COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.18 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..368582 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 106..462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS 556..1317 product biopolymer transport protein ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C7L9 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene exbB CDS 1375..1800 product biopolymer transport protein exbD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C7M0 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene exbD1 CDS 1804..2217 product biopolymer transport protein exbD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C7I9 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene exbD2 CDS 2320..3780 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035272.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 gene cls CDS 3821..4090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS 4100..4843 product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PEG8 transl_table 11 codon_start 1 locus_tag LOCUS_00070 gene pdxJ CDS 4988..5239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(5385..5609) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205394.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS 5690..6025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS 6176..7267 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035273.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS 7984..9186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 9183..10442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 11515..12198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(12690..13238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 13637..14293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS 14773..15936 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFZ8 transl_table 11 codon_start 1 locus_tag LOCUS_00170 gene xerC CDS 15957..17789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS 17826..19853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(19828..20244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS 20667..21137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS complement(21531..22427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(22558..22803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS complement(23626..24663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(24679..25866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS 26855..27313 product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888792.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS 27583..28305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS complement(28396..29103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635411.2 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS complement(29211..30227) product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PE85 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene fbp CDS complement(30566..31768) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PE84 transl_table 11 codon_start 1 locus_tag LOCUS_00300 gene tyrB CDS 31940..34030 product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035356.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 gene yncD CDS complement(34142..34486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 34634..35032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00330 note possible pseudo, frameshifted CDS 35199..36119 product non-homologous end joining protein Ku inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PE77 transl_table 11 codon_start 1 locus_tag LOCUS_00340 gene ku CDS 36123..38609 product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037451.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 gene lig3 CDS complement(38681..39073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(39201..40229) product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096816.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 gene adhA CDS complement(40326..40964) product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225133.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 gene eda CDS complement(41082..41693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS 41911..42966 product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035407.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(43068..43961) product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035413.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 gene phhA CDS 44129..44572 product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035414.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS 44729..45472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS complement(45519..46556) product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035416.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(46695..47708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635555.2 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 47868..50138 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036237.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene fyuA CDS complement(50251..51090) product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P342 transl_table 11 codon_start 1 locus_tag LOCUS_00470 gene phoC CDS 51352..52230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071847.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS 52242..53450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(53594..54415) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035418.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 gene ylmA CDS 54567..55769 product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635557.2 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS 55766..56098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035420.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 56113..56751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS 56805..57617 product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3C4 transl_table 11 codon_start 1 locus_tag LOCUS_00540 gene mutM CDS 57723..59327 product glucans biosynthesis protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3C6 transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene opgD CDS complement(59364..60068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(60170..60790) product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3C8 transl_table 11 codon_start 1 locus_tag LOCUS_00570 gene tdk CDS 60892..62868 product ATP-dependent DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3D2 transl_table 11 codon_start 1 locus_tag LOCUS_00580 gene rep CDS 63155..63679 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039207.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(63805..64455) product UPF0502 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3D5 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS 64557..65477 product 5'-nucleotidase, lipoprotein e(P4) family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039204.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 gene lppC CDS 65474..66199 product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3D7 transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene pyrF CDS 66418..67239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 67571..68473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639468.2 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 68473..71109 product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3E3 transl_table 11 codon_start 1 locus_tag LOCUS_00650 gene plsB CDS complement(71228..71431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039195.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS 71523..72443 product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3H2 transl_table 11 codon_start 1 locus_tag LOCUS_00670 gene ttcA CDS 72480..73385 product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3H3 transl_table 11 codon_start 1 locus_tag LOCUS_00680 gene rdgC CDS 73445..74224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039166.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS 74360..74656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(74757..75623) product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039702.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS 75790..78192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(78178..79623) product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035289.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 gene gltD CDS complement(79716..84170) product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035290.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 gene gltB CDS complement(84346..84738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035291.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 84847..85899 product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035292.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(85933..86241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 86123..86350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS 86437..87543 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811351.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(87577..88659) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143091.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 88851..89237 product methicillin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035303.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 gene mecI CDS 89241..91241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035304.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(91286..91600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(91676..92698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(92695..95184) product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035312.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(95278..96498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 96621..97139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS 97180..97854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035389.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(97925..99733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035345.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(99730..101904) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035346.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(101901..103022) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035347.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS complement(103019..103903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035348.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS complement(103923..104906) product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035349.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 gene moxR CDS complement(104923..105630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635487.2 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(105630..106964) product TldD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035351.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene tldD CDS complement(106986..108620) product TldD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035352.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 gene tldD CDS complement(108651..110282) product TldD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035353.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 gene tldD CDS 110894..111508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035344.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(111593..115279) product indolepyruvate ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635565.2 transl_table 11 codon_start 1 locus_tag LOCUS_00990 gene iorA CDS 115449..116084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035428.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(116661..118145) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113173.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS 118269..118898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035431.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene parA CDS 118948..119424 product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035432.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 119429..120046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035433.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS 120043..122082 product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035434.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene cls CDS 122093..122527 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635573.2 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 122648..123439 product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035436.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS 123447..124481 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035437.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 124538..126607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035438.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS 126618..127229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035439.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS complement(127354..127833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS complement(127962..128789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040034.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS complement(128863..129657) product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDZ9 transl_table 11 codon_start 1 locus_tag LOCUS_01130 gene uppP CDS 129881..131290 product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDZ8 transl_table 11 codon_start 1 locus_tag LOCUS_01140 gene glnA CDS 131633..131971 product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005992714.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 gene glnB CDS 131994..133421 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDZ7 transl_table 11 codon_start 1 locus_tag LOCUS_01160 gene amtB CDS 133869..134210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS 134324..134902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS 135131..135457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS 135481..136257 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038886.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS 136386..137561 product membrane-bound lytic murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY34 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS 137645..137959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS 138041..139102 product two-component system sensor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035444.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 gene ntrB CDS 139095..140543 product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035445.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 gene ntrC CDS 140637..141206 product superoxide dismutase [Cu-Zn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDZ4 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene yojM CDS 141238..141864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(141986..142873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035449.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 142982..144262 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035450.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 gene yfcY CDS complement(144418..145713) product porphyrin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035452.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 gene hemY CDS complement(145720..146697) product uroporphyrin-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035453.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(146802..147611) product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035454.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene hemD CDS 147647..148114 product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035456.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 148147..148572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035457.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS 148672..149067 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035458.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 note possible pseudo, internal stop codon, frameshifted CDS 149168..149686 product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDY1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 gene secB CDS 149707..150732 product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDY0 transl_table 11 codon_start 1 locus_tag LOCUS_01360 gene gpsA CDS complement(150883..151359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS 151494..152156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS 152279..153406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(153392..154036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS 154429..154770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(154870..155895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(156381..157067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS complement(157226..157498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS complement(157755..158783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 159017..159592 product Ax21 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035461.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 159762..160088 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247462.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(160110..161027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038184.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 160972..161154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS 161249..162223 product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531010.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS 162375..162791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(162888..163472) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766257.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS complement(163469..165658) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035914.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(165867..167033) product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035915.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(167120..167527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS complement(167874..168512) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192810.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS 168588..172187 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MJS2 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene bvgS CDS complement(172181..172582) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089377.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(172648..174324) product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065122.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS 174582..175745 product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036619.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene gcdH CDS complement(175902..176381) product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDX5 transl_table 11 codon_start 1 locus_tag LOCUS_01610 gene trmL CDS complement(176451..176927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035466.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 177294..180191 product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038616.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS 180350..180667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035467.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS 180771..181787 product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035468.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 gene fabH CDS 181846..182793 product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035472.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene dhaA CDS 182819..183052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS complement(183165..183596) product zinc/iron-chelating domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035473.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 gene ykgJ CDS 183701..185359 product peptide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635613.2 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 185356..186348 product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035475.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene cdh CDS 186431..186586 product UPF0391 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CLW2 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS complement(186653..187738) product D-alanine--D-alanine ligase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDW3 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene ddlA CDS complement(188023..188784) product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071010.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(188929..190893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(190899..193157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(193150..193377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(193377..193607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(193619..194401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951065.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(194398..196098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(196098..197072) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(197076..198050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS complement(198053..201556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS 201556..201786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(201741..202250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS complement(202250..203005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(203009..203221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(203218..203694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(203691..204224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(204234..204716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(204877..205821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286902.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS complement(205847..206188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(206211..207416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273072.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS complement(207713..208282) product virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938413.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(208282..209559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(209563..211089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938419.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(211086..212822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167501.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(212823..213380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS complement(213385..213681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227700.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(213705..214022) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777272.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS complement(214019..214525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS complement(214525..215043) product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N9C0 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene ybcS CDS complement(215238..215738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS complement(215766..216167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS 216228..216440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS 216437..216670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS 216667..216960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS 216975..217910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533821.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 217912..219726 product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990532.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS 219726..219884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS 219881..221056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602369.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS 221058..221294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 221287..221532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 221532..221840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 221842..222231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS 222221..222496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS 222489..222716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 222713..223192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS 223192..223446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS 223443..224054 product sulfate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070973.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS 224056..224739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 224736..225053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739863.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 225040..225945 product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3H3 transl_table 11 codon_start 1 locus_tag LOCUS_02220 gene rdgC CDS 225954..226322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 226315..226794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS 226784..226960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS 226957..227421 product GemA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939964.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 227418..227774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS 227953..228588 product sterol-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035478.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS 228585..230240 product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDW1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 gene ubiB CDS 230246..230824 product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706521.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 230931..231698 product pseudouridylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035480.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(231774..232301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035481.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS 232435..232866 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035482.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS 232871..233473 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035483.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS 233586..235742 product dipeptidyl carboxypeptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035485.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 gene dcp CDS complement(236060..236506) product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039151.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene aroD CDS complement(236510..236911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS 237094..237720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS 237844..239100 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095819.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS complement(239193..240101) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095817.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS 240198..240512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS complement(240482..241399) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035491.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene rbcR CDS 241561..243183 product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035492.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 gene mls CDS 243250..244551 product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035493.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 gene aceA CDS 244894..245934 product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035494.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS 245948..248437 product putative peptide modification system cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035495.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(248445..248741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 248880..250046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS complement(250066..252048) product 3-methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035499.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 gene accC CDS complement(252075..253685) product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035500.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 gene accD CDS complement(253696..254859) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035501.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 gene acdA CDS 255020..255628 product AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035502.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 255848..256366 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035509.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 256540..257985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS complement(258097..258954) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035514.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 258998..259669 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035515.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 259666..260766 product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDS4 transl_table 11 codon_start 1 locus_tag LOCUS_02570 gene zapE CDS complement(260825..261661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036593.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 262191..264593 product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K496 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 264712..265731 product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K3C2 transl_table 11 codon_start 1 locus_tag LOCUS_02600 gene nrdB CDS complement(265889..266524) product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090854.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 266615..267016 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039053.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 267073..267879 product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDM9 transl_table 11 codon_start 1 locus_tag LOCUS_02630 gene cobB CDS 267998..269098 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035562.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene frp CDS complement(269102..270013) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036387.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS 270128..270979 product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDM5 transl_table 11 codon_start 1 locus_tag LOCUS_02660 gene purU CDS complement(271108..271734) product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968676.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 gene pncA CDS complement(271790..272461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703367.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS 272978..274852 product RpoH suppressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P15715 transl_table 11 codon_start 1 locus_tag LOCUS_02690 gene suhR CDS complement(274926..275879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(276227..277594) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036453.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 277710..279215 product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036454.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 gene mmsA CDS 279230..280396 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036455.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 gene fadE9 CDS 280393..281190 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036456.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 gene paaF CDS 281187..282362 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036457.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 282359..283249 product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB60 transl_table 11 codon_start 1 locus_tag LOCUS_02760 gene mmsB CDS complement(283398..283823) product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104171.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 gene ohr CDS complement(283935..284915) product cation diffusion facilitator transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971314.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 285123..286577 product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331455.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS complement(286634..286942) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920873.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 gene higA CDS 287140..288171 product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3X4 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene dusA CDS 288385..288759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039016.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS 288833..289516 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002808458.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 gene phoP CDS 289542..290966 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039015.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 gene phoQ CDS complement(291052..291759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039012.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(291810..292088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS 292233..293201 product bifunctional ligase/repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3Y0 transl_table 11 codon_start 1 locus_tag LOCUS_02870 gene birA CDS 293198..293929 product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3Y1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 gene coaX CDS 293939..294793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02890 tRNA 294835..294910 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(295232..295525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(295578..295877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS 296397..296684 product toxin, RelE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942190.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS 296743..297045 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942189.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS complement(297215..297616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 298201..298971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS complement(298996..299343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS 299255..299440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 299474..300394 product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3Z1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene argI CDS 300557..300694 product entericidin A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038999.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 gene ecnA CDS 300901..301122 product UPF0337 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3Z3 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(301202..301996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 302105..303397 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3Z4 transl_table 11 codon_start 1 locus_tag LOCUS_03020 gene trpS CDS 303564..303866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS 304023..304955 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038996.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 305061..306713 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639261.2 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS complement(306788..307087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS complement(307155..308489) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039236.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene kgtP CDS 308713..309618 product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038991.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 gene yedA CDS 309615..310514 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038990.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(310636..313461) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038415.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 gene btuB CDS 313820..314119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS complement(314195..315517) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038988.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS complement(315531..316688) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038987.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS complement(316703..317392) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038986.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 gene tptC CDS complement(317495..318742) product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038985.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 gene acrE CDS 318915..319841 product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919031.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS 319838..320614 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919032.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS 320621..321835 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038984.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS 321832..322434 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038983.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(323004..323540) product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038981.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(323537..324640) product catalase-related peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P411 transl_table 11 codon_start 1 locus_tag LOCUS_03210 gene srpA CDS complement(324777..326144) product cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038979.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(326148..326867) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038978.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(326899..328008) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038977.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene yhhT CDS complement(328076..328531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038976.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(328528..328998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038975.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(329007..329369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038974.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS complement(329471..330904) product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038973.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene htrA CDS 331395..332282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS 332345..333070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS complement(333086..333445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036378.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS complement(333537..335939) product putative dipeptidyl peptidase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703651.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 336150..336722 product Ax21 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035461.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS 336920..337597 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406371.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS complement(337604..337993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036195.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 338191..338871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS complement(338868..340019) product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816947.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS 340160..341047 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035743.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS complement(341016..341483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035532.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS 341597..342349 product NADP-dependent 3-hydroxy acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038939.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(342477..343382) product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038937.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS complement(343404..345092) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P455 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene argS CDS complement(345208..345948) product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P456 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS complement(345983..346609) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704956.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS 346810..348099 product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038934.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 gene dfp CDS 348096..348569 product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P458 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene dut CDS 348582..350930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS complement(351026..351739) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035945.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene kdpE CDS complement(351720..354380) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035944.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 gene kdpD CDS complement(354432..355082) product potassium-transporting ATPase KdpC subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCM0 transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene kdpC CDS complement(355079..357136) product potassium-transporting ATPase ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCM1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 gene kdpB CDS complement(357147..358856) product potassium-transporting ATPase potassium-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCM2 transl_table 11 codon_start 1 locus_tag LOCUS_03520 gene kdpA CDS complement(359135..359782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038923.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(359820..360479) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P469 transl_table 11 codon_start 1 locus_tag LOCUS_03540 gene pyrE CDS 360849..362048 product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098087.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS complement(361975..362205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(362195..362410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS complement(362349..362744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(362741..363376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(363367..363966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS complement(363966..364445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS complement(364423..364737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS complement(364734..364994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS complement(364991..365242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS complement(365235..365621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(365646..365900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS complement(365893..366147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(366144..366404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(366595..367284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705721.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS 367330..367641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS 367748..368200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS 368197..368541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03720 sequence02 source 1..236702 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 92..439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS 460..1539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS 1536..1988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS complement(2045..3541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS 3974..4858 product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537992.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS 4960..6099 product virion core protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037207.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS 6120..7472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037206.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS 7469..7726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS complement(7821..8717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(8735..11029) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206776.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 gene fyuA CDS 11153..11797 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298113.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS 11879..12505 product putative 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8C7 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 12621..13475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03850 note possible pseudo, internal stop codon CDS 13539..14330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03860 note possible pseudo, internal stop codon CDS 14736..15248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS complement(15188..16372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03880 note possible pseudo, frameshifted CDS complement(17132..18313) product efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974436.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS 18569..19285 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705233.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS 19286..20365 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390680.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 20545..21465 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096386.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(21486..22100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 22270..23106 product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013339.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS 23302..25479 product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207286.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 gene bauA CDS 25532..25831 product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813607.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 25828..27438 product iron uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065178.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 27435..27713 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035505.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS complement(27782..28870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888703.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS complement(28948..29526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 29836..31971 product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207286.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 gene bauA CDS complement(32030..32506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS complement(32780..33145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS complement(33629..34570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(34668..35378) product chaperone CupC2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112554.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 gene cupC2 CDS complement(35572..36540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(36582..39113) product usher CupB3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895669.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 gene cupB3 CDS complement(39252..39977) product fimbrial chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095625.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(40033..40551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS complement(40976..41236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS complement(41262..41939) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529671.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS 41996..42640 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529671.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(42667..43197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS complement(43100..46075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS complement(46108..48756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 48867..49850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 49947..50906 product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC98 transl_table 11 codon_start 1 locus_tag LOCUS_04170 gene pip CDS complement(50916..52277) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083034.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(52274..52963) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764042.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS complement(52960..56073) product resistance-nodulation-cell division efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147398.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(56070..57248) product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103503.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS 57499..57804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 58126..58425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 58489..61248 product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808882.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 gene mgtA CDS 61280..62017 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706774.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 62198..63253 product two component sensor kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064429.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS 63246..63887 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064428.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(63939..64400) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217944.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 64675..65871 product merozoite surface protein 3b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120335.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS 65885..67372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS 67389..68816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS complement(68813..69991) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088460.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS complement(70001..70267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101434.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 70469..70993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 70990..71841 product sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112389.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 71922..74339 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074066.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS 74435..75307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS complement(75405..75944) product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403905.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS complement(76428..78713) product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083112.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 gene fdhF CDS 78959..79804 product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P888 transl_table 11 codon_start 1 locus_tag LOCUS_04400 gene fdhD CDS complement(79907..80443) product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P219 transl_table 11 codon_start 1 locus_tag LOCUS_04410 gene mip CDS 80550..81440 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063703.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(81534..82094) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015249.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS complement(82099..83631) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015248.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(83783..84529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS complement(84529..85155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS complement(85145..85681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114096.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS complement(85708..86961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113046.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(86954..87616) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093325.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(87646..88179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 88230..88688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS complement(88802..90934) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388620.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 91123..91971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS complement(92037..92930) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530651.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS complement(93163..96234) product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765563.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS complement(96231..97403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS complement(97400..98554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 98710..99384 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526208.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS 99377..100759 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930991.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(101180..103531) product sugar hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036281.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS complement(103803..104087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS 104313..106199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 106615..106860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS 106936..107532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS complement(107551..107874) product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035340.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene trxA CDS complement(107880..108296) product attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035339.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 gene atsE CDS 108803..110290 product proline/betaine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035341.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 gene proP CDS complement(110331..110954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(110958..111299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(111371..112957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(112967..113371) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920851.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS complement(113489..114865) product peptide signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206010.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS complement(115034..115798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002041986.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(115853..118975) product receptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206009.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(119158..120114) product iron dicitrate transporter FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389193.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(120197..120700) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389192.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS complement(120839..121765) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197652.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS 121916..122782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191946.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 122860..123540 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111283.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 123602..124000 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190295.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS complement(124064..124393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS complement(124492..126237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112715.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS complement(126280..126942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS complement(126982..127395) product transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085366.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 gene exbD2 CDS complement(127406..129190) product transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112717.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene exbB2 CDS complement(129229..130788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112718.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 130721..130942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 131044..131379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS complement(131414..131944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 131991..132437 product type II secretion system protein GspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112728.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 132434..132796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 132793..133407 product pseudopilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112729.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS complement(133627..145449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147216.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS 145714..146103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS complement(146256..147392) product alkaline phosphatase L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35482 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene phoA2 CDS complement(147610..148809) product type II secretion system protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112721.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS complement(148817..150250) product putative type II secretion system protein HxcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5N9 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene hxcR CDS complement(150247..152625) product type II secretion system protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009315212.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS complement(152631..153158) product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112724.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS complement(153155..154318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS complement(154315..155220) product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5P3 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS complement(155230..155667) product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085349.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS complement(155725..156309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS complement(156429..156980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS complement(157039..158019) product sigma factor regulator VreR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106396.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene vreR CDS complement(158089..158619) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384951.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS complement(158636..159265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS 160002..162527 product iron-uptake factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039027.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 gene piuB CDS complement(162573..165125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS 165299..166168 product N-hydroxyarylamine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187915.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 gene nhoA CDS complement(166231..166602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114616.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS complement(166625..167275) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035367.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS complement(167260..168360) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035366.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 168522..168944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 168971..170494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918222.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 170556..171272 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225220.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(171325..173937) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037527.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene cirA CDS complement(174074..175225) product phosphonate metabolism protein PhnM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113124.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 175317..176063 product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203732.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS complement(176119..177273) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813122.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(177285..178580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918537.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS complement(178577..179266) product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729800.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(179356..180261) product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038862.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 gene ampR CDS complement(180536..182083) product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382881.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS 182153..182986 product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197725.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS complement(183000..183593) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390815.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS complement(183610..184206) product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390814.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 184333..184866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS complement(184900..185727) product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919769.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 185891..186631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 186983..187432 product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD27 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene aroQ CDS 187429..187854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972297.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS 187908..188387 product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035766.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 gene bccP CDS 188398..189765 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035764.