus_tag LOCUS_35490 gene pdhA 12192 13262 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035683.1 protein_id gnl|my_center|LOCUS_35490 >Feature sequence166 <1 897 gene locus_tag LOCUS_35500 <1 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103691.1:GGDEF domain-containing protein 894 2717 gene locus_tag LOCUS_35510 894 2717 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903944.1 protein_id gnl|my_center|LOCUS_35510 2766 4148 gene locus_tag LOCUS_35520 2766 4148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 4392 4129 gene locus_tag LOCUS_35530 4392 4129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 6109 4460 gene locus_tag LOCUS_35540 6109 4460 CDS product iron(III) ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057549.1 protein_id gnl|my_center|LOCUS_35540 6556 6290 gene locus_tag LOCUS_35550 6556 6290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 6443 7183 gene locus_tag LOCUS_35560 6443 7183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 7597 7187 gene locus_tag LOCUS_35570 gene glbN 7597 7187 CDS product cyanoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037664.1 protein_id gnl|my_center|LOCUS_35570 8454 7600 gene locus_tag LOCUS_35580 8454 7600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037665.1 protein_id gnl|my_center|LOCUS_35580 9483 8485 gene locus_tag LOCUS_35590 9483 8485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 9641 11536 gene locus_tag LOCUS_35600 gene mnmG 9641 11536 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDG1 protein_id gnl|my_center|LOCUS_35600 12547 11549 gene locus_tag LOCUS_35610 12547 11549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 <13468 12552 gene locus_tag LOCUS_35620 <13468 12552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KFC8:2,3-bisphosphoglycerate-dependent phosphoglycerate mutase >Feature sequence167 671 384 gene locus_tag LOCUS_35630 671 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 2561 678 gene locus_tag LOCUS_35640 gene speA 2561 678 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P448 protein_id gnl|my_center|LOCUS_35640 3492 2551 gene locus_tag LOCUS_35650 3492 2551 CDS product isoaspartyl peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030503.1 protein_id gnl|my_center|LOCUS_35650 4868 3489 gene locus_tag LOCUS_35660 gene pmbA 4868 3489 CDS product PmbA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037734.1 protein_id gnl|my_center|LOCUS_35660 5185 4865 gene locus_tag LOCUS_35670 5185 4865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 5081 5404 gene locus_tag LOCUS_35680 5081 5404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 5545 6246 gene locus_tag LOCUS_35690 5545 6246 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123273.1 protein_id gnl|my_center|LOCUS_35690 6243 7211 gene locus_tag LOCUS_35700 6243 7211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112783.1 protein_id gnl|my_center|LOCUS_35700 7198 8658 gene locus_tag LOCUS_35710 7198 8658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112782.1 protein_id gnl|my_center|LOCUS_35710 8658 9827 gene locus_tag LOCUS_35720 8658 9827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 9841 10815 gene locus_tag LOCUS_35730 9841 10815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112780.1 protein_id gnl|my_center|LOCUS_35730 10812 12116 gene locus_tag LOCUS_35740 10812 12116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112779.1 protein_id gnl|my_center|LOCUS_35740 12113 12790 gene locus_tag LOCUS_35750 12113 12790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 12860 13186 gene locus_tag LOCUS_35760 12860 13186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035277.1 protein_id gnl|my_center|LOCUS_35760 >Feature sequence168 281 919 gene locus_tag LOCUS_35770 gene lexA 281 919 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRA7 protein_id gnl|my_center|LOCUS_35770 1043 4210 gene locus_tag LOCUS_35780 1043 4210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 4793 4212 gene locus_tag LOCUS_35790 gene orn 4793 4212 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMS7 protein_id gnl|my_center|LOCUS_35790 5976 5308 gene locus_tag LOCUS_35800 5976 5308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 6682 6140 gene locus_tag LOCUS_35810 6682 6140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 7168 6746 gene locus_tag LOCUS_35820 7168 6746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 7262 8725 gene locus_tag LOCUS_35830 gene mltF 7262 8725 CDS product membrane-bound lytic murein transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886W7 protein_id gnl|my_center|LOCUS_35830 8894 9604 gene locus_tag LOCUS_35840 8894 9604 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036194.1 protein_id gnl|my_center|LOCUS_35840 9625 10332 gene locus_tag LOCUS_35850 9625 10332 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036194.1 protein_id gnl|my_center|LOCUS_35850 10398 13220 gene locus_tag LOCUS_35860 gene uvrA 10398 13220 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBH3 protein_id gnl|my_center|LOCUS_35860 >Feature sequence169 426 1028 gene locus_tag LOCUS_35870 426 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 1126 1695 gene locus_tag LOCUS_35880 1126 1695 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_35880 1697 4435 gene locus_tag LOCUS_35890 1697 4435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 4845 6005 gene locus_tag LOCUS_35900 4845 6005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 6710 7591 gene locus_tag LOCUS_35910 6710 7591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 9532 8153 gene locus_tag LOCUS_35920 9532 8153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 10251 9529 gene locus_tag LOCUS_35930 10251 9529 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970997.1 protein_id gnl|my_center|LOCUS_35930 10412 11410 gene locus_tag LOCUS_35940 10412 11410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 11724 11473 gene locus_tag LOCUS_35950 11724 11473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 11714 12463 gene locus_tag LOCUS_35960 11714 12463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 12818 13195 gene locus_tag LOCUS_35970 12818 13195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 >Feature sequence170 1837 1418 gene locus_tag LOCUS_35980 1837 1418 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947347.1 protein_id gnl|my_center|LOCUS_35980 1950 2486 gene locus_tag LOCUS_35990 1950 2486 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073611.1 protein_id gnl|my_center|LOCUS_35990 4544 2496 gene locus_tag LOCUS_36000 4544 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 5183 4566 gene locus_tag LOCUS_36010 gene gst-2 5183 4566 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197522.1 protein_id gnl|my_center|LOCUS_36010 5971 5405 gene locus_tag LOCUS_36020 5971 5405 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974638.1 protein_id gnl|my_center|LOCUS_36020 7135 6059 gene locus_tag LOCUS_36030 7135 6059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403058.1 protein_id gnl|my_center|LOCUS_36030 9015 7132 gene locus_tag LOCUS_36040 9015 7132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 10582 9002 gene locus_tag LOCUS_36050 10582 9002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868303.1 protein_id gnl|my_center|LOCUS_36050 10696 11334 gene locus_tag LOCUS_36060 gene rsmG 10696 11334 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT10 protein_id gnl|my_center|LOCUS_36060 11313 12095 gene locus_tag LOCUS_36070 11313 12095 CDS product cobyric acid synthase CobQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707916.1 protein_id gnl|my_center|LOCUS_36070 12095 12964 gene locus_tag LOCUS_36080 12095 12964 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377885.1 protein_id gnl|my_center|LOCUS_36080 >Feature sequence171 773 123 gene locus_tag LOCUS_36090 773 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 827 1783 gene locus_tag LOCUS_36100 gene prmB 827 1783 CDS product 50S ribosomal protein L3 glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I347 protein_id gnl|my_center|LOCUS_36100 1773 2873 gene locus_tag LOCUS_36110 gene aroC 1773 2873 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7R0 protein_id gnl|my_center|LOCUS_36110 2870 3892 gene locus_tag LOCUS_36120 gene asd 2870 3892 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7R2 protein_id gnl|my_center|LOCUS_36120 4126 6933 gene locus_tag LOCUS_36130 4126 6933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 7036 7827 gene locus_tag LOCUS_36140 gene truA 7036 7827 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7R5 protein_id gnl|my_center|LOCUS_36140 7894 8493 gene locus_tag LOCUS_36150 gene trpF 7894 8493 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7R6 protein_id gnl|my_center|LOCUS_36150 8471 9700 gene locus_tag LOCUS_36160 gene trpB 8471 9700 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7R8 protein_id gnl|my_center|LOCUS_36160 9697 10491 gene locus_tag LOCUS_36170 gene trpA 9697 10491 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7S0 protein_id gnl|my_center|LOCUS_36170 10526 11428 gene locus_tag LOCUS_36180 gene accD 10526 11428 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZA7 protein_id gnl|my_center|LOCUS_36180 11428 12690 gene locus_tag LOCUS_36190 11428 12690 CDS product bifunctional protein FolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CMT7 protein_id gnl|my_center|LOCUS_36190 >Feature sequence172 1917 1267 gene locus_tag LOCUS_36200 1917 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709565.1 protein_id gnl|my_center|LOCUS_36200 2060 3058 gene locus_tag LOCUS_36210 2060 3058 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930763.1 protein_id gnl|my_center|LOCUS_36210 3580 5742 gene locus_tag LOCUS_36220 3580 5742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 7314 6097 gene locus_tag LOCUS_36230 7314 6097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 8179 10521 gene locus_tag LOCUS_36240 8179 10521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 12336 11398 gene locus_tag LOCUS_36250 12336 11398 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436783.1 protein_id gnl|my_center|LOCUS_36250 >Feature sequence173 1240 455 gene locus_tag LOCUS_36260 1240 455 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVM0 protein_id gnl|my_center|LOCUS_36260 4148 1287 gene locus_tag LOCUS_36270 4148 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 5456 4347 gene locus_tag LOCUS_36280 5456 4347 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222356.1 protein_id gnl|my_center|LOCUS_36280 5851 5546 gene locus_tag LOCUS_36290 5851 5546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114819.1 protein_id gnl|my_center|LOCUS_36290 6997 5957 gene locus_tag LOCUS_36300 6997 5957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 7260 8201 gene locus_tag LOCUS_36310 7260 8201 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_36310 8198 8938 gene locus_tag LOCUS_36320 8198 8938 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_36320 8940 10829 gene locus_tag LOCUS_36330 8940 10829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092447.1 protein_id gnl|my_center|LOCUS_36330 10832 11962 gene locus_tag LOCUS_36340 10832 11962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 12510 12148 gene locus_tag LOCUS_36350 12510 12148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 >Feature sequence174 64 249 gene locus_tag LOCUS_36360 64 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 1472 522 gene locus_tag LOCUS_36370 1472 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970816.1 protein_id gnl|my_center|LOCUS_36370 2928 6632 gene locus_tag LOCUS_36380 2928 6632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 7328 6978 gene locus_tag LOCUS_36390 7328 6978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 7580 7329 gene locus_tag LOCUS_36400 7580 7329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174908.1 protein_id gnl|my_center|LOCUS_36400 7862 7608 gene locus_tag LOCUS_36410 7862 7608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55482 protein_id gnl|my_center|LOCUS_36410 9226 7946 gene locus_tag LOCUS_36420 9226 7946 CDS product phosphatidylinositol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533388.1 protein_id gnl|my_center|LOCUS_36420 9548 9216 gene locus_tag LOCUS_36430 9548 9216 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943034.1 protein_id gnl|my_center|LOCUS_36430 10560 10844 gene locus_tag LOCUS_36440 10560 10844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 12093 11173 gene locus_tag LOCUS_36450 12093 11173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 >Feature sequence175 456 381 gene locus_tag LOCUS_t00270 456 381 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 592 519 gene locus_tag LOCUS_t00280 592 519 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 742 657 gene locus_tag LOCUS_t00290 742 657 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 3165 907 gene locus_tag LOCUS_36460 gene parC 3165 907 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUK1 protein_id gnl|my_center|LOCUS_36460 4011 3211 gene locus_tag LOCUS_36470 4011 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 4106 5038 gene locus_tag LOCUS_36480 gene rbsK 4106 5038 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UU55 protein_id gnl|my_center|LOCUS_36480 5786 5277 gene locus_tag LOCUS_36490 5786 5277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879396.1 protein_id gnl|my_center|LOCUS_36490 6168 5833 gene locus_tag LOCUS_36500 6168 5833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 7205 6519 gene locus_tag LOCUS_36510 gene dnaA-2 7205 6519 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706621.1 protein_id gnl|my_center|LOCUS_36510 8335 7202 gene locus_tag LOCUS_36520 8335 7202 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616381.1 protein_id gnl|my_center|LOCUS_36520 8874 8299 gene locus_tag LOCUS_36530 8874 8299 CDS product phosphatidylglycerophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948488.1 protein_id gnl|my_center|LOCUS_36530 9923 8889 gene locus_tag LOCUS_36540 9923 8889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 10117 11154 gene locus_tag LOCUS_36550 gene purM 10117 11154 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P725 protein_id gnl|my_center|LOCUS_36550 11154 11780 gene locus_tag LOCUS_36560 gene purN 11154 11780 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83K50 protein_id gnl|my_center|LOCUS_36560 11777 12478 gene locus_tag LOCUS_36570 11777 12478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 >Feature sequence176 250 696 gene locus_tag LOCUS_36580 250 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 885 1796 gene locus_tag LOCUS_36590 885 1796 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490846.1 protein_id gnl|my_center|LOCUS_36590 2439 1807 gene locus_tag LOCUS_36600 2439 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 3096 2893 gene locus_tag LOCUS_36610 3096 2893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 4581 3232 gene locus_tag LOCUS_36620 4581 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 7063 4703 gene locus_tag LOCUS_36630 7063 4703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 7366 7139 gene locus_tag LOCUS_36640 7366 7139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 7915 7547 gene locus_tag LOCUS_36650 7915 7547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 8951 8160 gene locus_tag LOCUS_36660 8951 8160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404272.1 protein_id gnl|my_center|LOCUS_36660 9565 8954 gene locus_tag LOCUS_36670 9565 8954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 10425 9727 gene locus_tag LOCUS_36680 10425 9727 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225375.1 protein_id gnl|my_center|LOCUS_36680 10808 11350 gene locus_tag LOCUS_36690 10808 11350 CDS product RNA polymerase subunit sigma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813613.1 protein_id gnl|my_center|LOCUS_36690 11347 11745 gene locus_tag LOCUS_36700 11347 11745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 >Feature sequence177 1751 3109 gene locus_tag LOCUS_36710 gene purB 1751 3109 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAJ1 protein_id gnl|my_center|LOCUS_36710 3106 4212 gene locus_tag LOCUS_36720 3106 4212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 4995 4246 gene locus_tag LOCUS_36730 4995 4246 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265940.1 protein_id gnl|my_center|LOCUS_36730 5931 5071 gene locus_tag LOCUS_36740 gene rpfD 5931 5071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037021.1 protein_id gnl|my_center|LOCUS_36740 6140 5928 gene locus_tag LOCUS_36750 6140 5928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 6036 7265 gene locus_tag LOCUS_36760 6036 7265 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087109.1 protein_id gnl|my_center|LOCUS_36760 7969 7517 gene locus_tag LOCUS_36770 7969 7517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 8045 11707 gene locus_tag LOCUS_36780 8045 11707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639423.2 protein_id gnl|my_center|LOCUS_36780 >Feature sequence178 5850 3769 gene locus_tag LOCUS_36790 5850 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 6326 8776 gene locus_tag LOCUS_36800 6326 8776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 10727 8847 gene locus_tag LOCUS_36810 10727 8847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637660.2 protein_id gnl|my_center|LOCUS_36810 11070 10870 gene locus_tag LOCUS_36820 11070 10870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 11222 12340 gene locus_tag LOCUS_36830 gene rnd 11222 12340 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I450 protein_id gnl|my_center|LOCUS_36830 >Feature sequence179 450 1 gene locus_tag LOCUS_36840 450 1 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530143.1 protein_id gnl|my_center|LOCUS_36840 532 891 gene locus_tag LOCUS_36850 gene merT 532 891 CDS product mercuric transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A219 protein_id gnl|my_center|LOCUS_36850 902 1192 gene locus_tag LOCUS_36860 902 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 1617 1399 gene locus_tag LOCUS_36870 1617 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 1804 2652 gene locus_tag LOCUS_36880 1804 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 3740 4138 gene locus_tag LOCUS_36890 3740 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 4135 5094 gene locus_tag LOCUS_36900 4135 5094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 5091 6272 gene locus_tag LOCUS_36910 5091 6272 CDS product cellobiose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947847.1 protein_id gnl|my_center|LOCUS_36910 6269 6622 gene locus_tag LOCUS_36920 6269 6622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 6612 8129 gene locus_tag LOCUS_36930 6612 8129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 8131 11235 gene locus_tag LOCUS_36940 8131 11235 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944011.1 protein_id gnl|my_center|LOCUS_36940 11261 11620 gene locus_tag LOCUS_36950 11261 11620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 11986 11669 gene locus_tag LOCUS_36960 11986 11669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 >Feature sequence180 2056 1445 gene locus_tag LOCUS_36970 2056 1445 CDS product fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121856.1 protein_id gnl|my_center|LOCUS_36970 2210 2701 gene locus_tag LOCUS_36980 2210 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 2921 3379 gene locus_tag LOCUS_36990 2921 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 4272 3421 gene locus_tag LOCUS_37000 4272 3421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 5129 4266 gene locus_tag LOCUS_37010 gene prmA 5129 4266 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FM56 protein_id gnl|my_center|LOCUS_37010 6497 5142 gene locus_tag LOCUS_37020 gene accC 6497 5142 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035764.1 protein_id gnl|my_center|LOCUS_37020 6972 6499 gene locus_tag LOCUS_37030 6972 6499 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946212.1 protein_id gnl|my_center|LOCUS_37030 7412 6975 gene locus_tag LOCUS_37040 gene aroQ 7412 6975 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JRK0 protein_id gnl|my_center|LOCUS_37040 9919 7526 gene locus_tag LOCUS_37050 gene gyrB 9919 7526 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83FD5 protein_id gnl|my_center|LOCUS_37050 11052 9997 gene locus_tag LOCUS_37060 gene recF 11052 9997 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PEH3 protein_id gnl|my_center|LOCUS_37060 12187 11087 gene locus_tag LOCUS_37070 gene dnaN 12187 11087 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PEH4 protein_id gnl|my_center|LOCUS_37070 >Feature sequence181 425 1855 gene locus_tag LOCUS_37080 gene gltD 425 1855 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095829.1 protein_id gnl|my_center|LOCUS_37080 2495 1863 gene locus_tag LOCUS_37090 2495 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 3314 2853 gene locus_tag LOCUS_37100 3314 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 3948 3364 gene locus_tag LOCUS_37110 3948 3364 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066263.1 protein_id gnl|my_center|LOCUS_37110 4103 4687 gene locus_tag LOCUS_37120 gene trpG 4103 4687 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035720.1 protein_id gnl|my_center|LOCUS_37120 4687 5718 gene locus_tag LOCUS_37130 gene trpD 4687 5718 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20574 protein_id gnl|my_center|LOCUS_37130 5711 6508 gene locus_tag LOCUS_37140 gene trpC 5711 6508 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD70 protein_id gnl|my_center|LOCUS_37140 7210 6536 gene locus_tag LOCUS_37150 gene clp 7210 6536 CDS product CRP-like protein Clp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22260 protein_id gnl|my_center|LOCUS_37150 7373 8572 gene locus_tag LOCUS_37160 7373 8572 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919187.1 protein_id gnl|my_center|LOCUS_37160 8584 9717 gene locus_tag LOCUS_37170 8584 9717 CDS product pimeloyl-CoA dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090541.1 protein_id gnl|my_center|LOCUS_37170 9714 11789 gene locus_tag LOCUS_37180 9714 11789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 >Feature sequence182 2757 124 gene locus_tag LOCUS_37190 2757 124 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404296.1 protein_id gnl|my_center|LOCUS_37190 3658 2963 gene locus_tag LOCUS_37200 3658 2963 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265932.1 protein_id gnl|my_center|LOCUS_37200 4017 3655 gene locus_tag LOCUS_37210 4017 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113301.1 protein_id gnl|my_center|LOCUS_37210 4343 4014 gene locus_tag LOCUS_37220 4343 4014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 9887 4437 gene locus_tag LOCUS_37230 9887 4437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 <12129 9980 gene locus_tag LOCUS_37240 <12129 9980 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760378.1:hybrid sensor histidine kinase/response regulator >Feature sequence183 1413 1625 gene locus_tag LOCUS_37250 1413 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 3534 2002 gene locus_tag LOCUS_37260 3534 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 4586 6892 gene locus_tag LOCUS_37270 4586 6892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 8085 6952 gene locus_tag LOCUS_37280 gene wecE 8085 6952 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3ERX1 protein_id gnl|my_center|LOCUS_37280 8409 9359 gene locus_tag LOCUS_37290 8409 9359 CDS product glucosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085896.1 protein_id gnl|my_center|LOCUS_37290 <12109 10164 gene locus_tag LOCUS_37300 <12109 10164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942144.1:membrane protein >Feature sequence184 2089 638 gene locus_tag LOCUS_37310 2089 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 2738 2172 gene locus_tag LOCUS_37320 2738 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 2796 2975 gene locus_tag LOCUS_37330 2796 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 2992 3666 gene locus_tag LOCUS_37340 2992 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102977.1 protein_id gnl|my_center|LOCUS_37340 3644 5518 gene locus_tag LOCUS_37350 3644 5518 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102976.1 protein_id gnl|my_center|LOCUS_37350 5515 6396 gene locus_tag LOCUS_37360 5515 6396 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102975.1 protein_id gnl|my_center|LOCUS_37360 6389 7759 gene locus_tag LOCUS_37370 6389 7759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 8278 9306 gene locus_tag LOCUS_37380 8278 9306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 9553 11175 gene locus_tag LOCUS_37390 9553 11175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 11420 11620 gene locus_tag LOCUS_37400 11420 11620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 11617 11916 gene locus_tag LOCUS_37410 11617 11916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 >Feature sequence185 4921 3914 gene locus_tag LOCUS_37420 4921 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37420 5464 4961 gene locus_tag LOCUS_37430 5464 4961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37430 6528 5461 gene locus_tag LOCUS_37440 gene leuB 6528 5461 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAR7 protein_id gnl|my_center|LOCUS_37440 7103 6525 gene locus_tag LOCUS_37450 gene leuD 7103 6525 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC30 protein_id gnl|my_center|LOCUS_37450 8510 7104 gene locus_tag LOCUS_37460 gene leuC 8510 7104 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC29 protein_id gnl|my_center|LOCUS_37460 9468 8485 gene locus_tag LOCUS_37470 9468 8485 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008807980.1 protein_id gnl|my_center|LOCUS_37470 11032 9461 gene locus_tag LOCUS_37480 gene leuA 11032 9461 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BX2 protein_id gnl|my_center|LOCUS_37480 11292 11029 gene locus_tag LOCUS_37490 11292 11029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 <11993 11289 gene locus_tag LOCUS_37500 <11993 11289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P5L4:acetolactate synthase >Feature sequence186 2 463 gene locus_tag LOCUS_37510 2 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 456 1706 gene locus_tag LOCUS_37520 456 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 1769 2722 gene locus_tag LOCUS_37530 1769 2722 CDS product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036165.1 protein_id gnl|my_center|LOCUS_37530 2719 3282 gene locus_tag LOCUS_37540 gene cvpA 2719 3282 CDS product bacteriocin production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420022.1 protein_id gnl|my_center|LOCUS_37540 3899 3267 gene locus_tag LOCUS_37550 3899 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389679.1 protein_id gnl|my_center|LOCUS_37550 5099 3987 gene locus_tag LOCUS_37560 5099 3987 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108615.1 protein_id gnl|my_center|LOCUS_37560 6236 5175 gene locus_tag LOCUS_37570 6236 5175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 7523 6519 gene locus_tag LOCUS_37580 gene icd 7523 6519 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036181.1 protein_id gnl|my_center|LOCUS_37580 9070 7613 gene locus_tag LOCUS_37590 gene gcvPB 9070 7613 CDS product putative glycine dehydrogenase (decarboxylating) subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZ97 protein_id gnl|my_center|LOCUS_37590 9115 11883 gene locus_tag LOCUS_37600 9115 11883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 >Feature sequence187 4514 4161 gene locus_tag LOCUS_37610 4514 4161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 5846 4659 gene locus_tag LOCUS_37620 gene dinB 5846 4659 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7USY7 protein_id gnl|my_center|LOCUS_37620 5966 8113 gene locus_tag LOCUS_37630 gene lptD 5966 8113 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCE0 protein_id gnl|my_center|LOCUS_37630 8110 9399 gene locus_tag LOCUS_37640 gene surA 8110 9399 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCE1 protein_id gnl|my_center|LOCUS_37640 9420 10358 gene locus_tag LOCUS_37650 gene pdxA1 9420 10358 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58715 protein_id gnl|my_center|LOCUS_37650 10355 11155 gene locus_tag LOCUS_37660 gene rsmA 10355 11155 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCE3 protein_id gnl|my_center|LOCUS_37660 >Feature sequence188 3700 1031 gene locus_tag LOCUS_37670 3700 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 4890 3697 gene locus_tag LOCUS_37680 4890 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918442.1 protein_id gnl|my_center|LOCUS_37680 6904 4880 gene locus_tag LOCUS_37690 6904 4880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 7352 7152 gene locus_tag LOCUS_37700 7352 7152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 9336 7837 gene locus_tag LOCUS_37710 9336 7837 CDS product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918886.1 protein_id gnl|my_center|LOCUS_37710 10217 9351 gene locus_tag LOCUS_37720 10217 9351 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918885.1 protein_id gnl|my_center|LOCUS_37720 11103 10375 gene locus_tag LOCUS_37730 11103 10375 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037952.1 protein_id gnl|my_center|LOCUS_37730 <11908 11197 gene locus_tag LOCUS_37740 <11908 11197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918883.1:TonB-dependent receptor >Feature sequence189 673 221 gene locus_tag LOCUS_37750 673 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 805 1023 gene locus_tag LOCUS_37760 805 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 1711 1088 gene locus_tag LOCUS_37770 1711 1088 CDS product prolyl 4-hydroxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073392.1 protein_id gnl|my_center|LOCUS_37770 2350 1793 gene locus_tag LOCUS_37780 2350 1793 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462001.1 protein_id gnl|my_center|LOCUS_37780 2918 2352 gene locus_tag LOCUS_37790 2918 2352 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112585.1 protein_id gnl|my_center|LOCUS_37790 2995 3498 gene locus_tag LOCUS_37800 2995 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063705.1 protein_id gnl|my_center|LOCUS_37800 3589 5262 gene locus_tag LOCUS_37810 3589 5262 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946440.1 protein_id gnl|my_center|LOCUS_37810 7826 5376 gene locus_tag LOCUS_37820 7826 5376 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921186.1 protein_id gnl|my_center|LOCUS_37820 8622 7876 gene locus_tag LOCUS_37830 8622 7876 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943419.1 protein_id gnl|my_center|LOCUS_37830 9200 8619 gene locus_tag LOCUS_37840 gene tag 9200 8619 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263635.1 protein_id gnl|my_center|LOCUS_37840 10149 9193 gene locus_tag LOCUS_37850 10149 9193 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888022.1 protein_id gnl|my_center|LOCUS_37850 10413 11234 gene locus_tag LOCUS_37860 10413 11234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 >Feature sequence190 2228 192 gene locus_tag LOCUS_37870 2228 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 2422 2826 gene locus_tag LOCUS_37880 2422 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 3057 2839 gene locus_tag LOCUS_37890 3057 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 3452 3015 gene locus_tag LOCUS_37900 3452 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 3888 3433 gene locus_tag LOCUS_37910 3888 3433 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269323.1 protein_id gnl|my_center|LOCUS_37910 4325 3906 gene locus_tag LOCUS_37920 4325 3906 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815126.1 protein_id gnl|my_center|LOCUS_37920 5209 4322 gene locus_tag LOCUS_37930 gene ghrA 5209 4322 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N3I0 protein_id gnl|my_center|LOCUS_37930 6600 5224 gene locus_tag LOCUS_37940 6600 5224 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 protein_id gnl|my_center|LOCUS_37940 7082 6588 gene locus_tag LOCUS_37950 7082 6588 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258193.1 protein_id gnl|my_center|LOCUS_37950 7230 7895 gene locus_tag LOCUS_37960 7230 7895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 7892 8362 gene locus_tag LOCUS_37970 gene rpoE 7892 8362 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224545.1 protein_id gnl|my_center|LOCUS_37970 8693 8346 gene locus_tag LOCUS_37980 8693 8346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 8804 11491 gene locus_tag LOCUS_37990 gene polA 8804 11491 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260947.1 protein_id gnl|my_center|LOCUS_37990 >Feature sequence191 306 216 gene locus_tag LOCUS_t00300 306 216 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 755 1390 gene locus_tag LOCUS_38000 755 1390 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001890391.1 protein_id gnl|my_center|LOCUS_38000 1536 2567 gene locus_tag LOCUS_38010 gene recA 1536 2567 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUJ7 protein_id gnl|my_center|LOCUS_38010 2564 3022 gene locus_tag LOCUS_38020 gene recX 2564 3022 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_095826.2 protein_id gnl|my_center|LOCUS_38020 3009 5645 gene locus_tag LOCUS_38030 gene alaS 3009 5645 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63TF9 protein_id gnl|my_center|LOCUS_38030 6007 6207 gene locus_tag LOCUS_38040 gene csrA 6007 6207 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69078 protein_id gnl|my_center|LOCUS_38040 6438 6528 gene locus_tag LOCUS_t00310 6438 6528 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6609 7172 gene locus_tag LOCUS_38050 6609 7172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 7332 8573 gene locus_tag LOCUS_38060 7332 8573 CDS product heavy metal RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817191.1 protein_id gnl|my_center|LOCUS_38060 8570 9964 gene locus_tag LOCUS_38070 8570 9964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 >Feature sequence192 1929 751 gene locus_tag LOCUS_38080 1929 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 2843 1926 gene locus_tag LOCUS_38090 2843 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 3856 2924 gene locus_tag LOCUS_38100 3856 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 4523 3846 gene locus_tag LOCUS_38110 gene macB 4523 3846 CDS product macrolide export ATP-binding/permease protein MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJ32 protein_id gnl|my_center|LOCUS_38110 5420 4698 gene locus_tag LOCUS_38120 5420 4698 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813013.1 protein_id gnl|my_center|LOCUS_38120 5866 5417 gene locus_tag LOCUS_38130 5866 5417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 6262 6783 gene locus_tag LOCUS_38140 6262 6783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 6780 7316 gene locus_tag LOCUS_38150 6780 7316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 7313 8566 gene locus_tag LOCUS_38160 7313 8566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 8816 9727 gene locus_tag LOCUS_38170 8816 9727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 9779 10474 gene locus_tag LOCUS_38180 9779 10474 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965007.1 protein_id gnl|my_center|LOCUS_38180 >Feature sequence193 296 631 gene locus_tag LOCUS_38190 296 631 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267061.1 protein_id gnl|my_center|LOCUS_38190 653 1123 gene locus_tag LOCUS_38200 gene arsC2 653 1123 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070873.1 protein_id gnl|my_center|LOCUS_38200 1120 1836 gene locus_tag LOCUS_38210 1120 1836 CDS product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095191.1 protein_id gnl|my_center|LOCUS_38210 3733 1817 gene locus_tag LOCUS_38220 3733 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 3789 7208 gene locus_tag LOCUS_38230 3789 7208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 7286 8089 gene locus_tag LOCUS_38240 7286 8089 CDS product alpha/beta family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265531.1 protein_id gnl|my_center|LOCUS_38240 8987 8094 gene locus_tag LOCUS_38250 8987 8094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 9062 11299 gene locus_tag LOCUS_38260 9062 11299 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919006.1 protein_id gnl|my_center|LOCUS_38260 >Feature sequence194 1315 437 gene locus_tag LOCUS_38270 1315 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 1439 2560 gene locus_tag LOCUS_38280 1439 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405182.1 protein_id gnl|my_center|LOCUS_38280 2557 4947 gene locus_tag LOCUS_38290 2557 4947 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_38290 6976 5177 gene locus_tag LOCUS_38300 6976 5177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 7107 8477 gene locus_tag LOCUS_38310 gene ntrX 7107 8477 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087262.1 protein_id gnl|my_center|LOCUS_38310 8505 9878 gene locus_tag LOCUS_38320 gene trkA 8505 9878 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768190.1 protein_id gnl|my_center|LOCUS_38320 9891 11351 gene locus_tag LOCUS_38330 gene trkH 9891 11351 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKR6 protein_id gnl|my_center|LOCUS_38330 >Feature sequence195 1506 421 gene locus_tag LOCUS_38340 1506 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 1880 1503 gene locus_tag LOCUS_38350 1880 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 3316 2141 gene locus_tag LOCUS_38360 3316 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 3420 4100 gene locus_tag LOCUS_38370 3420 4100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 4240 7116 gene locus_tag LOCUS_38380 4240 7116 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881117.1 protein_id gnl|my_center|LOCUS_38380 7828 7241 gene locus_tag LOCUS_38390 7828 7241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 8190 7837 gene locus_tag LOCUS_38400 8190 7837 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788181.1 protein_id gnl|my_center|LOCUS_38400 8265 9620 gene locus_tag LOCUS_38410 8265 9620 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085984871.1 protein_id gnl|my_center|LOCUS_38410 10095 9580 gene locus_tag LOCUS_38420 10095 9580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 <11549 10095 gene locus_tag LOCUS_38430 <11549 10095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919028.1:aminopeptidase >Feature sequence196 1634 999 gene locus_tag LOCUS_38440 1634 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 1817 3244 gene locus_tag LOCUS_38450 1817 3244 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918307.1 protein_id gnl|my_center|LOCUS_38450 5454 3256 gene locus_tag LOCUS_38460 gene glcB 5454 3256 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFM9 protein_id gnl|my_center|LOCUS_38460 5786 9049 gene locus_tag LOCUS_38470 5786 9049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404654.1 protein_id gnl|my_center|LOCUS_38470 9231 11336 gene locus_tag LOCUS_38480 9231 11336 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122114.1 protein_id gnl|my_center|LOCUS_38480 >Feature sequence197 2 217 gene locus_tag LOCUS_38490 2 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 310 107 gene locus_tag LOCUS_38500 310 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 1252 482 gene locus_tag LOCUS_38510 1252 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 1331 3394 gene locus_tag LOCUS_38520 1331 3394 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073927.1 protein_id gnl|my_center|LOCUS_38520 3806 3420 gene locus_tag LOCUS_38530 3806 3420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 4352 3810 gene locus_tag LOCUS_38540 4352 3810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 5113 4358 gene locus_tag LOCUS_38550 5113 4358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 5475 5116 gene locus_tag LOCUS_38560 5475 5116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225039.1 protein_id gnl|my_center|LOCUS_38560 6137 6394 gene locus_tag LOCUS_38570 6137 6394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 7707 6358 gene locus_tag LOCUS_38580 7707 6358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 8512 8153 gene locus_tag LOCUS_38590 8512 8153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 11244 8533 gene locus_tag LOCUS_38600 11244 8533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 >Feature sequence198 501 121 gene locus_tag LOCUS_38610 501 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 890 498 gene locus_tag LOCUS_38620 890 498 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812014.1 protein_id gnl|my_center|LOCUS_38620 1134 1490 gene locus_tag LOCUS_38630 1134 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 1499 1804 gene locus_tag LOCUS_38640 1499 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 2161 2478 gene locus_tag LOCUS_38650 2161 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 3540 2947 gene locus_tag LOCUS_38660 3540 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 3933 3610 gene locus_tag LOCUS_38670 3933 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 7028 3930 gene locus_tag LOCUS_38680 7028 3930 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942780.1 protein_id gnl|my_center|LOCUS_38680 8135 7038 gene locus_tag LOCUS_38690 8135 7038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 9356 8154 gene locus_tag LOCUS_38700 9356 8154 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070860.1 protein_id gnl|my_center|LOCUS_38700 10248 9763 gene locus_tag LOCUS_38710 10248 9763 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272725.1 protein_id gnl|my_center|LOCUS_38710 10270 11181 gene locus_tag LOCUS_38720 10270 11181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 >Feature sequence199 1083 2150 gene locus_tag LOCUS_38730 1083 2150 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723610.1 protein_id gnl|my_center|LOCUS_38730 2147 3118 gene locus_tag LOCUS_38740 2147 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 3103 3774 gene locus_tag LOCUS_38750 3103 3774 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893951.1 protein_id gnl|my_center|LOCUS_38750 4681 3782 gene locus_tag LOCUS_38760 4681 3782 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918355.1 protein_id gnl|my_center|LOCUS_38760 4767 5558 gene locus_tag LOCUS_38770 4767 5558 CDS product nitrilase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106646.1 protein_id gnl|my_center|LOCUS_38770 5688 6314 gene locus_tag LOCUS_38780 5688 6314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 6392 6706 gene locus_tag LOCUS_38790 gene rplU 6392 6706 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E873 protein_id gnl|my_center|LOCUS_38790 6716 6979 gene locus_tag LOCUS_38800 gene rpmA 6716 6979 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZS69 protein_id gnl|my_center|LOCUS_38800 7105 7341 gene locus_tag LOCUS_38810 7105 7341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 7482 9500 gene locus_tag LOCUS_38820 7482 9500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259149.1 protein_id gnl|my_center|LOCUS_38820 9512 10837 gene locus_tag LOCUS_38830 9512 10837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259148.1 protein_id gnl|my_center|LOCUS_38830 >Feature sequence200 881 3 gene locus_tag LOCUS_38840 881 3 CDS product mrr restriction system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887153.1 protein_id gnl|my_center|LOCUS_38840 1086 892 gene locus_tag LOCUS_38850 1086 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 