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 gene accC CDS complement(189893..190267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035763.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS complement(190264..191229) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035762.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS 191348..192301 product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD33 transl_table 11 codon_start 1 locus_tag LOCUS_05370 gene prmA CDS 192308..193114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05380 note possible pseudo, internal stop codon, frameshifted CDS 193308..193505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(193633..194628) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035755.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 gene cdsA CDS complement(194625..195254) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035754.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS complement(195268..195705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS complement(195702..197036) product ser/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035750.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS complement(197036..198787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035749.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS complement(198826..199446) product CDP-alcohol phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035748.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 gene pgsA CDS 199656..201239 product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD47 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene purH CDS 201271..202134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS 202193..203476 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD48 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene purD CDS complement(203562..203894) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891162.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS complement(203878..204222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388677.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS complement(204434..205309) product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H9L4M9 transl_table 11 codon_start 1 locus_tag LOCUS_05510 gene rpoH CDS complement(205588..206301) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4D7 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene ung CDS complement(206298..207140) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038855.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(207148..208095) product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4D5 transl_table 11 codon_start 1 locus_tag LOCUS_05540 gene ftsX CDS complement(208099..208785) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003484499.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 gene ftsE CDS complement(208919..210640) product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4D4 transl_table 11 codon_start 1 locus_tag LOCUS_05560 gene rhlB CDS complement(210815..211120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 211152..211481 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4D3 transl_table 11 codon_start 1 locus_tag LOCUS_05580 gene trxA CDS 211710..213461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS complement(213531..214598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(214716..217247) product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229330.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS 217134..217346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS 217589..218596 product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919916.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(218614..219891) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036694.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 gene fucP CDS 220332..223289 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039035.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 gene iroN CDS 223354..224370 product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039037.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 224485..226059 product cell signaling regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817287.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS complement(226096..226986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038860.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS complement(227048..228778) product isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4D0 transl_table 11 codon_start 1 locus_tag LOCUS_05690 gene aceK CDS complement(228925..229284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003656109.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS complement(229341..229757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS complement(229750..230298) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207703.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS complement(230291..231256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS complement(231539..233761) product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038863.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene icd CDS complement(233992..234522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS complement(234656..235168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038864.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(235215..235508) product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038865.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(235678..236496) product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4C5 transl_table 11 codon_start 1 locus_tag LOCUS_05780 gene queF sequence03 source 1..234635 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 86..2245 product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038053.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 gene yoaA CDS 2255..2968 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038052.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(3543..4427) product cell envelope biogenesis protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038050.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 gene tonB CDS complement(4427..5374) product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6P1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 gene gshB CDS 5663..6016 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038048.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 gene pilG CDS 6035..6397 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038047.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 gene pilH CDS 6397..6927 product pilus biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038046.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 gene pilI CDS 6969..9005 product pilus biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038045.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 gene pilJ CDS 9106..15675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 15662..16984 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038043.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 16981..17445 product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038042.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(17524..18261) product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6T0 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS complement(18252..19643) product adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038009.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene bioA CDS 19721..20284 product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038008.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 gene nudE CDS 20281..21084 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638230.2 transl_table 11 codon_start 1 locus_tag LOCUS_05930 gene cysQ CDS 21098..21937 product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038006.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 gene mazG CDS 21934..22263 product UPF0060 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6T5 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 22387..22689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192500.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 22757..23716 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038004.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS 23718..24161 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038003.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 24214..25353 product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6T8 transl_table 11 codon_start 1 locus_tag LOCUS_05990 gene gcvT CDS 25447..25842 product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6T9 transl_table 11 codon_start 1 locus_tag LOCUS_06000 gene gcvH CDS 26385..26603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06010 repeat_region 26657..27041 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aagaaggcagtgaagaagg CDS complement(27423..28823) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037998.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 gene bla CDS 29091..30437 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037997.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 30468..30818 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037996.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 30932..31393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(31300..31767) product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038810.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS complement(31843..34320) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037995.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 gene fadE CDS complement(34317..35234) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037994.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 35376..35978 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037993.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(36116..38860) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037992.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 gene btuB CDS complement(39252..40100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037991.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(40217..41110) product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6V0 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 41188..41937 product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6V1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene mtgA CDS 42001..43020 product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037988.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene gtrB CDS 42980..43411 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037987.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS complement(43663..45636) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037986.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS complement(45721..46359) product hemolysin III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037985.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 gene hly3 CDS complement(46534..48138) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6V6 transl_table 11 codon_start 1 locus_tag LOCUS_06180 gene prfC CDS complement(48205..49089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638206.2 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 49435..50466 product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6V8 transl_table 11 codon_start 1 locus_tag LOCUS_06200 gene metA CDS 50463..51698 product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037981.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 gene metB CDS 51695..52762 product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6W0 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(52795..53790) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037979.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS complement(53870..55252) product L-serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037978.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene sdaA CDS 55352..55582 product NrdH-redoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037977.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS complement(55658..56230) product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037976.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS complement(56234..56806) product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037975.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 gene yodB CDS complement(56817..57449) product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037974.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 57615..61160 product histidine kinase/response regulator hybrid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638195.2 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS 61256..64783 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037971.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS complement(65322..66731) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037970.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 gene emrA CDS complement(66824..67897) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6X1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene hemE CDS complement(67933..68172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037968.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS complement(68272..69384) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6X3 transl_table 11 codon_start 1 locus_tag LOCUS_06340 gene aroB CDS complement(69381..69923) product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6X4 transl_table 11 codon_start 1 locus_tag LOCUS_06350 gene aroK CDS 70022..70225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(70232..71041) product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920748.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 71100..71699 product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6X5 transl_table 11 codon_start 1 locus_tag LOCUS_06380 gene pdxH CDS 71908..72381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097792.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(72459..74042) product propionate catabolism operon regulatory protein PrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036230.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 gene prpR CDS 74152..75090 product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBT8 transl_table 11 codon_start 1 locus_tag LOCUS_06410 gene prpB CDS 75127..76284 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBT7 transl_table 11 codon_start 1 locus_tag LOCUS_06420 gene prpC CDS 76382..79000 product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115200.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 79052..80230 product putative methylaconitate Delta-isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036236.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS 80302..81762 product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930897.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 gene prpD CDS 81909..86816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036239.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 86878..89247 product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036244.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 gene pbpC CDS complement(89362..89937) product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036245.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(89967..90449) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036246.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 90711..91604 product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036248.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 gene cbpA CDS complement(91679..92050) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036249.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 gene pilH CDS complement(92139..93134) product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941435.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS 93288..94421 product HflK protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036250.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 gene hflK CDS 94418..95281 product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBR8 transl_table 11 codon_start 1 locus_tag LOCUS_06540 gene hflC CDS 95350..95535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 95861..97153 product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBR6 transl_table 11 codon_start 1 locus_tag LOCUS_06560 gene purA CDS 97713..98183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS 98310..98981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(99085..99729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(99734..100693) product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038316.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 100929..103055 product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637243.2 transl_table 11 codon_start 1 locus_tag LOCUS_06610 gene tsr CDS complement(103142..103468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS 103388..104101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(104111..104527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS 104636..105358 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036308.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 105441..106808 product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037940.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 gene gabP CDS 106912..107322 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106807.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(107415..110282) product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBK7 transl_table 11 codon_start 1 locus_tag LOCUS_06680 gene gcvP CDS 110724..111974 product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036313.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene bcr CDS 112115..113011 product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100352.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 113094..113486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS complement(113585..115549) product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036316.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS complement(116149..117798) product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036317.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 gene yjdB CDS complement(117795..118442) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036318.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(118659..120362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636494.2 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS 120478..121206 product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036320.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 gene colR CDS 121193..122479 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036321.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 gene colS CDS complement(122635..123024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS 123159..124409 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037853.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 124595..125725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707631.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(126231..126455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037849.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS complement(126455..128536) product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037848.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 gene cstA CDS 128752..129603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037847.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS complement(129732..130190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037845.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(130387..131106) product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGM8 transl_table 11 codon_start 1 locus_tag LOCUS_06850 gene aqpZ CDS complement(131227..132090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037844.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(132683..134746) product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036460.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 gene fadB CDS 134982..135602 product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036461.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 gene algU CDS 135599..136480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036462.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 136555..138090 product peptidase S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036463.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 gene mucD tRNA 138093..138182 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS 138256..140064 product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB55 transl_table 11 codon_start 1 locus_tag LOCUS_06910 gene lepA CDS 140119..140913 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB54 transl_table 11 codon_start 1 locus_tag LOCUS_06920 gene lepB CDS 140966..141349 product DUF4845 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036466.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 141339..142019 product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB52 transl_table 11 codon_start 1 locus_tag LOCUS_06940 gene rnc CDS 142016..142912 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB51 transl_table 11 codon_start 1 locus_tag LOCUS_06950 gene era CDS 142931..143650 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB50 transl_table 11 codon_start 1 locus_tag LOCUS_06960 gene recO CDS complement(144179..144907) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036470.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 145036..146370 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB48 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene rlmD CDS 146380..146889 product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036473.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS complement(146874..147116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS 147003..147698 product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036474.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 gene frnE CDS 147864..148871 product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB42 transl_table 11 codon_start 1 locus_tag LOCUS_07020 gene nagZ CDS 148871..149425 product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036478.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene hpt CDS 149508..150254 product putative S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB40 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 150343..150549 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003488188.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 gene scoF CDS 150652..151920 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036480.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS 152012..152371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(152373..153014) product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036481.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS complement(153004..155463) product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036482.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 gene lhr2 CDS complement(155460..157067) product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036483.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 gene lig2 CDS complement(157064..158062) product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036484.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS 158176..159813 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268974.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(160092..160502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS complement(160660..161001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS complement(161126..162301) product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036490.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 gene atoB CDS 162500..165337 product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636672.2 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(165384..166481) product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036492.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 gene leu CDS 166761..167834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635468.2 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(167838..169403) product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037836.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 gene cls CDS complement(169519..170217) product RNA-binding protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038074.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(170274..170765) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036494.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 170837..171394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035985.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 171526..171792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036497.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS complement(172370..172963) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036498.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(172999..173178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 173305..173883 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036499.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 gene algU CDS 173880..174407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036500.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS 174418..175299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036501.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(175349..175531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(175543..175794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS complement(176066..177427) product heat-shock protein Hsp70 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036502.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 gene yegD CDS 177597..177932 product phosphonoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036505.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(177940..179091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 179321..179923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036513.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 179973..180146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 180143..180760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07360 note possible pseudo, frameshifted CDS 180866..182185 product virulence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036514.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 gene acvB CDS complement(182279..184843) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036515.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS 185036..185383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036517.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS complement(185448..185861) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036529.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 gene ydgM CDS complement(185886..186476) product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036530.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 gene cicA CDS complement(186553..188634) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAY7 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene metG CDS complement(188736..189179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036533.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS complement(189497..189901) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036534.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS complement(189898..190968) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143091.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS complement(190985..192925) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636719.2 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS complement(193020..193805) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036538.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS complement(193802..194485) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036539.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 194562..195878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636722.2 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS complement(195882..196334) product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037753.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 196669..197013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS complement(197066..198688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(198685..200388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS complement(200496..201374) product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037752.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 gene trx CDS complement(201494..201868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 201916..202515 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037751.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 202621..205263 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7J1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene leuS CDS 205370..205984 product LPS-assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7J3 transl_table 11 codon_start 1 locus_tag LOCUS_07580 gene rlpB CDS 205998..207035 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037747.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene holA CDS 207039..207704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 207763..208173 product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7J6 transl_table 11 codon_start 1 locus_tag LOCUS_07610 gene rsfS CDS 208238..208708 product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7J8 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene rlmH tRNA 208731..208807 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS 208955..209920 product xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038153.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 gene xynB CDS complement(209941..211362) product arginine:ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192541.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 gene arcD CDS complement(211492..214284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114864.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS complement(214484..215143) product cell envelope biogenesis protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037742.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 gene tonB CDS complement(215361..216098) product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037741.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 gene bp26 CDS 216230..216838 product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7K1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS 216831..218318 product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037739.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 gene rng CDS 218349..222194 product DUF3971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037738.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 222255..223700 product TldD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037736.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 gene tldD CDS complement(223742..224329) product UPF0307 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7K6 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 224398..225765 product PmbA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037734.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene pmbA CDS 225853..226224 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037733.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS complement(226317..227195) product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037730.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene ispA CDS complement(227185..227445) product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7L2 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene xseB CDS complement(227482..228768) product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7L3 transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene tilS CDS complement(229311..229856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(229853..231559) product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037727.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene phoA CDS 231713..233047 product amino acid:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037726.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 gene gltT CDS complement(233309..234082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037714.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(234214..234606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07820 sequence04 source 1..219365 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2285 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105056.1:heterokaryon incompatibility induction protein PhcA locus_tag LOCUS_07830 CDS 2282..2905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 3034..3507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 3507..4106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS 4112..4831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07870 note possible pseudo, internal stop codon CDS 5017..5985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 6019..6225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 6228..7337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 7395..8489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(8584..9066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(9063..9614) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223369.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(9673..10404) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035643.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 gene comF CDS complement(10505..11845) product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037785.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 gene yadQ CDS 12049..13092 product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDF0 transl_table 11 codon_start 1 locus_tag LOCUS_07960 gene bioB CDS 13160..14383 product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDF1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene bioF CDS 14402..15181 product pimeloyl-[acyl-carrier protein] methyl ester esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDF3 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene bioH CDS 15211..15990 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035638.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 16003..16887 product malonyl-[acyl-carrier protein] O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDF5 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene bioC CDS complement(17525..18157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035634.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS complement(18154..19116) product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035633.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 gene ilvA CDS 19291..19767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 20300..22189 product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDG1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 gene mnmG CDS complement(22397..23812) product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268044.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS complement(23809..26958) product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268045.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS complement(26971..28170) product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158151.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 gene acrA CDS 28287..29690 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400907.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 29687..30391 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546865.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS 30523..31344 product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704031.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 31496..32026 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035602.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS 32150..32839 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123273.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 32836..33828 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268793.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 33818..35440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112782.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 35437..36621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 36618..37604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112780.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 37601..38899 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104968.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(39106..40284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037958.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(40292..40864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339300.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 41355..43193 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDJ3 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene ilvD CDS 43294..44466 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202736.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(44559..46661) product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039022.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 gene dinG CDS complement(46817..47170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS complement(47174..48019) product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3W6 transl_table 11 codon_start 1 locus_tag LOCUS_08240 gene aroE CDS 48071..48931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039026.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS complement(49029..49298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(49331..50320) product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3W3 transl_table 11 codon_start 1 locus_tag LOCUS_08270 gene hemB CDS complement(50340..51257) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929824.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS complement(51380..51628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 51813..52280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039030.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(52376..54175) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039031.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(54243..54758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039032.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(54784..57009) product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039033.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS complement(57168..57857) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039034.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 gene gst CDS 57968..58609 product UPF0114 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P0T8 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS 58826..59812 product cell envelope biogenesis protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039039.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(59895..60149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528682.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 60251..61024 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004546577.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 61185..61835 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387744.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS complement(61861..63045) product sodium ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039040.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 gene natB CDS complement(63042..63788) product sodium ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039041.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 gene natA CDS complement(63785..65311) product cysteine proteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039042.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS complement(65380..66582) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039866.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 66737..67222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385570.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 67456..68628 product chitin-binding protein CbpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I589 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene cbpD CDS 68810..69973 product chitin-binding protein CbpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I589 transl_table 11 codon_start 1 locus_tag LOCUS_08460 gene cbpD CDS 70315..70500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 70555..71331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS 71400..71855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 72980..73426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 73441..74004 product RNA polymerase sigma24 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029464.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 74092..75315 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244563.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 75316..76485 product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920568.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 76485..79730 product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920570.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS 79828..81162 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970462.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(81274..81597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 81977..82627 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970465.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS 82647..83297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970466.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 83427..83792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 83881..85131 product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920567.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS 85128..86360 product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920247.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS 86370..89507 product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920248.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS 89504..90235 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008460272.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 90252..90893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970466.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 90933..91178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS complement(91461..93512) product catecholate siderophore receptor CirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097960.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS complement(93659..94393) product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976314.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS complement(94469..95539) product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096673.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 95963..96724 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086503.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 97310..99478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS 99542..101134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(101177..101683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087041.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS complement(101680..102669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS complement(103683..105653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS complement(105677..105928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS complement(107078..107800) product phenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639315.2 transl_table 11 codon_start 1 locus_tag LOCUS_08760 gene poxF CDS 107964..108893 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039048.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene yadG CDS 108890..109681 product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3U1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 109922..110860 product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3T9 transl_table 11 codon_start 1 locus_tag LOCUS_08790 gene apbA CDS 110896..111756 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918939.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS complement(111823..112650) product preprotein translocase subunit TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035554.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene mttC CDS 112688..115192 product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035530.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 gene hrpB CDS 115328..115702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035529.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(115776..116345) product ribosomal large subunit pseudouridine synthase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDR2 transl_table 11 codon_start 1 locus_tag LOCUS_08840 gene rluE CDS complement(116384..116698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(116749..117606) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035527.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS 117776..118732 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035526.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 gene mocA tRNA 119379..119454 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS 119808..120932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038957.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS 120989..122209 product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P433 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene rtcB CDS complement(122278..122898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(122895..124565) product sulfate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089295.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 tRNA complement(123506..123600) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS complement(124742..125647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118999.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(125637..126146) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968525.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(126220..126504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 126388..128397 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035531.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 gene tsr CDS complement(128560..129441) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811189.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 129569..130783 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705534.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 130871..131680 product 2,5-diketo-D-gluconate reductase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035524.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene dkgB CDS complement(131795..132538) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920935.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 132662..133042 product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62KY7 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(133067..135793) product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039059.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(135871..137241) product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3S9 transl_table 11 codon_start 1 locus_tag LOCUS_09020 gene mgtE CDS 137377..137592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 137585..139363 product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039063.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 gene kefC CDS complement(139428..142766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039067.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 gene ank2 CDS complement(142759..143019) product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3S2 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(143170..144183) product cytochrome D ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037938.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 gene qxtB CDS complement(144185..145582) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037939.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(145816..146031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS complement(146028..146681) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036499.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 gene algU CDS complement(146719..147048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS 147216..149585 product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039087.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 149582..150001 product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895859.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS 150032..150589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS 150625..151731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 151781..152677 product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3Q0 transl_table 11 codon_start 1 locus_tag LOCUS_09160 gene hemF CDS 152772..153935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS complement(154010..154489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS complement(154818..157592) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039091.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene polA CDS 157691..157975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039092.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS complement(158119..158565) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3P5 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS complement(158787..159341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246043.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS complement(159482..159808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087185.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 159895..160653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS complement(160755..162947) product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3P3 transl_table 11 codon_start 1 locus_tag LOCUS_09250 gene uvrD CDS complement(162957..164378) product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039098.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(164424..165872) product cardiolipin synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039099.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene cls CDS complement(166074..166238) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66239 transl_table 11 codon_start 1 locus_tag LOCUS_09280 gene rpmG CDS complement(166252..166488) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66161 transl_table 11 codon_start 1 locus_tag LOCUS_09290 gene rpmB CDS complement(166726..167235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(167318..168211) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097828.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 168320..168718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097827.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS 168951..169283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 169340..170593 product outer membrane protein CzcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113317.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 gene czcC CDS 170590..171795 product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920568.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS 171806..175015 product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920570.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(175149..176921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039109.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(177262..177609) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038930.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS complement(177609..178331) product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038929.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 gene dpm1 CDS complement(178421..179386) product nucleotide sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038928.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 gene wbnF CDS complement(179438..180169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038927.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS complement(180296..181132) product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038925.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 gene parB CDS complement(181219..182016) product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038924.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene parA CDS complement(182129..182767) product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3N0 transl_table 11 codon_start 1 locus_tag LOCUS_09440 gene rsmG CDS complement(182807..183433) product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039112.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 gene hetI CDS 183491..183742 product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039113.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(183846..184628) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039115.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene xthA1 CDS complement(184741..186150) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8R7 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(186334..187998) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820458.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(188141..189568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639398.2 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS 189814..191757 product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3L1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene acsA CDS 191838..192503 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039130.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene tcsR CDS 192914..193489 product putative manganese efflux pump MntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3J6 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene mntP CDS complement(193582..197028) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039145.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS complement(197164..199311) product dipeptidyl peptidase S46 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071328.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 tRNA complement(199076..199165) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS complement(199483..203343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639423.2 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS complement(203340..205136) product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039154.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS complement(205393..207468) product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3I5 transl_table 11 codon_start 1 locus_tag LOCUS_09580 gene glyS CDS complement(207540..208451) product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3I4 transl_table 11 codon_start 1 locus_tag LOCUS_09590 gene glyQ CDS 208536..210371 product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039157.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene gspE CDS 210343..211089 product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039158.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 gene guaA CDS 211140..212051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639429.2 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS complement(212157..212906) product sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3I0 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene tatC CDS complement(212903..213367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(213383..213649) product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3H8 transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene tatA CDS complement(213686..214579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039163.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 214745..215707 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3H6 transl_table 11 codon_start 1 locus_tag LOCUS_09670 gene hemH CDS 215704..216558 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039165.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 216849..218954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09690 sequence05 source 1..179341 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(75..605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038054.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(611..3049) product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6N5 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene ponB CDS complement(2965..3228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS 3146..5245 product glycosyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638281.2 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(5242..6807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(6838..8958) product ATP--GTP 3'-pyrophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038059.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 gene relA CDS 9125..9661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038064.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(9715..13731) product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038068.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene hrpA CDS 13884..14432 product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038069.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS 14988..16793 product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038070.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 gene recQ CDS 16961..17344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 17420..19243 product copper resistance protein CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035822.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 gene copA CDS 19240..20205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 20287..20799 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038144.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(20883..21197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942213.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 21347..22114 product CAAX amino protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036243.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS 22207..22629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(22768..23706) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038647.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(23789..24040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS complement(24104..24640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09890 note possible pseudo, internal stop codon CDS 25260..25520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS 25557..25739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 25818..26135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09920 tRNA complement(26210..26285) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS 26454..27407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS complement(27460..27744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS complement(27759..28424) product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6F6 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene queC CDS complement(28503..29204) product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6F5 transl_table 11 codon_start 1 locus_tag LOCUS_09960 gene queE CDS complement(29407..30225) product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038132.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(30229..30747) product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038133.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 gene ompP6 CDS complement(30811..32130) product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6F2 transl_table 11 codon_start 1 locus_tag LOCUS_09990 gene tolB CDS complement(32316..33371) product protein TolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038135.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 gene tolA CDS complement(33361..33789) product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038136.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene tolR CDS complement(33814..34593) product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038137.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 gene tolQ CDS complement(34604..35035) product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038138.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS complement(35025..36065) product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6E7 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene ruvB CDS complement(36451..38370) product putative potassium transport system protein kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6E6 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene kup CDS complement(38420..39013) product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6E5 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene ruvA CDS complement(39027..39548) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6E4 transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene ruvC CDS complement(39653..40384) product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6E3 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS complement(40570..41202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038143.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS complement(41278..41799) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038144.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS complement(41831..42154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(42171..43922) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6E0 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene aspS CDS 44080..44820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038146.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS complement(44886..45524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038147.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS complement(45584..47140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(47245..48474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS complement(48560..49474) product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6D1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene bla CDS 49649..50515 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038155.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene ampR CDS complement(50781..50960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(50967..52832) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038157.