2629 1460 gene locus_tag LOCUS_38860 2629 1460 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108005.1 protein_id gnl|my_center|LOCUS_38860 3119 3592 gene locus_tag LOCUS_38870 3119 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 4194 4108 gene locus_tag LOCUS_t00320 4194 4108 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5096 4416 gene locus_tag LOCUS_38880 5096 4416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 6815 5262 gene locus_tag LOCUS_38890 gene yhcX 6815 5262 CDS product hydrolase YhcX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54608 protein_id gnl|my_center|LOCUS_38890 6863 9169 gene locus_tag LOCUS_38900 gene vacB 6863 9169 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAG7 protein_id gnl|my_center|LOCUS_38900 9208 9783 gene locus_tag LOCUS_38910 9208 9783 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNT2 protein_id gnl|my_center|LOCUS_38910 >Feature sequence201 444 2351 gene locus_tag LOCUS_38920 444 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 2418 3251 gene locus_tag LOCUS_38930 2418 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115216.1 protein_id gnl|my_center|LOCUS_38930 3340 4653 gene locus_tag LOCUS_38940 3340 4653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 6916 4886 gene locus_tag LOCUS_38950 6916 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 8251 7013 gene locus_tag LOCUS_38960 8251 7013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903543.1 protein_id gnl|my_center|LOCUS_38960 9443 8352 gene locus_tag LOCUS_38970 9443 8352 CDS product GTP-dependent nucleic acid-binding protein EngD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_231816.2 protein_id gnl|my_center|LOCUS_38970 10042 9467 gene locus_tag LOCUS_38980 gene pth 10042 9467 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC61 protein_id gnl|my_center|LOCUS_38980 10714 10046 gene locus_tag LOCUS_38990 gene rplY 10714 10046 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC62 protein_id gnl|my_center|LOCUS_38990 >Feature sequence202 <1 2036 gene locus_tag LOCUS_39000 <1 2036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105890.1:RTX toxin 2938 2387 gene locus_tag LOCUS_39010 2938 2387 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAE4 protein_id gnl|my_center|LOCUS_39010 3239 3481 gene locus_tag LOCUS_39020 3239 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 3542 4213 gene locus_tag LOCUS_39030 3542 4213 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037707.1 protein_id gnl|my_center|LOCUS_39030 5295 4210 gene locus_tag LOCUS_39040 5295 4210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920925.1 protein_id gnl|my_center|LOCUS_39040 6097 5303 gene locus_tag LOCUS_39050 gene aroE 6097 5303 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3W6 protein_id gnl|my_center|LOCUS_39050 7086 6094 gene locus_tag LOCUS_39060 gene hemB 7086 6094 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEG3 protein_id gnl|my_center|LOCUS_39060 7219 8388 gene locus_tag LOCUS_39070 7219 8388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 8588 9814 gene locus_tag LOCUS_39080 8588 9814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 10529 9975 gene locus_tag LOCUS_39090 10529 9975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 >Feature sequence203 2372 150 gene locus_tag LOCUS_39100 2372 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 2405 2626 gene locus_tag LOCUS_39110 2405 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 7194 3073 gene locus_tag LOCUS_39120 7194 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 7559 7263 gene locus_tag LOCUS_39130 7559 7263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 9091 7625 gene locus_tag LOCUS_39140 gene yclF 9091 7625 CDS product putative transporter YclF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94408 protein_id gnl|my_center|LOCUS_39140 <10977 9598 gene locus_tag LOCUS_39150 <10977 9598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003095680.1:protein FimX >Feature sequence204 126 689 gene locus_tag LOCUS_39160 126 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 842 1567 gene locus_tag LOCUS_39170 842 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 1615 1809 gene locus_tag LOCUS_39180 1615 1809 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815726.1 protein_id gnl|my_center|LOCUS_39180 2087 4072 gene locus_tag LOCUS_39190 2087 4072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 5456 4707 gene locus_tag LOCUS_39200 5456 4707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 5864 7375 gene locus_tag LOCUS_39210 5864 7375 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 protein_id gnl|my_center|LOCUS_39210 7391 8146 gene locus_tag LOCUS_39220 7391 8146 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104225.1 protein_id gnl|my_center|LOCUS_39220 9490 8372 gene locus_tag LOCUS_39230 9490 8372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 9739 9575 gene locus_tag LOCUS_39240 9739 9575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 9969 10754 gene locus_tag LOCUS_39250 9969 10754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 >Feature sequence205 122 568 gene locus_tag LOCUS_39260 122 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 1007 612 gene locus_tag LOCUS_39270 gene cheY 1007 612 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24072 protein_id gnl|my_center|LOCUS_39270 1651 1004 gene locus_tag LOCUS_39280 1651 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 3076 1664 gene locus_tag LOCUS_39290 3076 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 5472 3250 gene locus_tag LOCUS_39300 5472 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 7203 5545 gene locus_tag LOCUS_39310 7203 5545 CDS product aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_39310 8262 7270 gene locus_tag LOCUS_39320 8262 7270 CDS product cytochrome bd ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528683.1 protein_id gnl|my_center|LOCUS_39320 9620 8259 gene locus_tag LOCUS_39330 9620 8259 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887578.1 protein_id gnl|my_center|LOCUS_39330 10152 9622 gene locus_tag LOCUS_39340 10152 9622 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313806.1 protein_id gnl|my_center|LOCUS_39340 10356 10703 gene locus_tag LOCUS_39350 10356 10703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 >Feature sequence206 2363 318 gene locus_tag LOCUS_39360 2363 318 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074150.1 protein_id gnl|my_center|LOCUS_39360 3986 2598 gene locus_tag LOCUS_39370 gene gdhA 3986 2598 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94598 protein_id gnl|my_center|LOCUS_39370 4657 5727 gene locus_tag LOCUS_39380 gene czcB 4657 5727 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037294.1 protein_id gnl|my_center|LOCUS_39380 5724 8942 gene locus_tag LOCUS_39390 gene acrD 5724 8942 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037293.1 protein_id gnl|my_center|LOCUS_39390 >Feature sequence207 1518 2558 gene locus_tag LOCUS_39400 1518 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 4736 2583 gene locus_tag LOCUS_39410 4736 2583 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921166.1 protein_id gnl|my_center|LOCUS_39410 5846 4950 gene locus_tag LOCUS_39420 gene rluC 5846 4950 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0PCI6 protein_id gnl|my_center|LOCUS_39420 7129 5843 gene locus_tag LOCUS_39430 7129 5843 CDS product recombination factor protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637341.2 protein_id gnl|my_center|LOCUS_39430 7782 7126 gene locus_tag LOCUS_39440 gene lolA 7782 7126 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P991 protein_id gnl|my_center|LOCUS_39440 9755 7782 gene locus_tag LOCUS_39450 gene ftsK 9755 7782 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P993 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39450 10199 9780 gene locus_tag LOCUS_39460 10199 9780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39460 >Feature sequence208 2584 251 gene locus_tag LOCUS_39470 2584 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 2818 3018 gene locus_tag LOCUS_39480 2818 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 4730 3024 gene locus_tag LOCUS_39490 4730 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 5266 6228 gene locus_tag LOCUS_39500 5266 6228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 6960 6388 gene locus_tag LOCUS_39510 6960 6388 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958140.1 protein_id gnl|my_center|LOCUS_39510 7186 7989 gene locus_tag LOCUS_39520 7186 7989 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259182.1 protein_id gnl|my_center|LOCUS_39520 9848 8310 gene locus_tag LOCUS_39530 9848 8310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 >Feature sequence209 1501 200 gene locus_tag LOCUS_39540 1501 200 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639931.1 protein_id gnl|my_center|LOCUS_39540 1613 3478 gene locus_tag LOCUS_39550 1613 3478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 3902 3528 gene locus_tag LOCUS_39560 3902 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028234.1 protein_id gnl|my_center|LOCUS_39560 4379 6481 gene locus_tag LOCUS_39570 4379 6481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 6499 7476 gene locus_tag LOCUS_39580 6499 7476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39580 7542 8345 gene locus_tag LOCUS_39590 7542 8345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 8409 8783 gene locus_tag LOCUS_39600 8409 8783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 9193 8771 gene locus_tag LOCUS_39610 9193 8771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 9507 9190 gene locus_tag LOCUS_39620 9507 9190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 >Feature sequence210 <1 2284 gene locus_tag LOCUS_39630 <1 2284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938022.1:PAS domain-containing sensor histidine kinase 2281 2886 gene locus_tag LOCUS_39640 2281 2886 CDS product amino acid transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704971.1 protein_id gnl|my_center|LOCUS_39640 3792 2851 gene locus_tag LOCUS_39650 3792 2851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 5759 3792 gene locus_tag LOCUS_39660 5759 3792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 6672 5833 gene locus_tag LOCUS_39670 6672 5833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 8278 6776 gene locus_tag LOCUS_39680 8278 6776 CDS product L-lysine 6-aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037523.1 protein_id gnl|my_center|LOCUS_39680 9164 8409 gene locus_tag LOCUS_39690 9164 8409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266523.1 protein_id gnl|my_center|LOCUS_39690 9880 9230 gene locus_tag LOCUS_39700 9880 9230 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522863.1 protein_id gnl|my_center|LOCUS_39700 >Feature sequence211 1 1281 gene locus_tag LOCUS_39710 gene ctaD 1 1281 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P479 protein_id gnl|my_center|LOCUS_39710 1244 1408 gene locus_tag LOCUS_39720 1244 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 1405 1950 gene locus_tag LOCUS_39730 gene cox11 1405 1950 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038910.1 protein_id gnl|my_center|LOCUS_39730 1974 2843 gene locus_tag LOCUS_39740 gene cox3 1974 2843 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038909.1 protein_id gnl|my_center|LOCUS_39740 3158 2919 gene locus_tag LOCUS_39750 3158 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 3198 3932 gene locus_tag LOCUS_39760 3198 3932 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P484 protein_id gnl|my_center|LOCUS_39760 3925 4407 gene locus_tag LOCUS_39770 3925 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038906.1 protein_id gnl|my_center|LOCUS_39770 4400 5512 gene locus_tag LOCUS_39780 4400 5512 CDS product cytochrome oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038905.1 protein_id gnl|my_center|LOCUS_39780 5509 6387 gene locus_tag LOCUS_39790 gene cyoE 5509 6387 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYG0 protein_id gnl|my_center|LOCUS_39790 6464 8224 gene locus_tag LOCUS_39800 gene argS 6464 8224 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTX7 protein_id gnl|my_center|LOCUS_39800 8224 8787 gene locus_tag LOCUS_39810 8224 8787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095850.1 protein_id gnl|my_center|LOCUS_39810 9356 8946 gene locus_tag LOCUS_39820 9356 8946 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314011.1 protein_id gnl|my_center|LOCUS_39820 >Feature sequence212 1514 429 gene locus_tag LOCUS_39830 1514 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211252.1 protein_id gnl|my_center|LOCUS_39830 2405 1554 gene locus_tag LOCUS_39840 2405 1554 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002347746.1 protein_id gnl|my_center|LOCUS_39840 2915 2439 gene locus_tag LOCUS_39850 2915 2439 CDS product germin subfamily 1 member 15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037807.1 protein_id gnl|my_center|LOCUS_39850 3189 2917 gene locus_tag LOCUS_39860 3189 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39860 3570 4502 gene locus_tag LOCUS_39870 3570 4502 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943748.1 protein_id gnl|my_center|LOCUS_39870 8004 4798 gene locus_tag LOCUS_39880 gene mexF2 8004 4798 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947887.1 protein_id gnl|my_center|LOCUS_39880 9200 8001 gene locus_tag LOCUS_39890 9200 8001 CDS product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947886.1 protein_id gnl|my_center|LOCUS_39890 >Feature sequence213 704 120 gene locus_tag LOCUS_39900 704 120 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812293.1 protein_id gnl|my_center|LOCUS_39900 1243 1584 gene locus_tag LOCUS_39910 1243 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 1574 2890 gene locus_tag LOCUS_39920 1574 2890 CDS product putative kinase Y4mE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55564 protein_id gnl|my_center|LOCUS_39920 3296 2916 gene locus_tag LOCUS_39930 3296 2916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941585.1 protein_id gnl|my_center|LOCUS_39930 4167 3346 gene locus_tag LOCUS_39940 4167 3346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 4414 4193 gene locus_tag LOCUS_39950 4414 4193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 5171 4419 gene locus_tag LOCUS_39960 5171 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816142.1 protein_id gnl|my_center|LOCUS_39960 5668 7326 gene locus_tag LOCUS_39970 5668 7326 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057980.1 protein_id gnl|my_center|LOCUS_39970 8412 7456 gene locus_tag LOCUS_39980 8412 7456 CDS product 6-aminohexanoate-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389005.1 protein_id gnl|my_center|LOCUS_39980 9473 8676 gene locus_tag LOCUS_39990 9473 8676 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202330.1 protein_id gnl|my_center|LOCUS_39990 >Feature sequence214 630 466 gene locus_tag LOCUS_40000 630 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 779 1387 gene locus_tag LOCUS_40010 779 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 1513 2919 gene locus_tag LOCUS_40020 1513 2919 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919511.1 protein_id gnl|my_center|LOCUS_40020 2916 3668 gene locus_tag LOCUS_40030 2916 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 5313 3652 gene locus_tag LOCUS_40040 5313 3652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 6834 5419 gene locus_tag LOCUS_40050 6834 5419 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268124.1 protein_id gnl|my_center|LOCUS_40050 <9925 6827 gene locus_tag LOCUS_40060 <9925 6827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036630.1:multidrug efflux RND transporter permease subunit >Feature sequence215 2602 1130 gene locus_tag LOCUS_40070 gene trpE 2602 1130 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035712.1 protein_id gnl|my_center|LOCUS_40070 3233 2673 gene locus_tag LOCUS_40080 3233 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918592.1 protein_id gnl|my_center|LOCUS_40080 4951 3230 gene locus_tag LOCUS_40090 4951 3230 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036212.1 protein_id gnl|my_center|LOCUS_40090 5129 6061 gene locus_tag LOCUS_40100 5129 6061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 protein_id gnl|my_center|LOCUS_40100 6061 7011 gene locus_tag LOCUS_40110 6061 7011 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036210.1 protein_id gnl|my_center|LOCUS_40110 7038 9101 gene locus_tag LOCUS_40120 7038 9101 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036209.1 protein_id gnl|my_center|LOCUS_40120 9659 9276 gene locus_tag LOCUS_40130 9659 9276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 >Feature sequence216 1458 2528 gene locus_tag LOCUS_40140 1458 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 3095 2664 gene locus_tag LOCUS_40150 3095 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 3563 3108 gene locus_tag LOCUS_40160 3563 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 3912 3574 gene locus_tag LOCUS_40170 3912 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 4374 4102 gene locus_tag LOCUS_40180 4374 4102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 4406 5212 gene locus_tag LOCUS_40190 4406 5212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 5650 6537 gene locus_tag LOCUS_40200 5650 6537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 7349 6459 gene locus_tag LOCUS_40210 7349 6459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 7376 8794 gene locus_tag LOCUS_40220 7376 8794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 9152 8796 gene locus_tag LOCUS_40230 9152 8796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 9441 9626 gene locus_tag LOCUS_40240 9441 9626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 >Feature sequence217 1513 221 gene locus_tag LOCUS_40250 1513 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 3479 1608 gene locus_tag LOCUS_40260 3479 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 4773 3466 gene locus_tag LOCUS_40270 4773 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037869.1 protein_id gnl|my_center|LOCUS_40270 5333 4770 gene locus_tag LOCUS_40280 5333 4770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40280 7301 5382 gene locus_tag LOCUS_40290 7301 5382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40290 8946 7690 gene locus_tag LOCUS_40300 8946 7690 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZV80 protein_id gnl|my_center|LOCUS_40300 9590 8946 gene locus_tag LOCUS_40310 9590 8946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 >Feature sequence218 2336 906 gene locus_tag LOCUS_40320 2336 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037267.1 protein_id gnl|my_center|LOCUS_40320 3598 2333 gene locus_tag LOCUS_40330 3598 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 4594 3614 gene locus_tag LOCUS_40340 gene lpxK 4594 3614 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZGA8 protein_id gnl|my_center|LOCUS_40340 6376 4598 gene locus_tag LOCUS_40350 gene msbA 6376 4598 CDS product lipid A export ATP-binding/permease protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQW9 protein_id gnl|my_center|LOCUS_40350 6819 6400 gene locus_tag LOCUS_40360 gene exbD 6819 6400 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206590.1 protein_id gnl|my_center|LOCUS_40360 7433 6816 gene locus_tag LOCUS_40370 gene exbB 7433 6816 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037273.1 protein_id gnl|my_center|LOCUS_40370 <9633 7458 gene locus_tag LOCUS_40380 <9633 7458 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037274.1:DNA internalization-related competence protein ComEC/Rec2 >Feature sequence219 <1 1153 gene locus_tag LOCUS_40390 <1 1153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388247.1:TonB-dependent receptor 1302 1760 gene locus_tag LOCUS_40400 1302 1760 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102736.1 protein_id gnl|my_center|LOCUS_40400 1757 3913 gene locus_tag LOCUS_40410 1757 3913 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114948.1 protein_id gnl|my_center|LOCUS_40410 4099 4542 gene locus_tag LOCUS_40420 4099 4542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 4549 5817 gene locus_tag LOCUS_40430 4549 5817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 6373 5828 gene locus_tag LOCUS_40440 6373 5828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 7096 6386 gene locus_tag LOCUS_40450 7096 6386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105165.1 protein_id gnl|my_center|LOCUS_40450 9232 7628 gene locus_tag LOCUS_40460 9232 7628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 9572 9273 gene locus_tag LOCUS_40470 9572 9273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 >Feature sequence220 371 2209 gene locus_tag LOCUS_40480 gene deaD 371 2209 CDS product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7G9 protein_id gnl|my_center|LOCUS_40480 2306 2902 gene locus_tag LOCUS_40490 2306 2902 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257731.1 protein_id gnl|my_center|LOCUS_40490 2895 3467 gene locus_tag LOCUS_40500 2895 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 3982 3515 gene locus_tag LOCUS_40510 gene glbN 3982 3515 CDS product cyanoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037664.1 protein_id gnl|my_center|LOCUS_40510 8325 3982 gene locus_tag LOCUS_40520 8325 3982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 8872 8420 gene locus_tag LOCUS_40530 gene dksA 8872 8420 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MBV2 protein_id gnl|my_center|LOCUS_40530 <9567 8869 gene locus_tag LOCUS_40540 <9567 8869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388336.1:UDP-2,3-diacylglucosamine hydrolase >Feature sequence221 <1 511 gene locus_tag LOCUS_40550 <1 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036839.1:heme ABC transporter permease 508 699 gene locus_tag LOCUS_40560 508 699 CDS product heme exporter protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PA32 protein_id gnl|my_center|LOCUS_40560 677 1120 gene locus_tag LOCUS_40570 gene ccmE 677 1120 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZR01 protein_id gnl|my_center|LOCUS_40570 1110 3065 gene locus_tag LOCUS_40580 gene cycK 1110 3065 CDS product c-type cytochrome biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037369.1 protein_id gnl|my_center|LOCUS_40580 3062 3616 gene locus_tag LOCUS_40590 gene dsbE 3062 3616 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037370.1 protein_id gnl|my_center|LOCUS_40590 3531 3998 gene locus_tag LOCUS_40600 3531 3998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 3998 5248 gene locus_tag LOCUS_40610 3998 5248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 5235 5741 gene locus_tag LOCUS_40620 5235 5741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 5857 5738 gene locus_tag LOCUS_40630 5857 5738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 6067 5912 gene locus_tag LOCUS_40640 6067 5912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 6612 6064 gene locus_tag LOCUS_40650 6612 6064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 7711 6650 gene locus_tag LOCUS_40660 7711 6650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 7953 7741 gene locus_tag LOCUS_40670 7953 7741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40670 9137 8220 gene locus_tag LOCUS_40680 9137 8220 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093118.1 protein_id gnl|my_center|LOCUS_40680 >Feature sequence222 173 1987 gene locus_tag LOCUS_40690 gene recG 173 1987 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTL3 protein_id gnl|my_center|LOCUS_40690 2039 2563 gene locus_tag LOCUS_40700 2039 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 4065 2659 gene locus_tag LOCUS_40710 4065 2659 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TE8 protein_id gnl|my_center|LOCUS_40710 5178 4270 gene locus_tag LOCUS_40720 gene mutM 5178 4270 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L7T2 protein_id gnl|my_center|LOCUS_40720 7042 5075 gene locus_tag LOCUS_40730 7042 5075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 7914 7030 gene locus_tag LOCUS_40740 7914 7030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 >Feature sequence223 145 222 gene locus_tag LOCUS_t00330 145 222 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 508 903 gene locus_tag LOCUS_40750 508 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 1592 2134 gene locus_tag LOCUS_40760 1592 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 2459 2989 gene locus_tag LOCUS_40770 2459 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 3074 3424 gene locus_tag LOCUS_40780 3074 3424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 6336 3442 gene locus_tag LOCUS_40790 6336 3442 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138082.1 protein_id gnl|my_center|LOCUS_40790 6538 7125 gene locus_tag LOCUS_40800 6538 7125 CDS product DNA invertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113775.1 protein_id gnl|my_center|LOCUS_40800 7178 8458 gene locus_tag LOCUS_40810 7178 8458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40810 8907 8515 gene locus_tag LOCUS_40820 8907 8515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 <9460 8904 gene locus_tag LOCUS_40830 <9460 8904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941563.1:protein 3-oxoalanine-generating enzyme family protein >Feature sequence224 358 2013 gene locus_tag LOCUS_40840 gene ybiT 358 2013 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961458.1 protein_id gnl|my_center|LOCUS_40840 2072 2740 gene locus_tag LOCUS_40850 2072 2740 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_40850 3856 2747 gene locus_tag LOCUS_40860 3856 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697701.1 protein_id gnl|my_center|LOCUS_40860 4075 4875 gene locus_tag LOCUS_40870 4075 4875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40870 4885 5481 gene locus_tag LOCUS_40880 4885 5481 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWG9 protein_id gnl|my_center|LOCUS_40880 5478 6113 gene locus_tag LOCUS_40890 5478 6113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40890 8928 6121 gene locus_tag LOCUS_40900 8928 6121 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404793.1 protein_id gnl|my_center|LOCUS_40900 >Feature sequence225 891 1412 gene locus_tag LOCUS_40910 891 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 1366 2007 gene locus_tag LOCUS_40920 1366 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 2009 3931 gene locus_tag LOCUS_40930 2009 3931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404346.1 protein_id gnl|my_center|LOCUS_40930 3928 4362 gene locus_tag LOCUS_40940 3928 4362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40940 4440 5339 gene locus_tag LOCUS_40950 4440 5339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40950 5336 8539 gene locus_tag LOCUS_40960 5336 8539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40960 8543 8968 gene locus_tag LOCUS_40970 8543 8968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40970 >Feature sequence226 3025 305 gene locus_tag LOCUS_40980 gene btuB 3025 305 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038503.1 protein_id gnl|my_center|LOCUS_40980 5149 3113 gene locus_tag LOCUS_40990 gene plpD 5149 3113 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113139.1 protein_id gnl|my_center|LOCUS_40990 5177 5347 gene locus_tag LOCUS_41000 5177 5347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 5384 5965 gene locus_tag LOCUS_41010 5384 5965 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650L3 protein_id gnl|my_center|LOCUS_41010 5962 6774 gene locus_tag LOCUS_41020 5962 6774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41020 7107 6928 gene locus_tag LOCUS_41030 7107 6928 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVA5 protein_id gnl|my_center|LOCUS_41030 7241 7942 gene locus_tag LOCUS_41040 7241 7942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41040 7981 8394 gene locus_tag LOCUS_41050 7981 8394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41050 8747 8932 gene locus_tag LOCUS_41060 8747 8932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 >Feature sequence227 <1 1207 gene locus_tag LOCUS_41070 <1 1207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011106211.1:sodium:proton antiporter 2465 1422 gene locus_tag LOCUS_41080 2465 1422 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257679.1 protein_id gnl|my_center|LOCUS_41080 3353 2469 gene locus_tag LOCUS_41090 gene htpX 3353 2469 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8F0 protein_id gnl|my_center|LOCUS_41090 3473 4204 gene locus_tag LOCUS_41100 gene cysZ 3473 4204 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I595 protein_id gnl|my_center|LOCUS_41100 4162 5085 gene locus_tag LOCUS_41110 gene gluQ 4162 5085 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62IG0 protein_id gnl|my_center|LOCUS_41110 6343 5444 gene locus_tag LOCUS_41120 gene hemF 6343 5444 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVT4 protein_id gnl|my_center|LOCUS_41120 6918 6340 gene locus_tag LOCUS_41130 gene tsaC 6918 6340 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KE2 protein_id gnl|my_center|LOCUS_41130 9230 6915 gene locus_tag LOCUS_41140 gene topA 9230 6915 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4F3 protein_id gnl|my_center|LOCUS_41140 >Feature sequence228 <1 989 gene locus_tag LOCUS_41150 <1 989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P8J4:argininosuccinate synthase 986 2077 gene locus_tag LOCUS_41160 gene argE 986 2077 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037390.1 protein_id gnl|my_center|LOCUS_41160 2074 3390 gene locus_tag LOCUS_41170 gene argB 2074 3390 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8J6 protein_id gnl|my_center|LOCUS_41170 3387 4352 gene locus_tag LOCUS_41180 gene argC 3387 4352 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8J8 protein_id gnl|my_center|LOCUS_41180 4349 5647 gene locus_tag LOCUS_41190 gene argH 4349 5647 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8J9 protein_id gnl|my_center|LOCUS_41190 6218 5748 gene locus_tag LOCUS_41200 6218 5748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41200 7344 6469 gene locus_tag LOCUS_41210 7344 6469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 protein_id gnl|my_center|LOCUS_41210 >Feature sequence229 42 206 gene locus_tag LOCUS_41220 42 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 1837 2172 gene locus_tag LOCUS_41230 1837 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41230 2729 2334 gene locus_tag LOCUS_41240 gene vapC 2729 2334 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D058 protein_id gnl|my_center|LOCUS_41240 2919 2716 gene locus_tag LOCUS_41250 2919 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64878 protein_id gnl|my_center|LOCUS_41250 5293 3743 gene locus_tag LOCUS_41260 5293 3743 CDS product aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070418.1 protein_id gnl|my_center|LOCUS_41260 6337 5327 gene locus_tag LOCUS_41270 gene mtnA 6337 5327 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ65 protein_id gnl|my_center|LOCUS_41270 6882 6334 gene locus_tag LOCUS_41280 6882 6334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 6995 7750 gene locus_tag LOCUS_41290 6995 7750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 7747 8484 gene locus_tag LOCUS_41300 gene lpxH 7747 8484 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58976 protein_id gnl|my_center|LOCUS_41300 <9266 8551 gene locus_tag LOCUS_41310 <9266 8551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035739.1:membrane protein >Feature sequence230 499 1242 gene locus_tag LOCUS_41320 gene dpm1 499 1242 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038929.1 protein_id gnl|my_center|LOCUS_41320 2980 1325 gene locus_tag LOCUS_41330 2980 1325 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074280.1 protein_id gnl|my_center|LOCUS_41330 4608 2977 gene locus_tag LOCUS_41340 gene yjdB 4608 2977 CDS product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036317.1 protein_id gnl|my_center|LOCUS_41340 5359 4598 gene locus_tag LOCUS_41350 5359 4598 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036318.1 protein_id gnl|my_center|LOCUS_41350 7008 5350 gene locus_tag LOCUS_41360 7008 5350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 8313 7396 gene locus_tag LOCUS_41370 8313 7396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 8735 8929 gene locus_tag LOCUS_41380 8735 8929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 >Feature sequence231 4655 3837 gene locus_tag LOCUS_41390 4655 3837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 5367 4648 gene locus_tag LOCUS_41400 5367 4648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 7110 5539 gene locus_tag LOCUS_41410 7110 5539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41410 7191 7889 gene locus_tag LOCUS_41420 7191 7889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 7919 8689 gene locus_tag LOCUS_41430 7919 8689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41430 >Feature sequence232 3184 272 gene locus_tag LOCUS_41440 3184 272 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071943.1 protein_id gnl|my_center|LOCUS_41440 5267 3309 gene locus_tag LOCUS_41450 5267 3309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41450 6328 5450 gene locus_tag LOCUS_41460 6328 5450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 7673 6462 gene locus_tag LOCUS_41470 7673 6462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 7927 7751 gene locus_tag LOCUS_41480 7927 7751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 8011 8163 gene locus_tag LOCUS_41490 8011 8163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 8677 8378 gene locus_tag LOCUS_41500 8677 8378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 >Feature sequence233 807 427 gene locus_tag LOCUS_41510 807 427 CDS product biopolymer transporter protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707897.1 protein_id gnl|my_center|LOCUS_41510 957 1277 gene locus_tag LOCUS_41520 957 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41520 1299 2207 gene locus_tag LOCUS_41530 1299 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 2523 2242 gene locus_tag LOCUS_41540 2523 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887568.1 protein_id gnl|my_center|LOCUS_41540 2570 4198 gene locus_tag LOCUS_41550 gene prfC 2570 4198 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6V6 protein_id gnl|my_center|LOCUS_41550 5033 4203 gene locus_tag LOCUS_41560 5033 4203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 6204 5086 gene locus_tag LOCUS_41570 6204 5086 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946248.1 protein_id gnl|my_center|LOCUS_41570 6242 6703 gene locus_tag LOCUS_41580 6242 6703 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035458.1 protein_id gnl|my_center|LOCUS_41580 6784 7272 gene locus_tag LOCUS_41590 gene secB 6784 7272 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDY1 protein_id gnl|my_center|LOCUS_41590 7273 8295 gene locus_tag LOCUS_41600 gene gpsA 7273 8295 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDY0 protein_id gnl|my_center|LOCUS_41600 >Feature sequence234 41 436 gene locus_tag LOCUS_41610 41 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41610 701 1099 gene locus_tag LOCUS_41620 701 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 1131 1712 gene locus_tag LOCUS_41630 1131 1712 CDS product putative biphenyl-2,3-diol 1,2-dioxygenase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705084.1 protein_id gnl|my_center|LOCUS_41630 1750 2121 gene locus_tag LOCUS_41640 1750 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104373.1 protein_id gnl|my_center|LOCUS_41640 2118 3569 gene locus_tag LOCUS_41650 2118 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 4036 4557 gene locus_tag LOCUS_41660 4036 4557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 4637 6283 gene locus_tag LOCUS_41670 4637 6283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 6416 7471 gene locus_tag LOCUS_41680 6416 7471 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816612.1 protein_id gnl|my_center|LOCUS_41680 7480 8805 gene locus_tag LOCUS_41690 7480 8805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 >Feature sequence235 1798 947 gene locus_tag LOCUS_41700 1798 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071847.1 protein_id gnl|my_center|LOCUS_41700 2202 2002 gene locus_tag LOCUS_41710 2202 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41710 2642 2202 gene locus_tag LOCUS_41720 2642 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41720 3907 2639 gene locus_tag LOCUS_41730 gene pyrC 3907 2639 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ71 protein_id gnl|my_center|LOCUS_41730 4872 3904 gene locus_tag LOCUS_41740 gene pyrB 4872 3904 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V99 protein_id gnl|my_center|LOCUS_41740 5356 4865 gene locus_tag LOCUS_41750 gene pyrR 5356 4865 CDS product bifunctional protein PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ69 protein_id gnl|my_center|LOCUS_41750 5789 5343 gene locus_tag LOCUS_41760 gene yqgF 5789 5343 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CRB0 protein_id gnl|my_center|LOCUS_41760 6372 5809 gene locus_tag LOCUS_41770 6372 5809 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P765 protein_id gnl|my_center|LOCUS_41770 6488 7489 gene locus_tag LOCUS_41780 6488 7489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635555.2 protein_id gnl|my_center|LOCUS_41780 7582 7917 gene locus_tag LOCUS_41790 gene erpA 7582 7917 CDS product putative iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F6W8 protein_id gnl|my_center|LOCUS_41790 7942 8934 gene locus_tag LOCUS_41800 7942 8934 CDS product NTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804757.1 protein_id gnl|my_center|LOCUS_41800 >Feature sequence236 946 677 gene locus_tag LOCUS_41810 946 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 1190 7858 gene locus_tag LOCUS_41820 1190 7858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 8143 9030 gene locus_tag LOCUS_41830 8143 9030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 >Feature sequence237 719 1867 gene locus_tag LOCUS_41840 719 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 1986 3692 gene locus_tag LOCUS_41850 1986 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 3689 4651 gene locus_tag LOCUS_41860 3689 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 5669 4683 gene locus_tag LOCUS_41870 5669 4683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41870 7727 5919 gene locus_tag LOCUS_41880 7727 5919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41880 7939 8412 gene locus_tag LOCUS_41890 7939 8412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41890 <9095 8428 gene locus_tag LOCUS_41900 <9095 8428 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011013994.1:MFS transporter >Feature sequence238 29 433 gene locus_tag LOCUS_41910 29 433 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708751.1 protein_id gnl|my_center|LOCUS_41910 571 2838 gene locus_tag LOCUS_41920 571 2838 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528058.1 protein_id gnl|my_center|LOCUS_41920 3418 2906 gene locus_tag LOCUS_41930 3418 2906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296181.1 protein_id gnl|my_center|LOCUS_41930 4069 3993 gene locus_tag LOCUS_t00340 4069 3993 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4248 5528 gene locus_tag LOCUS_41940 4248 5528 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706992.1 protein_id gnl|my_center|LOCUS_41940 6730 5525 gene locus_tag LOCUS_41950 6730 5525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 7486 6746 gene locus_tag LOCUS_41960 7486 6746 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967150.1 protein_id gnl|my_center|LOCUS_41960 <9043 7595 gene locus_tag LOCUS_41970 <9043 7595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263309.1:cation transporter >Feature sequence239 2440 194 gene locus_tag LOCUS_41980 2440 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 4199 2454 gene locus_tag LOCUS_41990 4199 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 7297 4274 gene locus_tag LOCUS_42000 7297 4274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42000 7988 7308 gene locus_tag LOCUS_42010 7988 7308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 8463 7981 gene locus_tag LOCUS_42020 8463 7981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42020 8883 8650 gene locus_tag LOCUS_42030 8883 8650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42030 >Feature sequence240 119 652 gene locus_tag LOCUS_42040 119 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 2244 688 gene locus_tag LOCUS_42050 gene hyuB 2244 688 CDS product N-methylhydantoinase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881258.1 protein_id gnl|my_center|LOCUS_42050 2298 2876 gene locus_tag LOCUS_42060 gene sodB 2298 2876 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53641 protein_id gnl|my_center|LOCUS_42060 2895 4091 gene locus_tag LOCUS_42070 gene argD 2895 4091 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRB4 protein_id gnl|my_center|LOCUS_42070 5330 4125 gene locus_tag LOCUS_42080 5330 4125 CDS product KlaA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022426.1 protein_id gnl|my_center|LOCUS_42080 7995 5404 gene locus_tag LOCUS_42090 gene mutS 7995 5404 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBB5 protein_id gnl|my_center|LOCUS_42090 8046 8525 gene locus_tag LOCUS_42100 8046 8525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167419.1 protein_id gnl|my_center|LOCUS_42100 >Feature sequence241 920 90 gene locus_tag LOCUS_42110 920 90 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979322.1 protein_id gnl|my_center|LOCUS_42110 1751 933 gene locus_tag LOCUS_42120 gene pyrH 1751 933 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CZM1 protein_id gnl|my_center|LOCUS_42120 2578 1763 gene locus_tag LOCUS_42130 2578 1763 CDS product type 11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256320.1 protein_id gnl|my_center|LOCUS_42130 2823 3176 gene locus_tag LOCUS_42140 2823 3176 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881362.1 protein_id gnl|my_center|LOCUS_42140 3384 3659 gene locus_tag LOCUS_42150 3384 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42150 3775 4278 gene locus_tag LOCUS_42160 3775 4278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 4275 4826 gene locus_tag LOCUS_42170 4275 4826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639507.2 protein_id gnl|my_center|LOCUS_42170 5123 5485 gene locus_tag LOCUS_42180 5123 5485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 5508 6029 gene locus_tag LOCUS_42190 5508 6029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975418.1 protein_id gnl|my_center|LOCUS_42190 6137 6613 gene locus_tag LOCUS_42200 6137 6613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42200 6725 7078 gene locus_tag LOCUS_42210 6725 7078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42210 7305 7688 gene locus_tag LOCUS_42220 7305 7688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 >Feature sequence242 <1 1177 gene locus_tag LOCUS_42230 <1 1177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073483.1:sensor histidine kinase 2063 1284 gene locus_tag LOCUS_42240 2063 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090970.1 protein_id gnl|my_center|LOCUS_42240 2452 2060 gene locus_tag LOCUS_42250 2452 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919888.1 protein_id gnl|my_center|LOCUS_42250 2811 2452 gene locus_tag LOCUS_42260 2811 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 6735 2839 gene locus_tag