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene yheS CDS 53169..55556 product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038158.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 gene bfeA CDS 55756..57453 product cation:proton antiport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038163.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 gene ybaL CDS complement(57736..59022) product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038183.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene metB CDS 59205..59942 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098126.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 gene parR CDS 59939..61228 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113589.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene parS CDS 61369..62169 product structural protein MipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096744.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(62242..64827) product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6A0 transl_table 11 codon_start 1 locus_tag LOCUS_10270 gene clpB CDS 65081..65575 product ECF sigma factor FemI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088185.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 gene femI CDS 65565..66533 product sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112303.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS 66587..69376 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815398.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS 69412..70509 product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402885.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 gene mauG CDS complement(70517..71869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS complement(71944..72768) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038189.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS 72940..73650 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038188.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS complement(73730..75334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038191.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(75965..77683) product pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098265.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene poxB CDS complement(77793..78668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10370 note possible pseudo, internal stop codon, frameshifted CDS complement(78687..79169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038193.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS 79387..81822 product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038194.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene bfeA CDS 81970..82728 product trehalose 6-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P690 transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene ostB CDS 82718..84553 product glucoamylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS 84550..85914 product alpha,alpha-trehalose-phosphate synthase (UDP-forming) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P688 transl_table 11 codon_start 1 locus_tag LOCUS_10420 gene ostA CDS 86266..87564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS complement(87584..88015) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038200.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS complement(87990..88496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038201.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS complement(88517..89287) product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P683 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS complement(89287..90276) product ribosomal large subunit pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P682 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene rluD CDS 90408..91277 product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P681 transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene comL CDS complement(91425..93059) product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038206.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 gene nadE CDS complement(93266..94141) product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P677 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene sucD CDS complement(94163..95332) product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P676 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene sucC CDS 95737..97350 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038210.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 gene pilS CDS 97411..98784 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038211.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 gene pilR CDS complement(98892..100718) product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038212.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 gene pilB CDS complement(100844..101257) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P04739 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene pilA CDS complement(101385..101807) product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038214.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 gene pilE CDS 102162..103421 product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038215.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 gene pilC CDS 103429..104292 product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56763 transl_table 11 codon_start 1 locus_tag LOCUS_10580 gene xpsO CDS 104304..104915 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56764 transl_table 11 codon_start 1 locus_tag LOCUS_10590 gene coaE CDS complement(104974..105360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS complement(105777..107762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536040.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS complement(107939..108565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(108562..109200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(109197..110012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535790.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(110005..112614) product type IV secretion protein Rhs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196687.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS complement(112847..113251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(113516..114844) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038221.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 gene colS CDS complement(114849..115526) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003490678.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 gene colR CDS complement(115535..116008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS complement(116098..116574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(116821..117699) product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P665 transl_table 11 codon_start 1 locus_tag LOCUS_10710 gene rimK CDS 117865..118230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS complement(118217..119173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(119491..120132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037262.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS 120239..120559 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003282197.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS complement(120595..121485) product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038250.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS 121764..122672 product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277248.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS 123012..125918 product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932586.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS 125933..127720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031064.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS 127717..128511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932587.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS 128523..130523 product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932588.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 gene mod CDS 130535..133540 product type III restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932591.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 gene res CDS 133621..134355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS 134355..134624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 134641..135951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS 135948..136292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS 136285..136515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS 136512..139187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS 139184..140947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS 140944..141432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS 141423..142145 product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001863367.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS 142138..143481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS 143478..146834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS 146828..148768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 148771..151407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS 151404..154739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS complement(154770..156626) product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038851.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS 156924..157241 product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888282.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS 157241..157699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084500.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 157727..158086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038854.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS complement(158093..159616) product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038230.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(159632..160003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS complement(160000..161406) product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038229.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS complement(161417..162364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638462.2 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS complement(162361..162735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS complement(162972..163466) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878135.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS complement(163645..164409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038859.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(164425..167334) product conjugative transfer ATPase, PFL_4706 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038860.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(167334..167783) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038861.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(167764..169173) product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038862.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(169163..170089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11110 note possible pseudo, internal stop codon CDS complement(170086..170778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS complement(170775..171185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267025.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(171199..171558) product integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003294215.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(171575..171808) product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267027.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(171805..172188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS complement(172287..173036) product integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038879.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(173033..175216) product conjugative coupling factor TraD, PFGI-1 class inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038880.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(175221..175769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038881.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS complement(175766..176371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038882.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(176353..177090) product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038883.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(177105..177746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS complement(177743..178321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11230 sequence06 source 1..158676 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(208..1494) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037502.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(1613..2491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037501.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 note possible pseudo, internal stop codon, frameshifted CDS complement(2555..3907) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037500.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS 4012..5508 product gamma-glutamyl-gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102988.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(5664..6299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 6447..7748 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037495.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 gene yhjE CDS complement(7729..8190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037494.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(8276..9619) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037493.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene rrpX CDS complement(9715..11268) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038243.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(11467..13077) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038243.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(13122..14399) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037492.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS 14561..15322 product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037490.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 gene guaA CDS 15319..16713 product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037489.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 gene glnA CDS 16805..17914 product putrescine-binding periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P899 transl_table 11 codon_start 1 locus_tag LOCUS_11370 gene potF CDS 18102..19238 product polyamine-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8A3 transl_table 11 codon_start 1 locus_tag LOCUS_11380 gene potG CDS 19235..20167 product polyamine transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637693.2 transl_table 11 codon_start 1 locus_tag LOCUS_11390 gene potH CDS 20164..21006 product putrescine ABC transporter permease PotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037481.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 gene potI CDS 21106..22470 product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037479.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 gene gabD CDS complement(22545..23558) product magnesium transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037478.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 gene corA CDS complement(23574..24836) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037477.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(24833..25714) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037476.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene ybeX CDS complement(25779..26387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037475.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(26387..26995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS complement(27049..27534) product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8B2 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene ybeY CDS complement(27531..28517) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037472.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS 28893..32075 product type IV secretion protein Rhs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196687.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS 32075..35380 product phospholipase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112916.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 gene pldA CDS 36196..36987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS 37241..38191 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616206.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS 38212..39135 product ABC drugE1 family efflux system ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071850.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 39132..40244 product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFJ3 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(40318..41733) product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8B5 transl_table 11 codon_start 1 locus_tag LOCUS_11550 gene miaB CDS complement(41840..42460) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037470.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 gene gstA CDS 42541..43509 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037469.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 gene dnrO CDS 43556..44482 product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037468.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene yjbJ CDS 44677..45297 product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8B9 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene petA CDS 45297..46556 product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8C0 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene petB CDS 46549..47298 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037465.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene petC CDS 47433..48068 product stringent starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037464.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 gene sspA CDS 48153..48605 product stringent starvation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037463.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 gene sspB CDS complement(48644..48994) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037461.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(49062..50063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037639.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(50168..51019) product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037638.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 gene nadC CDS complement(51016..51285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037637.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS 51344..51847 product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7V5 transl_table 11 codon_start 1 locus_tag LOCUS_11680 gene purE CDS 51844..52992 product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7V6 transl_table 11 codon_start 1 locus_tag LOCUS_11690 gene purK CDS 53105..53446 product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MAX0 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(53560..54180) product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7V7 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene sodB CDS 54260..54580 product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7V8 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 54577..55353 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037632.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 55604..58807 product Oar protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037631.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 gene oar CDS 59349..59711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 59754..60185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS 60434..61828 product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037630.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS 61990..62505 product pre-pilin like leader sequence inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037629.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 gene fimT CDS 62502..62975 product type IV pilus modification protein PilV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037628.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene pilV CDS 62978..64138 product pilus assembly protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037627.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS 64141..64659 product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037626.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 gene pilX CDS 64671..68423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS 68462..68884 product type IV pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037623.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 gene pilE1 tRNA 68964..69040 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS complement(69089..69625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 69754..71778 product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7X1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 gene uvrB tRNA 71885..71959 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA 72058..72132 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS complement(72227..72553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(72775..72963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(73064..73633) product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039132.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 73796..73936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(73986..74270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS complement(74302..75069) product MltA-interacting protein MipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169267.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 75215..75886 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973316.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS 75888..77231 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087571.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS 77291..79690 product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037274.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 gene comA CDS 79694..80356 product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037273.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 gene exbB CDS 80360..80782 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037272.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 gene exbD CDS 80779..82527 product lipid A export ATP-binding/permease protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8W4 transl_table 11 codon_start 1 locus_tag LOCUS_11970 gene msbA CDS 82527..83546 product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8W5 transl_table 11 codon_start 1 locus_tag LOCUS_11980 gene lpxK CDS 83622..84395 product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8W6 transl_table 11 codon_start 1 locus_tag LOCUS_11990 gene kdsB CDS 84392..84880 product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037268.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 84877..86289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037267.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS 86286..88130 product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8W9 transl_table 11 codon_start 1 locus_tag LOCUS_12020 gene uvrC CDS 88150..88779 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037265.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene pgsA tRNA 88925..89000 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS 89418..90833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038813.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 90830..91969 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124973.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 gene devC CDS 91980..92708 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919952.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS 92705..93094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 93055..93675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(93678..94127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(94120..94521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12100 tRNA 94650..94725 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS 94953..96887 product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037264.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene intS CDS complement(97075..100194) product cation efflux system protein CusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38054 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene cusA CDS complement(100191..101723) product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817192.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS complement(101724..103031) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189952.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(103107..103475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS 103627..103869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 104454..104759 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003282197.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS complement(104764..105654) product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038250.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(105886..106170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS complement(106299..107225) product copper resistance protein CopD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267053.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS complement(107230..107616) product copper resistance protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267052.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS complement(107758..109833) product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083526.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS 109937..110152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(110351..110623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS complement(110657..111142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064916.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(111180..112160) product copper resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040630.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene copB CDS complement(112186..114078) product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931403.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 gene copA CDS 114360..115052 product transcriptional regulatory protein CusR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AD00 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene cusR CDS 115132..116460 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704248.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS 117408..117737 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811464.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS 117751..118221 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184724.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS 118234..118731 product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140066.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS 118742..119827 product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272375.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 119842..120264 product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MIZ5 transl_table 11 codon_start 1 locus_tag LOCUS_12340 gene arsC CDS 120336..120665 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879039.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS 120662..121891 product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040344.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS 121897..122427 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112705.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS complement(122635..124473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS complement(124425..124826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12390 note possible pseudo, frameshifted CDS complement(124919..125887) product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036629.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 gene mexE note possible pseudo, internal stop codon CDS complement(126409..128331) product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038851.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS 128572..129198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS 129211..129843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS 129928..130293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(130305..131825) product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038230.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(131839..132198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(132195..133589) product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038229.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(133599..134549) product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038857.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(134546..134938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS complement(135157..135651) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263378.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(135827..136594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038859.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(136619..139510) product conjugative transfer ATPase, PFL_4706 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038860.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS complement(139510..139959) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038861.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(139940..141358) product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038862.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(141348..142259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12550 note possible pseudo, internal stop codon CDS complement(142256..142948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(142945..143343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267025.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS complement(143355..143714) product integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003294215.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(143731..143964) product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267027.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(143961..144344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103322.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS 144548..145018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS 145015..145590 product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887596.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS 145608..146522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS 146519..146989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS 146986..147486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS 147486..148388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS 148427..149152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS 149162..151786 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267002.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS complement(151827..152576) product integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038879.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(152573..154765) product conjugative coupling factor TraD, PFGI-1 class inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038880.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS complement(154770..155318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038881.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS complement(155315..155884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038882.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(155887..156624) product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038883.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(156637..157281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS complement(157278..157877) product secreted protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038885.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 sequence07 source 1..152924 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 142..501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS 506..1018 product pathogenicity-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036344.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS 1174..2391 product putative RNA polymerase sigma factor RfaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46358 transl_table 11 codon_start 1 locus_tag LOCUS_12780 gene rfaY CDS complement(2443..3003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036342.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS 3166..3915 product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBH8 transl_table 11 codon_start 1 locus_tag LOCUS_12800 gene ate CDS 3954..5162 product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036340.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS complement(5244..6431) product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBI2 transl_table 11 codon_start 1 locus_tag LOCUS_12820 gene purT CDS 6569..7450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS 7496..7675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036334.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS 7672..7851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036333.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 7855..8448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS 8458..9267 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036332.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS complement(9705..10076) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036330.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS complement(10181..11254) product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036329.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(11488..12129) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036328.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(12129..13337) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036327.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS 13487..14083 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636501.2 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS 14029..14874 product putative septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBJ4 transl_table 11 codon_start 1 locus_tag LOCUS_12930 gene minC CDS 14910..15719 product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBJ5 transl_table 11 codon_start 1 locus_tag LOCUS_12940 gene minD CDS 15722..15982 product cell division topological specificity factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBJ6 transl_table 11 codon_start 1 locus_tag LOCUS_12950 gene minE CDS 16020..16508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036322.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(16597..17841) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037853.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(17973..20051) product alanyl dipeptidyl peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636480.2 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS complement(20307..22271) product oligopeptide transporter, OPT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036303.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene oliA CDS 22527..24281 product putative transporter YclF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94408 transl_table 11 codon_start 1 locus_tag LOCUS_13000 gene yclF CDS complement(24303..26288) product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073927.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(26361..28331) product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073927.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(28512..29147) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807274.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS 29287..30192 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818466.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 30284..30730 product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389455.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(30793..31281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(31266..32384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS 32606..34312 product putative malate:quinone oxidoreductase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYF4 transl_table 11 codon_start 1 locus_tag LOCUS_13080 gene mqo1 CDS 34577..36769 product ferripyoverdine receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635553.2 transl_table 11 codon_start 1 locus_tag LOCUS_13090 gene fpvA CDS 36992..38635 product malonate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038693.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 gene mdcA CDS 38646..38966 product malonate decarboxylase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4U6 transl_table 11 codon_start 1 locus_tag LOCUS_13110 gene mdcC CDS 38963..39871 product biotin-independent malonate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038695.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 gene mdcB CDS 39868..40578 product malonate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038696.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 gene mdcC CDS 40571..41212 product phosphoribosyl-dephospho-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4U3 transl_table 11 codon_start 1 locus_tag LOCUS_13140 gene mdcG CDS 41251..42066 product putative 2-(5''-triphosphoribosyl)-3'-dephosphocoenzyme-A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4U2 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene citG CDS 42063..42983 product malonate decarboxylase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038699.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 gene mdcH CDS 43088..44455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038700.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 gene matC CDS 44561..45280 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038701.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene mdcY CDS complement(45362..45694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS 45846..46793 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709461.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS complement(46798..48066) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730167.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS complement(48113..48886) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038759.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 gene algR CDS complement(48883..49956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS complement(49979..50839) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918777.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(50979..51992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(52090..52500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(52532..53674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS complement(53736..55274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390497.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS complement(55318..55578) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639890.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS complement(55556..56065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS complement(56274..57197) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860032.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS 57350..58324 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464546.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS complement(58328..58828) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972320.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(58842..59279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(59350..61092) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971995.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(61253..62278) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105224.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS complement(62360..63427) product diguanylate cyclase AdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096607.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS complement(63544..64578) product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919500.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS 64674..65726 product AP endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919504.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS 65754..66971 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097691.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS 66984..68108 product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097689.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 68128..68994 product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973789.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS 69013..69309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS complement(69340..70086) product large, multifunctional secreted protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384321.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS complement(70098..70673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973791.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(70673..72358) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973790.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(72386..73282) product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS complement(73891..74169) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103251.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS 74290..75108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS 75105..75566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS 75766..76263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS 77064..77891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837429.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS 77888..80008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816646.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 80316..81266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 81632..82747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS complement(83097..83537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS complement(83540..85255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS complement(85483..87036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS complement(87020..88291) product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815728.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS complement(88418..89008) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P778 transl_table 11 codon_start 1 locus_tag LOCUS_13600 gene ssb CDS 89301..90332 product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037601.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS complement(90377..90670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(90667..91131) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705267.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS complement(91282..91668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS complement(91808..93523) product cyclomaltodextrin glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037602.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 gene cgt CDS complement(93523..95010) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037603.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 gene suc1 CDS complement(95007..97205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637819.2 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS 97448..99493 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037605.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 gene aglA CDS 99745..102513 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037606.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene btuB CDS complement(102847..104460) product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037608.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 gene aglA CDS 104675..105673 product octaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037866.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 gene ispB CDS complement(105770..106540) product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037867.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 106694..107287 product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181700.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS complement(107348..108757) product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P775 transl_table 11 codon_start 1 locus_tag LOCUS_13740 gene murD CDS complement(108738..110090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037869.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS complement(110167..112761) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037871.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 gene lysA CDS 112771..113712 product phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037872.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS 113834..114712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037873.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(114784..115215) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037875.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene osmC CDS 115587..115985 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037886.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 gene hup CDS 116239..116547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS 116604..117152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037889.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS 117253..117831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037890.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS complement(117845..118387) product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037891.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 gene pfpI CDS complement(118551..119063) product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037892.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS 119229..119684 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037893.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS 119702..121177 product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037894.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 gene ynhE CDS 121251..122015 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037895.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 gene ynhD CDS 122015..123277 product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037896.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 gene ynhC CDS 123274..124530 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P745 transl_table 11 codon_start 1 locus_tag LOCUS_13900 gene nifS CDS complement(124638..124949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(125144..125650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS complement(125647..126600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(126604..131934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS 132158..132697 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037898.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS 132694..133026 product benzene 1,2-dioxygenase ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037899.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene bedB CDS 133202..133603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS 133748..136048 product iron transport receptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551717.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS 136117..136836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037902.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS 136847..137524 product PKHD-type hydroxylase PiuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVQ7 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene piuC CDS 137690..138091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 138252..140672 product exogenous ferric siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815626.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 gene bfrA CDS 140969..141583 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037903.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS 141611..142129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037904.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS 142205..143008 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037905.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS 143061..144032 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P736 transl_table 11 codon_start 1 locus_tag LOCUS_14060 gene apbE CDS 144029..145633 product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037907.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS complement(145786..146397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037908.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS complement(146432..147157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036974.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS complement(147175..148260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098363.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(148612..149010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005913333.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 gene comEA CDS 149140..150633 product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037909.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 gene dapE CDS 150696..150971 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037910.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS 151035..152060 product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037911.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 152057..152767 product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037912.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 gene glgC sequence08 source 1..133570 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 490..903 product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143935.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 966..1388 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704080.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS 1425..1835 product extradiol dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809248.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 1885..3171 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525075.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS 3281..4930 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038609.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS 5130..6389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS 6379..7149 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038759.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 gene algR CDS 7168..7512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038758.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS complement(7552..8166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038756.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 note possible pseudo, frameshifted CDS complement(8522..9109) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113746.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 9243..10460 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113745.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS 10457..11629 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026832.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS complement(11763..13874) product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038754.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS 14162..17113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS complement(17208..18089) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038750.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS 18186..18596 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089292.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS 18628..19416 product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038749.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS 19534..21183 product Na+:H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639007.2 transl_table 11 codon_start 1 locus_tag LOCUS_14330 gene yjcE CDS complement(21232..21525) product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038741.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS 21571..22113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038740.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS complement(22287..22562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038739.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS complement(22576..23064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14370 note possible pseudo, internal stop codon, frameshifted CDS complement(23194..24156) product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038737.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 gene motB note possible pseudo, internal stop codon, frameshifted CDS complement(24160..25026) product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038736.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 gene motA CDS complement(25106..25573) product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4Q6 transl_table 11 codon_start 1 locus_tag LOCUS_14400 gene msrB CDS 25713..26084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS 26218..26373 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(26429..26908) product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038732.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene lrp CDS 27058..28362 product D-amino acid dehydrogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTQ0 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene dadA1 CDS 28341..29411 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4R0 transl_table 11 codon_start 1 locus_tag LOCUS_14450 gene alr CDS complement(29540..30106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS 30354..32339 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038726.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS 32383..32676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038725.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(32754..33017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038723.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 33175..34239 product 16S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038722.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 gene rsmC CDS 34236..34937 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038721.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 gene rsuA CDS 34934..35617 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038720.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(35676..36884) product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035826.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 gene fabB CDS complement(36884..37399) product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCW9 transl_table 11 codon_start 1 locus_tag LOCUS_14540 gene fabA CDS 37591..38685 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCW8 transl_table 11 codon_start 1 locus_tag LOCUS_14550 gene dinB CDS complement(38821..39735) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083599.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS complement(39900..40538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936948.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS 40647..41576 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083596.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS 41573..42364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113379.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 42430..43086 product phosphoglycolate phosphatase, bacterial inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035829.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 gene gph CDS complement(43228..45072) product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038182.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 gene btuB CDS 45554..46132 product alpha-ribazole-5'-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404266.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(46170..46532) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035830.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(46529..47011) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035831.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS 47080..47763 product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCW4 transl_table 11 codon_start 1 locus_tag LOCUS_14650 gene bioD CDS complement(47839..49287) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817442.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS complement(49436..50173) product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89EN0 transl_table 11 codon_start 1 locus_tag LOCUS_14670 gene msrA CDS complement(50188..51954) product cytochrome C biogenesis protein DipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975109.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS complement(51957..52529) product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088596.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS 52673..53392 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704857.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 53389..54858 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704858.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS complement(54855..56207) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096876.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(56198..56887) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076440.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 gene rstA CDS 57234..59135 product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036622.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 gene wbpS CDS complement(59477..59824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(59941..60303) product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCW2 transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene ptps CDS 60497..63136 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206610.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 gene btuB CDS 63211..65805 product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404296.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(66325..67746) product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035834.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 gene rhlE CDS 68626..69600 product fumarylacetoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035835.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 gene uptA CDS 69615..70283 product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035836.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene uptB CDS complement(70330..71790) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038747.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS complement(71771..73054) product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038748.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS complement(73130..74257) product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035837.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 gene uptC CDS 74379..74744 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035838.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene uptD CDS 74741..75625 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035839.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 gene uptE CDS 75793..75957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 75950..76186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS 76487..77857 product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035841.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 gene cysB CDS 77991..79193 product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035842.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 gene metB CDS 79190..80020 product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FYB8 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS 80010..81437 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705992.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 81479..85792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS complement(85850..86980) product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NF91 transl_table 11 codon_start 1 locus_tag LOCUS_14940 gene rffE CDS complement(87126..87584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS 87730..88152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(88173..89675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS complement(89675..90805) product dTDP-4-amino-4,6-dideoxy-D-glucose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950550.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS complement(90841..91215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(91212..91970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(91975..92931) product glucosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525085.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(93252..94190) product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035862.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 gene etfA CDS complement(94190..94936) product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035863.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 gene etfB CDS 95233..96288 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C7J0 transl_table 11 codon_start 1 locus_tag LOCUS_15040 gene rfbB CDS 96303..97190 product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C7J4 transl_table 11 codon_start 1 locus_tag LOCUS_15050 gene rmlA CDS 97187..97744 product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035866.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 gene rmlC CDS 97741..98634 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035867.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 gene rmlD CDS complement(98710..100113) product xanthan biosynthesis protein XanB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C7J3 transl_table 11 codon_start 1 locus_tag LOCUS_15080 gene xanB CDS complement(100125..101471) product phosphohexose mutases inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C7J2 transl_table 11 codon_start 1 locus_tag LOCUS_15090 gene xanA CDS complement(101560..101952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS complement(101949..103235) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229161.