LOCUS_42270 6735 2839 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105494.1 protein_id gnl|my_center|LOCUS_42270 6892 7596 gene locus_tag LOCUS_42280 6892 7596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 >Feature sequence243 <1 561 gene locus_tag LOCUS_42290 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WJQ8:homoserine dehydrogenase 754 1971 gene locus_tag LOCUS_42300 754 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42300 2363 2923 gene locus_tag LOCUS_42310 2363 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 5117 3135 gene locus_tag LOCUS_42320 5117 3135 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706128.1 protein_id gnl|my_center|LOCUS_42320 5306 5608 gene locus_tag LOCUS_42330 5306 5608 CDS product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191359.1 protein_id gnl|my_center|LOCUS_42330 5608 6228 gene locus_tag LOCUS_42340 5608 6228 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203514.1 protein_id gnl|my_center|LOCUS_42340 6225 6647 gene locus_tag LOCUS_42350 6225 6647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42350 7636 6701 gene locus_tag LOCUS_42360 gene secF 7636 6701 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTY6 protein_id gnl|my_center|LOCUS_42360 <8910 7646 gene locus_tag LOCUS_42370 <8910 7646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KTY7:protein translocase subunit SecD >Feature sequence244 >Feature sequence245 2491 962 gene locus_tag LOCUS_42380 2491 962 CDS product gonadoliberin III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457220.1 protein_id gnl|my_center|LOCUS_42380 3282 2488 gene locus_tag LOCUS_42390 3282 2488 CDS product ATP-dependent Zn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705414.1 protein_id gnl|my_center|LOCUS_42390 3637 3284 gene locus_tag LOCUS_42400 3637 3284 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813253.1 protein_id gnl|my_center|LOCUS_42400 4175 3639 gene locus_tag LOCUS_42410 4175 3639 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095503.1 protein_id gnl|my_center|LOCUS_42410 4974 4255 gene locus_tag LOCUS_42420 4974 4255 CDS product cytochrome biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268429.1 protein_id gnl|my_center|LOCUS_42420 5132 4971 gene locus_tag LOCUS_42430 5132 4971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 7582 5129 gene locus_tag LOCUS_42440 7582 5129 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114668.1 protein_id gnl|my_center|LOCUS_42440 7787 7572 gene locus_tag LOCUS_42450 7787 7572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42450 <8674 7805 gene locus_tag LOCUS_42460 <8674 7805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268426.1:4Fe-4S ferredoxin >Feature sequence246 2618 2049 gene locus_tag LOCUS_42470 2618 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42470 2810 4831 gene locus_tag LOCUS_42480 2810 4831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42480 4831 5964 gene locus_tag LOCUS_42490 4831 5964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42490 5996 7570 gene locus_tag LOCUS_42500 gene exeA 5996 7570 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942184.1 protein_id gnl|my_center|LOCUS_42500 7554 8456 gene locus_tag LOCUS_42510 7554 8456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 >Feature sequence247 <1 1903 gene locus_tag LOCUS_42520 <1 1903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_637141.2:glucan 1,4-beta-glucosidase 1900 4131 gene locus_tag LOCUS_42530 1900 4131 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203679.1 protein_id gnl|my_center|LOCUS_42530 4128 5771 gene locus_tag LOCUS_42540 4128 5771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 <8659 5808 gene locus_tag LOCUS_42550 <8659 5808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q881T7:error-prone DNA polymerase >Feature sequence248 >Feature sequence249 724 1494 gene locus_tag LOCUS_42560 724 1494 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459021.1 protein_id gnl|my_center|LOCUS_42560 1491 2897 gene locus_tag LOCUS_42570 gene ttpC 1491 2897 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071945.1 protein_id gnl|my_center|LOCUS_42570 2881 3405 gene locus_tag LOCUS_42580 gene exbB 2881 3405 CDS product TonB2 energy transduction system inner membrane component ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071946.1 protein_id gnl|my_center|LOCUS_42580 3455 3862 gene locus_tag LOCUS_42590 3455 3862 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_42590 3868 4500 gene locus_tag LOCUS_42600 gene tonB2 3868 4500 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFY6 protein_id gnl|my_center|LOCUS_42600 4504 5763 gene locus_tag LOCUS_42610 4504 5763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42610 5874 6746 gene locus_tag LOCUS_42620 gene xerD 5874 6746 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXQ6 protein_id gnl|my_center|LOCUS_42620 6836 7084 gene locus_tag LOCUS_42630 6836 7084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42630 7020 7739 gene locus_tag LOCUS_42640 gene dsbC 7020 7739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035896.1 protein_id gnl|my_center|LOCUS_42640 >Feature sequence250 <1 665 gene locus_tag LOCUS_42650 <1 665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002208505.1:two-component sensor histidine kinase 1379 669 gene locus_tag LOCUS_42660 1379 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 2327 1488 gene locus_tag LOCUS_42670 2327 1488 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114813.1 protein_id gnl|my_center|LOCUS_42670 2941 2324 gene locus_tag LOCUS_42680 gene cynT 2941 2324 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGU2 protein_id gnl|my_center|LOCUS_42680 3539 3090 gene locus_tag LOCUS_42690 3539 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42690 3423 4142 gene locus_tag LOCUS_42700 3423 4142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42700 4876 4145 gene locus_tag LOCUS_42710 4876 4145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056014.1 protein_id gnl|my_center|LOCUS_42710 4983 6437 gene locus_tag LOCUS_42720 4983 6437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122583.1 protein_id gnl|my_center|LOCUS_42720 6439 7359 gene locus_tag LOCUS_42730 6439 7359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057009.1 protein_id gnl|my_center|LOCUS_42730 7455 7631 gene locus_tag LOCUS_42740 7455 7631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 8117 7695 gene locus_tag LOCUS_42750 8117 7695 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119294.1 protein_id gnl|my_center|LOCUS_42750 8384 8121 gene locus_tag LOCUS_42760 8384 8121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42760 >Feature sequence251 <1 1014 gene locus_tag LOCUS_42770 <1 1014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8PC59:elongation factor Tu-A 1099 1174 gene locus_tag LOCUS_t00350 1099 1174 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1233 1580 gene locus_tag LOCUS_42780 gene secE 1233 1580 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KP8 protein_id gnl|my_center|LOCUS_42780 1590 2123 gene locus_tag LOCUS_42790 gene nusG 1590 2123 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC4 protein_id gnl|my_center|LOCUS_42790 2209 2643 gene locus_tag LOCUS_42800 gene rplK 2209 2643 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC5 protein_id gnl|my_center|LOCUS_42800 2643 3335 gene locus_tag LOCUS_42810 gene rplA 2643 3335 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Y1 protein_id gnl|my_center|LOCUS_42810 3496 4071 gene locus_tag LOCUS_42820 gene rplJ 3496 4071 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYQ2 protein_id gnl|my_center|LOCUS_42820 4167 4541 gene locus_tag LOCUS_42830 gene rplL 4167 4541 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYQ1 protein_id gnl|my_center|LOCUS_42830 4769 5761 gene locus_tag LOCUS_42840 4769 5761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_42840 >Feature sequence252 1976 720 gene locus_tag LOCUS_42850 1976 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 3259 2006 gene locus_tag LOCUS_42860 gene vieA 3259 2006 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037833.1 protein_id gnl|my_center|LOCUS_42860 3436 4629 gene locus_tag LOCUS_42870 3436 4629 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763530.1 protein_id gnl|my_center|LOCUS_42870 4652 5374 gene locus_tag LOCUS_42880 4652 5374 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707648.1 protein_id gnl|my_center|LOCUS_42880 7717 5420 gene locus_tag LOCUS_42890 7717 5420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42890 <8505 7729 gene locus_tag LOCUS_42900 <8505 7729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122048.1:two-component system sensor histidine kinase/response regulator >Feature sequence253 3333 1162 gene locus_tag LOCUS_42910 3333 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42910 3472 3915 gene locus_tag LOCUS_42920 3472 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42920 4756 4001 gene locus_tag LOCUS_42930 4756 4001 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918668.1 protein_id gnl|my_center|LOCUS_42930 4921 5451 gene locus_tag LOCUS_42940 4921 5451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40882 protein_id gnl|my_center|LOCUS_42940 6101 5421 gene locus_tag LOCUS_42950 6101 5421 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269129.1 protein_id gnl|my_center|LOCUS_42950 7066 6098 gene locus_tag LOCUS_42960 7066 6098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113208.1 protein_id gnl|my_center|LOCUS_42960 >Feature sequence254 293 3553 gene locus_tag LOCUS_42970 293 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42970 3582 4808 gene locus_tag LOCUS_42980 3582 4808 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087545.1 protein_id gnl|my_center|LOCUS_42980 4938 5786 gene locus_tag LOCUS_42990 4938 5786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 protein_id gnl|my_center|LOCUS_42990 5752 6315 gene locus_tag LOCUS_43000 5752 6315 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222931.1 protein_id gnl|my_center|LOCUS_43000 6382 7560 gene locus_tag LOCUS_43010 6382 7560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43010 7557 8150 gene locus_tag LOCUS_43020 gene lexA 7557 8150 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KS7 protein_id gnl|my_center|LOCUS_43020 >Feature sequence255 158 469 gene locus_tag LOCUS_43030 gene rpsJ 158 469 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC50 protein_id gnl|my_center|LOCUS_43030 689 1339 gene locus_tag LOCUS_43040 gene rplC 689 1339 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ES4 protein_id gnl|my_center|LOCUS_43040 1342 1944 gene locus_tag LOCUS_43050 gene rplD 1342 1944 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JS46 protein_id gnl|my_center|LOCUS_43050 1941 2252 gene locus_tag LOCUS_43060 gene rplW 1941 2252 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC47 protein_id gnl|my_center|LOCUS_43060 2264 3091 gene locus_tag LOCUS_43070 gene rplB 2264 3091 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK65 protein_id gnl|my_center|LOCUS_43070 3105 3377 gene locus_tag LOCUS_43080 gene rpsS 3105 3377 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ES0 protein_id gnl|my_center|LOCUS_43080 3390 3722 gene locus_tag LOCUS_43090 gene rplV 3390 3722 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHW3 protein_id gnl|my_center|LOCUS_43090 3756 4427 gene locus_tag LOCUS_43100 gene rpsC 3756 4427 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC44 protein_id gnl|my_center|LOCUS_43100 4439 4852 gene locus_tag LOCUS_43110 gene rplP 4439 4852 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHW1 protein_id gnl|my_center|LOCUS_43110 4852 5055 gene locus_tag LOCUS_43120 gene rpmC 4852 5055 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK61 protein_id gnl|my_center|LOCUS_43120 5052 5312 gene locus_tag LOCUS_43130 gene rpsQ 5052 5312 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC41 protein_id gnl|my_center|LOCUS_43130 5326 5694 gene locus_tag LOCUS_43140 gene rplN 5326 5694 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CLU5 protein_id gnl|my_center|LOCUS_43140 5755 6078 gene locus_tag LOCUS_43150 gene rplX 5755 6078 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889W0 protein_id gnl|my_center|LOCUS_43150 6090 6629 gene locus_tag LOCUS_43160 gene rplE 6090 6629 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K1I4 protein_id gnl|my_center|LOCUS_43160 6635 6940 gene locus_tag LOCUS_43170 gene rpsN 6635 6940 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CLU4 protein_id gnl|my_center|LOCUS_43170 7021 7413 gene locus_tag LOCUS_43180 gene rpsH 7021 7413 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK55 protein_id gnl|my_center|LOCUS_43180 7426 7953 gene locus_tag LOCUS_43190 gene rplF 7426 7953 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC37 protein_id gnl|my_center|LOCUS_43190 >Feature sequence256 1746 286 gene locus_tag LOCUS_43200 1746 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43200 2624 1734 gene locus_tag LOCUS_43210 2624 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43210 3389 2676 gene locus_tag LOCUS_43220 gene ate 3389 2676 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M0 protein_id gnl|my_center|LOCUS_43220 3941 3429 gene locus_tag LOCUS_43230 gene nbaC 3941 3429 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAD0 protein_id gnl|my_center|LOCUS_43230 4369 3938 gene locus_tag LOCUS_43240 4369 3938 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462120.1 protein_id gnl|my_center|LOCUS_43240 5799 4366 gene locus_tag LOCUS_43250 5799 4366 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257240.1 protein_id gnl|my_center|LOCUS_43250 6775 5813 gene locus_tag LOCUS_43260 6775 5813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 7745 6885 gene locus_tag LOCUS_43270 7745 6885 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037285.1 protein_id gnl|my_center|LOCUS_43270 7783 7953 gene locus_tag LOCUS_43280 7783 7953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43280 7966 8241 gene locus_tag LOCUS_43290 7966 8241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8V6 protein_id gnl|my_center|LOCUS_43290 >Feature sequence257 <1 755 gene locus_tag LOCUS_43300 <1 755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0C6PA30:signal peptidase I 748 1152 gene locus_tag LOCUS_43310 748 1152 CDS product DUF4845 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036466.1 protein_id gnl|my_center|LOCUS_43310 1142 1798 gene locus_tag LOCUS_43320 gene rnc 1142 1798 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB52 protein_id gnl|my_center|LOCUS_43320 1795 2721 gene locus_tag LOCUS_43330 gene era 1795 2721 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB51 protein_id gnl|my_center|LOCUS_43330 2730 3410 gene locus_tag LOCUS_43340 gene recO 2730 3410 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGF4 protein_id gnl|my_center|LOCUS_43340 3295 4128 gene locus_tag LOCUS_43350 gene pdxJ 3295 4128 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPB5 protein_id gnl|my_center|LOCUS_43350 4139 5413 gene locus_tag LOCUS_43360 4139 5413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43360 5509 5871 gene locus_tag LOCUS_43370 5509 5871 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227761.1 protein_id gnl|my_center|LOCUS_43370 5912 6532 gene locus_tag LOCUS_43380 5912 6532 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815407.1 protein_id gnl|my_center|LOCUS_43380 8011 6695 gene locus_tag LOCUS_43390 8011 6695 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187694.1 protein_id gnl|my_center|LOCUS_43390 >Feature sequence258 1095 202 gene locus_tag LOCUS_43400 1095 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43400 1631 1113 gene locus_tag LOCUS_43410 1631 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43410 6564 1858 gene locus_tag LOCUS_43420 6564 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43420 7359 6655 gene locus_tag LOCUS_43430 7359 6655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142238.1 protein_id gnl|my_center|LOCUS_43430 8078 7356 gene locus_tag LOCUS_43440 8078 7356 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947243.1 protein_id gnl|my_center|LOCUS_43440 >Feature sequence259 272 709 gene locus_tag LOCUS_43450 gene cdd 272 709 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616222.1 protein_id gnl|my_center|LOCUS_43450 772 1773 gene locus_tag LOCUS_43460 gene idiA 772 1773 CDS product iron deficiency-induced protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLH9 protein_id gnl|my_center|LOCUS_43460 1961 1827 gene locus_tag LOCUS_43470 1961 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43470 3219 1972 gene locus_tag LOCUS_43480 3219 1972 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035879.1 protein_id gnl|my_center|LOCUS_43480 3466 4395 gene locus_tag LOCUS_43490 gene glsA 3466 4395 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEA1 protein_id gnl|my_center|LOCUS_43490 4392 4601 gene locus_tag LOCUS_43500 4392 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43500 4669 5970 gene locus_tag LOCUS_43510 4669 5970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43510 7847 5988 gene locus_tag LOCUS_43520 7847 5988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43520 >Feature sequence260 2198 156 gene locus_tag LOCUS_43530 2198 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43530 2665 4242 gene locus_tag LOCUS_43540 2665 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 4430 6388 gene locus_tag LOCUS_43550 4430 6388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 6469 6795 gene locus_tag LOCUS_43560 6469 6795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 7891 6839 gene locus_tag LOCUS_43570 7891 6839 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528843.1 protein_id gnl|my_center|LOCUS_43570 >Feature sequence261 1538 540 gene locus_tag LOCUS_43580 gene bioB 1538 540 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDF0 protein_id gnl|my_center|LOCUS_43580 1768 2304 gene locus_tag LOCUS_43590 1768 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43590 2449 3408 gene locus_tag LOCUS_43600 2449 3408 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_43600 3443 4801 gene locus_tag LOCUS_43610 3443 4801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43610 6059 4821 gene locus_tag LOCUS_43620 6059 4821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 6458 7438 gene locus_tag LOCUS_43630 6458 7438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43630 >Feature sequence262 324 1019 gene locus_tag LOCUS_43640 324 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43640 3569 1194 gene locus_tag LOCUS_43650 3569 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43650 4961 4455 gene locus_tag LOCUS_43660 4961 4455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43660 5515 6546 gene locus_tag LOCUS_43670 5515 6546 CDS product HflK protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_43670 6543 7484 gene locus_tag LOCUS_43680 6543 7484 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73N23 protein_id gnl|my_center|LOCUS_43680 >Feature sequence263 465 2459 gene locus_tag LOCUS_43690 gene tktA 465 2459 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CGS3 protein_id gnl|my_center|LOCUS_43690 2523 3536 gene locus_tag LOCUS_43700 gene gap 2523 3536 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WK56 protein_id gnl|my_center|LOCUS_43700 3553 4737 gene locus_tag LOCUS_43710 gene pgk 3553 4737 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIB1 protein_id gnl|my_center|LOCUS_43710 4734 5441 gene locus_tag LOCUS_43720 4734 5441 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I767 protein_id gnl|my_center|LOCUS_43720 5495 6517 gene locus_tag LOCUS_43730 5495 6517 CDS product putative fructose-bisphosphate aldolase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5Z7 protein_id gnl|my_center|LOCUS_43730 6520 6723 gene locus_tag LOCUS_43740 6520 6723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43740 7504 6800 gene locus_tag LOCUS_43750 7504 6800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919167.1 protein_id gnl|my_center|LOCUS_43750 >Feature sequence264 1199 540 gene locus_tag LOCUS_43760 1199 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 2883 1231 gene locus_tag LOCUS_43770 2883 1231 CDS product Mur ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021312.1 protein_id gnl|my_center|LOCUS_43770 5671 2876 gene locus_tag LOCUS_43780 gene cphA 5671 2876 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021315.1 protein_id gnl|my_center|LOCUS_43780 6986 5874 gene locus_tag LOCUS_43790 gene selU 6986 5874 CDS product tRNA 2-selenouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PAG6 protein_id gnl|my_center|LOCUS_43790 <7892 6983 gene locus_tag LOCUS_43800 <7892 6983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KKE7:selenide, water dikinase >Feature sequence265 1378 755 gene locus_tag LOCUS_43810 gene nfuA 1378 755 CDS product Fe/S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CUG9 protein_id gnl|my_center|LOCUS_43810 2391 1375 gene locus_tag LOCUS_43820 2391 1375 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932879.1 protein_id gnl|my_center|LOCUS_43820 2663 2388 gene locus_tag LOCUS_43830 gene ppiC 2663 2388 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071952.1 protein_id gnl|my_center|LOCUS_43830 2740 4215 gene locus_tag LOCUS_43840 2740 4215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037688.1 protein_id gnl|my_center|LOCUS_43840 6769 4220 gene locus_tag LOCUS_43850 6769 4220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43850 7245 6772 gene locus_tag LOCUS_43860 7245 6772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43860 >Feature sequence266 1714 2145 gene locus_tag LOCUS_43870 1714 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43870 3958 2288 gene locus_tag LOCUS_43880 3958 2288 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901535.1 protein_id gnl|my_center|LOCUS_43880 6982 4157 gene locus_tag LOCUS_43890 6982 4157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43890 7270 6989 gene locus_tag LOCUS_43900 7270 6989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887737.1 protein_id gnl|my_center|LOCUS_43900 >Feature sequence267 182 1291 gene locus_tag LOCUS_43910 182 1291 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339450.1 protein_id gnl|my_center|LOCUS_43910 1284 2660 gene locus_tag LOCUS_43920 1284 2660 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097871.1 protein_id gnl|my_center|LOCUS_43920 2653 4242 gene locus_tag LOCUS_43930 2653 4242 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920957.1 protein_id gnl|my_center|LOCUS_43930 4310 6271 gene locus_tag LOCUS_43940 4310 6271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43940 >Feature sequence268 238 930 gene locus_tag LOCUS_43950 238 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43950 923 4156 gene locus_tag LOCUS_43960 923 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43960 4146 5012 gene locus_tag LOCUS_43970 4146 5012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43970 5020 5826 gene locus_tag LOCUS_43980 5020 5826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43980 5823 7598 gene locus_tag LOCUS_43990 5823 7598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43990 >Feature sequence269 2407 92 gene locus_tag LOCUS_44000 2407 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44000 4125 2569 gene locus_tag LOCUS_44010 4125 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44010 5763 4663 gene locus_tag LOCUS_44020 5763 4663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44020 6655 5903 gene locus_tag LOCUS_44030 6655 5903 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389698.1 protein_id gnl|my_center|LOCUS_44030 7413 6826 gene locus_tag LOCUS_44040 7413 6826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44040 >Feature sequence270 2858 225 gene locus_tag LOCUS_44050 gene aceE 2858 225 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MID8 protein_id gnl|my_center|LOCUS_44050 3085 3450 gene locus_tag LOCUS_44060 3085 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44060 4047 4445 gene locus_tag LOCUS_44070 4047 4445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 4513 4893 gene locus_tag LOCUS_44080 4513 4893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814908.1 protein_id gnl|my_center|LOCUS_44080 5874 6314 gene locus_tag LOCUS_44090 5874 6314 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390219.1 protein_id gnl|my_center|LOCUS_44090 6315 7166 gene locus_tag LOCUS_44100 6315 7166 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204064.1 protein_id gnl|my_center|LOCUS_44100 >Feature sequence271 <1 992 gene locus_tag LOCUS_44110 <1 992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RX54:Mg-protoporphyrin IX chelatase 989 1882 gene locus_tag LOCUS_44120 989 1882 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388246.1 protein_id gnl|my_center|LOCUS_44120 1884 3425 gene locus_tag LOCUS_44130 1884 3425 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388252.1 protein_id gnl|my_center|LOCUS_44130 3412 4482 gene locus_tag LOCUS_44140 3412 4482 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388253.1 protein_id gnl|my_center|LOCUS_44140 4482 4616 gene locus_tag LOCUS_44150 4482 4616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44150 5557 4613 gene locus_tag LOCUS_44160 5557 4613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44160 6999 5554 gene locus_tag LOCUS_44170 6999 5554 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390732.1 protein_id gnl|my_center|LOCUS_44170 >Feature sequence272 <1 563 gene locus_tag LOCUS_44180 <1 563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836785.1:YSIRK signal domain/LPXTG anchor domain surface protein 603 2987 gene locus_tag LOCUS_44190 603 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44190 3516 3298 gene locus_tag LOCUS_44200 3516 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44200 4648 3617 gene locus_tag LOCUS_44210 4648 3617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021055.1 protein_id gnl|my_center|LOCUS_44210 4902 5429 gene locus_tag LOCUS_44220 4902 5429 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073616.1 protein_id gnl|my_center|LOCUS_44220 5466 5894 gene locus_tag LOCUS_44230 5466 5894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381519.1 protein_id gnl|my_center|LOCUS_44230 6504 6956 gene locus_tag LOCUS_44240 6504 6956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_44240 >Feature sequence273 294 1943 gene locus_tag LOCUS_44250 294 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44250 2548 2057 gene locus_tag LOCUS_44260 2548 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44260 2623 4650 gene locus_tag LOCUS_44270 2623 4650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44270 4651 5916 gene locus_tag LOCUS_44280 4651 5916 CDS product L-cystine transporter tcyP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707739.1 protein_id gnl|my_center|LOCUS_44280 6173 7141 gene locus_tag LOCUS_44290 6173 7141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44290 >Feature sequence274 526 2241 gene locus_tag LOCUS_44300 526 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44300 2248 3033 gene locus_tag LOCUS_44310 2248 3033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44310 3046 4599 gene locus_tag LOCUS_44320 3046 4599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 4599 5405 gene locus_tag LOCUS_44330 4599 5405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44330 5419 6459 gene locus_tag LOCUS_44340 5419 6459 CDS product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268762.1 protein_id gnl|my_center|LOCUS_44340 6459 7283 gene locus_tag LOCUS_44350 6459 7283 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764735.1 protein_id gnl|my_center|LOCUS_44350 >Feature sequence275 1075 158 gene locus_tag LOCUS_44360 gene lpxL 1075 158 CDS product lipid A biosynthesis lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW10 protein_id gnl|my_center|LOCUS_44360 2119 1085 gene locus_tag LOCUS_44370 2119 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44370 4773 2116 gene locus_tag LOCUS_44380 4773 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44380 5422 4733 gene locus_tag LOCUS_44390 5422 4733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44390 5865 5467 gene locus_tag LOCUS_44400 5865 5467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44400 6021 6809 gene locus_tag LOCUS_44410 6021 6809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 >Feature sequence276 684 124 gene locus_tag LOCUS_44420 684 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44420 982 773 gene locus_tag LOCUS_44430 982 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 2865 1312 gene locus_tag LOCUS_44440 2865 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44440 2975 3361 gene locus_tag LOCUS_44450 2975 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44450 3432 3827 gene locus_tag LOCUS_44460 3432 3827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 4537 4779 gene locus_tag LOCUS_44470 gene parD-4 4537 4779 CDS product antitoxin protein parD-4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265886.1 protein_id gnl|my_center|LOCUS_44470 6982 6212 gene locus_tag LOCUS_44480 6982 6212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44480 >Feature sequence277 2499 1588 gene locus_tag LOCUS_44490 2499 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44490 3451 3143 gene locus_tag LOCUS_44500 3451 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44500 3419 3859 gene locus_tag LOCUS_44510 3419 3859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 4288 6963 gene locus_tag LOCUS_44520 4288 6963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44520 >Feature sequence278 <1 892 gene locus_tag LOCUS_44530 <1 892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DHP3:beta-xylanase 1399 914 gene locus_tag LOCUS_44540 1399 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44540 1491 1913 gene locus_tag LOCUS_44550 1491 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44550 1933 2739 gene locus_tag LOCUS_44560 1933 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44560 2736 3557 gene locus_tag LOCUS_44570 2736 3557 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037402.1 protein_id gnl|my_center|LOCUS_44570 4422 3517 gene locus_tag LOCUS_44580 4422 3517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947383.1 protein_id gnl|my_center|LOCUS_44580 4859 4419 gene locus_tag LOCUS_44590 4859 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44590 5008 5991 gene locus_tag LOCUS_44600 5008 5991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44600 6092 7003 gene locus_tag LOCUS_44610 gene mutY 6092 7003 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522857.1 protein_id gnl|my_center|LOCUS_44610 >Feature sequence279 754 176 gene locus_tag LOCUS_44620 754 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44620 1272 811 gene locus_tag LOCUS_44630 1272 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44630 4667 1269 gene locus_tag LOCUS_44640 4667 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44640 6568 4799 gene locus_tag LOCUS_44650 6568 4799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44650 6581 6919 gene locus_tag LOCUS_44660 gene glnB 6581 6919 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038947.1 protein_id gnl|my_center|LOCUS_44660 >Feature sequence280 327 127 gene locus_tag LOCUS_44670 327 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 546 373 gene locus_tag LOCUS_44680 546 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44680 476 1846 gene locus_tag LOCUS_44690 476 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44690 2863 1940 gene locus_tag LOCUS_44700 2863 1940 CDS product glutaredoxin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638714.2 protein_id gnl|my_center|LOCUS_44700 3433 3122 gene locus_tag LOCUS_44710 3433 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44710 3368 4438 gene locus_tag LOCUS_44720 3368 4438 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067192.1 protein_id gnl|my_center|LOCUS_44720 5017 4418 gene locus_tag LOCUS_44730 5017 4418 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093976.1 protein_id gnl|my_center|LOCUS_44730 5158 5844 gene locus_tag LOCUS_44740 5158 5844 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035515.1 protein_id gnl|my_center|LOCUS_44740 5876 6952 gene locus_tag LOCUS_44750 gene zapE 5876 6952 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPZ4 protein_id gnl|my_center|LOCUS_44750 >Feature sequence281 1221 217 gene locus_tag LOCUS_44760 gene argF' 1221 217 CDS product N-acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8J2 protein_id gnl|my_center|LOCUS_44760 2021 1473 gene locus_tag LOCUS_44770 2021 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636501.2 protein_id gnl|my_center|LOCUS_44770 2084 3229 gene locus_tag LOCUS_44780 2084 3229 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036327.1 protein_id gnl|my_center|LOCUS_44780 3226 3867 gene locus_tag LOCUS_44790 3226 3867 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036328.1 protein_id gnl|my_center|LOCUS_44790 5740 4196 gene locus_tag LOCUS_44800 5740 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44800 6644 5733 gene locus_tag LOCUS_44810 6644 5733 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921131.1 protein_id gnl|my_center|LOCUS_44810 >Feature sequence282 624 388 gene locus_tag LOCUS_44820 624 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44820 1195 731 gene locus_tag LOCUS_44830 1195 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44830 1630 1313 gene locus_tag LOCUS_44840 1630 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44840 2420 2103 gene locus_tag LOCUS_44850 2420 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44850 4229 2517 gene locus_tag LOCUS_44860 gene sopT 4229 2517 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722319.1 protein_id gnl|my_center|LOCUS_44860 4884 4261 gene locus_tag LOCUS_44870 4884 4261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44870 5154 6395 gene locus_tag LOCUS_44880 5154 6395 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762307.1 protein_id gnl|my_center|LOCUS_44880 >Feature sequence283 1535 276 gene locus_tag LOCUS_44890 gene murA 1535 276 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZX85 protein_id gnl|my_center|LOCUS_44890 1764 1537 gene locus_tag LOCUS_44900 1764 1537 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037923.1 protein_id gnl|my_center|LOCUS_44900 2422 3399 gene locus_tag LOCUS_44910 2422 3399 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_44910 3402 4412 gene locus_tag LOCUS_44920 gene kpsF 3402 4412 CDS product arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P717 protein_id gnl|my_center|LOCUS_44920 4414 4962 gene locus_tag LOCUS_44930 4414 4962 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224883.1 protein_id gnl|my_center|LOCUS_44930 4959 5516 gene locus_tag LOCUS_44940 4959 5516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44940 5482 5982 gene locus_tag LOCUS_44950 gene lptA 5482 5982 CDS product lipopolysaccharide export system protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63XK5 protein_id gnl|my_center|LOCUS_44950 5986 6732 gene locus_tag LOCUS_44960 5986 6732 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094355.1 protein_id gnl|my_center|LOCUS_44960 >Feature sequence284 1165 392 gene locus_tag LOCUS_44970 gene hisF 1165 392 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9N9 protein_id gnl|my_center|LOCUS_44970 1884 1147 gene locus_tag LOCUS_44980 gene hisA 1884 1147 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E634 protein_id gnl|my_center|LOCUS_44980 2480 1881 gene locus_tag LOCUS_44990 gene hisH 2480 1881 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9P1 protein_id gnl|my_center|LOCUS_44990 3550 2477 gene locus_tag LOCUS_45000 gene hisB 3550 2477 CDS product histidine biosynthesis bifunctional protein HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QK9 protein_id gnl|my_center|LOCUS_45000 4593 3547 gene locus_tag LOCUS_45010 gene hisC 4593 3547 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58892 protein_id gnl|my_center|LOCUS_45010 5882 4590 gene locus_tag LOCUS_45020 gene hisD 5882 4590 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9P2 protein_id gnl|my_center|LOCUS_45020 6788 5886 gene locus_tag LOCUS_45030 gene hisG 6788 5886 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CLW6 protein_id gnl|my_center|LOCUS_45030 >Feature sequence285 369 1025 gene locus_tag LOCUS_45040 369 1025 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405204.1 protein_id gnl|my_center|LOCUS_45040 3281 1425 gene locus_tag LOCUS_45050 3281 1425 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_45050 6067 3284 gene locus_tag LOCUS_45060 6067 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339535.1 protein_id gnl|my_center|LOCUS_45060 >Feature sequence286 120 599 gene locus_tag LOCUS_45070 120 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45070 770 1162 gene locus_tag LOCUS_45080 770 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45080 1677 2063 gene locus_tag LOCUS_45090 1677 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45090 2502 2792 gene locus_tag LOCUS_45100 2502 2792 CDS product plasmid maintenance system killer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_45100 2866 3108 gene locus_tag LOCUS_45110 2866 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45110 4548 3493 gene locus_tag LOCUS_45120 4548 3493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45120 5720 4638 gene locus_tag LOCUS_45130 5720 4638 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083636.1 protein_id gnl|my_center|LOCUS_45130 6546 5980 gene locus_tag LOCUS_45140 6546 5980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45140 >Feature sequence287 62 505 gene locus_tag LOCUS_45150 62 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45150 572 892 gene locus_tag LOCUS_45160 572 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45160 889 2250 gene locus_tag LOCUS_45170 889 2250 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635937.2 protein_id gnl|my_center|LOCUS_45170 5161 2255 gene locus_tag LOCUS_45180 5161 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45180 6677 5682 gene locus_tag LOCUS_45190 6677 5682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918442.1 protein_id gnl|my_center|LOCUS_45190 >Feature sequence288 814 1494 gene locus_tag LOCUS_45200 814 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45200 1473 2588 gene locus_tag LOCUS_45210 1473 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45210 3141 3545 gene locus_tag LOCUS_45220 3141 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45220 3538 3816 gene locus_tag LOCUS_45230 3538 3816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45230 3908 4540 gene locus_tag LOCUS_45240 3908 4540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45240 4533 6416 gene locus_tag LOCUS_45250 4533 6416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45250 >Feature sequence289 268 101 gene locus_tag LOCUS_45260 268 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45260 549 1193 gene locus_tag LOCUS_45270 gene mtgA 549 1193 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KK53 protein_id gnl|my_center|LOCUS_45270 2075 1170 gene locus_tag LOCUS_45280 2075 1170 CDS product malate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035429.1 protein_id gnl|my_center|LOCUS_45280 2168 3922 gene locus_tag LOCUS_45290 2168 3922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039109.1 protein_id gnl|my_center|LOCUS_45290 4127 4873 gene locus_tag LOCUS_45300 gene etfB 4127 4873 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035863.1 protein_id gnl|my_center|LOCUS_45300 4873 5808 gene locus_tag LOCUS_45310 gene etfA 4873 5808 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035862.1 protein_id gnl|my_center|LOCUS_45310 5805 6398 gene locus_tag LOCUS_45320 5805 6398 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920504.1 protein_id gnl|my_center|LOCUS_45320 >Feature sequence290 168 464 gene locus_tag LOCUS_45330 168 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45330 750 1220 gene locus_tag LOCUS_45340 750 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45340 3018 1420 gene locus_tag LOCUS_45350 3018 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45350 3964 3008 gene locus_tag LOCUS_45360 3964 3008 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771391.1 protein_id gnl|my_center|LOCUS_45360 4384 3974 gene locus_tag LOCUS_45370 4384 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45370 5297 4353 gene locus_tag LOCUS_45380 gene wxcM 5297 4353 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035858.1 protein_id gnl|my_center|LOCUS_45380 <6495 5297 gene locus_tag LOCUS_45390 <6495 5297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103409.1:erythromycin biosynthesis sensory transduction protein EryC1 >Feature sequence291 1225 41 gene locus_tag LOCUS_45400 1225 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45400 1992 1222 gene locus_tag LOCUS_45410 1992 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036168.1 protein_id gnl|my_center|LOCUS_45410 3378 2125 gene locus_tag LOCUS_45420 gene icd 3378 2125 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L5 protein_id gnl|my_center|LOCUS_45420 4836 3448 gene locus_tag LOCUS_45430 gene purF 4836 3448 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51342 protein_id gnl|my_center|LOCUS_45430 4723 4944 gene locus_tag LOCUS_45440 4723 4944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45440 <6486 5097 gene locus_tag LOCUS_45450 <6486 5097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010950346.1:PE family protein >Feature sequence292 2247 2795 gene locus_tag LOCUS_45460 2247 2795 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5S3 protein_id gnl|my_center|LOCUS_45460 2827 3288 gene locus_tag LOCUS_45470 2827 3288 CDS product DUF55 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072063.1 protein_id gnl|my_center|LOCUS_45470 3285 3938 gene locus_tag LOCUS_45480 gene rpiA 3285 3938 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A7Z0 protein_id gnl|my_center|LOCUS_45480 4512 3979 gene locus_tag LOCUS_45490 4512 3979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45490 4670 4855 gene locus_tag LOCUS_45500 4670 4855 CDS product stress-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037304.1 protein_id gnl|my_center|LOCUS_45500 4852 5697 gene locus_tag LOCUS_45510 4852 5697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45510 >Feature sequence293 <1 793 gene locus_tag LOCUS_45520 <1 793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263179.1:molybdate ABC transporter substrate-binding protein 790 1479 gene locus_tag LOCUS_45530 gene modB 790 1479 CDS product molybdate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038307.1 protein_id gnl|my_center|LOCUS_45530 1476 2633 gene locus_tag LOCUS_45540 gene modC 1476 2633 CDS product molybdenum import ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M918 protein_id gnl|my_center|LOCUS_45540 3148 2747 gene locus_tag LOCUS_45550 3148 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45550 3776 4027 gene locus_tag LOCUS_45560 gene yefM 3776 4027 CDS product antitoxin YefM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P69346 protein_id gnl|my_center|LOCUS_45560 4024 4278 gene locus_tag LOCUS_45570 4024 4278 CDS product toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 protein_id gnl|my_center|LOCUS_45570 4620 4387 gene locus_tag LOCUS_45580 4620 4387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45580 5574 5098 gene locus_tag LOCUS_45590 5574 5098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45590 >Feature sequence294 863 