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(103239..104198) product NAD-dependent nucleoside diphosphate-sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941053.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS complement(104195..104932) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267576.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS complement(104935..106239) product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267577.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS complement(106239..107633) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931866.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS 107854..108585 product succinyl-CoA:3-ketoacid coenzyme A transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C7I7 transl_table 11 codon_start 1 locus_tag LOCUS_15160 gene lpsI CDS 108587..109219 product succinyl-CoA:3-ketoacid coenzyme A transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C7I8 transl_table 11 codon_start 1 locus_tag LOCUS_15170 gene lpsJ CDS 109266..109853 product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035874.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 gene alkB CDS complement(109897..110538) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035875.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(110535..111461) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035876.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(111465..112292) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035877.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 gene yrbF CDS complement(112294..113415) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035878.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 gene yrbE CDS 113508..114767 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035879.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(114878..115261) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035880.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS complement(115485..117188) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCS4 transl_table 11 codon_start 1 locus_tag LOCUS_15250 gene proS CDS complement(117852..118268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035882.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS 118307..119083 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035883.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 gene pssA CDS 119080..119592 product alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035884.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS 119589..120086 product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCS0 transl_table 11 codon_start 1 locus_tag LOCUS_15290 gene rimI CDS complement(120191..121012) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703884.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(121147..123975) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCR7 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene valS CDS complement(124048..124473) product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005995970.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene holC CDS complement(124556..126034) product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCR4 transl_table 11 codon_start 1 locus_tag LOCUS_15330 gene pepA CDS 126139..127221 product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035891.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS 127233..128324 product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035892.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS complement(128412..128858) product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035894.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS 128960..129937 product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCQ9 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene xerD CDS 130038..130829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035896.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 gene dsbC CDS complement(130945..133044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15390 sequence09 source 1..129508 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 156..2357 product ferripyoverdine receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635553.2 transl_table 11 codon_start 1 locus_tag LOCUS_15400 gene fpvA CDS 2464..2778 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035507.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS 2775..4412 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035506.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS 4409..4738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(4939..7077) product ribosomal RNA large subunit methyltransferase K/L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAE0 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene rlmL CDS complement(7223..7873) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036725.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS 7823..8389 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036723.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS complement(8629..9531) product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036721.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 gene sseA CDS complement(9528..10214) product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036720.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS complement(10481..11182) product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CLT3 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS 11350..12132 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036719.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene crt CDS 12137..12490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS 12490..13182 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAF2 transl_table 11 codon_start 1 locus_tag LOCUS_15520 gene nth CDS complement(13263..14495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS 14994..16010 product phosphate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAF6 transl_table 11 codon_start 1 locus_tag LOCUS_15540 gene phoX CDS 16603..17691 product phosphate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAF7 transl_table 11 codon_start 1 locus_tag LOCUS_15550 gene pstS CDS 17774..18742 product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAF8 transl_table 11 codon_start 1 locus_tag LOCUS_15560 gene pstC CDS 18742..19605 product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAF9 transl_table 11 codon_start 1 locus_tag LOCUS_15570 gene pstA CDS 19625..20455 product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAG0 transl_table 11 codon_start 1 locus_tag LOCUS_15580 gene pstB CDS 20521..21228 product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAG1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 gene phoU CDS 21453..21809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS 21865..22671 product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWS2 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS 22664..23419 product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114075.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS 23443..23964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113020.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS 24146..24796 product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAG3 transl_table 11 codon_start 1 locus_tag LOCUS_15640 gene rnt CDS complement(24868..27831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636891.2 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS complement(28073..29482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(29489..30217) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096597.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS 30421..31662 product MacA family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208368.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 gene macA CDS 31659..33617 product macrolide export ATP-binding/permease protein MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIL8 transl_table 11 codon_start 1 locus_tag LOCUS_15690 gene macB CDS 33614..35053 product outer membrane efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535038.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS complement(35130..35873) product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAG5 transl_table 11 codon_start 1 locus_tag LOCUS_15710 gene rlmB CDS complement(35980..36462) product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036703.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS complement(36557..39016) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAG7 transl_table 11 codon_start 1 locus_tag LOCUS_15730 gene vacB tRNA 39145..39229 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA 39384..39468 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS complement(39654..40400) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972224.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS 40500..41399 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184803.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 tRNA 41450..41536 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS complement(41781..43370) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036592.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene pmrB CDS complement(43378..44559) product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036591.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene pmrA CDS complement(44571..46064) product multidrug RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036590.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene yjcP CDS complement(46061..46504) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036589.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 gene yybA CDS 46680..47558 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036588.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS 47619..49862 product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAT2 transl_table 11 codon_start 1 locus_tag LOCUS_15810 gene parC CDS complement(50202..50690) product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAT4 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene brf CDS 50814..53141 product penicillin acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036584.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 gene acyII CDS complement(53173..54864) product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036581.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 gene asnB CDS 55211..56095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636762.2 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(56150..57277) product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAU0 transl_table 11 codon_start 1 locus_tag LOCUS_15860 gene dapE CDS complement(57274..57645) product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036578.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(57677..58543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS complement(58546..59607) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAU3 transl_table 11 codon_start 1 locus_tag LOCUS_15890 gene dapD CDS complement(59607..62234) product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAU4 transl_table 11 codon_start 1 locus_tag LOCUS_15900 gene glnD CDS complement(62237..63022) product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAU5 transl_table 11 codon_start 1 locus_tag LOCUS_15910 gene map CDS complement(63222..63434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS 63316..63783 product protein U inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036573.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 gene pru CDS 63783..64532 product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036572.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 gene ecpD CDS 64540..66918 product outer membrane usher protein FasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636753.2 transl_table 11 codon_start 1 locus_tag LOCUS_15950 gene fasD CDS 66915..67949 product spore coat protein U inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036570.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS 67951..68319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 68319..69017 product type 1 pili usher pathway chaperone CsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096058.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS 69237..70043 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAV2 transl_table 11 codon_start 1 locus_tag LOCUS_15990 gene rpsB CDS 70170..71045 product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAV3 transl_table 11 codon_start 1 locus_tag LOCUS_16000 gene tsf CDS 71308..72846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS 72968..73696 product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59009 transl_table 11 codon_start 1 locus_tag LOCUS_16020 gene pyrH CDS 73793..74347 product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAV6 transl_table 11 codon_start 1 locus_tag LOCUS_16030 gene frr CDS 74410..75120 product ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAV7 transl_table 11 codon_start 1 locus_tag LOCUS_16040 gene uppS CDS 75117..75953 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAV8 transl_table 11 codon_start 1 locus_tag LOCUS_16050 gene cdsA CDS 75956..77146 product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAV9 transl_table 11 codon_start 1 locus_tag LOCUS_16060 gene dxr CDS 77202..78560 product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAW0 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS 78635..80998 product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAW1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 gene oma CDS 81384..82406 product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAW3 transl_table 11 codon_start 1 locus_tag LOCUS_16090 gene lpxD CDS 82403..82861 product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAW4 transl_table 11 codon_start 1 locus_tag LOCUS_16100 gene fabZ CDS 82877..83668 product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAW5 transl_table 11 codon_start 1 locus_tag LOCUS_16110 gene lpxA CDS 83665..84924 product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAW6 transl_table 11 codon_start 1 locus_tag LOCUS_16120 gene lpxB CDS 84921..85586 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAW7 transl_table 11 codon_start 1 locus_tag LOCUS_16130 gene rnhB CDS 85857..89447 product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAW8 transl_table 11 codon_start 1 locus_tag LOCUS_16140 gene dnaE1 CDS 89512..90381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS 90495..91454 product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAW9 transl_table 11 codon_start 1 locus_tag LOCUS_16160 gene accA CDS complement(91629..92084) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036547.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS 92234..92824 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036546.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS 92918..94225 product PHB depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636727.2 transl_table 11 codon_start 1 locus_tag LOCUS_16190 gene phaZ CDS complement(94362..95351) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036544.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS complement(95348..95713) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036543.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS 95850..96752 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037755.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS complement(97334..98206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037756.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(98328..98576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS 98460..99266 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037757.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS 99336..99629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037760.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS complement(99671..100453) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037761.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(100486..100842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189643.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS 100955..102763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037762.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS 102919..103614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS 103557..103916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16310 note possible pseudo, frameshifted CDS complement(103926..105137) product bifunctional glucose-1-phosphatase/inositol phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749190.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS complement(105134..106966) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037763.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 gene bapA CDS complement(107117..108685) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037766.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS 108796..109239 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808385.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS 109236..110066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037768.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS 110101..111048 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037769.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS complement(111109..112269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109755.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS complement(112433..113503) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259351.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(113638..114360) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7H1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS complement(114395..116026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(116169..118547) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037771.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS complement(118817..120763) product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7G9 transl_table 11 codon_start 1 locus_tag LOCUS_16430 gene deaD CDS 121032..121253 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037775.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS complement(121265..122443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037777.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 gene visC CDS complement(122524..122913) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037778.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS complement(122925..123470) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(123529..124725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037781.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS 125111..126589 product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037782.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 gene Ada CDS 126586..127077 product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7F8 transl_table 11 codon_start 1 locus_tag LOCUS_16500 gene ogt CDS 127239..128489 product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037784.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(128590..128769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(128880..129293) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037787.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 sequence10 source 1..129308 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 544..1596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS complement(1604..1864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS complement(1851..2210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268497.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS complement(2285..2866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS complement(3187..3756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS complement(3753..4337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056538.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(4534..5004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(5001..5246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS complement(5243..5470) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS 5592..7517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS complement(7549..8757) product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387953.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS 8834..9616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS complement(9638..10138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS complement(10213..10596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(10598..11416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS 11523..11879 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036785.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS 11958..12218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS 12350..14956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038875.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(14990..15298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS complement(15298..15483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(15520..15771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(16246..16620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS complement(16617..16856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS complement(16897..17118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS complement(17115..17411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS complement(17849..18235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS complement(18597..19541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS 20431..22119 product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039285.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 22116..22493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS 22500..22778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037162.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS complement(22834..23115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS complement(23334..24329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(24520..24933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 25151..25672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038765.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS 25720..26358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038777.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 26360..26950 product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038763.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 gene entB CDS complement(26980..27909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118999.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS complement(27976..28536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036824.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(28652..31198) product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037451.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 gene lig3 CDS complement(31211..31387) product DUF3606 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037452.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS complement(31406..32350) product non-homologous end joining protein Ku inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PE77 transl_table 11 codon_start 1 locus_tag LOCUS_16940 gene ku CDS complement(32435..32944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037183.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 32994..33749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16960 note possible pseudo, frameshifted CDS 33677..34942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16970 note possible pseudo, frameshifted CDS complement(34987..35364) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967059.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS 35526..36668 product two-component system sensor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636560.2 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS 36670..37032 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036384.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(37072..37524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS 37663..38502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS complement(38499..40700) product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096059.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS complement(40710..41366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS complement(41483..41980) product spore coat protein U inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366014.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS 42424..43413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS complement(43503..43970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS complement(43967..44335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS complement(44340..44852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS 45027..45518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS complement(45557..46330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(46451..49102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(49105..50670) product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035470.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS complement(50798..51211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS complement(51277..51660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS complement(51657..51971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS complement(51968..52288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS complement(52476..52685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS complement(52685..53269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS complement(53376..54950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS complement(55498..56511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55426 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS complement(56578..56823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS complement(56886..58571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS complement(58582..58752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS complement(59252..59914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(59907..60695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS complement(60688..61377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS complement(61464..62030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS complement(62193..62531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS complement(62681..63034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS complement(63418..63963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS complement(64132..64902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS complement(64889..66832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS 67036..69591 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBB5 transl_table 11 codon_start 1 locus_tag LOCUS_17340 gene mutS CDS 69784..71427 product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F601 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS 71536..72138 product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036403.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS complement(72211..73398) product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870481.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS complement(73512..73919) product heat shock protein 15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBB8 transl_table 11 codon_start 1 locus_tag LOCUS_17380 gene hslR CDS complement(73929..74168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS 74231..75703 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036400.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(75820..76230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089492.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(76269..76703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063677.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS complement(76784..77164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS complement(77247..77648) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBC0 transl_table 11 codon_start 1 locus_tag LOCUS_17440 gene rplS CDS complement(77803..78561) product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBC1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 gene trmD CDS complement(78570..79082) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBC2 transl_table 11 codon_start 1 locus_tag LOCUS_17460 gene rimM CDS complement(79127..79387) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBC3 transl_table 11 codon_start 1 locus_tag LOCUS_17470 gene rpsP CDS complement(79518..80300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036395.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS complement(80297..81319) product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036394.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS complement(81464..82840) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBC8 transl_table 11 codon_start 1 locus_tag LOCUS_17500 gene ffh CDS 82963..83757 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036390.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(83859..84365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(84416..86722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036366.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS complement(86771..88627) product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036365.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 gene hsp90xc CDS complement(88803..90179) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBF8 transl_table 11 codon_start 1 locus_tag LOCUS_17550 gene radA CDS 90330..92390 product putative signaling protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I310 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS complement(92508..92849) product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036359.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 gene cyoD CDS complement(92849..93487) product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036358.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 gene cyoC CDS complement(93484..95481) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036357.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 gene cyoB CDS complement(95484..96524) product ubiquinol oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBG3 transl_table 11 codon_start 1 locus_tag LOCUS_17600 gene cyoA CDS complement(96841..97197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(98453..99307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS complement(100170..101294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17630 tRNA complement(101737..101812) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS complement(101863..102867) product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056558.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS complement(102965..105838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS 106074..106601 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402962.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS 106598..107566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS 107581..110367 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207266.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 gene btuB CDS complement(110455..111120) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704333.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS complement(111117..112985) product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036360.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(113214..114164) product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBG4 transl_table 11 codon_start 1 locus_tag LOCUS_17710 gene ispH CDS complement(114192..114716) product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBG5 transl_table 11 codon_start 1 locus_tag LOCUS_17720 gene lspA CDS complement(114716..117547) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBG6 transl_table 11 codon_start 1 locus_tag LOCUS_17730 gene ileS CDS complement(117544..118491) product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBG7 transl_table 11 codon_start 1 locus_tag LOCUS_17740 gene ribF CDS complement(118567..120186) product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBG8 transl_table 11 codon_start 1 locus_tag LOCUS_17750 gene mviN CDS 120289..120558 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBG9 transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene rpsT CDS complement(120754..121806) product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBH0 transl_table 11 codon_start 1 locus_tag LOCUS_17770 gene obg CDS complement(122010..122273) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBH1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 gene rpmA CDS complement(122292..122600) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBH2 transl_table 11 codon_start 1 locus_tag LOCUS_17790 gene rplU CDS 122919..125921 product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBH3 transl_table 11 codon_start 1 locus_tag LOCUS_17800 gene uvrA CDS 125921..126328 product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036347.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS 126419..127144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS complement(127384..127698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS 127865..128641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036346.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 sequence11 source 1..114062 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 296..1147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035911.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS 1144..1983 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035916.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 gene gtrB CDS 2037..3218 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCP3 transl_table 11 codon_start 1 locus_tag LOCUS_17870 gene pncB CDS complement(3241..3606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 4066..4605 product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113678.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 gene pilin CDS 4691..5422 product fimbrial chaperone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206740.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 gene mrkB CDS 5494..8079 product outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206739.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 gene mrkC CDS 8070..9107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS 9372..10859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817396.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 gene bcsE CDS 10856..11035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS 11032..12663 product cellulose biosynthesis protein BcsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192026.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS 12663..12842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS 12839..13594 product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174891.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 gene bcsF CDS 13594..16218 product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369239.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 gene bcsA CDS 16215..18584 product cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z290 transl_table 11 codon_start 1 locus_tag LOCUS_17990 gene bcsB CDS 18584..22165 product cellulose biosynthesis protein BcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817392.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 gene bcsC CDS 22149..23291 product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770923.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 gene wssD CDS complement(23331..24647) product xanthine/uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035550.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 gene yieG CDS complement(24732..26396) product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035928.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 gene yjjK CDS 26650..27123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS 27296..28549 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCN4 transl_table 11 codon_start 1 locus_tag LOCUS_18050 gene glyA CDS 28617..29033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS 29061..29510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18070 tRNA complement(29764..29845) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS 30287..31372 product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCN1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 gene ribD CDS complement(31412..31630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS 32236..33333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS complement(33375..34259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS complement(34361..35017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS complement(35160..35780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035933.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS 36230..36832 product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035934.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 gene ribE CDS 36829..37929 product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035935.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene ribA CDS 38114..38581 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCM7 transl_table 11 codon_start 1 locus_tag LOCUS_18160 gene ribH CDS 38578..39057 product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCM6 transl_table 11 codon_start 1 locus_tag LOCUS_18170 gene nusB CDS 39178..40140 product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCM5 transl_table 11 codon_start 1 locus_tag LOCUS_18180 gene thiL CDS complement(40720..41091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(41252..41965) product fimbrial chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484311.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS complement(42019..42528) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704062.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS 42927..45380 product outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210844.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 gene htrE CDS 45377..45883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS 45990..46892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS 46925..47944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS complement(48035..48436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS 48906..49466 product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947704.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS complement(49683..51068) product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035947.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 gene dld CDS complement(51373..51741) product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCL4 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS complement(51731..53464) product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035950.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS 53534..54352 product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCL2 transl_table 11 codon_start 1 locus_tag LOCUS_18310 gene rsmI CDS complement(55004..55483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184771.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS complement(55585..56337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035954.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS 56661..57107 product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCK8 transl_table 11 codon_start 1 locus_tag LOCUS_18340 gene mraZ CDS 57122..58090 product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCK7 transl_table 11 codon_start 1 locus_tag LOCUS_18350 gene rsmH CDS 58087..58350 product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCK6 transl_table 11 codon_start 1 locus_tag LOCUS_18360 gene ftsL CDS 58347..60191 product penicillin-binding protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035957.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 gene ftsI CDS 60188..61696 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCK4 transl_table 11 codon_start 1 locus_tag LOCUS_18380 gene murE CDS 61693..63087 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCK3 transl_table 11 codon_start 1 locus_tag LOCUS_18390 gene murF CDS 63077..64162 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCK2 transl_table 11 codon_start 1 locus_tag LOCUS_18400 gene mraY CDS 64164..65483 product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCK1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 gene ftsW CDS 65480..66565 product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCK0 transl_table 11 codon_start 1 locus_tag LOCUS_18420 gene murG CDS 66606..68042 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCJ9 transl_table 11 codon_start 1 locus_tag LOCUS_18430 gene murC CDS 68039..69001 product D-alanine--D-alanine ligase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCJ8 transl_table 11 codon_start 1 locus_tag LOCUS_18440 gene ddlB CDS 68998..69747 product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCJ7 transl_table 11 codon_start 1 locus_tag LOCUS_18450 gene ftsQ CDS 69744..70979 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CLU9 transl_table 11 codon_start 1 locus_tag LOCUS_18460 gene ftsA CDS 71150..72385 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCJ6 transl_table 11 codon_start 1 locus_tag LOCUS_18470 gene ftsZ CDS 72579..73490 product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCJ5 transl_table 11 codon_start 1 locus_tag LOCUS_18480 gene lpxC CDS complement(73773..74222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035968.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS 74235..75191 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035969.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS 75464..78196 product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCJ2 transl_table 11 codon_start 1 locus_tag LOCUS_18510 gene secA CDS 78329..79255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035972.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS complement(79345..79929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035974.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(79970..80797) product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCI7 transl_table 11 codon_start 1 locus_tag LOCUS_18540 gene metF CDS 81000..81932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS 81951..83003 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403193.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS 83000..83731 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403194.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 gene algR CDS complement(83738..85255) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS 85391..85948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035986.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS 86049..86684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(86754..87239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS complement(87239..87712) product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XCT4 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS complement(87877..89322) product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCH5 transl_table 11 codon_start 1 locus_tag LOCUS_18630 gene ahcY CDS 89563..92079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035989.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS 92252..94963 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P336 transl_table 11 codon_start 1 locus_tag LOCUS_18650 gene ppc CDS complement(95031..95537) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815410.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS complement(95678..96889) product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCH3 transl_table 11 codon_start 1 locus_tag LOCUS_18670 gene metK CDS 97215..98930 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705506.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS 98927..99727 product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921173.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS 99823..100890 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035998.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS complement(100988..101815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS complement(101925..102989) product tRNA-dihydrouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCH1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 gene dusB CDS complement(103068..103514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS complement(103648..104613) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCH0 transl_table 11 codon_start 1 locus_tag LOCUS_18740 gene rbsK CDS complement(104639..105937) product nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036001.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 gene yeiM CDS 106014..107102 product NADP-dependent aryl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036002.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS 107314..107514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036003.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS 107668..109860 product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036004.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 gene phuR CDS 109865..110464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 110533..111468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636161.2 transl_table 11 codon_start 1 locus_tag LOCUS_18800 misc_feature complement(111703..>114062) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036012.1:oxidoreductase locus_tag LOCUS_18810 sequence12 source 1..103588 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 858..2003 product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038556.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 gene mltB CDS 2000..3268 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038555.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 gene rlpA CDS 3369..4589 product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038554.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 gene dacC CDS complement(4842..5807) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038553.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS 5745..6038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS 6259..7251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638800.2 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS 7413..7700 product UPF0250 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P588 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS 7688..8398 product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P589 transl_table 11 codon_start 1 locus_tag LOCUS_18890 gene lipB CDS 8417..9427 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P590 transl_table 11 codon_start 1 locus_tag LOCUS_18900 gene lipA CDS 9710..11887 product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038548.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 gene prc CDS 12038..12637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS 12661..13893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038538.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS 13904..14809 product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038537.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 gene gndA CDS complement(15020..16063) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038536.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 gene ydgJ CDS 16235..16618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS 16821..18638 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038534.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS 18635..19075 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038533.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS 19080..20591 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038532.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS complement(20667..21410) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531816.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS 21501..21986 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038531.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 gene folK CDS complement(22047..22784) product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 gene ptr1 CDS 22844..24028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638777.2 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS 24025..24417 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038528.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS complement(24553..26910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS complement(27022..29685) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038012.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 gene iroN CDS complement(29829..30845) product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038011.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 gene glk CDS 30766..30984 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS 31222..32511 product glucose/galactose MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038511.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 gene gluP CDS 32518..33618 product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038510.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS 33626..34654 product glucosamine-fructose-6-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638757.2 transl_table 11 codon_start 1 locus_tag LOCUS_19110 gene glmS CDS 34654..35802 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5D1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 gene nagA CDS 35802..36869 product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428415.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS 37185..40211 product autotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974616.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS complement(40392..40823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS 41074..42108 product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038507.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS 42112..42447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS 42497..42931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS complement(43274..44494) product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5D4 transl_table 11 codon_start 1 locus_tag LOCUS_19190 gene cca CDS complement(44570..44806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS complement(44873..46858) product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038504.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 gene slt CDS complement(46877..47167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS 47079..47417 product biopolymer transport protein exbD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C7I9 transl_table 11 codon_start 1 locus_tag LOCUS_19230 gene exbD2 CDS 47476..47706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS 47938..50799 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038503.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 gene btuB CDS complement(50876..53017) product ferric-rhodotorulic acid/ferric-coprogen receptor FhuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953420.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 gene fhuE CDS complement(53193..53744) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037887.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS complement(53821..54303) product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532463.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS 54376..55251 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921297.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS complement(55343..56110) product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038499.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS complement(56134..56967) product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038498.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 gene dsbA CDS complement(57074..57724) product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5E2 transl_table 11 codon_start 1 locus_tag LOCUS_19320 gene dsbA CDS complement(57831..58631) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038496.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 gene cycA CDS 58788..59390 product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5E4 transl_table 11 codon_start 1 locus_tag LOCUS_19340 gene engB CDS complement(59491..60462) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815405.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS complement(61184..62008) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973637.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS complement(62005..62709) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888239.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS 62862..64226 product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038494.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 gene gsh1 CDS complement(64350..65408) product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113749.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS 65516..66400 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067687.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS complement(66444..67097) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706988.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS 67183..67878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706987.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS complement(67891..68307) product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087011.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS complement(68406..69584) product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267094.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS 69641..70546 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400772.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS 70618..70893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038488.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS 70952..72061 product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7L9 transl_table 11 codon_start 1 locus_tag LOCUS_19470 gene adhC CDS 72112..72942 product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5F4 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS 73138..74574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS complement(74650..75090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114763.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS 75232..76140 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003143729.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS 76317..77831 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114761.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS 77855..78937 product secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114760.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS 78934..80346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114759.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS complement(80459..80797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038481.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS complement(80875..81816) product DegV domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5F9 transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS complement(81912..82544) product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186002.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS complement(82565..83848) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038470.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS complement(83848..85257) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038469.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS 85417..86193 product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761555.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS 86237..86776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531871.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS complement(86851..87777) product glutaredoxin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638714.2 transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS complement(87951..88568) product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038463.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS complement(88572..89870) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038462.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 gene aspC CDS 89970..91070 product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5H9 transl_table 11 codon_start 1 locus_tag LOCUS_19650 gene rsgA CDS 91215..92468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038459.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS 92624..94927 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639569.2 transl_table 11 codon_start 1 locus_tag LOCUS_19670 gene fecA CDS complement(95143..95358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS complement(95471..96007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS complement(96157..96897) product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038453.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 gene fabG CDS complement(96922..98253) product citrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038452.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 gene citM CDS complement(98326..99498) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038451.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 gene oprO CDS 99695..100384 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038450.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 gene tctD CDS 100377..101768 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038449.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 gene tctE CDS 101765..102820 product periplasmic iron-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638696.2 transl_table 11 codon_start 1 locus_tag LOCUS_19750 gene afuA CDS 102849..103499 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038447.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 sequence13 source 1..101568 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(205..726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS complement(892..2799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS complement(2799..3419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS complement(3466..4551) product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706124.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS 4655..5575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS 6158..6496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037228.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 gene orf112 CDS 6564..6869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS complement(6879..8075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689773.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS complement(8072..8386) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS complement(8392..9963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS complement(10090..10341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS complement(10338..10541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS complement(10667..10969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS complement(10966..12078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS complement(12071..12286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS complement(12283..12567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS complement(12557..12727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS complement(13484..14803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS complement(14908..15393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS 15483..16331 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222419.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS complement(16378..17151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS complement(17214..17693) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210231.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS 17878..20022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038673.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS 20080..20580 product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036969.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 gene tspO CDS complement(20597..20890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS 21157..23394 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971984.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS 23391..23858 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316403.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS 23851..26250 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088025.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS complement(26253..26945) product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084072.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS complement(26956..27630) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770944.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS complement(27627..28250) product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404802.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS 28382..29149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036528.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS 29231..30181 product delta 9 acyl-lipid fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036524.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 gene desC CDS 30183..31460 product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036523.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS 31457..32224 product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036522.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS 32221..33480 product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636703.2 transl_table 11 codon_start 1 locus_tag LOCUS_20120 gene cfaA CDS 33482..34030 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036520.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS 34027..34812 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036519.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS 34809..35882 product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036518.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS 35891..36424 product outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639462.2 transl_table 11 codon_start 1 locus_tag LOCUS_20160 gene blc CDS 36549..37085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS complement(36995..38446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS 38508..39104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS 39200..39892 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406371.