2104 gene locus_tag LOCUS_45600 863 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_45600 2252 2599 gene locus_tag LOCUS_45610 2252 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45610 3475 2966 gene locus_tag LOCUS_45620 3475 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45620 5723 3639 gene locus_tag LOCUS_45630 gene fusA2 5723 3639 CDS product elongation factor G 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPM5 protein_id gnl|my_center|LOCUS_45630 >Feature sequence295 51 2201 gene locus_tag LOCUS_45640 51 2201 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 protein_id gnl|my_center|LOCUS_45640 2201 2980 gene locus_tag LOCUS_45650 2201 2980 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853568.1 protein_id gnl|my_center|LOCUS_45650 3637 3260 gene locus_tag LOCUS_45660 3637 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45660 4075 3683 gene locus_tag LOCUS_45670 4075 3683 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918016.1 protein_id gnl|my_center|LOCUS_45670 4301 4921 gene locus_tag LOCUS_45680 4301 4921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45680 4918 5406 gene locus_tag LOCUS_45690 4918 5406 CDS product auxin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405734.1 protein_id gnl|my_center|LOCUS_45690 >Feature sequence296 <1 1008 gene locus_tag LOCUS_45700 <1 1008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037028.1:long-chain-fatty-acid--CoA ligase 2819 1344 gene locus_tag LOCUS_45710 2819 1344 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113173.1 protein_id gnl|my_center|LOCUS_45710 3702 2812 gene locus_tag LOCUS_45720 3702 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940028.1 protein_id gnl|my_center|LOCUS_45720 4969 3710 gene locus_tag LOCUS_45730 4969 3710 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405216.1 protein_id gnl|my_center|LOCUS_45730 5694 4993 gene locus_tag LOCUS_45740 5694 4993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339247.1 protein_id gnl|my_center|LOCUS_45740 >Feature sequence297 531 2360 gene locus_tag LOCUS_45750 531 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45750 2357 4138 gene locus_tag LOCUS_45760 2357 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45760 4138 5211 gene locus_tag LOCUS_45770 4138 5211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45770 5208 5663 gene locus_tag LOCUS_45780 gene rcp1 5208 5663 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123131.1 protein_id gnl|my_center|LOCUS_45780 >Feature sequence298 425 871 gene locus_tag LOCUS_45790 425 871 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121094.1 protein_id gnl|my_center|LOCUS_45790 1327 1094 gene locus_tag LOCUS_45800 1327 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45800 1251 5096 gene locus_tag LOCUS_45810 1251 5096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45810 5209 6084 gene locus_tag LOCUS_45820 5209 6084 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400692.1 protein_id gnl|my_center|LOCUS_45820 >Feature sequence299 337 579 gene locus_tag LOCUS_45830 337 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45830 684 1637 gene locus_tag LOCUS_45840 684 1637 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814121.1 protein_id gnl|my_center|LOCUS_45840 3431 1623 gene locus_tag LOCUS_45850 gene egl2 3431 1623 CDS product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H9L4N3 protein_id gnl|my_center|LOCUS_45850 3486 5336 gene locus_tag LOCUS_45860 3486 5336 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108596.1 protein_id gnl|my_center|LOCUS_45860 >Feature sequence300 1829 1320 gene locus_tag LOCUS_45870 gene lspA 1829 1320 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIM3 protein_id gnl|my_center|LOCUS_45870 4651 1826 gene locus_tag LOCUS_45880 gene ileS 4651 1826 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBI4 protein_id gnl|my_center|LOCUS_45880 5783 4833 gene locus_tag LOCUS_45890 gene ribF 5783 4833 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBG7 protein_id gnl|my_center|LOCUS_45890 >Feature sequence301 5434 2654 gene locus_tag LOCUS_45900 5434 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45900 5592 5667 gene locus_tag LOCUS_t00360 5592 5667 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence302 486 1553 gene locus_tag LOCUS_45910 486 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45910 2482 1871 gene locus_tag LOCUS_45920 2482 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45920 2876 3892 gene locus_tag LOCUS_45930 2876 3892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45930 4360 3869 gene locus_tag LOCUS_45940 4360 3869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45940 4488 4853 gene locus_tag LOCUS_45950 4488 4853 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBZ0 protein_id gnl|my_center|LOCUS_45950 5479 4850 gene locus_tag LOCUS_45960 5479 4850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45960 >Feature sequence303 <1 501 gene locus_tag LOCUS_45970 <1 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390731.1:geranylgeranyl pyrophosphate synthase 508 1632 gene locus_tag LOCUS_45980 508 1632 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390730.1 protein_id gnl|my_center|LOCUS_45980 1677 2633 gene locus_tag LOCUS_45990 1677 2633 CDS product chlorophyll synthesis pathway protein BchC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390729.1 protein_id gnl|my_center|LOCUS_45990 2697 3638 gene locus_tag LOCUS_46000 2697 3638 CDS product chlorophyllide reductase iron protein subunit X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390728.1 protein_id gnl|my_center|LOCUS_46000 3638 5152 gene locus_tag LOCUS_46010 3638 5152 CDS product chlorophyllide reductase subunit Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390727.1 protein_id gnl|my_center|LOCUS_46010 >Feature sequence304 <1 2265 gene locus_tag LOCUS_46020 <1 2265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640062.1:TonB-dependent receptor 2490 4052 gene locus_tag LOCUS_46030 2490 4052 CDS product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920646.1 protein_id gnl|my_center|LOCUS_46030 4118 5437 gene locus_tag LOCUS_46040 4118 5437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46040 >Feature sequence305 756 166 gene locus_tag LOCUS_46050 756 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46050 1355 753 gene locus_tag LOCUS_46060 1355 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46060 1951 1430 gene locus_tag LOCUS_46070 1951 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46070 >Feature sequence306 725 384 gene locus_tag LOCUS_46080 725 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46080 848 1642 gene locus_tag LOCUS_46090 gene gloB 848 1642 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP80 protein_id gnl|my_center|LOCUS_46090 1731 1940 gene locus_tag LOCUS_46100 1731 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46100 2202 1873 gene locus_tag LOCUS_46110 2202 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46110 2358 2759 gene locus_tag LOCUS_46120 2358 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46120 4845 2749 gene locus_tag LOCUS_46130 4845 2749 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104891.1 protein_id gnl|my_center|LOCUS_46130 5214 4852 gene locus_tag LOCUS_46140 gene pilH 5214 4852 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036249.1 protein_id gnl|my_center|LOCUS_46140 >Feature sequence307 168 1391 gene locus_tag LOCUS_46150 gene acrE 168 1391 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038985.1 protein_id gnl|my_center|LOCUS_46150 1425 2108 gene locus_tag LOCUS_46160 gene tptC 1425 2108 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038986.1 protein_id gnl|my_center|LOCUS_46160 2108 3268 gene locus_tag LOCUS_46170 2108 3268 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038987.1 protein_id gnl|my_center|LOCUS_46170 3268 4440 gene locus_tag LOCUS_46180 3268 4440 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038988.1 protein_id gnl|my_center|LOCUS_46180 <5776 4778 gene locus_tag LOCUS_46190 <5776 4778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005454895.1:alcohol dehydrogenase >Feature sequence308 261 665 gene locus_tag LOCUS_46200 gene fur 261 665 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555142.1 protein_id gnl|my_center|LOCUS_46200 810 2015 gene locus_tag LOCUS_46210 gene gcdH 810 2015 CDS product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036619.1 protein_id gnl|my_center|LOCUS_46210 2103 4406 gene locus_tag LOCUS_46220 2103 4406 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948281.1 protein_id gnl|my_center|LOCUS_46220 4425 5321 gene locus_tag LOCUS_46230 4425 5321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46230 >Feature sequence309 2544 1381 gene locus_tag LOCUS_46240 gene metB 2544 1381 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037981.1 protein_id gnl|my_center|LOCUS_46240 3581 2541 gene locus_tag LOCUS_46250 gene metA 3581 2541 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6V8 protein_id gnl|my_center|LOCUS_46250 3914 4438 gene locus_tag LOCUS_46260 3914 4438 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MY1 protein_id gnl|my_center|LOCUS_46260 4435 4923 gene locus_tag LOCUS_46270 gene moaC 4435 4923 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGL3 protein_id gnl|my_center|LOCUS_46270 >Feature sequence310 270 1349 gene locus_tag LOCUS_46280 270 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031466.1 protein_id gnl|my_center|LOCUS_46280 2682 1945 gene locus_tag LOCUS_46290 2682 1945 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088861.1 protein_id gnl|my_center|LOCUS_46290 4040 2679 gene locus_tag LOCUS_46300 4040 2679 CDS product sulfite dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088862.1 protein_id gnl|my_center|LOCUS_46300 4592 4182 gene locus_tag LOCUS_46310 4592 4182 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810412.1 protein_id gnl|my_center|LOCUS_46310 <5617 4594 gene locus_tag LOCUS_46320 <5617 4594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119474.1:polyketide cyclase >Feature sequence311 157 1485 gene locus_tag LOCUS_46330 157 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46330 1617 2153 gene locus_tag LOCUS_46340 1617 2153 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123671.1 protein_id gnl|my_center|LOCUS_46340 2832 2203 gene locus_tag LOCUS_46350 2832 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46350 3015 3260 gene locus_tag LOCUS_46360 3015 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46360 3357 3593 gene locus_tag LOCUS_46370 gene rbpD 3357 3593 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115113.1 protein_id gnl|my_center|LOCUS_46370 3602 4372 gene locus_tag LOCUS_46380 3602 4372 CDS product chitooligosaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123674.1 protein_id gnl|my_center|LOCUS_46380 5085 4414 gene locus_tag LOCUS_46390 5085 4414 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085667.1 protein_id gnl|my_center|LOCUS_46390 5466 5149 gene locus_tag LOCUS_46400 5466 5149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46400 >Feature sequence312 945 34 gene locus_tag LOCUS_46410 945 34 CDS product NAD regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085337.1 protein_id gnl|my_center|LOCUS_46410 1468 935 gene locus_tag LOCUS_46420 1468 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46420 1658 2374 gene locus_tag LOCUS_46430 1658 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46430 2392 3423 gene locus_tag LOCUS_46440 gene ntrB 2392 3423 CDS product two-component system sensor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035444.1 protein_id gnl|my_center|LOCUS_46440 3420 4805 gene locus_tag LOCUS_46450 gene glnG 3420 4805 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175753.1 protein_id gnl|my_center|LOCUS_46450 >Feature sequence313 1248 778 gene locus_tag LOCUS_46460 gene rpsG 1248 778 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC53 protein_id gnl|my_center|LOCUS_46460 1639 1265 gene locus_tag LOCUS_46470 gene rpsL 1639 1265 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD0 protein_id gnl|my_center|LOCUS_46470 <5527 1833 gene locus_tag LOCUS_46480 <5527 1833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8PC55:DNA-directed RNA polymerase subunit beta' >Feature sequence314 2951 195 gene locus_tag LOCUS_46490 gene secA 2951 195 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCJ2 protein_id gnl|my_center|LOCUS_46490 4055 3120 gene locus_tag LOCUS_46500 4055 3120 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035969.1 protein_id gnl|my_center|LOCUS_46500 4082 4513 gene locus_tag LOCUS_46510 4082 4513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46510 5463 4552 gene locus_tag LOCUS_46520 gene lpxC 5463 4552 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P47205 protein_id gnl|my_center|LOCUS_46520 >Feature sequence315 17 1684 gene locus_tag LOCUS_46530 17 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46530 1849 2199 gene locus_tag LOCUS_46540 gene rbfA 1849 2199 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7U8 protein_id gnl|my_center|LOCUS_46540 2206 3096 gene locus_tag LOCUS_46550 gene truB 2206 3096 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72154 protein_id gnl|my_center|LOCUS_46550 4493 3444 gene locus_tag LOCUS_46560 4493 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46560 4431 4622 gene locus_tag LOCUS_46570 4431 4622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46570 >Feature sequence316 3328 1796 gene locus_tag LOCUS_46580 3328 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46580 3948 3424 gene locus_tag LOCUS_46590 3948 3424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46590 4530 3967 gene locus_tag LOCUS_46600 4530 3967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46600 4871 4545 gene locus_tag LOCUS_46610 4871 4545 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528592.1 protein_id gnl|my_center|LOCUS_46610 5063 5326 gene locus_tag LOCUS_46620 5063 5326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46620 >Feature sequence317 602 168 gene locus_tag LOCUS_46630 602 168 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH28 protein_id gnl|my_center|LOCUS_46630 1540 599 gene locus_tag LOCUS_46640 1540 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46640 1496 1675 gene locus_tag LOCUS_46650 1496 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46650 3149 1728 gene locus_tag LOCUS_46660 3149 1728 CDS product membrane-bound O-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379730.1 protein_id gnl|my_center|LOCUS_46660 3392 3583 gene locus_tag LOCUS_46670 3392 3583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46670 4581 3616 gene locus_tag LOCUS_46680 4581 3616 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142814.1 protein_id gnl|my_center|LOCUS_46680 4795 5169 gene locus_tag LOCUS_46690 4795 5169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_46690 >Feature sequence318 1104 439 gene locus_tag LOCUS_46700 gene ccmB 1104 439 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK41 protein_id gnl|my_center|LOCUS_46700 1724 1101 gene locus_tag LOCUS_46710 gene ccmA 1724 1101 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8M1 protein_id gnl|my_center|LOCUS_46710 1834 3183 gene locus_tag LOCUS_46720 gene gor 1834 3183 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189043.1 protein_id gnl|my_center|LOCUS_46720 >Feature sequence319 349 1494 gene locus_tag LOCUS_46730 349 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46730 3724 1571 gene locus_tag LOCUS_46740 3724 1571 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265529.1 protein_id gnl|my_center|LOCUS_46740 4199 3840 gene locus_tag LOCUS_46750 4199 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46750 <5197 4340 gene locus_tag LOCUS_46760 <5197 4340 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037261.1:DDE transposase >Feature sequence320 283 2532 gene locus_tag LOCUS_46770 283 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46770 4662 2482 gene locus_tag LOCUS_46780 4662 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46780 >Feature sequence321 <1 741 gene locus_tag LOCUS_46790 <1 741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262662.1:general secretion pathway protein GspA 738 902 gene locus_tag LOCUS_46800 738 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46800 1553 1353 gene locus_tag LOCUS_46810 1553 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46810 2331 1672 gene locus_tag LOCUS_46820 2331 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46820 2322 2690 gene locus_tag LOCUS_46830 2322 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46830 3210 3461 gene locus_tag LOCUS_46840 3210 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46840 3470 4048 gene locus_tag LOCUS_46850 3470 4048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46850 4045 4557 gene locus_tag LOCUS_46860 4045 4557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46860 4646 4909 gene locus_tag LOCUS_46870 4646 4909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46870 >Feature sequence322 397 774 gene locus_tag LOCUS_46880 397 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101585.1 protein_id gnl|my_center|LOCUS_46880 806 2608 gene locus_tag LOCUS_46890 gene msbA 806 2608 CDS product lipid A export ATP-binding/permease protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83D84 protein_id gnl|my_center|LOCUS_46890 3524 2559 gene locus_tag LOCUS_46900 gene htrB 3524 2559 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038820.1 protein_id gnl|my_center|LOCUS_46900 4378 3521 gene locus_tag LOCUS_46910 4378 3521 CDS product chloramphenicol resistance permease RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099254.1 protein_id gnl|my_center|LOCUS_46910 >Feature sequence323 <1 2088 gene locus_tag LOCUS_46920 <1 2088 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038525.1:TonB-dependent receptor 2641 4425 gene locus_tag LOCUS_46930 2641 4425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46930 4531 4779 gene locus_tag LOCUS_46940 4531 4779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46940 >Feature sequence324 723 307 gene locus_tag LOCUS_46950 723 307 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089880.1 protein_id gnl|my_center|LOCUS_46950 2472 1495 gene locus_tag LOCUS_46960 gene lipA 2472 1495 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P590 protein_id gnl|my_center|LOCUS_46960 3164 2469 gene locus_tag LOCUS_46970 gene lipB 3164 2469 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHQ5 protein_id gnl|my_center|LOCUS_46970 3445 3152 gene locus_tag LOCUS_46980 3445 3152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46980 4589 3435 gene locus_tag LOCUS_46990 gene dacC 4589 3435 CDS product D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 protein_id gnl|my_center|LOCUS_46990 >Feature sequence325 2886 1675 gene locus_tag LOCUS_47000 gene ahcY 2886 1675 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKL5 protein_id gnl|my_center|LOCUS_47000 4116 2890 gene locus_tag LOCUS_47010 4116 2890 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87M21 protein_id gnl|my_center|LOCUS_47010 <4807 4113 gene locus_tag LOCUS_47020 <4807 4113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086179.1:transcriptional regulator >Feature sequence326 858 2948 gene locus_tag LOCUS_47030 858 2948 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530022.1 protein_id gnl|my_center|LOCUS_47030 2945 4567 gene locus_tag LOCUS_47040 2945 4567 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920663.1 protein_id gnl|my_center|LOCUS_47040 >Feature sequence327 862 206 gene locus_tag LOCUS_47050 862 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47050 1209 859 gene locus_tag LOCUS_47060 1209 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47060 1754 1206 gene locus_tag LOCUS_47070 gene rpoE 1754 1206 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941382.1 protein_id gnl|my_center|LOCUS_47070 1921 2553 gene locus_tag LOCUS_47080 1921 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47080 2575 4719 gene locus_tag LOCUS_47090 gene priA 2575 4719 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CL19 protein_id gnl|my_center|LOCUS_47090 >Feature sequence328 945 22 gene locus_tag LOCUS_47100 945 22 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071997.1 protein_id gnl|my_center|LOCUS_47100 1369 3480 gene locus_tag LOCUS_47110 1369 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47110 <4771 3611 gene locus_tag LOCUS_47120 <4771 3611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002210166.1:outer membrane protein assembly factor >Feature sequence329 2580 1330 gene locus_tag LOCUS_47130 2580 1330 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036480.1 protein_id gnl|my_center|LOCUS_47130 2693 4003 gene locus_tag LOCUS_47140 2693 4003 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708034.1 protein_id gnl|my_center|LOCUS_47140 4000 4536 gene locus_tag LOCUS_47150 4000 4536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47150 >Feature sequence330 2249 1695 gene locus_tag LOCUS_47160 2249 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47160 2652 3032 gene locus_tag LOCUS_47170 2652 3032 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265654.1 protein_id gnl|my_center|LOCUS_47170 3413 3216 gene locus_tag LOCUS_47180 3413 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47180 3618 4442 gene locus_tag LOCUS_47190 3618 4442 CDS product amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882799.1 protein_id gnl|my_center|LOCUS_47190 >Feature sequence331 346 101 gene locus_tag LOCUS_47200 346 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47200 1115 453 gene locus_tag LOCUS_47210 1115 453 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 protein_id gnl|my_center|LOCUS_47210 1355 3370 gene locus_tag LOCUS_47220 1355 3370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47220 