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS 39889..42210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(42211..42966) product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528770.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS complement(43077..43349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS complement(43550..45586) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ES7 transl_table 11 codon_start 1 locus_tag LOCUS_20240 gene fusA CDS complement(45996..46745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS complement(47005..47766) product hemin import ATP-binding protein HmuV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RKQ4 transl_table 11 codon_start 1 locus_tag LOCUS_20260 gene hmuV CDS complement(47763..48767) product hemin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405433.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS complement(48803..49849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS complement(49901..51277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS complement(51400..52368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090549.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS 52255..52497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS complement(52510..52695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS 52710..53084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS complement(53158..53547) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036362.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS complement(53736..55097) product recombination factor protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637341.2 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS complement(55286..55924) product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P991 transl_table 11 codon_start 1 locus_tag LOCUS_20360 gene lolA CDS complement(56036..57979) product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037137.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS complement(58019..60379) product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P993 transl_table 11 codon_start 1 locus_tag LOCUS_20380 gene ftsK CDS 60613..61584 product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P994 transl_table 11 codon_start 1 locus_tag LOCUS_20390 gene trxB CDS complement(61686..62315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS complement(62580..64046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS 64221..65372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037134.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS complement(65417..66685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS 66759..67499 product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P996 transl_table 11 codon_start 1 locus_tag LOCUS_20440 gene aat CDS 67586..67804 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P997 transl_table 11 codon_start 1 locus_tag LOCUS_20450 gene infA CDS complement(67860..68009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS 68008..68385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS complement(68457..70742) product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037131.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 gene clpA CDS 70881..71693 product streptomycin 3''-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113610.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 gene str CDS complement(71887..72213) product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P999 transl_table 11 codon_start 1 locus_tag LOCUS_20500 gene clpS CDS 72326..72799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056178.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS 72801..73262 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037129.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 gene mutT CDS 73259..74401 product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9A1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 gene mnmA CDS 74398..75012 product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9A2 transl_table 11 codon_start 1 locus_tag LOCUS_20540 gene hflD CDS 75177..76367 product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037126.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 gene mcp CDS 76373..76678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20560 repeat_region 76708..77002 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcaggcatccgtgccgaccaa CDS complement(77069..79828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637325.2 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS 79960..82062 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037123.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 gene hrpX CDS 82067..83839 product c-di-GMP phosphodiesterase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037122.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 gene pdeA CDS complement(83930..85150) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037121.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS complement(85242..85580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037120.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS complement(85577..85882) product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037119.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 gene flgM CDS complement(85958..86614) product flagellar basal body P-ring biosynthesis protein FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637319.2 transl_table 11 codon_start 1 locus_tag LOCUS_20630 gene flgA CDS 86797..87741 product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037117.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 gene cheV CDS 87881..88276 product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9B3 transl_table 11 codon_start 1 locus_tag LOCUS_20650 gene flgB CDS 88280..88687 product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9B4 transl_table 11 codon_start 1 locus_tag LOCUS_20660 gene flgC CDS 88711..89394 product basal-body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9B5 transl_table 11 codon_start 1 locus_tag LOCUS_20670 gene flgD CDS 89427..90650 product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9B6 transl_table 11 codon_start 1 locus_tag LOCUS_20680 gene flgE CDS 90683..91432 product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9B7 transl_table 11 codon_start 1 locus_tag LOCUS_20690 gene flgF CDS 91535..92320 product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9B8 transl_table 11 codon_start 1 locus_tag LOCUS_20700 gene flgG CDS 92343..93035 product flagellar L-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9B9 transl_table 11 codon_start 1 locus_tag LOCUS_20710 gene flgH CDS 93119..94180 product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9C0 transl_table 11 codon_start 1 locus_tag LOCUS_20720 gene flgI CDS 94182..95381 product flagellar rod assembly protein/muramidase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637309.2 transl_table 11 codon_start 1 locus_tag LOCUS_20730 gene flgJ CDS 95390..97270 product flagellar hook protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037108.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 gene flgK CDS 97267..98469 product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037107.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 gene flgL CDS 98855..100075 product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9C4 transl_table 11 codon_start 1 locus_tag LOCUS_20760 gene fliC CDS 100148..101335 product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9C4 transl_table 11 codon_start 1 locus_tag LOCUS_20770 gene fliC sequence14 source 1..101296 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 971..1405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS complement(1472..2722) product DNA polymerase V subunit UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038087.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 gene umuC CDS complement(2706..3188) product peptidase S24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038086.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 gene umuD CDS complement(3573..4928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS 5286..5852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS complement(5986..6483) product fasciclin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083338.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS complement(6725..6976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS complement(7069..7314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS complement(7506..8336) product non-heme chloroperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096737.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS 8538..9530 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974642.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS complement(9607..10005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS 10126..10545 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035880.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS 10595..11002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(11026..11667) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089404.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS 12142..12594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036511.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS complement(12744..16103) product outer membrane autotransporter barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103649.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS 16292..16492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS 16614..16964 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971965.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS complement(16980..17597) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082696.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS 17723..19195 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112370.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS complement(19207..19509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS complement(19673..20137) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038649.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS 20203..21099 product interphotoreceptor retinoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222113.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS 21189..22091 product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971752.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS 22302..24833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS 25054..25224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS complement(25283..27334) product catecholate siderophore receptor CirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706114.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS 27824..29749 product glucans biosynthesis glucosyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P532 transl_table 11 codon_start 1 locus_tag LOCUS_21050 gene opgH CDS 29800..30459 product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038606.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS 30463..31506 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038605.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 gene algZ CDS 31517..32248 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038604.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 gene algR CDS 32796..33707 product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P536 transl_table 11 codon_start 1 locus_tag LOCUS_21090 gene hemC CDS complement(33825..34601) product salt-induced outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038602.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS complement(34708..35424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS 35392..36363 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038601.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS 36390..37184 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4S9 transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS complement(37291..38790) product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDI0 transl_table 11 codon_start 1 locus_tag LOCUS_21140 gene glpK CDS complement(38870..40351) product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDH8 transl_table 11 codon_start 1 locus_tag LOCUS_21150 gene glpD CDS complement(40505..41140) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035787.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 gene ompW CDS 41327..41896 product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035788.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS 42010..43713 product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD06 transl_table 11 codon_start 1 locus_tag LOCUS_21180 gene phdB CDS 43821..45629 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD04 transl_table 11 codon_start 1 locus_tag LOCUS_21190 gene lpdA CDS complement(46079..46921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035794.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS 47357..47722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035795.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS 47754..48554 product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD00 transl_table 11 codon_start 1 locus_tag LOCUS_21220 gene atpB CDS 48628..48933 product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CLV6 transl_table 11 codon_start 1 locus_tag LOCUS_21230 gene atpE CDS 48956..49510 product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCZ9 transl_table 11 codon_start 1 locus_tag LOCUS_21240 gene atpF CDS 49513..50040 product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCZ8 transl_table 11 codon_start 1 locus_tag LOCUS_21250 gene atpH CDS 50085..51632 product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCZ7 transl_table 11 codon_start 1 locus_tag LOCUS_21260 gene atpA CDS 51730..52593 product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCZ6 transl_table 11 codon_start 1 locus_tag LOCUS_21270 gene atpG CDS 52631..54037 product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCZ5 transl_table 11 codon_start 1 locus_tag LOCUS_21280 gene atpD CDS 54151..54573 product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCZ4 transl_table 11 codon_start 1 locus_tag LOCUS_21290 gene atpC CDS complement(54677..55063) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035804.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS 55147..56514 product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCZ1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 gene glmU CDS 56483..57016 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I1K2 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS complement(57073..58425) product histidine kinase/response regulator hybrid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635954.2 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS complement(58422..59849) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035809.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 gene ntrC CDS complement(59890..60270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS complement(60272..61489) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035811.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 gene ybjZ CDS complement(61510..62808) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035812.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 gene ybjZ CDS complement(62819..63544) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035813.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 gene ycfV CDS complement(63580..64857) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035814.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 gene ybjY CDS 65061..66899 product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCY1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 gene glmS CDS 67347..67778 product signal transduction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224278.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS complement(67846..68274) product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530756.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS complement(68366..68881) product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCX6 transl_table 11 codon_start 1 locus_tag LOCUS_21430 gene gloA CDS 69007..70119 product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035824.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 gene cysM CDS complement(70189..70593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS 70764..72794 product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035825.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 gene prlC CDS complement(72876..73679) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038719.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS complement(73676..74272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038716.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS complement(74344..74826) product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4S5 transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS 74973..75869 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038714.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS 76084..77091 product methionine import ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4S7 transl_table 11 codon_start 1 locus_tag LOCUS_21510 gene metN CDS 77088..77777 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038712.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 gene yaeE CDS complement(77847..78443) product outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638854.2 transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS 78571..78897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS 78967..81063 product prolyl oligopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038598.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS complement(81181..82374) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P544 transl_table 11 codon_start 1 locus_tag LOCUS_21560 gene aspC CDS 82571..84682 product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038594.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 gene ptrB CDS 84737..85162 product inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P546 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS 85245..85517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS 85510..86361 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P548 transl_table 11 codon_start 1 locus_tag LOCUS_21600 gene dapF CDS 86358..87032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038590.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS 87049..87939 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P550 transl_table 11 codon_start 1 locus_tag LOCUS_21620 gene xerC CDS 87987..88217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS 88292..88843 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P551 transl_table 11 codon_start 1 locus_tag LOCUS_21640 gene hslV CDS 88977..90320 product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P552 transl_table 11 codon_start 1 locus_tag LOCUS_21650 gene hslU CDS complement(90386..91372) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795082.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS complement(91434..92093) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526226.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 gene bpeR CDS 92304..93488 product MexX family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943335.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 gene acrA CDS 93501..96623 product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074281.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 gene vmeB CDS 96729..98114 product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037811.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 gene oprM CDS complement(98196..98618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113677.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS complement(98681..99007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035523.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS complement(99082..99342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS complement(99542..99994) product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038585.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 gene codA CDS 100075..100836 product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P558 transl_table 11 codon_start 1 locus_tag LOCUS_21750 gene ubiE sequence15 source 1..97985 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 16..92 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA 199..275 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS 423..2378 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBY3 transl_table 11 codon_start 1 locus_tag LOCUS_21760 gene ppiD CDS complement(2574..3773) product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036189.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 gene dniR CDS complement(3770..4534) product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBY0 transl_table 11 codon_start 1 locus_tag LOCUS_21780 gene gloB CDS 4546..5190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036191.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS 5203..5655 product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBX8 transl_table 11 codon_start 1 locus_tag LOCUS_21800 gene rnhA CDS 5660..6391 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036193.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 gene dnaQ CDS complement(6457..7161) product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036194.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 tRNA 7327..7417 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS 7683..8087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036195.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS complement(8136..9161) product ADP-heptose--LPS heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036196.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 gene opsX CDS 9164..9952 product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBX3 transl_table 11 codon_start 1 locus_tag LOCUS_21850 gene kdkA CDS 9952..10719 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036198.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS 10716..11105 product DUF4440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036200.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS 11580..11897 product QacE family quaternary ammonium compound efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115842.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 gene sugE CDS 12407..23158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS complement(23216..23659) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384944.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS complement(23736..24857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21910 tRNA complement(25365..25457) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS complement(25500..25736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS 25620..27653 product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036204.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 gene dnaX CDS 27660..27980 product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBW5 transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS 28122..28721 product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBW4 transl_table 11 codon_start 1 locus_tag LOCUS_21950 gene recR CDS 28789..29148 product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036207.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS complement(29227..29754) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036208.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 gene slp CDS complement(29751..31682) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036209.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS complement(31693..32637) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036210.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS complement(32640..33566) product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036211.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 gene moxR CDS 33636..35471 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036212.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS complement(35558..36127) product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBV4 transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS 36313..36750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036217.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS 36858..37052 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBV2 transl_table 11 codon_start 1 locus_tag LOCUS_22040 gene rpmF CDS 37144..38121 product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBV1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 gene fabH CDS 38200..38982 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS 39118..40062 product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBV0 transl_table 11 codon_start 1 locus_tag LOCUS_22070 gene fabD CDS 40144..40887 product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036220.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 gene fabG CDS 41040..41279 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63447 transl_table 11 codon_start 1 locus_tag LOCUS_22090 gene acpP CDS 41423..42685 product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBU8 transl_table 11 codon_start 1 locus_tag LOCUS_22100 gene fabF CDS 42787..44151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036222.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 gene trpE CDS 44365..45426 product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036223.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS 45423..46088 product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YH1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 gene tmk CDS 46085..47041 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036224.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 gene holB CDS 47038..47391 product type IV fimbriae assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036225.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 gene pilZ tRNA 47525..47599 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS complement(47684..48247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS complement(48300..48707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS 49226..49606 product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190990.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS complement(49688..50761) product phage late control protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038112.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 gene D CDS complement(50752..50967) product tail protein X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970908.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS complement(50951..51418) product tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140365.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 gene gpU CDS complement(51421..53883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS complement(54004..54294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS complement(54376..54879) product phage major tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247634.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS complement(54882..56084) product bacteriophage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113197.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS complement(56187..56819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS complement(56821..58902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS complement(58910..59689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS complement(59682..60578) product baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038101.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 gene J CDS complement(60581..60919) product baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177595.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS complement(60972..61562) product baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271909.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS complement(61559..62113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS complement(62207..62482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS complement(62457..62834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS complement(62831..63316) product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EHE9 transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS complement(63313..63663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS complement(63660..64109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS complement(64439..64822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS complement(64974..65525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS complement(65566..65793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS complement(65945..68230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS 68762..68986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS 68998..69252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS 69413..69850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS 69979..72117 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035647.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 gene fhuA CDS 72129..73634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114902.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS complement(73644..74777) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619360.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS complement(74789..75565) product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310903.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS 75714..76373 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704297.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS complement(76390..77064) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090698.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS complement(77143..78522) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531252.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS 78611..79519 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531253.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS 79677..80558 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730663.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS 80597..80827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22540 note possible pseudo, internal stop codon CDS 80882..81475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22550 note possible pseudo, internal stop codon CDS complement(81489..82430) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529929.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS 82495..84012 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529928.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS complement(84452..84856) product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707472.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS 85029..86003 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035992.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS 86003..88024 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035993.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS complement(88112..89473) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223556.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS 89563..89997 product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037956.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 gene soxR CDS complement(90040..90642) product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703478.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS 90704..91618 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703477.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS complement(91658..92479) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P757 transl_table 11 codon_start 1 locus_tag LOCUS_22650 gene proC CDS complement(92498..93175) product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037884.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS 93263..94300 product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003489919.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 gene pilT CDS 94400..95542 product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005990431.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 gene pilU CDS 95664..96647 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037809.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS complement(96690..97586) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037808.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS 97680..97889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975334.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 sequence16 source 1..96827 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 36..2612 product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038158.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 gene bfeA CDS 2727..3281 product FMN reductase (NADPH) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31038 transl_table 11 codon_start 1 locus_tag LOCUS_22730 gene msuE CDS 3438..3800 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS 3815..4792 product alkanal monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187562.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS 4811..6154 product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525217.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS 6159..7379 product hippurate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973024.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS 7376..7927 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973023.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS 7924..9669 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315104.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS 9686..10660 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973022.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS complement(10748..13864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS 14363..14860 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812293.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS complement(14954..15847) product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975353.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS complement(15871..16368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS complement(16385..17128) product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816333.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS complement(17352..18428) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074216.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS 18533..19144 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035488.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS complement(19141..21087) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971403.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS complement(21183..21890) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143931.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS 22078..22887 product aminoglycoside phosphotransferase APH(3') inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970345.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS 22969..23559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS 23556..24590 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704524.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS 24689..25693 product spectinomycin phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947221.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS complement(25760..26686) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036959.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS complement(26680..27741) product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9R1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 gene murB CDS complement(27750..28805) product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9R0 transl_table 11 codon_start 1 locus_tag LOCUS_22960 gene pyrD CDS complement(28814..29584) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036962.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS complement(29590..29874) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036963.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS complement(30053..30856) product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035669.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS complement(30856..32388) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036964.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 tRNA 32574..32650 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS complement(32744..33733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS complement(34215..34727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS 34864..35106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS 35364..35735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS complement(35967..37646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222614.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 gene funZ CDS complement(37747..37989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS complement(38364..39254) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705975.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS 39424..39882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS complement(39860..40078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS 40019..40873 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108071.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS complement(40821..41651) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720879.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS 41820..42383 product HTH-type transcriptional regulator nfxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P32265 transl_table 11 codon_start 1 locus_tag LOCUS_23120 gene nfxB CDS 42849..48896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS 48893..52582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462999.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS complement(52649..53008) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036384.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS complement(52998..54089) product two-component system sensor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636560.2 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS 54352..57426 product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036382.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS 57423..58247 product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036381.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 gene cheR CDS 58247..58822 product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036380.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 gene cheB CDS 58819..59952 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036379.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS 60036..60464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS complement(60467..60787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS 60874..61311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038731.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS 61308..61721 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967549.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS 61819..62841 product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929827.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS complement(62838..63617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036506.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS 63699..64397 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036056.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS 64557..65507 product multidrug DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036055.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS 65646..65780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS 65865..68369 product bifunctional aspartokinase I/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036970.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 gene thrA CDS 68366..69280 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9Q0 transl_table 11 codon_start 1 locus_tag LOCUS_23310 gene thrB CDS 69310..70596 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637168.2 transl_table 11 codon_start 1 locus_tag LOCUS_23320 gene thrC CDS complement(70781..71533) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036975.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 gene fnr CDS 71660..73057 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9P5 transl_table 11 codon_start 1 locus_tag LOCUS_23340 gene hisS CDS 73054..73350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS 73758..74066 product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036977.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS 74101..75012 product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9P3 transl_table 11 codon_start 1 locus_tag LOCUS_23370 gene hisG CDS 75009..76304 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9P2 transl_table 11 codon_start 1 locus_tag LOCUS_23380 gene hisD CDS 76301..77392 product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58892 transl_table 11 codon_start 1 locus_tag LOCUS_23390 gene hisC CDS 77389..78462 product histidine biosynthesis bifunctional protein HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58882 transl_table 11 codon_start 1 locus_tag LOCUS_23400 gene hisB CDS 78459..79061 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9P1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 gene hisH CDS 79058..79792 product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9P0 transl_table 11 codon_start 1 locus_tag LOCUS_23420 gene hisA CDS 79786..80562 product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9N9 transl_table 11 codon_start 1 locus_tag LOCUS_23430 gene hisF CDS 80552..81172 product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9N8 transl_table 11 codon_start 1 locus_tag LOCUS_23440 gene hisI CDS 81327..82916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637181.2 transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS 82952..83236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS 83321..84343 product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038011.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 gene glk CDS 84395..85393 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638262.2 transl_table 11 codon_start 1 locus_tag LOCUS_23480 gene aspG CDS 85390..86121 product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6Q4 transl_table 11 codon_start 1 locus_tag LOCUS_23490 gene cutC CDS 86459..89416 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039283.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS 89568..92060 product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931165.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS 92076..92531 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886859.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS complement(92610..92804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008991978.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS complement(93029..96106) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037060.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 gene cirA sequence17 source 1..89580 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(637..1188) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194069.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS complement(1185..3569) product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035768.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 gene dsbD CDS complement(3566..3904) product divalent cation tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035769.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 gene cutA CDS complement(3973..5763) product ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635913.2 transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS 6120..6407 product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A0R6 transl_table 11 codon_start 1 locus_tag LOCUS_23590 gene groS CDS 6489..8138 product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD23 transl_table 11 codon_start 1 locus_tag LOCUS_23600 gene groL CDS complement(8299..8565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS 8721..9221 product putative HTH-type transcriptional regulator YetL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31541 transl_table 11 codon_start 1 locus_tag LOCUS_23620 gene yetL CDS 9218..9955 product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389300.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS 10069..10326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS 10621..11694 product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4W9 transl_table 11 codon_start 1 locus_tag LOCUS_23650 gene aroG CDS complement(11973..12623) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393544.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS 12574..13185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS 13238..13723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918731.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS complement(13806..15086) product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038851.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 gene ndh CDS 15210..15989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038849.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS 16130..16750 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038848.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 gene gst CDS complement(16846..19044) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4E3 transl_table 11 codon_start 1 locus_tag LOCUS_23720 gene priA CDS 19436..20440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038846.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS 20433..21008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038845.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS 21133..22497 product putative multidrug resistance protein NorM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4E6 transl_table 11 codon_start 1 locus_tag LOCUS_23750 gene norM CDS 22614..24536 product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4E7 transl_table 11 codon_start 1 locus_tag LOCUS_23760 gene sppA CDS complement(24612..24824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS 24936..25712 product tropinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038842.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 gene trn2 CDS complement(25805..26227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS complement(26578..27246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038839.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS complement(27317..27907) product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4F2 transl_table 11 codon_start 1 locus_tag LOCUS_23810 gene tsaC CDS complement(28031..30508) product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4F3 transl_table 11 codon_start 1 locus_tag LOCUS_23820 gene topA CDS complement(30702..31634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS complement(31684..32436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS complement(32476..32949) product protein Smg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4F6 transl_table 11 codon_start 1 locus_tag LOCUS_23850 gene smg CDS complement(32993..34120) product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038833.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 gene smf CDS complement(34251..35348) product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038832.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS 35454..36023 product peptide deformylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4F9 transl_table 11 codon_start 1 locus_tag LOCUS_23880 gene def2 CDS 36144..37067 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4G0 transl_table 11 codon_start 1 locus_tag LOCUS_23890 gene fmt CDS 37071..38402 product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4G1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 gene rsmB CDS 38426..40135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639091.2 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS 40294..41550 product polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038827.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS complement(41578..42384) product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038826.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS 42362..43441 product CDP-glycerol glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038825.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS complement(43518..45056) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038824.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS complement(45053..45553) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038823.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS complement(45629..46762) product GTP cyclohydrolase-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4G8 transl_table 11 codon_start 1 locus_tag LOCUS_23970 gene ribA CDS complement(46865..47803) product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038820.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 gene htrB CDS 47848..48288 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4H1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 gene dtd CDS 48379..50232 product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4H2 transl_table 11 codon_start 1 locus_tag LOCUS_24000 gene rpoD CDS 50499..50810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24010 tRNA 50851..50926 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS complement(51004..51258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS complement(51245..51655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS complement(51652..52224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS complement(52221..52469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS 52691..53518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS complement(53536..55503) product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268015.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS 55607..55828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS complement(55855..56025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS complement(56018..56671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS complement(56668..57168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS complement(57180..57425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS complement(57406..57630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS complement(57646..57891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS complement(57891..58085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS complement(58082..58378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS complement(58375..58599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS complement(58596..58880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS complement(58877..59395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS 59800..60021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS complement(60040..60741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705721.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS 60820..61083 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS complement(61179..61481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS 61608..62210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS 62207..62545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS 62542..62895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS 62892..63872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS 63889..64449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS 64436..64966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS 64966..65478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS 65475..66266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS 66266..66694 product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028460.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS 66751..67125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS 67125..68873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS 68870..69022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS 69022..69786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS complement(69841..70182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24370 tRNA 70402..70476 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS 70755..71267 product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NA40 transl_table 11 codon_start 1 locus_tag LOCUS_24380 gene r CDS 71264..71719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS 71716..72198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS 72200..72487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS 72744..73184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001389340.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS 73252..75246 product DNA packaging protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640155.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS 75248..75463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377401.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS 75456..76937 product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104536.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS 76927..78288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS 78291..78980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS 79067..80068 product minor capsid protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104533.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS 80114..80872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384017.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS 80869..81201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS 81194..81649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS 81686..82441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS 82438..82863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS 82890..83087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS 83080..85869 product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072857.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 gene H CDS 85869..86225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS 86222..86683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS 86683..87078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24580 sequence18 source 1..88204 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(66..665) product Fe/S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8Z9 transl_table 11 codon_start 1 locus_tag LOCUS_24590 gene nfuA CDS 756..1106 product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8Z8 transl_table 11 codon_start 1 locus_tag LOCUS_24600 gene phhB CDS 1103..1519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037237.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS 1618..2427 product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8Z6 transl_table 11 codon_start 1 locus_tag LOCUS_24620 gene zupT CDS complement(2541..3515) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8Z5 transl_table 11 codon_start 1 locus_tag LOCUS_24630 gene rluC CDS 3924..7193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS complement(7472..8359) product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037347.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS complement(8362..11529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037348.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS complement(11526..12362) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037349.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 gene lacG CDS complement(12359..13240) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037350.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 gene lacF CDS complement(13237..14577) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037351.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 gene malE CDS complement(14582..16186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637563.2 transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS complement(16437..19493) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039201.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS complement(19570..20607) product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037354.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS complement(20757..21032) product cell division protein BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037355.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS complement(21029..21328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037356.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS complement(21507..21701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS 21771..22610 product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8M8 transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS 22624..23499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24770 note possible pseudo, internal stop codon CDS 23492..25132 product ribosomal large subunit pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8M6 transl_table 11 codon_start 1 locus_tag LOCUS_24780 gene rluB CDS 25333..25593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS complement(25687..26124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037360.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS complement(26153..26959) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037362.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS complement(26974..28122) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037363.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 gene ybdL CDS 28308..28937 product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8M1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 gene ccmA CDS 28934..29629 product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8M0 transl_table 11 codon_start 1 locus_tag LOCUS_24840 gene cycW CDS 29673..30443 product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037366.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 gene cycZ CDS 30440..30628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS 30625..31086 product cytochrome c-type biogenesis protein CcmE 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8L7 transl_table 11 codon_start 1 locus_tag LOCUS_24870 gene ccmE2 CDS 31087..33006 product c-type cytochrome biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037369.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 gene cycK CDS 33015..33632 product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037370.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 gene dsbE CDS 33637..34086 product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037371.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 gene cycL CDS 34080..35069 product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037372.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 gene cycH CDS 35221..36333 product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8L2 transl_table 11 codon_start 1 locus_tag LOCUS_24920 gene metX CDS 36334..36678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS complement(36750..38423) product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037375.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 gene cydC CDS complement(38420..40165) product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037376.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 gene strW CDS 40394..41983 product cytochrome d ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037377.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 gene cydA CDS 41999..43150 product cytochrome D ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037378.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 gene cydB tRNA 43377..43453 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA 43594..43670 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS complement(43702..44313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24980 tRNA complement(44535..44611) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA complement(44752..44828) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS complement(45055..46206) product cytochrome D ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037378.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 gene cydB CDS complement(46222..47811) product cytochrome d ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037377.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 gene cydA CDS 48040..49785 product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037376.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 gene strW CDS 49782..51455 product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037375.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 gene cydC CDS complement(51527..51871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS complement(51872..52984) product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8L2 transl_table 11 codon_start 1 locus_tag LOCUS_25040 gene metX CDS complement(53136..54125) product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037372.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 gene cycH CDS complement(54119..54568) product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037371.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 gene cycL CDS complement(54573..55190) product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037370.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 gene dsbE CDS complement(55199..57118) product c-type cytochrome biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037369.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 gene cycK CDS complement(57119..57580) product cytochrome c-type biogenesis protein CcmE 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8L7 transl_table 11 codon_start 1 locus_tag LOCUS_25090 gene ccmE2 CDS complement(57577..57765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS complement(57762..58532) product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037366.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 gene cycZ CDS complement(58576..59271) product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8M0 transl_table 11 codon_start 1 locus_tag LOCUS_25120 gene cycW CDS complement(59268..59897) product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8M1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 gene ccmA CDS 60083..61231 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037363.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 gene ybdL CDS 61246..62052 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037362.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS 62081..62518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037360.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS complement(62612..62872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS complement(63073..64713) product ribosomal large subunit pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8M6 transl_table 11 codon_start 1 locus_tag LOCUS_25180 gene rluB CDS complement(64706..65581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25190 note possible pseudo, internal stop codon CDS complement(65595..66434) product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8M8 transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS 66504..66698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS 66877..67176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037356.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS 67173..67448 product cell division protein BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037355.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS 67598..68635 product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037354.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS 68712..71768 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039201.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS 72019..73623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637563.2 transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS 73628..74968 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037351.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 gene malE CDS 74965..75846 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037350.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 gene lacF CDS 75843..76679 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037349.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 gene lacG CDS 76676..79843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037348.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS 79846..80733 product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037347.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS complement(81012..84281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS 84690..85664 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8Z5 transl_table 11 codon_start 1 locus_tag LOCUS_25330 gene rluC CDS complement(85778..86587) product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8Z6 transl_table 11 codon_start 1 locus_tag LOCUS_25340 gene zupT CDS complement(86686..87102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037237.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS complement(87099..87449) product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8Z8 transl_table 11 codon_start 1 locus_tag LOCUS_25360 gene phhB CDS 87540..88139 product Fe/S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8Z9 transl_table 11 codon_start 1 locus_tag LOCUS_25370 gene nfuA sequence19 source 1..84701 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2964 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206610.1:TonB-dependent receptor locus_tag LOCUS_25380 CDS 3021..4385 product alpha-N-acetylgalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECL7 transl_table 11 codon_start 1 locus_tag LOCUS_25390 gene nagA CDS 4614..4913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS complement(4957..6816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS complement(6917..8149) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039142.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 tRNA complement(8116..8192) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS 8342..9235 product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDE8 transl_table 11 codon_start 1 locus_tag LOCUS_25430 gene ubiA CDS 9608..11032 product short-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407630.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS 11305..11466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS complement(11521..12147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038642.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS 12229..12735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035704.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS 12825..14645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS 14642..16051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25490 CDS complement(16053..16724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035555.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS complement(16783..17895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS complement(17909..18736) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089438.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS 18923..19336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS 19568..21925 product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246690.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS 21925..23226 product isopenicillin-N epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084098.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS complement(23399..24913) product putative HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q01856 transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS complement(24923..25525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004352065.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS complement(25525..25785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS complement(25859..27274) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708519.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS 27458..28363 product ubiquinol oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CK33 transl_table 11 codon_start 1 locus_tag LOCUS_25600 gene cyoA CDS 28369..30345 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926118.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 gene cyoB CDS 30342..30977 product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179831.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS 30979..31311 product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208652.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 gene cyoD CDS 31323..32003 product SCO1/SenC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064817.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS complement(32092..32688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS complement(32688..34454) product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037804.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS 34799..35239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704919.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS 35232..36542 product L-sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113059.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS complement(36682..37404) product protein ExoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q52923 transl_table 11 codon_start 1 locus_tag LOCUS_25690 gene exoD CDS 37466..38329 product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094783.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS 38892..41210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS complement(41466..42965) product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038949.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 gene comM CDS 43334..44740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS complement(44795..45298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS complement(45345..45701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS 46271..46744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS 46775..47149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS 47246..47623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS complement(47716..48156) product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028626.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS complement(48276..48527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038948.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS 48682..49020 product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038947.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 gene glnB CDS complement(49240..49899) product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038946.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS 50332..51240 product aspartyl/asparaginyl beta-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035636.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 gene aspH CDS complement(51327..52181) product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P447 transl_table 11 codon_start 1 locus_tag LOCUS_25840 gene speE CDS 52372..54261 product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P448 transl_table 11 codon_start 1 locus_tag LOCUS_25850 gene speA CDS 54305..54625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS complement(54685..56013) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920606.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS complement(56010..56669) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311298.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS complement(56669..56959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS 57109..57543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS complement(57671..58150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS complement(58353..59564) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037302.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS complement(59577..60071) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038950.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 gene blc CDS 60253..60501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS 60598..63018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035655.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS complement(63561..65666) product phosphoglycerol transferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDD7 transl_table 11 codon_start 1 locus_tag LOCUS_25960 gene opgB CDS complement(65911..67602) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035657.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS 67765..68691 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035658.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS complement(68797..70335) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035660.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS 70429..71076 product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035668.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS 71076..71783 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710023.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS 72033..72419 product drug:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529579.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS complement(72542..73930) product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDB3 transl_table 11 codon_start 1 locus_tag LOCUS_26030 gene pdhB CDS complement(73927..74280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035681.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS complement(74282..75349) product 2-oxoisovalerate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035682.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 gene pdhB CDS complement(75342..76424) product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035683.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 gene pdhA CDS 76760..77635 product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDA8 transl_table 11 codon_start 1 locus_tag LOCUS_26070 gene kynA CDS 77816..79315 product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035686.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 gene yhiP CDS 79336..79935 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035687.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS 80103..81242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS complement(81322..81813) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035688.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS 81943..83055 product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035689.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS 83141..84448 product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDA2 transl_table 11 codon_start 1 locus_tag LOCUS_26130 gene hmgA sequence20 source 1..80752 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(483..1427) product sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113764.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS complement(1424..1942) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406891.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS 2092..2472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889155.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS 2617..4596 product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038500.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 gene betT CDS complement(4697..6337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26180 CDS complement(6357..7319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS complement(7443..8420) product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383116.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 gene mecR CDS 8853..11216 product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3T3 transl_table 11 codon_start 1 locus_tag LOCUS_26210 gene nrdA CDS 11316..12356 product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3T4 transl_table 11 codon_start 1 locus_tag LOCUS_26220 gene nrdB CDS 12463..12849 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039055.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS 12821..13147 product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039054.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 gene trxA CDS complement(13259..14590) product divalent metal cation transporter MntH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8R8 transl_table 11 codon_start 1 locus_tag LOCUS_26250 gene mntH CDS 14708..15178 product transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037316.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS complement(15245..15766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS complement(15783..17942) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765027.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS complement(18160..18816) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038955.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS 18954..19979 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038954.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS 19991..21139 product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038953.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 CDS complement(21145..21480) product TPR repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7B1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS complement(21480..22055) product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814305.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS complement(22052..22681) product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53652 transl_table 11 codon_start 1 locus_tag LOCUS_26340 gene sodA CDS complement(23188..24699) product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038903.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS complement(24838..25287) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704476.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS 25354..26289 product coenzyme F420-dependent N5,N10-methylene tetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_601421.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS 26404..26748 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038641.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS 26902..28098 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147483.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS 28095..29288 product isochorismate synthase EntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001954.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 gene entC CDS 29285..30937 product 2,3-dihydroxybenzoate-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40871 transl_table 11 codon_start 1 locus_tag LOCUS_26410 gene dhbE CDS 30937..31569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26420 note possible pseudo, internal stop codon, frameshifted CDS 31569..31826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS 31823..35713 product enterobactin synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077698.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 gene entF CDS 35704..36462 product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39071 transl_table 11 codon_start 1 locus_tag LOCUS_26450 gene dhbA CDS 36607..37053 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269184.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS complement(37127..38587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530985.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS complement(38609..40927) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639569.2 transl_table 11 codon_start 1 locus_tag LOCUS_26480 gene fecA CDS complement(41195..41563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26490 note possible pseudo, internal stop codon CDS complement(41553..42191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639058.2 transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS complement(42188..44452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038794.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS complement(44463..45116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038793.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS 45261..46184 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037185.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS complement(46232..46624) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY23 transl_table 11 codon_start 1 locus_tag LOCUS_26540 gene dgkA CDS complement(46780..47253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS complement(47370..48248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280038.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS 48520..48849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS complement(48843..49247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS 49442..50422 product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIL8 transl_table 11 codon_start 1 locus_tag LOCUS_26590 gene moaA CDS 50431..51426 product molybdenum cofactor biosynthesis bifunctional protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59014 transl_table 11 codon_start 1 locus_tag LOCUS_26600 gene moaCB CDS 51426..52676 product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037163.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 gene moeA CDS 52679..52939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS 52943..53431 product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207008.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 gene moaE CDS 53516..54064 product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037164.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 gene mobA CDS 54061..54426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26650 note possible pseudo, internal stop codon, frameshifted CDS 54572..55990 product nitrite extrusion protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105301.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 gene narK2 CDS 56062..59805 product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105302.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 gene narG CDS 59805..61349 product respiratory nitrate reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205549.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 gene narH CDS 61349..62029 product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705098.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 CDS 62026..62733 product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105305.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 gene narI CDS 62737..63636 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXD5 transl_table 11 codon_start 1 locus_tag LOCUS_26710 CDS 63660..64991 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525898.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS 65122..66345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS 66357..67133 product fumarate and nitrate reduction regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z787 transl_table 11 codon_start 1 locus_tag LOCUS_26740 gene fnr CDS 67153..67896 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205679.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 CDS 67900..68583 product molybdenum ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190258.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 gene modB CDS 68573..69241 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190506.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 gene modC CDS complement(69532..70332) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903995.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS complement(70329..71105) product iron ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392936.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS complement(71102..72115) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223651.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 CDS complement(72118..73155) product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390967.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS complement(73152..73694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26820 CDS complement(73697..75682) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933422.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS 75866..76669 product ModE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204316.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 gene modE CDS complement(76870..78399) product sulfite reductase [NADPH] flavoprotein alpha-component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32214 transl_table 11 codon_start 1 locus_tag LOCUS_26850 gene cysJ CDS complement(78396..78824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS complement(79007..79321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522986.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 CDS complement(79318..80052) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550326.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 CDS 80179..80643 product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522988.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 sequence21 source 1..79313 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(334..1059) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971202.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS 1178..2068 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968210.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS complement(2161..3192) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036627.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS 3340..3567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26930 CDS 3564..4334 product aklaviketone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036628.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 gene dauE CDS 4426..5649 product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036629.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 gene mexE CDS 5777..8947 product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036630.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 gene mexF CDS 9012..9749 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036631.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS 9743..11164 product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036632.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 gene oprN CDS 11414..11677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS complement(11696..12550) product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038545.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS complement(12688..12933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS complement(12959..13198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27020 CDS complement(13330..13563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS complement(13651..14355) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916254.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS complement(14361..15233) product protein deglycase HchA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706906.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 gene hchA CDS complement(15318..17327) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035993.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 CDS 17481..17942 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261733.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 CDS complement(18304..18867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS 19600..20181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS complement(20380..20964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS 20993..21316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS complement(22161..22490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS 22845..24566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS complement(25417..25827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS complement(25890..26129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS 26330..26809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS 26820..27119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS 27155..27691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27180 CDS complement(27777..28007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS complement(27997..29793) product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105772.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS complement(30267..31724) product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036792.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 tmRNA complement(31987..32379) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS 32599..33171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS complement(33312..33815) product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAL7 transl_table 11 codon_start 1 locus_tag LOCUS_27230 gene smpB CDS 33873..34298 product ubiquinone-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036653.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 CDS 34302..34559 product UPF0125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAL5 transl_table 11 codon_start 1 locus_tag LOCUS_27250 CDS complement(34596..34988) product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAL4 transl_table 11 codon_start 1 locus_tag LOCUS_27260 gene bamE CDS 35092..35499 product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036656.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 gene fur CDS complement(35558..36802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147894.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS 36900..37817 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115019.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS complement(37924..39600) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAL2 transl_table 11 codon_start 1 locus_tag LOCUS_27300 gene recN CDS 39715..40779 product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAL1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 gene hrcA CDS 40843..41358 product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAL0 transl_table 11 codon_start 1 locus_tag LOCUS_27320 gene grpE CDS 41542..43467 product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAK9 transl_table 11 codon_start 1 locus_tag LOCUS_27330 gene dnaK CDS 43621..44748 product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAK8 transl_table 11 codon_start 1 locus_tag LOCUS_27340 gene dnaJ CDS complement(44809..45606) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819104.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS 45718..46878 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367899.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS 47493..48401 product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAK7 transl_table 11 codon_start 1 locus_tag LOCUS_27370 gene pdxY CDS 48398..49522 product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036663.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 gene tyrA CDS complement(49773..49967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27390 CDS complement(50044..51816) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036668.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 gene draA CDS complement(51809..52405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636855.2 transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS complement(52446..53450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS complement(53447..54070) product Ecf-type RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810497.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 CDS 54213..57056 product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267676.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS complement(57076..57669) product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAJ9 transl_table 11 codon_start 1 locus_tag LOCUS_27450 CDS complement(57771..59267) product L-lysine 6-aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037523.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 CDS 59478..60545 product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P867 transl_table 11 codon_start 1 locus_tag LOCUS_27470 gene queA CDS 60685..61815 product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P868 transl_table 11 codon_start 1 locus_tag LOCUS_27480 gene tgt CDS 61950..62294 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037519.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 gene yajC CDS 62356..64212 product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P870 transl_table 11 codon_start 1 locus_tag LOCUS_27500 gene secD CDS 64228..65208 product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P871 transl_table 11 codon_start 1 locus_tag LOCUS_27510 gene secF CDS 65884..67143 product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP8 transl_table 11 codon_start 1 locus_tag LOCUS_27520 gene fabV CDS complement(67215..69338) product GGDEF-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037435.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS complement(69376..70560) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037434.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS complement(70557..71105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037433.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS 71230..72108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114880.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 CDS complement(72115..72603) product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8F4 transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS 72905..73114 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037431.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 gene cspA CDS 73298..73987 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037430.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 gene gstA CDS 74020..75585 product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8F8 transl_table 11 codon_start 1 locus_tag LOCUS_27600 CDS 76180..76716 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8F9 transl_table 11 codon_start 1 locus_tag LOCUS_27610 gene apt CDS complement(76814..78190) product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037426.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 gene dbpA misc_feature complement(78275..>79313) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HTI1:UPF0324 membrane protein locus_tag LOCUS_27630 sequence22 source 1..78655 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 130..1005 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317531.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 CDS 1361..3313 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037425.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 gene uup CDS complement(3414..3875) product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037296.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 gene cycM CDS complement(3885..4352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS 4480..5631 product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037294.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 gene czcB CDS 5628..9149 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037293.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 gene acrD CDS 9146..12232 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037292.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 gene acrD CDS complement(12367..13587) product pheromone shutdown protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037346.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 gene traB CDS complement(13592..14122) product phosphinothricin N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037345.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 gene pat CDS complement(14137..15024) product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037344.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 CDS complement(15186..16223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037343.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS complement(16263..16592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037342.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 CDS 17062..17739 product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8P4 transl_table 11 codon_start 1 locus_tag LOCUS_27760 gene cmk CDS 17938..19623 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8P5 transl_table 11 codon_start 1 locus_tag LOCUS_27770 gene rpsA CDS 19712..20017 product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8P6 transl_table 11 codon_start 1 locus_tag LOCUS_27780 gene ihfB CDS 20095..20379 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037338.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS 20386..21564 product lipopolysaccharide assembly protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8P8 transl_table 11 codon_start 1 locus_tag LOCUS_27800 gene lapB CDS 21568..22557 product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037336.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 gene rfb303 CDS 22561..24474 product multidrug MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037335.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS 24558..25349 product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8Q1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 gene galU CDS 25538..25897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27840 CDS complement(25901..27109) product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037142.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 gene fadA CDS complement(27179..29551) product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037143.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 gene fadB CDS complement(29605..30258) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037144.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 gene psrA CDS 30584..31009 product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65539 transl_table 11 codon_start 1 locus_tag LOCUS_27880 gene ndk CDS 31020..32225 product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P984 transl_table 11 codon_start 1 locus_tag LOCUS_27890 gene rlmN CDS 32212..32997 product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037146.1 transl_table 11 codon_start 1 locus_tag LOCUS_27900 gene pilF CDS 33016..33885 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037147.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 CDS 33951..34589 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037148.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS 34589..35797 product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P980 transl_table 11 codon_start 1 locus_tag LOCUS_27930 gene bamB CDS 35815..37212 product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P979 transl_table 11 codon_start 1 locus_tag LOCUS_27940 gene der CDS 37354..38490 product molybdopterin biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037152.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 gene moeB CDS 38961..40793 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037333.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 gene kefB CDS 41016..41894 product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8Q4 transl_table 11 codon_start 1 locus_tag LOCUS_27970 gene folD CDS 42015..43472 product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8Q5 transl_table 11 codon_start 1 locus_tag LOCUS_27980 gene guaB CDS 43577..45142 product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8Q6 transl_table 11 codon_start 1 locus_tag LOCUS_27990 gene guaA CDS 45548..50821 product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883981.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS 50828..53617 product ATP-dependent helicase HepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883982.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 CDS 53642..58096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256730.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS 58200..60029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS 60079..60846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS 60899..62269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS 62276..62548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS complement(62828..63184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS complement(63739..64662) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095765.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS 64759..65598 product thiazole biosynthesis protein ThiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968037.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS 65768..66550 product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814011.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS complement(66547..67311) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185819.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS 67463..67882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS complement(67917..68375) product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528593.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS complement(68378..68692) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528592.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS complement(68704..69159) product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226555.1 transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS 69375..71144 product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082857.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS complement(71193..72032) product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112398.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS 72165..73085 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895557.1 transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS 73190..73777 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086782.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS 73871..74374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS 74618..77383 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PA41 transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS complement(77389..78390) product transcriptional regulator FtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194618.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 gene ftrA sequence23 source 1..77054 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 203..1138 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037668.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS 1812..2567 product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7T0 transl_table 11 codon_start 1 locus_tag LOCUS_28240 gene tpiA CDS 2599..3036 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637878.2 transl_table 11 codon_start 1 locus_tag LOCUS_28250 gene secG tRNA 3088..3172 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS 3284..3640 product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7T2 transl_table 11 codon_start 1 locus_tag LOCUS_28260 gene nuoA CDS 3631..4185 product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7T3 transl_table 11 codon_start 1 locus_tag LOCUS_28270 gene nuoB CDS 4282..4968 product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7T4 transl_table 11 codon_start 1 locus_tag LOCUS_28280 gene nuoC CDS 4965..6272 product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7T5 transl_table 11 codon_start 1 locus_tag LOCUS_28290 gene nuoD CDS 6370..6897 product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037655.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 gene nuoE CDS 6902..8242 product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037654.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 gene nuoF CDS 8239..10473 product NADH-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7T8 transl_table 11 codon_start 1 locus_tag LOCUS_28320 gene nuoG CDS 10470..11564 product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7T9 transl_table 11 codon_start 1 locus_tag LOCUS_28330 gene nuoH CDS 11566..12057 product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7U0 transl_table 11 codon_start 1 locus_tag LOCUS_28340 gene nuoI CDS 12067..12723 product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037650.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 gene nuoJ CDS 12720..13025 product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CLR2 transl_table 11 codon_start 1 locus_tag LOCUS_28360 gene nuoK CDS 13033..15192 product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037649.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 gene nuoL CDS 15216..16724 product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037648.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 gene nuoM CDS 16740..18200 product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7U4 transl_table 11 codon_start 1 locus_tag LOCUS_28390 gene nuoN tRNA 18328..18404 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA 18487..18563 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS 18952..19542 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7U5 transl_table 11 codon_start 1 locus_tag LOCUS_28400 gene rimP CDS 19547..21058 product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7U6 transl_table 11 codon_start 1 locus_tag LOCUS_28410 gene nusA CDS 21151..23796 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7U7 transl_table 11 codon_start 1 locus_tag LOCUS_28420 gene infB CDS 23900..24304 product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7U8 transl_table 11 codon_start 1 locus_tag LOCUS_28430 gene rbfA CDS 24410..25318 product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7U9 transl_table 11 codon_start 1 locus_tag LOCUS_28440 gene truB CDS 25493..25753 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7V0 transl_table 11 codon_start 1 locus_tag LOCUS_28450 gene rpsO CDS 25905..28013 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7V1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 gene pnp CDS 28076..29713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS complement(29682..30746) product 6-aminohexanoate-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640075.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS complement(30955..31956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973752.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS 32173..33366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS complement(33404..34963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035397.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 CDS complement(34974..35237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS complement(35237..35533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS complement(35541..37667) product ferrichrome receptor FiuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113264.1 transl_table 11 codon_start 1 locus_tag LOCUS_28540 gene fiuA CDS 38030..39931 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7Z2 transl_table 11 codon_start 1 locus_tag LOCUS_28550 gene thrS CDS 39980..40522 product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7Z3 transl_table 11 codon_start 1 locus_tag LOCUS_28560 gene infC CDS 40789..40986 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66283 transl_table 11 codon_start 1 locus_tag LOCUS_28570 gene rpmI CDS 40998..41357 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7Z4 transl_table 11 codon_start 1 locus_tag LOCUS_28580 gene rplT CDS 41551..42546 product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7Z5 transl_table 11 codon_start 1 locus_tag LOCUS_28590 gene pheS CDS 42607..45003 product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7Z6 transl_table 11 codon_start 1 locus_tag LOCUS_28600 gene pheT CDS 45031..45330 product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A0T9 transl_table 11 codon_start 1 locus_tag LOCUS_28610 gene ihfA CDS 45311..45667 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005995911.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 tRNA 45736..45812 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS complement(45878..46351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS complement(46414..46917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS 47193..47552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS complement(47577..48269) product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265932.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS 48424..49065 product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387809.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS 49160..49333 product UPF0391 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB24 transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS complement(49356..49715) product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814037.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS complement(49702..50271) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969925.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS complement(50358..50591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036825.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 CDS complement(50604..50888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28720 CDS complement(50949..51116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28730 CDS 51286..51543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28740 CDS complement(51512..51934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28750 CDS complement(52196..52651) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P04739 transl_table 11 codon_start 1 locus_tag LOCUS_28760 gene pilA CDS complement(52736..53122) product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001909686.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS complement(53370..53780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS complement(53927..54349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003656109.1 transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS complement(54353..54724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS complement(54717..55268) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207703.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 CDS complement(55265..55972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS 56223..56894 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704956.1 transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS 57023..57583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS 57752..57955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS complement(58072..59979) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P815 transl_table 11 codon_start 1 locus_tag LOCUS_28860 gene dxs CDS complement(60085..60750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637786.2 transl_table 11 codon_start 1 locus_tag LOCUS_28870 CDS complement(60998..62788) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037573.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS complement(62853..63329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037572.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 CDS complement(63494..64045) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037571.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 gene blc tRNA complement(64201..64276) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA complement(64350..64425) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS 64760..65785 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035525.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS complement(65832..66674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS 66807..67568 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705864.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS 67694..67867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS complement(68026..68265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28950 CDS complement(68262..68561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28960 CDS complement(68554..68763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS complement(68760..69020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS complement(69017..69916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28990 CDS complement(69913..70251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS complement(70248..72257) product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268028.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 CDS complement(72250..72570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29020 CDS complement(72567..72707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29030 CDS 72821..73411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS complement(73435..73692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS complement(73689..73910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29060 sequence24 source 1..74346 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(67..1398) product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5S9 transl_table 11 codon_start 1 locus_tag LOCUS_29070 gene pepQ CDS complement(1474..1848) product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038358.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS complement(1845..4127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638601.2 transl_table 11 codon_start 1 locus_tag LOCUS_29090 CDS complement(4327..5553) product YggW family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038356.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS complement(5611..6207) product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5T3 transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS complement(6204..6593) product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038354.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS complement(6590..7315) product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5T5 transl_table 11 codon_start 1 locus_tag LOCUS_29130 gene rph CDS 7452..8300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038352.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 CDS complement(8343..9422) product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WCS1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 gene selD tRNA complement(9449..9544) product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS complement(9569..11500) product selenocysteine-specific translation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187519.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 gene selB CDS complement(11497..12921) product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JQ3 transl_table 11 codon_start 1 locus_tag LOCUS_29170 gene selA CDS complement(12926..13909) product protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WAH4 transl_table 11 codon_start 1 locus_tag LOCUS_29180 gene fdhE CDS complement(14365..15012) product formate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551972.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 gene fdoI CDS complement(15009..15923) product formate dehydrogenase-O iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528944.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 gene fdoH CDS complement(15934..19002) product formate dehydrogenase-O, alpha subunit, selenocysteine-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:A3NM19 transl_table 11 codon_start 1 transl_except (pos:18412..18414,aa:Sec) note codon on position 197 is selenocysteine opal codon. locus_tag LOCUS_29210 gene fdoG CDS 19296..19961 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5T7 transl_table 11 codon_start 1 locus_tag LOCUS_29220 gene gmk CDS 20072..20371 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66733 transl_table 11 codon_start 1 locus_tag LOCUS_29230 gene rpoZ CDS 20477..22639 product bifunctional GTP diphosphokinase/guanosine-3',5'-bis(diphosphate) 3'-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038350.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 gene spoT CDS 22872..23258 product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038342.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 gene yjgF CDS 23266..25377 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5U7 transl_table 11 codon_start 1 locus_tag LOCUS_29260 gene recG CDS 25674..26747 product inosine-uridine preferring nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038340.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS 26836..27078 product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5U9 transl_table 11 codon_start 1 locus_tag LOCUS_29280 gene rpmE2 CDS 27375..28652 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5V0 transl_table 11 codon_start 1 locus_tag LOCUS_29290 gene gltA CDS 28993..30087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528199.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 CDS 30366..31004 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287810.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 gene tcfB CDS 31058..33790 product fimbrial outer membrane usher protein TcfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092510.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 gene tsaC CDS 33787..34923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29330 CDS 34944..35651 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705402.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS 35721..39218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29350 note possible pseudo, internal stop codon, frameshifted CDS 39422..40306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29360 note possible pseudo, frameshifted CDS 40376..41122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS complement(41224..41874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038337.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS complement(42021..44444) product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038336.1 transl_table 11 codon_start 1 locus_tag LOCUS_29390 gene mrcA CDS 44733..45722 product fimbrial assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038335.1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 gene pilM CDS 45722..46618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29410 CDS 46615..47289 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038333.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 gene pilO CDS 47289..47822 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038332.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 gene pilP CDS 47844..49808 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038331.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 gene pilQ CDS 49976..51001 product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038330.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 gene moxR CDS 51040..51939 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038329.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS 51936..52385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038328.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 CDS 52382..53386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038327.1 transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS 53383..55194 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038326.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS 55191..56906 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038325.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS 56964..58283 product proton glutamate symport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038324.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 gene gltP CDS 58482..60479 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5W5 transl_table 11 codon_start 1 locus_tag LOCUS_29520 gene tktA CDS 60491..60796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS 61084..61389 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103139.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS complement(61475..63427) product acetyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038313.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 CDS complement(63463..64020) product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038309.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 CDS 64139..64504 product BlaI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038312.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 gene blaI CDS 64497..65738 product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5X8 transl_table 11 codon_start 1 locus_tag LOCUS_29580 CDS 65735..66295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS complement(66350..67150) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038303.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS complement(67162..67980) product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038304.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS complement(68217..68846) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038301.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 gene ompW CDS 69039..70043 product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5Z0 transl_table 11 codon_start 1 locus_tag LOCUS_29630 gene gapA CDS 70169..72838 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038297.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 CDS 72835..74211 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038296.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 sequence25 source 1..72784 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(105..692) product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QI7 transl_table 11 codon_start 1 locus_tag LOCUS_29660 gene azoR CDS 820..1812 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036777.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 tRNA 1914..2003 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS complement(2171..2626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29680 CDS complement(3408..6158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29690 CDS complement(6279..7268) product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538217.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 CDS 7371..7718 product HxlR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185699.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 CDS complement(8309..9505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS 10136..10543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29730 CDS 10646..11101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039246.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS complement(11259..11636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS complement(11667..12026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29760 CDS complement(12145..14115) product macrolide export ATP-binding/permease protein MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIL8 transl_table 11 codon_start 1 locus_tag LOCUS_29770 gene macB CDS complement(14112..15302) product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815858.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 CDS complement(15429..15857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29790 CDS complement(16171..17520) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087571.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS complement(17520..18194) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087570.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 CDS 18389..18670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29820 CDS complement(18748..19218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS complement(19215..19781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS complement(19974..22115) product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036583.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 gene fhuA CDS complement(22190..22834) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226070.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 CDS 22918..24450 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229883.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS complement(24494..24739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS complement(24866..25195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29890 CDS complement(25231..25632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29900 CDS 25546..25899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS complement(25996..26472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29920 CDS complement(26565..27803) product FMN oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114387.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS 27893..28375 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114388.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 CDS complement(28392..29603) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036509.1 transl_table 11 codon_start 1 locus_tag LOCUS_29950 gene araJ CDS 29697..29906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29960 CDS 30153..30410 product UPF0386 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5L6 transl_table 11 codon_start 1 locus_tag LOCUS_29970 CDS 30484..30990 product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207057.1 transl_table 11 codon_start 1 locus_tag LOCUS_29980 gene yhbS CDS complement(31013..31219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29990 CDS complement(31278..31715) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920126.