3446 4447 gene locus_tag LOCUS_47230 3446 4447 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638865.2 protein_id gnl|my_center|LOCUS_47230 >Feature sequence332 2068 1121 gene locus_tag LOCUS_47240 gene pqqB 2068 1121 CDS product coenzyme PQQ synthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TEB9 protein_id gnl|my_center|LOCUS_47240 2643 2050 gene locus_tag LOCUS_47250 2643 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47250 2810 4096 gene locus_tag LOCUS_47260 2810 4096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47260 >Feature sequence333 1349 387 gene locus_tag LOCUS_47270 1349 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47270 1552 4449 gene locus_tag LOCUS_47280 1552 4449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47280 >Feature sequence334 414 734 gene locus_tag LOCUS_47290 414 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47290 854 1276 gene locus_tag LOCUS_47300 854 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705410.1 protein_id gnl|my_center|LOCUS_47300 1383 1589 gene locus_tag LOCUS_47310 1383 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47310 1671 3953 gene locus_tag LOCUS_47320 1671 3953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47320 >Feature sequence335 1976 519 gene locus_tag LOCUS_47330 gene cls 1976 519 CDS product cardiolipin synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122347.1 protein_id gnl|my_center|LOCUS_47330 2863 1973 gene locus_tag LOCUS_47340 2863 1973 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89PT3 protein_id gnl|my_center|LOCUS_47340 3891 3055 gene locus_tag LOCUS_47350 3891 3055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47350 >Feature sequence336 2699 1302 gene locus_tag LOCUS_47360 2699 1302 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073369.1 protein_id gnl|my_center|LOCUS_47360 3331 2777 gene locus_tag LOCUS_47370 3331 2777 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036085.1 protein_id gnl|my_center|LOCUS_47370 3477 4307 gene locus_tag LOCUS_47380 gene nei 3477 4307 CDS product endonuclease 8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83LZ7 protein_id gnl|my_center|LOCUS_47380 >Feature sequence337 181 106 gene locus_tag LOCUS_t00370 181 106 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 2101 260 gene locus_tag LOCUS_47390 2101 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637660.2 protein_id gnl|my_center|LOCUS_47390 >Feature sequence338 449 63 gene locus_tag LOCUS_47400 gene doc 449 63 CDS product death-on-curing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921192.1 protein_id gnl|my_center|LOCUS_47400 651 439 gene locus_tag LOCUS_47410 651 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47410 1385 930 gene locus_tag LOCUS_47420 1385 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47420 >Feature sequence339 2500 2826 gene locus_tag LOCUS_47430 2500 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47430 3018 3908 gene locus_tag LOCUS_47440 3018 3908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112778.1 protein_id gnl|my_center|LOCUS_47440 >Feature sequence340 2914 161 gene locus_tag LOCUS_47450 2914 161 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140762.1 protein_id gnl|my_center|LOCUS_47450 3095 3610 gene locus_tag LOCUS_47460 3095 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47460 >Feature sequence341 3158 420 gene locus_tag LOCUS_47470 gene rpfA 3158 420 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9K3 protein_id gnl|my_center|LOCUS_47470 3930 3337 gene locus_tag LOCUS_47480 gene hflD 3930 3337 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44796 protein_id gnl|my_center|LOCUS_47480 >Feature sequence342 <1 985 gene locus_tag LOCUS_47490 <1 985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227211.1:type IV secretion protein Rhs 991 1572 gene locus_tag LOCUS_47500 991 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47500 1696 2535 gene locus_tag LOCUS_47510 1696 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47510 3280 2546 gene locus_tag LOCUS_47520 3280 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102969.1 protein_id gnl|my_center|LOCUS_47520 >Feature sequence343 221 1498 gene locus_tag LOCUS_47530 gene rhlE 221 1498 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSL5 protein_id gnl|my_center|LOCUS_47530 2963 1527 gene locus_tag LOCUS_47540 2963 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47540 3916 2963 gene locus_tag LOCUS_47550 3916 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47550 >Feature sequence344 158 499 gene locus_tag LOCUS_47560 158 499 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482886.1 protein_id gnl|my_center|LOCUS_47560 3139 500 gene locus_tag LOCUS_47570 3139 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47570 3682 3161 gene locus_tag LOCUS_47580 3682 3161 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123671.1 protein_id gnl|my_center|LOCUS_47580 >Feature sequence345 754 1581 gene locus_tag LOCUS_47590 754 1581 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074319.1 protein_id gnl|my_center|LOCUS_47590 3004 1676 gene locus_tag LOCUS_47600 gene dhlE 3004 1676 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162675.1 protein_id gnl|my_center|LOCUS_47600 3588 3001 gene locus_tag LOCUS_47610 3588 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47610 >Feature sequence346 24 1304 gene locus_tag LOCUS_47620 24 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47620 2025 1312 gene locus_tag LOCUS_47630 gene aat 2025 1312 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PDB1 protein_id gnl|my_center|LOCUS_47630 3147 2035 gene locus_tag LOCUS_47640 3147 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114811.1 protein_id gnl|my_center|LOCUS_47640 <3770 3156 gene locus_tag LOCUS_47650 <3770 3156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P994:thioredoxin reductase >Feature sequence347 284 2509 gene locus_tag LOCUS_47660 284 2509 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_47660 2623 3219 gene locus_tag LOCUS_47670 2623 3219 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083595.1 protein_id gnl|my_center|LOCUS_47670 3292 3696 gene locus_tag LOCUS_47680 3292 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47680 >Feature sequence348 600 866 gene locus_tag LOCUS_47690 600 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47690 1032 910 gene locus_tag LOCUS_47700 1032 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47700 1783 3315 gene locus_tag LOCUS_47710 1783 3315 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368514.1 protein_id gnl|my_center|LOCUS_47710 >Feature sequence349 919 119 gene locus_tag LOCUS_47720 919 119 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455384.1 protein_id gnl|my_center|LOCUS_47720 1432 1001 gene locus_tag LOCUS_47730 1432 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47730 1950 1606 gene locus_tag LOCUS_47740 1950 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47740 2368 1961 gene locus_tag LOCUS_47750 2368 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47750 2523 3473 gene locus_tag LOCUS_47760 2523 3473 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978446.1 protein_id gnl|my_center|LOCUS_47760 >Feature sequence350 45 392 gene locus_tag LOCUS_47770 45 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47770 737 432 gene locus_tag LOCUS_47780 737 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47780 3303 724 gene locus_tag LOCUS_47790 3303 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47790 >Feature sequence351 432 52 gene locus_tag LOCUS_47800 gene sdhD 432 52 CDS product succinate dehydrogenase membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037282.1 protein_id gnl|my_center|LOCUS_47800 815 429 gene locus_tag LOCUS_47810 gene sdhC 815 429 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083343.1 protein_id gnl|my_center|LOCUS_47810 2719 1109 gene locus_tag LOCUS_47820 2719 1109 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089209.1 protein_id gnl|my_center|LOCUS_47820 <3615 2733 gene locus_tag LOCUS_47830 <3615 2733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003101357.1:acetolactate synthase >Feature sequence352 406 1719 gene locus_tag LOCUS_47840 gene pepQ 406 1719 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEL3 protein_id gnl|my_center|LOCUS_47840 2034 3293 gene locus_tag LOCUS_47850 2034 3293 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227900.1 protein_id gnl|my_center|LOCUS_47850 >Feature sequence353 1284 1541 gene locus_tag LOCUS_47860 1284 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47860 1553 2455 gene locus_tag LOCUS_47870 1553 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47870 2458 3372 gene locus_tag LOCUS_47880 2458 3372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47880 >Feature sequence354 1640 738 gene locus_tag LOCUS_47890 gene glyQ 1640 738 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3I4 protein_id gnl|my_center|LOCUS_47890 2524 2018 gene locus_tag LOCUS_47900 2524 2018 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096210.1 protein_id gnl|my_center|LOCUS_47900 >Feature sequence355 280 3534 gene locus_tag LOCUS_47910 280 3534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_47910 >Feature sequence356 677 799 gene locus_tag LOCUS_47920 677 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47920 2715 1522 gene locus_tag LOCUS_47930 gene rimK 2715 1522 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNW8 protein_id gnl|my_center|LOCUS_47930 >Feature sequence357 391 1254 gene locus_tag LOCUS_47940 gene glpQ 391 1254 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102904.1 protein_id gnl|my_center|LOCUS_47940 >Feature sequence358 633 307 gene locus_tag LOCUS_47950 633 307 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370060.1 protein_id gnl|my_center|LOCUS_47950 1506 730 gene locus_tag LOCUS_47960 1506 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036528.1 protein_id gnl|my_center|LOCUS_47960 2065 1493 gene locus_tag LOCUS_47970 2065 1493 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942963.1 protein_id gnl|my_center|LOCUS_47970 2774 2136 gene locus_tag LOCUS_47980 2774 2136 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105706.1 protein_id gnl|my_center|LOCUS_47980 <3473 2771 gene locus_tag LOCUS_47990 <3473 2771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704691.1:MarR family transcriptional regulator >Feature sequence359 >Feature sequence360 2122 59 gene locus_tag LOCUS_48000 2122 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918443.1 protein_id gnl|my_center|LOCUS_48000 3124 2144 gene locus_tag LOCUS_48010 3124 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918444.1 protein_id gnl|my_center|LOCUS_48010 >Feature sequence361 864 352 gene locus_tag LOCUS_48020 864 352 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918364.1 protein_id gnl|my_center|LOCUS_48020 1418 861 gene locus_tag LOCUS_48030 1418 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038901.1 protein_id gnl|my_center|LOCUS_48030 2726 1956 gene locus_tag LOCUS_48040 2726 1956 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919591.1 protein_id gnl|my_center|LOCUS_48040 <3395 2779 gene locus_tag LOCUS_48050 <3395 2779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263801.1:lipoprotein >Feature sequence362 3 1646 gene locus_tag LOCUS_48060 3 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48060 1693 2043 gene locus_tag LOCUS_48070 1693 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48070 2761 2066 gene locus_tag LOCUS_48080 2761 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48080 <3341 2758 gene locus_tag LOCUS_48090 <3341 2758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8PAD4:exodeoxyribonuclease I >Feature sequence363 1108 11 gene locus_tag LOCUS_48100 gene mnmA 1108 11 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZFQ5 protein_id gnl|my_center|LOCUS_48100 1611 1105 gene locus_tag LOCUS_48110 gene mutT 1611 1105 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037129.1 protein_id gnl|my_center|LOCUS_48110 2521 1604 gene locus_tag LOCUS_48120 gene rbcR 2521 1604 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035491.1 protein_id gnl|my_center|LOCUS_48120 >Feature sequence364 1473 145 gene locus_tag LOCUS_48130 gene dnaA 1473 145 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKT2 protein_id gnl|my_center|LOCUS_48130 1663 2148 gene locus_tag LOCUS_48140 1663 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48140 2194 3054 gene locus_tag LOCUS_48150 2194 3054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48150 >Feature sequence365 >Feature sequence366 1414 461 gene locus_tag LOCUS_48160 1414 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48160 1993 1556 gene locus_tag LOCUS_48170 1993 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48170 2550 2768 gene locus_tag LOCUS_48180 2550 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48180 2826 3140 gene locus_tag LOCUS_48190 2826 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48190 >Feature sequence367 <1 669 gene locus_tag LOCUS_48200 <1 669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87LY0:histidine kinase 1119 682 gene locus_tag LOCUS_48210 1119 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48210 2394 1237 gene locus_tag LOCUS_48220 2394 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48220 2912 2391 gene locus_tag LOCUS_48230 2912 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48230 >Feature sequence368 1651 140 gene locus_tag LOCUS_48240 1651 140 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385794.1 protein_id gnl|my_center|LOCUS_48240 2083 1688 gene locus_tag LOCUS_48250 2083 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257245.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48250 2258 3043 gene locus_tag LOCUS_48260 gene dapB 2258 3043 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7N0 protein_id gnl|my_center|LOCUS_48260 >Feature sequence369 1174 2208 gene locus_tag LOCUS_48270 1174 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48270 >Feature sequence370 486 1628 gene locus_tag LOCUS_48280 486 1628 CDS product YggW family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038356.1 protein_id gnl|my_center|LOCUS_48280 2379 1600 gene locus_tag LOCUS_48290 2379 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204774.1 protein_id gnl|my_center|LOCUS_48290 >Feature sequence371 158 2896 gene locus_tag LOCUS_48300 158 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48300 >Feature sequence372 1610 129 gene locus_tag LOCUS_48310 gene glpK1 1610 129 CDS product glycerol kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY41 protein_id gnl|my_center|LOCUS_48310 1930 1607 gene locus_tag LOCUS_48320 1930 1607 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947640.1 protein_id gnl|my_center|LOCUS_48320 2182 2874 gene locus_tag LOCUS_48330 2182 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48330 >Feature sequence373 2136 577 gene locus_tag LOCUS_48340 2136 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48340 2368 2694 gene locus_tag LOCUS_48350 2368 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48350 >Feature sequence374 1884 100 gene locus_tag LOCUS_48360 gene oppA 1884 100 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206613.1 protein_id gnl|my_center|LOCUS_48360 >Feature sequence375 27 1292 gene locus_tag LOCUS_48370 27 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48370 1414 1767 gene locus_tag LOCUS_48380 1414 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113848.1 protein_id gnl|my_center|LOCUS_48380 1764 2759 gene locus_tag LOCUS_48390 1764 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48390 >Feature sequence376 1415 795 gene locus_tag LOCUS_48400 1415 795 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083090.1 protein_id gnl|my_center|LOCUS_48400 2569 1412 gene locus_tag LOCUS_48410 2569 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48410 >Feature sequence377 721 1617 gene locus_tag LOCUS_48420 gene aguB 721 1617 CDS product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941690.1 protein_id gnl|my_center|LOCUS_48420 1614 2822 gene locus_tag LOCUS_48430 gene traB 1614 2822 CDS product pheromone shutdown protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037346.1 protein_id gnl|my_center|LOCUS_48430 >Feature sequence378 >Feature sequence379 2 853 gene locus_tag LOCUS_48440 2 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48440 799 1824 gene locus_tag LOCUS_48450 799 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48450 >Feature sequence380 1615 752 gene locus_tag LOCUS_48460 1615 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29370 protein_id gnl|my_center|LOCUS_48460 1642 2103 gene locus_tag LOCUS_48470 1642 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114062.1 protein_id gnl|my_center|LOCUS_48470 >Feature sequence381 9 1256 gene locus_tag LOCUS_48480 9 1256 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021346.1 protein_id gnl|my_center|LOCUS_48480 1249 1671 gene locus_tag LOCUS_48490 1249 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48490 2106 1840 gene locus_tag LOCUS_48500 2106 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48500 >Feature sequence382 9 218 gene locus_tag LOCUS_48510 9 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48510 941 414 gene locus_tag LOCUS_48520 941 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48520 1249 2139 gene locus_tag LOCUS_48530 1249 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085391.1 protein_id gnl|my_center|LOCUS_48530 >Feature sequence383 1346 147 gene locus_tag LOCUS_48540 1346 147 CDS product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367128.1 protein_id gnl|my_center|LOCUS_48540 1919 1374 gene locus_tag LOCUS_48550 1919 1374 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813206.1 protein_id gnl|my_center|LOCUS_48550 >Feature sequence384 739 62 gene locus_tag LOCUS_48560 gene lolD 739 62 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZV73 protein_id gnl|my_center|LOCUS_48560 1976 732 gene locus_tag LOCUS_48570 gene lolC 1976 732 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037277.1 protein_id gnl|my_center|LOCUS_48570 2132 1980 gene locus_tag LOCUS_48580 2132 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48580 2124 2315 gene locus_tag LOCUS_48590 2124 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48590 >Feature sequence385 265 615 gene locus_tag LOCUS_48600 gene pilZ 265 615 CDS product type 4 fimbrial biogenesis protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_48600 <2373 659 gene locus_tag LOCUS_48610 <2373 659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036460.1:3-hydroxyacyl-CoA dehydrogenase >Feature sequence386 456 190 gene locus_tag LOCUS_48620 456 190 CDS product UPF0125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZH12 protein_id gnl|my_center|LOCUS_48620 562 1071 gene locus_tag LOCUS_48630 562 1071 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920713.1 protein_id gnl|my_center|LOCUS_48630 1773 1147 gene locus_tag LOCUS_48640 1773 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48640 2033 2311 gene locus_tag LOCUS_48650 2033 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48650 >Feature sequence387 968 636 gene locus_tag LOCUS_48660 gene yajC 968 636 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037519.1 protein_id gnl|my_center|LOCUS_48660 1989 1294 gene locus_tag LOCUS_48670 gene dnaQ 1989 1294 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A1H0 protein_id gnl|my_center|LOCUS_48670 >Feature sequence388 140 583 gene locus_tag LOCUS_48680 140 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_48680 735 1778 gene locus_tag LOCUS_48690 735 1778 CDS product IS91 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118153.1 protein_id gnl|my_center|LOCUS_48690 >Feature sequence389 >Feature sequence390 93 911 gene locus_tag LOCUS_48700 93 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48700 1545 976 gene locus_tag LOCUS_48710 gene dcd 1545 976 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63W86 protein_id gnl|my_center|LOCUS_48710 <2082 1542 gene locus_tag LOCUS_48720 <2082 1542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H2WIY7:iron-sulfur cluster carrier protein >Feature sequence391 814 56 gene locus_tag LOCUS_48730 814 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48730 1044 1313 gene locus_tag LOCUS_48740 1044 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48740 >Feature sequence392 636 1514 gene locus_tag LOCUS_48750 gene mucB 636 1514 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930931.1 protein_id gnl|my_center|LOCUS_48750 1511 1897 gene locus_tag LOCUS_48760 1511 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48760 >Feature sequence393 1812 1165 gene locus_tag LOCUS_48770 1812 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48770 >Feature sequence394 1573 842 gene locus_tag LOCUS_48780 gene cobB 1573 842 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67919 protein_id gnl|my_center|LOCUS_48780 >Feature sequence395 1118 1507 gene locus_tag LOCUS_48790 gene queF 1118 1507 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMA3 protein_id gnl|my_center|LOCUS_48790 1612 1851 gene locus_tag LOCUS_48800 1612 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48800 >Feature sequence396 1336 413 gene locus_tag LOCUS_48810 1336 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144116.1 protein_id gnl|my_center|LOCUS_48810 <1902 1356 gene locus_tag LOCUS_48820 <1902 1356 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974101.1:gamma-glutamyltranspeptidase >Feature sequence397 226 1308 gene locus_tag LOCUS_48830 226 1308 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729232.1 protein_id gnl|my_center|LOCUS_48830 >Feature sequence398 278 943 gene locus_tag LOCUS_48840 278 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48840 >Feature sequence399 >Feature sequence400 >Feature sequence401