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS complement(31783..32550) product NAD(P)H dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525154.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS 32629..32988 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640344.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 CDS 33064..33588 product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8S0 transl_table 11 codon_start 1 locus_tag LOCUS_30030 gene tadA CDS 33664..34236 product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8S1 transl_table 11 codon_start 1 locus_tag LOCUS_30040 gene orn CDS 34396..35271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106675.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 CDS 35411..36526 product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112378.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 CDS complement(36633..37526) product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037313.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 gene yggB CDS complement(37664..40042) product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8S3 transl_table 11 codon_start 1 locus_tag LOCUS_30080 gene ppsA CDS 40188..41009 product putative phosphoenolpyruvate synthase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8S4 transl_table 11 codon_start 1 locus_tag LOCUS_30090 CDS 41158..41667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037310.1 transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS 41710..42198 product 7,8-dihydro-8-oxoguanine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037309.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 gene mutT CDS 42392..42970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113820.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS 43091..44455 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385416.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 CDS complement(44643..45287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30140 CDS 45657..46253 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037307.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 gene pssA CDS 46276..47370 product class III poly(R)-hydroxyalkanoic acid synthase subunit PhaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037306.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 gene phaE CDS 47367..48434 product poly-beta-hydroxybutyrate polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037305.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 gene phbC CDS 48468..48836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035581.1 transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS 48903..49106 product stress-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037304.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 CDS 49103..49555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037303.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS 50245..50460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037301.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 CDS 50668..53055 product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037300.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 gene tex CDS 53264..55447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30230 CDS 55544..56227 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381155.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 CDS 56205..57584 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404984.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 CDS 58207..61428 product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085718.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 gene ragC CDS 61421..62584 product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085719.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS 62571..63965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089909.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 CDS 64043..64285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS complement(64287..64577) product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388148.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 CDS complement(64640..65242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30310 note possible pseudo, frameshifted CDS complement(65313..65729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS 66279..68105 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921178.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 CDS complement(68102..69541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30340 CDS complement(69654..70163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30350 tRNA complement(70270..70355) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 CDS 70488..70868 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037298.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS 70939..71136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS complement(71182..72138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30380 CDS 72216..72632 product AttT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035584.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 gene attT tRNA complement(72693..72768) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 sequence26 source 1..72066 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(4137..5132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30400 CDS complement(5455..5808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30410 CDS 6435..6791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS 6861..7262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS complement(7315..8412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112913.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 CDS complement(8553..9029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096727.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 CDS complement(9091..9660) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196513.1 transl_table 11 codon_start 1 locus_tag LOCUS_30460 CDS 9829..10782 product chloroperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969967.1 transl_table 11 codon_start 1 locus_tag LOCUS_30470 CDS complement(10837..13488) product excinuclease ABC subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036288.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 gene uvrA2 CDS complement(13597..15480) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038680.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 CDS complement(15527..17992) product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267348.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 CDS complement(18092..19129) product sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082671.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 CDS complement(19126..19935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30520 CDS complement(19997..21385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038717.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 CDS complement(21478..24546) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919015.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 CDS complement(24659..25699) product sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113263.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 CDS complement(25702..26193) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082669.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS complement(26382..27062) product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537687.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 CDS 27152..28348 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706360.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 CDS complement(28406..28933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098394.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS 29046..29414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS complement(29426..30931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS complement(31012..31884) product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDM1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 gene metF CDS complement(31884..32798) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035570.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 gene metR CDS 32974..33555 product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035571.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 gene sflA CDS 33556..34590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035572.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 CDS 34630..35664 product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035573.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 gene metE CDS 35797..37044 product arsenic transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088028.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 gene arsB CDS 37369..38211 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836266.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 gene yeaM CDS complement(38199..39200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS 39397..41583 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265529.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 CDS 41617..42495 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923326.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS 42492..42977 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531248.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 CDS 43014..46652 product two-component sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114080.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 CDS 47160..48806 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940904.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 CDS complement(48877..50082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30750 CDS complement(50393..51865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30760 CDS complement(51891..53465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035939.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS 53618..54922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS complement(55101..55295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS 55213..55953 product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036828.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 gene nucA CDS complement(56010..56948) product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530060.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS 57163..58104 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530059.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 CDS 58127..58822 product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925735.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 CDS complement(58830..59060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708898.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS complement(59057..59482) product lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972459.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 CDS complement(59493..59954) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970370.1 transl_table 11 codon_start 1 locus_tag LOCUS_30860 CDS complement(60024..61343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30870 CDS 61775..62305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30880 CDS 62302..62919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113479.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 CDS 62962..64278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30900 CDS 64377..65081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113481.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 CDS 65095..65844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS 65891..67228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088309.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 CDS 67407..68930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS 69007..70059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30950 CDS 70280..70570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30960 CDS 70614..70883 product RebB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197243.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 CDS 70910..71176 product RebB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038031.1 transl_table 11 codon_start 1 locus_tag LOCUS_30980 gene rebB CDS 71237..71509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30990 CDS 71579..71815 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31000 sequence27 source 1..68526 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 404..1300 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9X9 transl_table 11 codon_start 1 locus_tag LOCUS_31010 gene folP CDS 1300..2253 product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9X8 transl_table 11 codon_start 1 locus_tag LOCUS_31020 gene miaA CDS 2350..2625 product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9X7 transl_table 11 codon_start 1 locus_tag LOCUS_31030 gene hfq CDS 2640..3950 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9X6 transl_table 11 codon_start 1 locus_tag LOCUS_31040 gene hflX CDS 4073..4567 product competence damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036895.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 CDS 4599..6284 product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9X3 transl_table 11 codon_start 1 locus_tag LOCUS_31060 gene aarF CDS 6493..7128 product LexA repressor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9X2 transl_table 11 codon_start 1 locus_tag LOCUS_31070 gene lexA2 CDS 7270..8370 product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q60101 transl_table 11 codon_start 1 locus_tag LOCUS_31080 gene recA CDS 8379..8972 product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9X1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 gene recX CDS 9082..11730 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9X0 transl_table 11 codon_start 1 locus_tag LOCUS_31100 gene alaS CDS 11879..12082 product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9W9 transl_table 11 codon_start 1 locus_tag LOCUS_31110 gene csrA tRNA 12161..12253 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS 12505..13062 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814464.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 CDS 13142..14296 product sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082671.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 CDS 14389..16920 product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267348.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 CDS complement(16975..19305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31150 CDS 19450..20379 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814017.1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 gene alcR CDS 20491..22662 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926982.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 gene fauA CDS complement(22683..22901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31180 CDS 22786..23268 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31190 CDS complement(23325..26000) product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVZ9 transl_table 11 codon_start 1 locus_tag LOCUS_31200 CDS 26275..26790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31210 CDS 26787..27812 product FecR protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836262.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 gene fecR CDS 27951..30884 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635445.2 transl_table 11 codon_start 1 locus_tag LOCUS_31230 gene cirA CDS 30895..32490 product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919439.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 CDS complement(32593..34713) product phospholipase C, phosphocholine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038152.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250 gene plcN CDS complement(34710..37088) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038151.1 transl_table 11 codon_start 1 locus_tag LOCUS_31260 gene fhuA CDS 37263..38771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31270 CDS complement(38784..39710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS complement(39707..41053) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113742.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 CDS 41239..42390 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038989.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS complement(42474..43613) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403811.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 CDS 43799..44494 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114420.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS 44682..46886 product ferripyoverdine receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48632 transl_table 11 codon_start 1 locus_tag LOCUS_31330 gene fpvA CDS complement(46943..47644) product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036904.1 transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS 47785..48705 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036906.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 CDS complement(49264..50655) product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC31 transl_table 11 codon_start 1 locus_tag LOCUS_31360 gene dhs1 CDS 50876..53002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31370 CDS complement(53048..53554) product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC32 transl_table 11 codon_start 1 locus_tag LOCUS_31380 gene dsbB CDS complement(53739..54122) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z3E6 transl_table 11 codon_start 1 locus_tag LOCUS_31390 gene rplQ CDS complement(54314..55312) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A0Y1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 gene rpoA CDS complement(55369..55998) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A0X9 transl_table 11 codon_start 1 locus_tag LOCUS_31410 gene rpsD CDS complement(56014..56403) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A0X2 transl_table 11 codon_start 1 locus_tag LOCUS_31420 gene rpsK CDS complement(56415..56771) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z3F0 transl_table 11 codon_start 1 locus_tag LOCUS_31430 gene rpsM CDS complement(57119..58486) product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC33 transl_table 11 codon_start 1 locus_tag LOCUS_31440 gene secY CDS complement(58494..58937) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC34 transl_table 11 codon_start 1 locus_tag LOCUS_31450 gene rplO CDS complement(58944..59135) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC35 transl_table 11 codon_start 1 locus_tag LOCUS_31460 gene rpmD CDS complement(59128..59670) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66587 transl_table 11 codon_start 1 locus_tag LOCUS_31470 gene rpsE CDS complement(59832..60185) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC36 transl_table 11 codon_start 1 locus_tag LOCUS_31480 gene rplR CDS complement(60272..60796) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC37 transl_table 11 codon_start 1 locus_tag LOCUS_31490 gene rplF CDS complement(60815..61213) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC38 transl_table 11 codon_start 1 locus_tag LOCUS_31500 gene rpsH CDS complement(61473..61778) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CLU4 transl_table 11 codon_start 1 locus_tag LOCUS_31510 gene rpsN CDS complement(61797..62339) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC39 transl_table 11 codon_start 1 locus_tag LOCUS_31520 gene rplE CDS complement(62351..62668) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC40 transl_table 11 codon_start 1 locus_tag LOCUS_31530 gene rplX CDS complement(62685..63053) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CLU5 transl_table 11 codon_start 1 locus_tag LOCUS_31540 gene rplN CDS complement(63066..63335) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC41 transl_table 11 codon_start 1 locus_tag LOCUS_31550 gene rpsQ CDS complement(63347..63532) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC42 transl_table 11 codon_start 1 locus_tag LOCUS_31560 gene rpmC CDS complement(63532..63945) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC43 transl_table 11 codon_start 1 locus_tag LOCUS_31570 gene rplP CDS complement(63951..64685) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC44 transl_table 11 codon_start 1 locus_tag LOCUS_31580 gene rpsC CDS complement(64704..65039) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CLU6 transl_table 11 codon_start 1 locus_tag LOCUS_31590 gene rplV CDS complement(65052..65321) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC45 transl_table 11 codon_start 1 locus_tag LOCUS_31600 gene rpsS CDS complement(65328..66155) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC46 transl_table 11 codon_start 1 locus_tag LOCUS_31610 gene rplB CDS complement(66166..66465) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC47 transl_table 11 codon_start 1 locus_tag LOCUS_31620 gene rplW CDS complement(66462..67067) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC48 transl_table 11 codon_start 1 locus_tag LOCUS_31630 gene rplD CDS complement(67080..67730) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC49 transl_table 11 codon_start 1 locus_tag LOCUS_31640 gene rplC CDS complement(67742..68053) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC50 transl_table 11 codon_start 1 locus_tag LOCUS_31650 gene rpsJ sequence28 source 1..67709 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 703..1062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31660 CDS 1287..1616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31670 CDS complement(1613..1894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS 2044..2262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31690 CDS complement(3310..3585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31700 CDS 3648..4262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS complement(4248..4547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS complement(4715..4936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31730 CDS 5147..5647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31740 CDS complement(5651..6859) product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938819.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 tRNA complement(7016..7091) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS complement(7103..7441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31760 CDS 7353..7616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS 7797..10127 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036376.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 gene fyuA CDS complement(10216..12288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31790 CDS complement(12407..13486) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8D6 transl_table 11 codon_start 1 locus_tag LOCUS_31800 gene rnD CDS 13571..15457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637660.2 transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS 15508..16443 product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390203.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS complement(16963..18294) product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8D9 transl_table 11 codon_start 1 locus_tag LOCUS_31830 gene xseA CDS complement(18339..19415) product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8E0 transl_table 11 codon_start 1 locus_tag LOCUS_31840 gene queG CDS 19433..20917 product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8E1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS 20914..21396 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037444.1 transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS 21479..23041 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037443.1 transl_table 11 codon_start 1 locus_tag LOCUS_31870 gene amiC CDS 23163..25067 product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8E4 transl_table 11 codon_start 1 locus_tag LOCUS_31880 gene mutL CDS 25079..26008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037441.1 transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS 26010..26972 product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037440.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 CDS complement(27048..27704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637650.2 transl_table 11 codon_start 1 locus_tag LOCUS_31910 CDS complement(27777..28517) product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037438.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 gene phbB CDS complement(28535..29455) product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8E9 transl_table 11 codon_start 1 locus_tag LOCUS_31930 gene gluQ CDS 29549..30415 product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8F0 transl_table 11 codon_start 1 locus_tag LOCUS_31940 gene htpX CDS complement(30972..31799) product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037421.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 gene suhB CDS 31920..32690 product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8G5 transl_table 11 codon_start 1 locus_tag LOCUS_31960 gene trmJ CDS 32767..33669 product phosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037419.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 CDS 33666..35792 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037418.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 CDS complement(35910..36926) product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037417.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS 37047..37613 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8G9 transl_table 11 codon_start 1 locus_tag LOCUS_32000 gene efp CDS 37814..39157 product N-ethylammeline chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037414.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 CDS 39183..39899 product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8H2 transl_table 11 codon_start 1 locus_tag LOCUS_32020 gene ubiG CDS 39896..40591 product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8H3 transl_table 11 codon_start 1 locus_tag LOCUS_32030 gene gph CDS 40603..41307 product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037411.1 transl_table 11 codon_start 1 locus_tag LOCUS_32040 CDS complement(41396..42244) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037402.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 CDS complement(42244..43590) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8I4 transl_table 11 codon_start 1 locus_tag LOCUS_32060 gene pyrC CDS complement(43592..43846) product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8I5 transl_table 11 codon_start 1 locus_tag LOCUS_32070 CDS 44119..45348 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32080 CDS complement(45718..46965) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037397.1 transl_table 11 codon_start 1 locus_tag LOCUS_32090 gene tetV CDS complement(46962..47414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037396.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 CDS complement(47469..48845) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8J0 transl_table 11 codon_start 1 locus_tag LOCUS_32110 gene cysS CDS 49032..49595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037394.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 CDS 49915..50925 product N-acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8J2 transl_table 11 codon_start 1 locus_tag LOCUS_32130 gene argF' CDS 51044..52240 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8J4 transl_table 11 codon_start 1 locus_tag LOCUS_32140 gene argG CDS 52328..53416 product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037390.1 transl_table 11 codon_start 1 locus_tag LOCUS_32150 gene argE CDS 53442..54770 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8J6 transl_table 11 codon_start 1 locus_tag LOCUS_32160 gene argB CDS 54774..55376 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037388.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 gene argA CDS 55373..56326 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8J8 transl_table 11 codon_start 1 locus_tag LOCUS_32180 gene argC CDS 56347..57642 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8J9 transl_table 11 codon_start 1 locus_tag LOCUS_32190 gene argH CDS 57642..57905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037384.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 CDS 57917..59074 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8K2 transl_table 11 codon_start 1 locus_tag LOCUS_32210 gene proB CDS 59071..60342 product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8K3 transl_table 11 codon_start 1 locus_tag LOCUS_32220 gene proA CDS complement(60515..60985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32230 CDS complement(60982..62238) product poly-beta-1,6 N-acetyl-D-glucosamine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164390.1 transl_table 11 codon_start 1 locus_tag LOCUS_32240 gene hmsR CDS complement(62240..64126) product poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064163.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 gene hmsF CDS complement(64128..66155) product poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816569.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 gene hmsH CDS complement(66503..67708) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037380.1 transl_table 11 codon_start 1 locus_tag LOCUS_32270 gene cynX sequence29 source 1..67671 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1542..2522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32280 CDS 3209..3397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32290 CDS 3503..4048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32300 CDS 4045..4521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32310 CDS 4545..5576 product membrane fimbriae assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521659.1 transl_table 11 codon_start 1 locus_tag LOCUS_32320 CDS 5595..6953 product exported fimbriae assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192085.1 transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS 7026..8237 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193624.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 CDS 8222..9571 product type II/IV secretion system ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521658.1 transl_table 11 codon_start 1 locus_tag LOCUS_32350 CDS 9574..10530 product type II secretion protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810181.1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 CDS 10559..11494 product type II secretion protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810184.1 transl_table 11 codon_start 1 locus_tag LOCUS_32370 CDS 11494..12375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS 12372..12842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS 12851..15004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810187.1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS 15158..15817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32410 CDS complement(15884..16270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32420 CDS 16457..17281 product non-heme chloroperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037318.1 transl_table 11 codon_start 1 locus_tag LOCUS_32430 gene cpo CDS complement(17404..18984) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037320.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 gene tetV CDS complement(19047..20330) product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941467.1 transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS complement(20309..22279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637531.2 transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS complement(22276..22701) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037322.1 transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS complement(22704..22862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32480 note possible pseudo, frameshifted CDS complement(22859..23359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32490 note possible pseudo, frameshifted CDS complement(23356..23772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32500 CDS complement(23850..24182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32510 CDS 24288..27308 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037325.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 CDS 27301..27954 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037326.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 CDS complement(28088..29545) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 CDS complement(29597..30298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067763.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 CDS 30421..31302 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112482.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 CDS 31435..31872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32570 CDS complement(31917..33077) product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086627.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 CDS 33263..33904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974912.1 transl_table 11 codon_start 1 locus_tag LOCUS_32590 CDS complement(33987..36713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895598.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 CDS 36926..37525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32610 CDS complement(37522..38295) product CDP-diacylglycerol diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036871.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 gene cdh CDS complement(38469..39086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32630 CDS complement(39220..39819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32640 CDS complement(39823..41655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32650 CDS complement(41741..42232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32660 CDS complement(42357..42842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32670 CDS complement(42968..43447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32680 CDS complement(43458..44339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32690 CDS complement(44339..47122) product type IV secretion protein Rhs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196687.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 CDS 47357..48415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549922.1 transl_table 11 codon_start 1 locus_tag LOCUS_32710 CDS complement(48461..49240) product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205261.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 CDS complement(49243..50226) product type VI secretion-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200003.1 transl_table 11 codon_start 1 locus_tag LOCUS_32730 CDS complement(50223..53930) product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206361.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 CDS complement(53946..55382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32750 CDS complement(55425..55685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193592.1 transl_table 11 codon_start 1 locus_tag LOCUS_32760 CDS complement(55788..56669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32770 CDS 56744..57628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32780 CDS complement(57668..58642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32790 CDS complement(58718..59764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32800 CDS complement(59799..59942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32810 CDS 60010..61059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32820 CDS complement(61462..62301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32830 CDS complement(62915..63964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32840 CDS complement(63968..66709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205114.1 transl_table 11 codon_start 1 locus_tag LOCUS_32850 CDS complement(66702..67553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526759.1 transl_table 11 codon_start 1 locus_tag LOCUS_32860 sequence30 source 1..66761 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1126 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_638835.2:multidrug resistance efflux pump locus_tag LOCUS_32870 CDS complement(1235..1726) product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037815.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 CDS complement(1761..3164) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7C5 transl_table 11 codon_start 1 locus_tag LOCUS_32890 gene gltX CDS complement(3258..4871) product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073369.1 transl_table 11 codon_start 1 locus_tag LOCUS_32900 CDS complement(5068..5478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32910 CDS complement(5489..6808) product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037822.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 gene creD CDS complement(6890..8350) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037824.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 gene creC CDS complement(8354..9079) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037825.1 transl_table 11 codon_start 1 locus_tag LOCUS_32940 gene creB CDS 9115..9972 product ribosomal RNA large subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7B5 transl_table 11 codon_start 1 locus_tag LOCUS_32950 gene rlmJ CDS 10068..10613 product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037827.1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 CDS 10824..14288 product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7B3 transl_table 11 codon_start 1 locus_tag LOCUS_32970 gene mfd CDS 14339..14950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813001.1 transl_table 11 codon_start 1 locus_tag LOCUS_32980 CDS complement(15139..17307) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037840.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 CDS complement(17451..18200) product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7A1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 gene gpmA CDS 18304..18969 product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7A0 transl_table 11 codon_start 1 locus_tag LOCUS_33010 gene nfi CDS complement(19007..19987) product cation diffusion facilitator transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036459.1 transl_table 11 codon_start 1 locus_tag LOCUS_33020 gene czcD CDS 19946..20197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33030 CDS complement(20167..22416) product outer membrane receptor FepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112590.1 transl_table 11 codon_start 1 locus_tag LOCUS_33040 gene pirA CDS 22674..24116 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931513.1 transl_table 11 codon_start 1 locus_tag LOCUS_33050 CDS complement(24119..25324) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039766.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 CDS 25403..25852 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926470.1 transl_table 11 codon_start 1 locus_tag LOCUS_33070 CDS 25926..27044 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073324.1 transl_table 11 codon_start 1 locus_tag LOCUS_33080 CDS 27177..27860 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526208.1 transl_table 11 codon_start 1 locus_tag LOCUS_33090 CDS 27857..29236 product two-component system sensor kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526207.1 transl_table 11 codon_start 1 locus_tag LOCUS_33100 CDS 29262..30152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204045.1 transl_table 11 codon_start 1 locus_tag LOCUS_33110 CDS 30154..30513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33120 CDS 30510..30908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33130 CDS 30919..32127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33140 CDS 32296..33012 product 2,3-diketo-5-methylthio-1-phosphopentane phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816647.1 transl_table 11 codon_start 1 locus_tag LOCUS_33150 CDS 33078..34478 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251051.1 transl_table 11 codon_start 1 locus_tag LOCUS_33160 CDS 34507..35571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33170 CDS 35575..36459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33180 CDS 36633..36992 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706716.1 transl_table 11 codon_start 1 locus_tag LOCUS_33190 CDS 37061..37273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33200 CDS 37275..38063 product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I095 transl_table 11 codon_start 1 locus_tag LOCUS_33210 gene map CDS complement(38060..38674) product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038077.1 transl_table 11 codon_start 1 locus_tag LOCUS_33220 gene yggA CDS 38780..39673 product chromosome replication initiation inhibitor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038078.1 transl_table 11 codon_start 1 locus_tag LOCUS_33230 CDS 39779..41158 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707258.1 transl_table 11 codon_start 1 locus_tag LOCUS_33240 CDS 41151..42164 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073793.1 transl_table 11 codon_start 1 locus_tag LOCUS_33250 CDS 42149..43336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33260 CDS 43333..44460 product multidrug ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207409.1 transl_table 11 codon_start 1 locus_tag LOCUS_33270 gene ybhR CDS complement(44577..44939) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038539.1 transl_table 11 codon_start 1 locus_tag LOCUS_33280 CDS complement(45112..47352) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037053.1 transl_table 11 codon_start 1 locus_tag LOCUS_33290 gene tsr CDS complement(47517..48065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33300 CDS complement(48196..48543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33310 CDS 48784..49176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33320 CDS 49771..50526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33330 CDS 50628..52283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33340 CDS 52415..52897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33350 CDS complement(53074..56001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33360 CDS complement(56064..57974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33370 CDS complement(57952..59034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33380 CDS complement(59173..59295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33390 CDS complement(59549..60250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33400 CDS complement(60250..63177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33410 CDS complement(63174..63794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33420 CDS complement(63857..65056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33430 CDS complement(65123..65737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33440 CDS complement(65771..66217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33450 sequence31 source 1..60506 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 52..261 product DUF1656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039232.1 transl_table 11 codon_start 1 locus_tag LOCUS_33460 CDS 258..1175 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039233.1 transl_table 11 codon_start 1 locus_tag LOCUS_33470 gene fusE CDS 1172..2641 product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039234.1 transl_table 11 codon_start 1 locus_tag LOCUS_33480 gene nodT CDS 2645..4684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33490 CDS 4746..5141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33500 CDS complement(5239..7119) product RecBCD enzyme subunit RecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P380 transl_table 11 codon_start 1 locus_tag LOCUS_33510 gene recD CDS complement(7116..10796) product RecBCD enzyme subunit RecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P379 transl_table 11 codon_start 1 locus_tag LOCUS_33520 gene recB CDS complement(10793..14140) product RecBCD enzyme subunit RecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P378 transl_table 11 codon_start 1 locus_tag LOCUS_33530 gene recC CDS 14321..15118 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039268.1 transl_table 11 codon_start 1 locus_tag LOCUS_33540 gene yrbF CDS 15118..15867 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039269.1 transl_table 11 codon_start 1 locus_tag LOCUS_33550 gene yrbE CDS 15927..16451 product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039270.1 transl_table 11 codon_start 1 locus_tag LOCUS_33560 gene yrbD CDS 16448..17110 product organic solvent ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039271.1 transl_table 11 codon_start 1 locus_tag LOCUS_33570 gene yrbC CDS 17100..17411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039272.1 transl_table 11 codon_start 1 locus_tag LOCUS_33580 CDS 17413..18429 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039273.1 transl_table 11 codon_start 1 locus_tag LOCUS_33590 gene vacJ CDS complement(18559..24918) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33600 CDS 25212..25751 product microcystin dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039263.1 transl_table 11 codon_start 1 locus_tag LOCUS_33610 CDS 25806..26336 product microcystin dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039264.1 transl_table 11 codon_start 1 locus_tag LOCUS_33620 CDS 26368..26901 product microcystin dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039265.1 transl_table 11 codon_start 1 locus_tag LOCUS_33630 CDS 26898..27449 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039266.1 transl_table 11 codon_start 1 locus_tag LOCUS_33640 CDS complement(27466..27756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639540.2 transl_table 11 codon_start 1 locus_tag LOCUS_33650 CDS complement(27905..28450) product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P365 transl_table 11 codon_start 1 locus_tag LOCUS_33660 gene btuE CDS complement(28537..28935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33670 CDS complement(29007..30563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639549.2 transl_table 11 codon_start 1 locus_tag LOCUS_33680 CDS 30608..31213 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096819.1 transl_table 11 codon_start 1 locus_tag LOCUS_33690 CDS complement(31240..32247) product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039277.1 transl_table 11 codon_start 1 locus_tag LOCUS_33700 CDS 32345..33310 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039278.1 transl_table 11 codon_start 1 locus_tag LOCUS_33710 CDS 33326..33955 product leucine efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192135.1 transl_table 11 codon_start 1 locus_tag LOCUS_33720 CDS 34200..35627 product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039281.1 transl_table 11 codon_start 1 locus_tag LOCUS_33730 gene yhdG CDS complement(35721..36962) product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039289.1 transl_table 11 codon_start 1 locus_tag LOCUS_33740 CDS complement(37170..37472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33750 CDS complement(37533..38213) product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198318.1 transl_table 11 codon_start 1 locus_tag LOCUS_33760 CDS complement(38274..39443) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039292.1 transl_table 11 codon_start 1 locus_tag LOCUS_33770 CDS 39734..40696 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039293.1 transl_table 11 codon_start 1 locus_tag LOCUS_33780 gene ygjT CDS 40803..41573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639567.2 transl_table 11 codon_start 1 locus_tag LOCUS_33790 CDS complement(41668..42774) product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039295.1 transl_table 11 codon_start 1 locus_tag LOCUS_33800 gene glpQ CDS complement(42970..44319) product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P340 transl_table 11 codon_start 1 locus_tag LOCUS_33810 gene mnmE CDS complement(44323..46995) product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639573.2 transl_table 11 codon_start 1 locus_tag LOCUS_33820 CDS complement(47111..48826) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P338 transl_table 11 codon_start 1 locus_tag LOCUS_33830 gene yidC CDS complement(48826..49320) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P337 transl_table 11 codon_start 1 locus_tag LOCUS_33840 gene rnpA CDS complement(49326..49466) product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66262 transl_table 11 codon_start 1 locus_tag LOCUS_33850 gene rpmH CDS 49716..51053 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PEH5 transl_table 11 codon_start 1 locus_tag LOCUS_33860 gene dnaA CDS 51329..52429 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PEH4 transl_table 11 codon_start 1 locus_tag LOCUS_33870 gene dnaN CDS 53371..54465 product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PEH3 transl_table 11 codon_start 1 locus_tag LOCUS_33880 gene recF CDS 54578..57037 product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PEH2 transl_table 11 codon_start 1 locus_tag LOCUS_33890 gene gyrB CDS 57105..57950 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035263.1 transl_table 11 codon_start 1 locus_tag LOCUS_33900 CDS 58022..58828 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035264.1 transl_table 11 codon_start 1 locus_tag LOCUS_33910 CDS 58961..60151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035265.1 transl_table 11 codon_start 1 locus_tag LOCUS_33920 sequence32 source 1..56170 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(897..1202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038887.1 transl_table 11 codon_start 1 locus_tag LOCUS_33930 CDS complement(1272..1583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038887.1 transl_table 11 codon_start 1 locus_tag LOCUS_33940 CDS complement(1686..2807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33950 note possible pseudo, internal stop codon, frameshifted CDS complement(2871..3521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267038.1 transl_table 11 codon_start 1 locus_tag LOCUS_33960 CDS complement(3605..4012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33970 CDS complement(4104..4802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038889.1 transl_table 11 codon_start 1 locus_tag LOCUS_33980 CDS complement(4857..5771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33990 CDS complement(6151..6963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038891.1 transl_table 11 codon_start 1 locus_tag LOCUS_34000 note possible pseudo, frameshifted CDS complement(7244..7522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34010 CDS complement(7617..8354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038892.1 transl_table 11 codon_start 1 locus_tag LOCUS_34020 CDS complement(8567..8959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34030 note possible pseudo, internal stop codon, frameshifted CDS complement(8981..9193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958171.1 transl_table 11 codon_start 1 locus_tag LOCUS_34040 CDS complement(9524..9769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34050 CDS complement(10293..12305) product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038895.1 transl_table 11 codon_start 1 locus_tag LOCUS_34060 CDS complement(12575..13015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34070 note possible pseudo, frameshifted CDS complement(13089..13616) product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895541.1 transl_table 11 codon_start 1 locus_tag LOCUS_34080 CDS complement(13613..14413) product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038897.1 transl_table 11 codon_start 1 locus_tag LOCUS_34090 CDS complement(14731..15975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34100 note possible pseudo, internal stop codon, frameshifted CDS complement(15979..16539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34110 CDS complement(16555..18183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038900.1 transl_table 11 codon_start 1 locus_tag LOCUS_34120 CDS complement(18176..18424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34130 CDS complement(18408..19283) product chromosome partitioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038901.1 transl_table 11 codon_start 1 locus_tag LOCUS_34140 CDS complement(19326..19538) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002346894.2 transl_table 11 codon_start 1 locus_tag LOCUS_34150 CDS complement(19657..20412) product receptor protein-tyrosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038902.1 transl_table 11 codon_start 1 locus_tag LOCUS_34160 CDS complement(20977..22905) product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038254.1 transl_table 11 codon_start 1 locus_tag LOCUS_34170 gene intS tRNA complement(23147..23220) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS complement(23351..25186) product lipase/esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038255.1 transl_table 11 codon_start 1 locus_tag LOCUS_34180 gene estA CDS 25394..25594 product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038256.1 transl_table 11 codon_start 1 locus_tag LOCUS_34190 CDS 25727..26521 product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P632 transl_table 11 codon_start 1 locus_tag LOCUS_34200 gene thiG CDS 26521..27255 product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P631 transl_table 11 codon_start 1 locus_tag LOCUS_34210 gene trmB CDS 27283..29130 product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038259.1 transl_table 11 codon_start 1 locus_tag LOCUS_34220 gene sac1 CDS complement(29403..29738) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038260.1 transl_table 11 codon_start 1 locus_tag LOCUS_34230 CDS 29860..30198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038261.1 transl_table 11 codon_start 1 locus_tag LOCUS_34240 CDS 30274..30990 product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038262.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 CDS 31046..31450 product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P626 transl_table 11 codon_start 1 locus_tag LOCUS_34260 gene mscL CDS 31676..33097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34270 CDS complement(33243..34694) product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387166.1 transl_table 11 codon_start 1 locus_tag LOCUS_34280 gene alsT CDS complement(34705..35163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34290 CDS complement(35913..36749) product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038272.1 transl_table 11 codon_start 1 locus_tag LOCUS_34300 CDS complement(36750..38258) product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038273.1 transl_table 11 codon_start 1 locus_tag LOCUS_34310 CDS complement(38369..38908) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038274.1 transl_table 11 codon_start 1 locus_tag LOCUS_34320 CDS complement(38901..42026) product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038276.1 transl_table 11 codon_start 1 locus_tag LOCUS_34330 gene acrF CDS complement(42023..43129) product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038277.1 transl_table 11 codon_start 1 locus_tag LOCUS_34340 CDS complement(43345..45408) product copper transporter porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119294.1 transl_table 11 codon_start 1 locus_tag LOCUS_34350 gene oprC CDS complement(45481..45912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34360 CDS complement(46585..47568) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038287.1 transl_table 11 codon_start 1 locus_tag LOCUS_34370 gene cysB CDS 47777..48736 product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P600 transl_table 11 codon_start 1 locus_tag LOCUS_34380 gene cysK CDS 48948..49547 product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5Z8 transl_table 11 codon_start 1 locus_tag LOCUS_34390 CDS complement(49640..50782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34400 CDS complement(50912..51916) product putative fructose-bisphosphate aldolase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5Z7 transl_table 11 codon_start 1 locus_tag LOCUS_34410 CDS complement(52114..53580) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5Z6 transl_table 11 codon_start 1 locus_tag LOCUS_34420 gene pykA CDS complement(53755..54408) product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038294.1 transl_table 11 codon_start 1 locus_tag LOCUS_34430 gene idgB CDS complement(54405..55580) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5Z4 transl_table 11 codon_start 1 locus_tag LOCUS_34440 gene pgk sequence33 source 1..55620 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(80..1720) product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532998.1 transl_table 11 codon_start 1 locus_tag LOCUS_34450 CDS complement(1784..3169) product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762699.1 transl_table 11 codon_start 1 locus_tag LOCUS_34460 CDS complement(3883..4662) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530905.1 transl_table 11 codon_start 1 locus_tag LOCUS_34470 CDS complement(4711..5637) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9K7 transl_table 11 codon_start 1 locus_tag LOCUS_34480 gene prfB CDS complement(5759..5974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34490 CDS 6025..6765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112931.1 transl_table 11 codon_start 1 locus_tag LOCUS_34500 CDS complement(6799..7701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037021.1 transl_table 11 codon_start 1 locus_tag LOCUS_34510 gene rpfD CDS 7838..9046 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037018.1 transl_table 11 codon_start 1 locus_tag LOCUS_34520 CDS 9056..10042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34530 CDS complement(10104..13022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34540 CDS complement(13205..13792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34550 CDS complement(14110..14499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34560 CDS complement(14507..19003) product type IV secretion protein Rhs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705805.1 transl_table 11 codon_start 1 locus_tag LOCUS_34570 CDS complement(19023..19151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34580 CDS complement(19148..19858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34590 CDS complement(19858..20943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34600 CDS 21172..22221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037017.1 transl_table 11 codon_start 1 locus_tag LOCUS_34610 gene rpfI CDS complement(22306..24063) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037016.1 transl_table 11 codon_start 1 locus_tag LOCUS_34620 gene recJ CDS complement(24224..25141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037015.1 transl_table 11 codon_start 1 locus_tag LOCUS_34630 gene rpfE CDS complement(25146..25622) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L4D3 transl_table 11 codon_start 1 locus_tag LOCUS_34640 gene greA CDS complement(25619..28861) product carbamoyl-phosphate synthase large chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58943 transl_table 11 codon_start 1 locus_tag LOCUS_34650 gene carB CDS complement(29011..30138) product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58896 transl_table 11 codon_start 1 locus_tag LOCUS_34660 gene carA CDS complement(30448..31167) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9L3 transl_table 11 codon_start 1 locus_tag LOCUS_34670 gene dapB CDS 31258..32019 product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803832.1 transl_table 11 codon_start 1 locus_tag LOCUS_34680 CDS 32024..32227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34690 CDS complement(32230..32436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34700 CDS 32531..32992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34710 CDS complement(33097..33342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037006.1 transl_table 11 codon_start 1 locus_tag LOCUS_34720 CDS complement(33342..35207) product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037005.1 transl_table 11 codon_start 1 locus_tag LOCUS_34730 gene feoB CDS complement(35204..35458) product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037004.1 transl_table 11 codon_start 1 locus_tag LOCUS_34740 gene feoA CDS 35578..36366 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037003.1 transl_table 11 codon_start 1 locus_tag LOCUS_34750 CDS 36369..36770 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083350.1 transl_table 11 codon_start 1 locus_tag LOCUS_34760 CDS 36767..37663 product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037002.1 transl_table 11 codon_start 1 locus_tag LOCUS_34770 gene mvaB CDS 37764..38534 product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037001.1 transl_table 11 codon_start 1 locus_tag LOCUS_34780 gene hadH2 CDS 38583..39149 product elongation factor P-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9M3 transl_table 11 codon_start 1 locus_tag LOCUS_34790 CDS complement(39232..39927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34800 CDS complement(40011..40403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34810 CDS complement(40384..43533) product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705231.1 transl_table 11 codon_start 1 locus_tag LOCUS_34820 CDS complement(43570..44691) product MexC family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705232.1 transl_table 11 codon_start 1 locus_tag LOCUS_34830 CDS 44848..45564 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705233.1 transl_table 11 codon_start 1 locus_tag LOCUS_34840 CDS 45564..46640 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705234.1 transl_table 11 codon_start 1 locus_tag LOCUS_34850 CDS complement(46618..48414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036998.1 transl_table 11 codon_start 1 locus_tag LOCUS_34860 CDS complement(48455..48754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34870 CDS complement(48818..50206) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036996.1 transl_table 11 codon_start 1 locus_tag LOCUS_34880 CDS 50376..51617 product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036995.1 transl_table 11 codon_start 1 locus_tag LOCUS_34890 gene serA CDS complement(51728..52297) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036993.1 transl_table 11 codon_start 1 locus_tag LOCUS_34900 CDS 52475..53950 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036992.1 transl_table 11 codon_start 1 locus_tag LOCUS_34910 gene yhdG CDS 54033..55460 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036991.1 transl_table 11 codon_start 1 locus_tag LOCUS_34920 gene yhdG sequence34 source 1..54992 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 255..698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34930 CDS 695..2062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34940 CDS 2055..2261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34950 CDS 2258..2842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34960 CDS 2839..3159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34970 CDS 3156..3386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34980 CDS 3406..4611 product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038129.1 transl_table 11 codon_start 1 locus_tag LOCUS_34990 gene int CDS complement(4622..5551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35000 CDS complement(5557..5904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35010 tRNA complement(6084..6160) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 tRNA complement(6200..6276) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 CDS 6457..7215 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036182.1 transl_table 11 codon_start 1 locus_tag LOCUS_35020 CDS complement(7275..8024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818563.1 transl_table 11 codon_start 1 locus_tag LOCUS_35030 CDS complement(8050..8958) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931482.1 transl_table 11 codon_start 1 locus_tag LOCUS_35040 CDS complement(9012..9755) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096511.1 transl_table 11 codon_start 1 locus_tag LOCUS_35050 CDS complement(9958..10962) product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036181.1 transl_table 11 codon_start 1 locus_tag LOCUS_35060 gene icd CDS complement(11285..11677) product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBZ0 transl_table 11 codon_start 1 locus_tag LOCUS_35070 CDS complement(11674..11964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35080 note possible pseudo, frameshifted CDS 12107..13753 product putative beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBZ2 transl_table 11 codon_start 1 locus_tag LOCUS_35090 CDS 13870..14559 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036177.1 transl_table 11 codon_start 1 locus_tag LOCUS_35100 gene phoB CDS 14666..15997 product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036176.1 transl_table 11 codon_start 1 locus_tag LOCUS_35110 gene phoR CDS 16002..18089 product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBZ5 transl_table 11 codon_start 1 locus_tag LOCUS_35120 gene ppk CDS 18392..19918 product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036174.1 transl_table 11 codon_start 1 locus_tag LOCUS_35130 gene ppx CDS 20185..23151 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038415.1 transl_table 11 codon_start 1 locus_tag LOCUS_35140 gene btuB CDS 23309..24454 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036173.1 transl_table 11 codon_start 1 locus_tag LOCUS_35150 gene gtrB CDS 24435..24974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35160 CDS 25034..25780 product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58976 transl_table 11 codon_start 1 locus_tag LOCUS_35170 gene lpxH CDS complement(25868..27121) product peptidyl-Asp metalloendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC00 transl_table 11 codon_start 1 locus_tag LOCUS_35180 tRNA complement(27017..27112) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 CDS 27347..28804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104578.1 transl_table 11 codon_start 1 locus_tag LOCUS_35190 CDS complement(28872..29693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036168.1 transl_table 11 codon_start 1 locus_tag LOCUS_35200 CDS complement(29706..31172) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC02 transl_table 11 codon_start 1 locus_tag LOCUS_35210 gene purF CDS complement(31203..31964) product colicin V biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036166.1 transl_table 11 codon_start 1 locus_tag LOCUS_35220 gene cvpA CDS complement(32008..33063) product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036165.1 transl_table 11 codon_start 1 locus_tag LOCUS_35230 CDS complement(33145..34416) product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036164.1 transl_table 11 codon_start 1 locus_tag LOCUS_35240 gene folC CDS complement(34458..35102) product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036162.1 transl_table 11 codon_start 1 locus_tag LOCUS_35250 gene pgmA CDS complement(35277..37442) product dipeptidyl peptidase S46 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071328.1 transl_table 11 codon_start 1 locus_tag LOCUS_35260 CDS 37720..38757 product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34268 transl_table 11 codon_start 1 locus_tag LOCUS_35270 gene tdh CDS complement(38908..39600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036158.1 transl_table 11 codon_start 1 locus_tag LOCUS_35280 CDS 39778..41007 product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC15 transl_table 11 codon_start 1 locus_tag LOCUS_35290 gene kbl CDS complement(41130..41465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35300 CDS complement(41551..42357) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC17 transl_table 11 codon_start 1 locus_tag LOCUS_35310 CDS complement(42378..42884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036150.1 transl_table 11 codon_start 1 locus_tag LOCUS_35320 CDS complement(43103..44194) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036149.1 transl_table 11 codon_start 1 locus_tag LOCUS_35330 gene mopB CDS 44552..45571 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036148.1 transl_table 11 codon_start 1 locus_tag LOCUS_35340 CDS 45757..46314 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027777.1 transl_table 11 codon_start 1 locus_tag LOCUS_35350 CDS 46586..48616 product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036147.1 transl_table 11 codon_start 1 locus_tag LOCUS_35360 gene fadH CDS 48913..49371 product cell wall hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036144.1 transl_table 11 codon_start 1 locus_tag LOCUS_35370 CDS 49456..50067 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039939.1 transl_table 11 codon_start 1 locus_tag LOCUS_35380 gene gst CDS complement(50134..51189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35390 CDS complement(51236..51739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35400 CDS complement(51961..53841) product propionate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813753.1 transl_table 11 codon_start 1 locus_tag LOCUS_35410 gene prpE misc_feature complement(54485..>54992) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J6D8:pseudouridine synthase locus_tag LOCUS_35420 sequence35 source 1..53655 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 7..1149 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036751.1 transl_table 11 codon_start 1 locus_tag LOCUS_35430 gene hisC CDS complement(1202..1939) product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAB7 transl_table 11 codon_start 1 locus_tag LOCUS_35440 gene zipA CDS complement(1986..5489) product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAB8 transl_table 11 codon_start 1 locus_tag LOCUS_35450 gene smc CDS complement(5749..6198) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAC0 transl_table 11 codon_start 1 locus_tag LOCUS_35460 gene rplI CDS complement(6304..6534) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAC1 transl_table 11 codon_start 1 locus_tag LOCUS_35470 gene rpsR CDS complement(6546..6983) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAC2 transl_table 11 codon_start 1 locus_tag LOCUS_35480 gene rpsF CDS complement(7205..7543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036746.1 transl_table 11 codon_start 1 locus_tag LOCUS_35490 CDS 7672..9066 product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAC4 transl_table 11 codon_start 1 locus_tag LOCUS_35500 gene asnS CDS 9097..9396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036743.1 transl_table 11 codon_start 1 locus_tag LOCUS_35510 CDS 9402..9716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036742.1 transl_table 11 codon_start 1 locus_tag LOCUS_35520 CDS 9724..10362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036741.1 transl_table 11 codon_start 1 locus_tag LOCUS_35530 gene paiB CDS 10435..11097 product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAC9 transl_table 11 codon_start 1 locus_tag LOCUS_35540 gene yadF CDS 11117..11638 product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAD0 transl_table 11 codon_start 1 locus_tag LOCUS_35550 gene nbaC CDS 11843..13117 product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAD2 transl_table 11 codon_start 1 locus_tag LOCUS_35560 gene kynU CDS 13149..14516 product kynurenine 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAD3 transl_table 11 codon_start 1 locus_tag LOCUS_35570 gene kmo CDS 14516..15955 product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAD4 transl_table 11 codon_start 1 locus_tag LOCUS_35580 gene sbcB CDS 15952..16638 product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036734.1 transl_table 11 codon_start 1 locus_tag LOCUS_35590 CDS 16638..17630 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388814.1 transl_table 11 codon_start 1 locus_tag LOCUS_35600 CDS 17673..18224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036733.1 transl_table 11 codon_start 1 locus_tag LOCUS_35610 CDS complement(18317..19261) product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036731.1 transl_table 11 codon_start 1 locus_tag LOCUS_35620 CDS complement(19309..20082) product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAD9 transl_table 11 codon_start 1 locus_tag LOCUS_35630 gene nadK CDS complement(20318..25225) product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037508.1 transl_table 11 codon_start 1 locus_tag LOCUS_35640 CDS 25503..26201 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037509.1 transl_table 11 codon_start 1 locus_tag LOCUS_35650 CDS 26201..27469 product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037510.1 transl_table 11 codon_start 1 locus_tag LOCUS_35660 gene acrA CDS 27485..30658 product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037511.1 transl_table 11 codon_start 1 locus_tag LOCUS_35670 gene acrB CDS 30957..31841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35680 CDS complement(31955..33103) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036700.1 transl_table 11 codon_start 1 locus_tag LOCUS_35690 gene acdA CDS 33257..34186 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036699.1 transl_table 11 codon_start 1 locus_tag LOCUS_35700 CDS 34199..35293 product 5-methyltetrahydrofolate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036698.1 transl_table 11 codon_start 1 locus_tag LOCUS_35710 gene metH1 CDS 35290..37974 product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036697.1 transl_table 11 codon_start 1 locus_tag LOCUS_35720 gene metH2 CDS 38061..39245 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103817.1 transl_table 11 codon_start 1 locus_tag LOCUS_35730 CDS complement(39258..41330) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204587.1 transl_table 11 codon_start 1 locus_tag LOCUS_35740 CDS complement(41379..42059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036691.1 transl_table 11 codon_start 1 locus_tag LOCUS_35750 CDS complement(42070..42312) product protein SlyX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAH9 transl_table 11 codon_start 1 locus_tag LOCUS_35760 gene slyX CDS complement(42305..43654) product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036689.1 transl_table 11 codon_start 1 locus_tag LOCUS_35770 gene ugd CDS complement(43678..44655) product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAI1 transl_table 11 codon_start 1 locus_tag LOCUS_35780 gene fkpA CDS complement(44752..45366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35790 CDS 45707..45952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35800 CDS 45955..46314 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036686.1 transl_table 11 codon_start 1 locus_tag LOCUS_35810 CDS 46314..47189 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036685.1 transl_table 11 codon_start 1 locus_tag LOCUS_35820 gene nodI CDS 47186..48214 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036684.1 transl_table 11 codon_start 1 locus_tag LOCUS_35830 CDS 48240..49127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036683.1 transl_table 11 codon_start 1 locus_tag LOCUS_35840 CDS 49157..49768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036682.1 transl_table 11 codon_start 1 locus_tag LOCUS_35850 CDS 49869..50294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036681.1 transl_table 11 codon_start 1 locus_tag LOCUS_35860 CDS complement(50365..51804) product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAI9 transl_table 11 codon_start 1 locus_tag LOCUS_35870 gene fumC CDS 52067..53467 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAJ1 transl_table 11 codon_start 1 locus_tag LOCUS_35880 gene purB sequence36 source 1..52413 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(481..2058) product glycine/betaine ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731943.1 transl_table 11 codon_start 1 locus_tag LOCUS_35890 gene betL CDS 2489..4333 product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5L9 transl_table 11 codon_start 1 locus_tag LOCUS_35900 gene thiC CDS 4428..5099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207910.1 transl_table 11 codon_start 1 locus_tag LOCUS_35910 CDS 5359..7686 product biopolymer transporter Tol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038417.1 transl_table 11 codon_start 1 locus_tag LOCUS_35920 CDS 7802..8701 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038416.1 transl_table 11 codon_start 1 locus_tag LOCUS_35930 CDS 8751..11609 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038415.1 transl_table 11 codon_start 1 locus_tag LOCUS_35940 gene btuB CDS 11780..11989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35950 CDS complement(12050..13171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038414.1 transl_table 11 codon_start 1 locus_tag LOCUS_35960 CDS complement(13323..13859) product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5M4 transl_table 11 codon_start 1 locus_tag LOCUS_35970 gene ppa CDS 14044..14535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35980 CDS 14535..15011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038413.1 transl_table 11 codon_start 1 locus_tag LOCUS_35990 CDS 15058..15597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36000 CDS 15702..16634 product iron dicitrate transporter FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969652.1 transl_table 11 codon_start 1 locus_tag LOCUS_36010 gene fecR CDS 16813..19731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112301.1 transl_table 11 codon_start 1 locus_tag LOCUS_36020 CDS complement(19835..20095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119522.1 transl_table 11 codon_start 1 locus_tag LOCUS_36030 CDS 20199..20786 product heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972364.1 transl_table 11 codon_start 1 locus_tag LOCUS_36040 gene hemO CDS 20818..21285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36050 CDS 21251..22000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36060 note possible pseudo, frameshifted CDS 22010..22435 product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385082.1 transl_table 11 codon_start 1 locus_tag LOCUS_36070 gene exbD CDS 22432..23151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36080 CDS complement(23192..25219) product K(+)-insensitive pyrophosphate-energized proton pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5M6 transl_table 11 codon_start 1 locus_tag LOCUS_36090 gene hppA CDS 25499..26002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038411.1 transl_table 11 codon_start 1 locus_tag LOCUS_36100 CDS complement(26075..26464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200901.1 transl_table 11 codon_start 1 locus_tag LOCUS_36110 CDS complement(26536..28293) product putative potassium transport system protein kup 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZSY2 transl_table 11 codon_start 1 locus_tag LOCUS_36120 gene kup3 CDS 28184..28570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36130 CDS complement(28598..29854) product pyrophosphate--fructose 6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5P4 transl_table 11 codon_start 1 locus_tag LOCUS_36140 gene pfkA CDS 29991..30554 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5P5 transl_table 11 codon_start 1 locus_tag LOCUS_36150 gene adk CDS 30884..32248 product UDP-N-acetylmuramate--L-alanyl-gamma-D-glutamyl-meso-2,6-diaminoheptandioate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5P6 transl_table 11 codon_start 1 locus_tag LOCUS_36160 gene mpl CDS 32245..32823 product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038391.1 transl_table 11 codon_start 1 locus_tag LOCUS_36170 CDS complement(32918..34915) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038389.1 transl_table 11 codon_start 1 locus_tag LOCUS_36180 CDS 35001..35663 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038388.1 transl_table 11 codon_start 1 locus_tag LOCUS_36190 CDS 35660..36166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36200 CDS complement(36278..36961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36210 CDS 37070..37888 product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038387.1 transl_table 11 codon_start 1 locus_tag LOCUS_36220 CDS 37982..38974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038386.1 transl_table 11 codon_start 1 locus_tag LOCUS_36230 CDS 39152..40084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038386.1 transl_table 11 codon_start 1 locus_tag LOCUS_36240 CDS complement(40147..41019) product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038385.1 transl_table 11 codon_start 1 locus_tag LOCUS_36250 gene kch CDS 41083..42309 product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5Q4 transl_table 11 codon_start 1 locus_tag LOCUS_36260 gene argD CDS complement(42343..42945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36270 CDS 43068..43517 product azurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5R2 transl_table 11 codon_start 1 locus_tag LOCUS_36280 gene az1 CDS complement(43686..44975) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5R4 transl_table 11 codon_start 1 locus_tag LOCUS_36290 gene hemL CDS complement(44992..45618) product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5R7 transl_table 11 codon_start 1 locus_tag LOCUS_36300 gene thiE CDS 45653..45877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36310 CDS complement(45926..46777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038369.1 transl_table 11 codon_start 1 locus_tag LOCUS_36320 CDS complement(46954..47397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038368.1 transl_table 11 codon_start 1 locus_tag LOCUS_36330 CDS complement(47418..48065) product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5S1 transl_table 11 codon_start 1 locus_tag LOCUS_36340 gene rpiA CDS complement(48088..48567) product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038366.1 transl_table 11 codon_start 1 locus_tag LOCUS_36350 CDS complement(48564..49157) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5S3 transl_table 11 codon_start 1 locus_tag LOCUS_36360 CDS complement(49524..49820) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5S4 transl_table 11 codon_start 1 locus_tag LOCUS_36370 CDS complement(49817..50038) product TIGR02449 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038363.1 transl_table 11 codon_start 1 locus_tag LOCUS_36380 CDS 49931..50197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36390 CDS 50190..50738 product UPF0149 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5S6 transl_table 11 codon_start 1 locus_tag LOCUS_36400 CDS 50738..52066 product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038361.1 transl_table 11 codon_start 1 locus_tag LOCUS_36410 gene pepP sequence37 source 1..50578 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 295..2760 product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAB5 transl_table 11 codon_start 1 locus_tag LOCUS_36420 gene ligA CDS 2810..3295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36430 CDS 3292..4248 product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAB4 transl_table 11 codon_start 1 locus_tag LOCUS_36440 gene lysS CDS 4376..5116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036754.1 transl_table 11 codon_start 1 locus_tag LOCUS_36450 CDS 5164..6228 product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAB2 transl_table 11 codon_start 1 locus_tag LOCUS_36460 gene mtnA CDS 6449..9163 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAB1 transl_table 11 codon_start 1 locus_tag LOCUS_36470 gene gyrA CDS 9294..11846 product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036757.1 transl_table 11 codon_start 1 locus_tag LOCUS_36480 gene gcd CDS complement(11854..12843) product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967019.1 transl_table 11 codon_start 1 locus_tag LOCUS_36490 CDS 12962..13867 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388220.1 transl_table 11 codon_start 1 locus_tag LOCUS_36500 CDS 13916..14401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36510 CDS 14465..15895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36520 CDS complement(15905..16297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142760.1 transl_table 11 codon_start 1 locus_tag LOCUS_36530 CDS complement(16275..17051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142761.1 transl_table 11 codon_start 1 locus_tag LOCUS_36540 CDS 17511..17840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36550 CDS 18010..20472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920521.1 transl_table 11 codon_start 1 locus_tag LOCUS_36560 CDS 20583..21350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36570 CDS 21469..21789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36580 CDS complement(21803..22786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122551.1 transl_table 11 codon_start 1 locus_tag LOCUS_36590 CDS 22924..23889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36600 CDS 23981..24748 product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107331.1 transl_table 11 codon_start 1 locus_tag LOCUS_36610 CDS complement(24696..25565) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707685.1 transl_table 11 codon_start 1 locus_tag LOCUS_36620 CDS 25671..26804 product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707684.1 transl_table 11 codon_start 1 locus_tag LOCUS_36630 CDS complement(26811..27356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36640 CDS 27330..28001 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401168.1 transl_table 11 codon_start 1 locus_tag LOCUS_36650 CDS 28054..28437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36660 CDS complement(28619..30727) product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973814.1 transl_table 11 codon_start 1 locus_tag LOCUS_36670 CDS complement(30924..32360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36680 CDS complement(32525..34192) product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58988 transl_table 11 codon_start 1 locus_tag LOCUS_36690 gene hutU CDS complement(34189..35043) product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036760.1 transl_table 11 codon_start 1 locus_tag LOCUS_36700 gene hutG CDS complement(35040..36581) product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAA7 transl_table 11 codon_start 1 locus_tag LOCUS_36710 gene hutH CDS complement(36578..37801) product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAA6 transl_table 11 codon_start 1 locus_tag LOCUS_36720 gene hutI CDS 37869..39239 product N-formimino-L-glutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636952.2 transl_table 11 codon_start 1 locus_tag LOCUS_36730 gene sdeB CDS 39267..39995 product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636953.2 transl_table 11 codon_start 1 locus_tag LOCUS_36740 gene hutC CDS complement(40097..41086) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036765.1 transl_table 11 codon_start 1 locus_tag LOCUS_36750 CDS complement(41325..41816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36760 CDS complement(41897..42172) product polyhydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036767.1 transl_table 11 codon_start 1 locus_tag LOCUS_36770 CDS 42298..43104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636956.2 transl_table 11 codon_start 1 locus_tag LOCUS_36780 CDS 43357..44442 product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PA97 transl_table 11 codon_start 1 locus_tag LOCUS_36790 gene serC CDS 44494..45693 product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036772.1 transl_table 11 codon_start 1 locus_tag LOCUS_36800 gene pheA CDS 45770..47077 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PA95 transl_table 11 codon_start 1 locus_tag LOCUS_36810 gene aroA CDS complement(47236..47808) product cell envelope biogenesis protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036774.1 transl_table 11 codon_start 1 locus_tag LOCUS_36820 CDS complement(47928..48566) product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036775.1 transl_table 11 codon_start 1 locus_tag LOCUS_36830 CDS 48680..49960 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PA92 transl_table 11 codon_start 1 locus_tag LOCUS_36840 gene serS CDS complement(50141..50491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388136.1 transl_table 11 codon_start 1 locus_tag LOCUS_36850 sequence38 source 1..47534 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 87..1853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037234.1 transl_table 11 codon_start 1 locus_tag LOCUS_36860 CDS complement(2099..2512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037424.1 transl_table 11 codon_start 1 locus_tag LOCUS_36870 CDS complement(2512..2964) product ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637634.2 transl_table 11 codon_start 1 locus_tag LOCUS_36880 CDS 3184..3795 product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C0F8 transl_table 11 codon_start 1 locus_tag LOCUS_36890 gene sodA CDS complement(3774..3962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36900 CDS complement(3997..4845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36910 CDS 5008..6573 product oligopeptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636779.2 transl_table 11 codon_start 1 locus_tag LOCUS_36920 gene ygdR CDS 6581..7207 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036598.1 transl_table 11 codon_start 1 locus_tag LOCUS_36930 CDS complement(7251..7436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36940 CDS 7622..7924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636782.2 transl_table 11 codon_start 1 locus_tag LOCUS_36950 CDS 7958..8842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036601.1 transl_table 11 codon_start 1 locus_tag LOCUS_36960 CDS 8862..9977 product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258479.1 transl_table 11 codon_start 1 locus_tag LOCUS_36970 CDS complement(10067..12205) product dipeptidyl carboxypeptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036603.1 transl_table 11 codon_start 1 locus_tag LOCUS_36980 gene dcp CDS 12366..12845 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAR5 transl_table 11 codon_start 1 locus_tag LOCUS_36990 gene gpo CDS complement(12925..13704) product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036605.1 transl_table 11 codon_start 1 locus_tag LOCUS_37000 gene fpr CDS complement(13784..15661) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036606.1 transl_table 11 codon_start 1 locus_tag LOCUS_37010 gene msbA CDS complement(15810..16280) product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VW5 transl_table 11 codon_start 1 locus_tag LOCUS_37020 CDS complement(16296..17192) product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186174.1 transl_table 11 codon_start 1 locus_tag LOCUS_37030 CDS 17311..18828 product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAR2 transl_table 11 codon_start 1 locus_tag LOCUS_37040 gene fumB CDS 18949..19287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37050 CDS 19345..19980 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036609.1 transl_table 11 codon_start 1 locus_tag LOCUS_37060 gene gst CDS complement(20054..20395) product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92R44 transl_table 11 codon_start 1 locus_tag LOCUS_37070 gene arsC CDS complement(20395..21549) product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036611.1 transl_table 11 codon_start 1 locus_tag LOCUS_37080 CDS complement(21669..22154) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036612.1 transl_table 11 codon_start 1 locus_tag LOCUS_37090 CDS 22390..22599 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003483561.1 transl_table 11 codon_start 1 locus_tag LOCUS_37100 gene cspA CDS complement(22672..23166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036613.1 transl_table 11 codon_start 1 locus_tag LOCUS_37110 gene pcp CDS complement(23302..23736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37120 CDS 23816..24640 product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036615.1 transl_table 11 codon_start 1 locus_tag LOCUS_37130 gene moeB CDS complement(24674..25447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036616.1 transl_table 11 codon_start 1 locus_tag LOCUS_37140 CDS complement(25444..25659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036617.1 transl_table 11 codon_start 1 locus_tag LOCUS_37150 CDS 25823..26668 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036618.1 transl_table 11 codon_start 1 locus_tag LOCUS_37160 CDS 26799..27341 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918215.1 transl_table 11 codon_start 1 locus_tag LOCUS_37170 CDS 27401..28174 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036621.1 transl_table 11 codon_start 1 locus_tag LOCUS_37180 gene gst CDS 28237..30516 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728359.1 transl_table 11 codon_start 1 locus_tag LOCUS_37190 CDS 30538..32463 product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036622.1 transl_table 11 codon_start 1 locus_tag LOCUS_37200 gene wbpS CDS 32530..33090 product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036623.1 transl_table 11 codon_start 1 locus_tag LOCUS_37210 CDS 33304..34734 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAP5 transl_table 11 codon_start 1 locus_tag LOCUS_37220 gene dnaB CDS 34909..37152 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639569.2 transl_table 11 codon_start 1 locus_tag LOCUS_37230 gene fecA CDS 37152..38741 product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140493.1 transl_table 11 codon_start 1 locus_tag LOCUS_37240 CDS 38910..39122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37250 CDS 39128..39370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37260 CDS complement(39484..40920) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAJ8 transl_table 11 codon_start 1 locus_tag LOCUS_37270 gene ldp CDS complement(40984..42183) product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAJ7 transl_table 11 codon_start 1 locus_tag LOCUS_37280 gene sucB CDS complement(42224..45055) product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636859.2 transl_table 11 codon_start 1 locus_tag LOCUS_37290 gene sucA CDS complement(45242..46138) product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036674.1 transl_table 11 codon_start 1 locus_tag LOCUS_37300 misc_feature complement(46148..>47534) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036675.1:transcriptional regulator locus_tag LOCUS_37310 sequence39 source 1..47387 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(48..1067) product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942561.1 transl_table 11 codon_start 1 locus_tag LOCUS_37320 CDS 1253..3976 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207266.1 transl_table 11 codon_start 1 locus_tag LOCUS_37330 gene btuB CDS complement(4483..5574) product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC60 transl_table 11 codon_start 1 locus_tag LOCUS_37340 gene ychF CDS complement(5726..6304) product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC61 transl_table 11 codon_start 1 locus_tag LOCUS_37350 gene pth CDS complement(6353..6970) product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC62 transl_table 11 codon_start 1 locus_tag LOCUS_37360 gene rplY CDS complement(7080..8087) product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC63 transl_table 11 codon_start 1 locus_tag LOCUS_37370 gene prs tRNA complement(8180..8256) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS complement(8268..9137) product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC64 transl_table 11 codon_start 1 locus_tag LOCUS_37380 gene ispE CDS complement(9134..9793) product outer-membrane lipoprotein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC65 transl_table 11 codon_start 1 locus_tag LOCUS_37390 gene lolB CDS complement(9790..11475) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036105.1 transl_table 11 codon_start 1 locus_tag LOCUS_37400 CDS 11539..12822 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC67 transl_table 11 codon_start 1 locus_tag LOCUS_37410 gene hemA CDS 12800..13882 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC68 transl_table 11 codon_start 1 locus_tag LOCUS_37420 gene prfA CDS 13888..15594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036102.1 transl_table 11 codon_start 1 locus_tag LOCUS_37430 CDS 15641..16423 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036100.1 transl_table 11 codon_start 1 locus_tag LOCUS_37440 CDS complement(16986..17558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37450 CDS complement(17555..18829) product UPF0761 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC75 transl_table 11 codon_start 1 locus_tag LOCUS_37460 CDS 18907..19500 product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC76 transl_table 11 codon_start 1 locus_tag LOCUS_37470 CDS 19497..19832 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036094.1 transl_table 11 codon_start 1 locus_tag LOCUS_37480 CDS 19903..20397 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036092.1 transl_table 11 codon_start 1 locus_tag LOCUS_37490 gene aspG CDS complement(20486..22225) product extracellular protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23314 transl_table 11 codon_start 1 locus_tag LOCUS_37500 CDS complement(22604..23626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37510 CDS complement(23628..23963) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403775.1 transl_table 11 codon_start 1 locus_tag LOCUS_37520 CDS complement(23960..24616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37530 CDS complement(24785..25879) product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC84 transl_table 11 codon_start 1 locus_tag LOCUS_37540 gene ilvE CDS complement(25939..26436) product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036085.1 transl_table 11 codon_start 1 locus_tag LOCUS_37550 CDS 26613..27032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036084.1 transl_table 11 codon_start 1 locus_tag LOCUS_37560 CDS complement(27522..28982) product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLT5 transl_table 11 codon_start 1 locus_tag LOCUS_37570 CDS complement(28979..29299) product NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227778.1 transl_table 11 codon_start 1 locus_tag LOCUS_37580 CDS 29428..29982 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036083.1 transl_table 11 codon_start 1 locus_tag LOCUS_37590 CDS 29979..30305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37600 CDS 30310..30771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37610 CDS complement(30835..31914) product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223977.1 transl_table 11 codon_start 1 locus_tag LOCUS_37620 gene pntA CDS complement(31966..34287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636233.2 transl_table 11 codon_start 1 locus_tag LOCUS_37630 CDS 34601..35200 product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036076.1 transl_table 11 codon_start 1 locus_tag LOCUS_37640 CDS 35197..36132 product exodeoxyribonuclease IX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036075.1 transl_table 11 codon_start 1 locus_tag LOCUS_37650 gene exo CDS 36129..36683 product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036074.1 transl_table 11 codon_start 1 locus_tag LOCUS_37660 CDS 36676..37512 product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036073.1 transl_table 11 codon_start 1 locus_tag LOCUS_37670 CDS complement(37575..38990) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114873.1 transl_table 11 codon_start 1 locus_tag LOCUS_37680 CDS 39096..39980 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114872.1 transl_table 11 codon_start 1 locus_tag LOCUS_37690 CDS complement(40053..40994) product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC98 transl_table 11 codon_start 1 locus_tag LOCUS_37700 gene pip CDS complement(41043..41900) product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC99 transl_table 11 codon_start 1 locus_tag LOCUS_37710 gene prmC CDS 42223..42786 product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083828.1 transl_table 11 codon_start 1 locus_tag LOCUS_37720 gene ahpC CDS 43012..44604 product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036069.1 transl_table 11 codon_start 1 locus_tag LOCUS_37730 gene ahpF CDS 44690..45655 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036068.1 transl_table 11 codon_start 1 locus_tag LOCUS_37740 gene oxyR CDS 45779..46183 product regulator of nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636222.2 transl_table 11 codon_start 1 locus_tag LOCUS_37750 gene rnk CDS 46234..47190 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCA4 transl_table 11 codon_start 1 locus_tag LOCUS_37760 gene tal sequence40 source 1..46501 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2313..2696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010365266.1 transl_table 11 codon_start 1 locus_tag LOCUS_37770 CDS complement(2833..3324) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037040.1 transl_table 11 codon_start 1 locus_tag LOCUS_37780 gene cheW CDS complement(3507..4280) product flagellar brake protein YcgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9J1 transl_table 11 codon_start 1 locus_tag LOCUS_37790 gene ycgR CDS complement(4484..6733) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037048.1 transl_table 11 codon_start 1 locus_tag LOCUS_37800 gene tsr CDS complement(7116..9107) product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037054.1 transl_table 11 codon_start 1 locus_tag LOCUS_37810 gene cheA CDS complement(9153..9518) product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806565.1 transl_table 11 codon_start 1 locus_tag LOCUS_37820 gene cheY CDS complement(9515..9823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037055.1 transl_table 11 codon_start 1 locus_tag LOCUS_37830 CDS complement(9905..11128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37840 CDS complement(11125..11907) product chromosome partioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637254.2 transl_table 11 codon_start 1 locus_tag LOCUS_37850 gene parA CDS complement(11912..12928) product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037058.1 transl_table 11 codon_start 1 locus_tag LOCUS_37860 gene motB CDS complement(12930..13670) product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037059.1 transl_table 11 codon_start 1 locus_tag LOCUS_37870 gene motC CDS complement(13772..15598) product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037070.1 transl_table 11 codon_start 1 locus_tag LOCUS_37880 gene cheA CDS complement(15601..16206) product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037071.1 transl_table 11 codon_start 1 locus_tag LOCUS_37890 gene cheZ CDS complement(16206..16598) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005996243.1 transl_table 11 codon_start 1 locus_tag LOCUS_37900 gene cheY CDS complement(16656..17399) product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9F9 transl_table 11 codon_start 1 locus_tag LOCUS_37910 gene fliA CDS complement(17396..18283) product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037073.1 transl_table 11 codon_start 1 locus_tag LOCUS_37920 gene fleN CDS complement(18270..19958) product flagellar biosynthesis regulator FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037074.1 transl_table 11 codon_start 1 locus_tag LOCUS_37930 gene flhF CDS complement(20038..22146) product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037075.1 transl_table 11 codon_start 1 locus_tag LOCUS_37940 gene flhA CDS complement(22143..23273) product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037076.1 transl_table 11 codon_start 1 locus_tag LOCUS_37950 gene flhB CDS complement(23412..25544) product putative signaling protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I310 transl_table 11 codon_start 1 locus_tag LOCUS_37960 CDS complement(25710..26501) product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9F1 transl_table 11 codon_start 1 locus_tag LOCUS_37970 gene fliR CDS complement(26515..26784) product flagellar biosynthesis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037081.1 transl_table 11 codon_start 1 locus_tag LOCUS_37980 gene fliQ CDS complement(26869..27648) product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9E9 transl_table 11 codon_start 1 locus_tag LOCUS_37990 gene fliP CDS complement(27650..28069) product flagellar protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9E8 transl_table 11 codon_start 1 locus_tag LOCUS_38000 gene fliO CDS complement(28066..28401) product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9E7 transl_table 11 codon_start 1 locus_tag LOCUS_38010 gene fliN CDS complement(28398..29402) product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9E6 transl_table 11 codon_start 1 locus_tag LOCUS_38020 gene fliM CDS complement(29413..29928) product flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037086.1 transl_table 11 codon_start 1 locus_tag LOCUS_38030 gene fliL CDS complement(30169..31323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38040 CDS complement(31323..31790) product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037088.1 transl_table 11 codon_start 1 locus_tag LOCUS_38050 gene fliJ CDS complement(31794..33191) product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037089.1 transl_table 11 codon_start 1 locus_tag LOCUS_38060 gene fliI CDS complement(33188..33826) product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037090.1 transl_table 11 codon_start 1 locus_tag LOCUS_38070 gene fliH CDS complement(33823..34824) product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9E0 transl_table 11 codon_start 1 locus_tag LOCUS_38080 gene fliG CDS complement(34817..36460) product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9D9 transl_table 11 codon_start 1 locus_tag LOCUS_38090 gene fliF CDS complement(36474..36842) product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9D8 transl_table 11 codon_start 1 locus_tag LOCUS_38100 gene fliE CDS complement(37328..37744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38110 CDS complement(37917..39422) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037099.1 transl_table 11 codon_start 1 locus_tag LOCUS_38120 gene fleQ CDS complement(39419..39796) product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005997154.1 transl_table 11 codon_start 1 locus_tag LOCUS_38130 CDS complement(39811..41220) product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9D0 transl_table 11 codon_start 1 locus_tag LOCUS_38140 gene rpoN CDS complement(41491..42123) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037101.1 transl_table 11 codon_start 1 locus_tag LOCUS_38150 CDS complement(42216..42794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38160 CDS complement(42791..43084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38170 CDS complement(43081..43497) product flagellar protein FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9C6 transl_table 11 codon_start 1 locus_tag LOCUS_38180 gene fliS CDS complement(43626..45044) product flagellar hook-associated protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CIC9 transl_table 11 codon_start 1 locus_tag LOCUS_38190 gene fliD misc_feature complement(45486..>46501) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P9C4:flagellin locus_tag LOCUS_38200 sequence41 source 1..43523 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(2..78) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 tRNA complement(111..187) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 tRNA complement(257..333) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 CDS complement(324..1250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036908.1 transl_table 11 codon_start 1 locus_tag LOCUS_38210 CDS complement(1247..2056) product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036909.1 transl_table 11 codon_start 1 locus_tag LOCUS_38220 gene thiD CDS complement(2121..2789) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462033.1 transl_table 11 codon_start 1 locus_tag LOCUS_38230 CDS complement(2802..3308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637103.2 transl_table 11 codon_start 1 locus_tag LOCUS_38240 CDS complement(3305..4705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637104.2 transl_table 11 codon_start 1 locus_tag LOCUS_38250 CDS complement(4790..5269) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036912.1 transl_table 11 codon_start 1 locus_tag LOCUS_38260 CDS complement(5361..5921) product glycine cleavage system transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036914.1 transl_table 11 codon_start 1 locus_tag LOCUS_38270 gene gcvR CDS 6086..6979 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9V6 transl_table 11 codon_start 1 locus_tag LOCUS_38280 gene dapA CDS 7012..7527 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036916.1 transl_table 11 codon_start 1 locus_tag LOCUS_38290 CDS complement(7726..8049) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036917.1 transl_table 11 codon_start 1 locus_tag LOCUS_38300 CDS 8241..9665 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036933.1 transl_table 11 codon_start 1 locus_tag LOCUS_38310 gene xylE tRNA 9248..9333 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 tRNA complement(10046..10120) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 CDS 10167..11552 product poly(A) polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9T2 transl_table 11 codon_start 1 locus_tag LOCUS_38320 gene pcnB CDS 11556..12041 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036940.1 transl_table 11 codon_start 1 locus_tag LOCUS_38330 CDS 12076..12891 product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9T0 transl_table 11 codon_start 1 locus_tag LOCUS_38340 gene panB CDS 12888..13727 product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9S9 transl_table 11 codon_start 1 locus_tag LOCUS_38350 gene panC CDS 13794..14297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38360 CDS 14385..14765 product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9S8 transl_table 11 codon_start 1 locus_tag LOCUS_38370 gene panD CDS 14762..16276 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9S7 transl_table 11 codon_start 1 locus_tag LOCUS_38380 gene pgi CDS 16558..16764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38390 CDS 16845..19745 product lanthionine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226577.1 transl_table 11 codon_start 1 locus_tag LOCUS_38400 CDS complement(19767..20336) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036952.1 transl_table 11 codon_start 1 locus_tag LOCUS_38410 gene regR CDS complement(20333..21559) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036953.1 transl_table 11 codon_start 1 locus_tag LOCUS_38420 gene regS CDS 21674..22939 product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9R7 transl_table 11 codon_start 1 locus_tag LOCUS_38430 gene ispG CDS 22920..23669 product phosphatidylglycerophosphatase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036955.1 transl_table 11 codon_start 1 locus_tag LOCUS_38440 CDS 23870..24517 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037241.1 transl_table 11 codon_start 1 locus_tag LOCUS_38450 gene gacA CDS complement(24807..25466) product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037291.1 transl_table 11 codon_start 1 locus_tag LOCUS_38460 gene eda CDS complement(25702..27618) product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037290.1 transl_table 11 codon_start 1 locus_tag LOCUS_38470 gene edd CDS complement(27677..28399) product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037289.1 transl_table 11 codon_start 1 locus_tag LOCUS_38480 gene pgl CDS complement(28396..29403) product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8U7 transl_table 11 codon_start 1 locus_tag LOCUS_38490 gene glk CDS complement(29400..30836) product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8U8 transl_table 11 codon_start 1 locus_tag LOCUS_38500 gene zwf CDS 31190..32272 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037286.1 transl_table 11 codon_start 1 locus_tag LOCUS_38510 gene ugpC CDS complement(32400..33275) product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037285.1 transl_table 11 codon_start 1 locus_tag LOCUS_38520 CDS 33602..33934 product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083343.1 transl_table 11 codon_start 1 locus_tag LOCUS_38530 gene sdhC CDS 33931..34317 product succinate dehydrogenase membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037282.1 transl_table 11 codon_start 1 locus_tag LOCUS_38540 gene sdhD CDS 34349..36139 product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8V4 transl_table 11 codon_start 1 locus_tag LOCUS_38550 gene sdhA CDS 36206..36991 product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8V5 transl_table 11 codon_start 1 locus_tag LOCUS_38560 gene sdhB CDS 37065..37313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8V6 transl_table 11 codon_start 1 locus_tag LOCUS_38570 CDS 37264..37713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38580 CDS 37737..38978 product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037277.1 transl_table 11 codon_start 1 locus_tag LOCUS_38590 gene lolC CDS 38971..39684 product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8V9 transl_table 11 codon_start 1 locus_tag LOCUS_38600 gene lolD CDS 39906..40358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037562.1 transl_table 11 codon_start 1 locus_tag LOCUS_38610 CDS complement(40433..40702) product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P829 transl_table 11 codon_start 1 locus_tag LOCUS_38620 CDS complement(40708..41832) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037560.1 transl_table 11 codon_start 1 locus_tag LOCUS_38630 gene mutY CDS complement(41918..43231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38640 note possible pseudo, internal stop codon, frameshifted sequence42 source 1..41082 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 624..2420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38650 CDS 2423..2989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38660 CDS 3108..3317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38670 CDS 3402..3707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38680 CDS complement(3806..4675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918751.1 transl_table 11 codon_start 1 locus_tag LOCUS_38690 CDS complement(4801..6501) product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIT0 transl_table 11 codon_start 1 locus_tag LOCUS_38700 gene dld CDS complement(6498..7637) product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV37 transl_table 11 codon_start 1 locus_tag LOCUS_38710 gene lldD CDS complement(7642..8406) product transcriptional regulator LldR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636695.1 transl_table 11 codon_start 1 locus_tag LOCUS_38720 CDS complement(8460..10118) product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z2E3 transl_table 11 codon_start 1 locus_tag LOCUS_38730 gene lldP CDS complement(10343..10903) product Mg(2+) transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064951.1 transl_table 11 codon_start 1 locus_tag LOCUS_38740 CDS complement(10918..11676) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971780.1 transl_table 11 codon_start 1 locus_tag LOCUS_38750 CDS 12123..13076 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814017.1 transl_table 11 codon_start 1 locus_tag LOCUS_38760 gene alcR CDS complement(13526..15436) product glutaryl-7-ACA acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 transl_table 11 codon_start 1 locus_tag LOCUS_38770 gene gaa CDS complement(15636..16019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38780 CDS complement(16022..17377) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082692.1 transl_table 11 codon_start 1 locus_tag LOCUS_38790 CDS 17483..18379 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082689.1 transl_table 11 codon_start 1 locus_tag LOCUS_38800 CDS complement(18482..21277) product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036595.1 transl_table 11 codon_start 1 locus_tag LOCUS_38810 gene bglS CDS 21616..22050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118992.1 transl_table 11 codon_start 1 locus_tag LOCUS_38820 CDS 22338..23042 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719734.1 transl_table 11 codon_start 1 locus_tag LOCUS_38830 CDS complement(23052..23942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085391.1 transl_table 11 codon_start 1 locus_tag LOCUS_38840 CDS 24074..25024 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268540.1 transl_table 11 codon_start 1 locus_tag LOCUS_38850 CDS 25153..25767 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379308.1 transl_table 11 codon_start 1 locus_tag LOCUS_38860 CDS 25801..26808 product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119474.1 transl_table 11 codon_start 1 locus_tag LOCUS_38870 CDS complement(26899..27096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38880 CDS 27028..27642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762447.1 transl_table 11 codon_start 1 locus_tag LOCUS_38890 CDS 27652..29061 product DNA repair nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104196.1 transl_table 11 codon_start 1 locus_tag LOCUS_38900 CDS 29068..32178 product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q881T7 transl_table 11 codon_start 1 locus_tag LOCUS_38910 gene dnaE2 CDS 32260..32766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38920 CDS complement(32866..34152) product transcriptional regulator PtsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063850.1 transl_table 11 codon_start 1 locus_tag LOCUS_38930 CDS 34229..35002 product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811326.1 transl_table 11 codon_start 1 locus_tag LOCUS_38940 CDS 34999..35700 product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391259.1 transl_table 11 codon_start 1 locus_tag LOCUS_38950 CDS 35697..35921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38960 CDS 36070..36579 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114482.1 transl_table 11 codon_start 1 locus_tag LOCUS_38970 CDS 36576..37502 product iron dicitrate transporter FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389193.1 transl_table 11 codon_start 1 locus_tag LOCUS_38980 CDS 37567..40038 product hemin receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708869.1 transl_table 11 codon_start 1 locus_tag LOCUS_38990 CDS 40025..40825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113451.1 transl_table 11 codon_start 1 locus_tag LOCUS_39000 sequence43 source 1..38929 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(123..638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038686.1 transl_table 11 codon_start 1 locus_tag LOCUS_39010 CDS complement(674..1525) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038687.1 transl_table 11 codon_start 1 locus_tag LOCUS_39020 CDS complement(1574..1801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39030 CDS complement(1956..2915) product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038688.1 transl_table 11 codon_start 1 locus_tag LOCUS_39040 CDS 3042..3632 product putative NADH dehydrogenase/NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4V1 transl_table 11 codon_start 1 locus_tag LOCUS_39050 CDS 3708..4424 product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038690.1 transl_table 11 codon_start 1 locus_tag LOCUS_39060 CDS complement(4625..5026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39070 CDS 5177..6010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39080 CDS complement(6392..7189) product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038691.1 transl_table 11 codon_start 1 locus_tag LOCUS_39090 gene mxcB CDS complement(7250..7810) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038692.1 transl_table 11 codon_start 1 locus_tag LOCUS_39100 CDS 8356..11043 product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4T1 transl_table 11 codon_start 1 locus_tag LOCUS_39110 gene aceE CDS 11106..14144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39120 CDS complement(14406..14774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39130 CDS 14722..14937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39140 CDS complement(15229..15654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39150 CDS 15888..17033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550675.1 transl_table 11 codon_start 1 locus_tag LOCUS_39160 gene yncE CDS 17187..18101 product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530589.1 transl_table 11 codon_start 1 locus_tag LOCUS_39170 CDS complement(18160..18843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39180 CDS 19738..21591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39190 CDS 21588..22265 product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266570.1 transl_table 11 codon_start 1 locus_tag LOCUS_39200 CDS complement(22344..22823) product DUF4440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918775.1 transl_table 11 codon_start 1 locus_tag LOCUS_39210 CDS 23044..23856 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383500.1 transl_table 11 codon_start 1 locus_tag LOCUS_39220 CDS 23866..24039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036510.1 transl_table 11 codon_start 1 locus_tag LOCUS_39230 CDS 24180..24854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39240 CDS complement(24851..25993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39250 CDS 26094..27062 product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947709.1 transl_table 11 codon_start 1 locus_tag LOCUS_39260 CDS complement(27182..27787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39270 CDS 27671..27997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39280 CDS complement(28099..29025) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038631.1 transl_table 11 codon_start 1 locus_tag LOCUS_39290 CDS complement(29022..29438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39300 CDS 29530..29814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39310 CDS complement(29811..30185) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035511.1 transl_table 11 codon_start 1 locus_tag LOCUS_39320 CDS 30255..31580 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035512.1 transl_table 11 codon_start 1 locus_tag LOCUS_39330 CDS complement(31652..33259) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895566.1 transl_table 11 codon_start 1 locus_tag LOCUS_39340 CDS complement(33423..34322) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113086.1 transl_table 11 codon_start 1 locus_tag LOCUS_39350 CDS 34473..35729 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526239.1 transl_table 11 codon_start 1 locus_tag LOCUS_39360 CDS 35726..36910 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188971.1 transl_table 11 codon_start 1 locus_tag LOCUS_39370 CDS complement(37223..38839) product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038952.1 transl_table 11 codon_start 1 locus_tag LOCUS_39380 sequence44 source 1..36804 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(500..2674) product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038895.1 transl_table 11 codon_start 1 locus_tag LOCUS_39390 gene bglX CDS complement(2803..4074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103754.1 transl_table 11 codon_start 1 locus_tag LOCUS_39400 CDS complement(4162..4515) product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P495 transl_table 11 codon_start 1 locus_tag LOCUS_39410 gene folB CDS complement(4933..5262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39420 CDS 5336..5539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39430 CDS complement(5596..6579) product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P494 transl_table 11 codon_start 1 locus_tag LOCUS_39440 gene tsaD CDS 6788..7003 product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66536 transl_table 11 codon_start 1 locus_tag LOCUS_39450 gene rpsU CDS 7137..7583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038898.1 transl_table 11 codon_start 1 locus_tag LOCUS_39460 CDS complement(7662..8591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39470 CDS 8883..9731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038899.1 transl_table 11 codon_start 1 locus_tag LOCUS_39480 gene rbn CDS 9792..11531 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P491 transl_table 11 codon_start 1 locus_tag LOCUS_39490 gene dnaG CDS 11559..12059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038901.1 transl_table 11 codon_start 1 locus_tag LOCUS_39500 CDS 12088..13059 product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038902.1 transl_table 11 codon_start 1 locus_tag LOCUS_39510 CDS complement(13153..13755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39520 CDS complement(13902..14201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39530 CDS complement(14541..15362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39540 CDS complement(15508..16401) product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P487 transl_table 11 codon_start 1 locus_tag LOCUS_39550 gene cyoE CDS complement(16406..17569) product cytochrome oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038905.1 transl_table 11 codon_start 1 locus_tag LOCUS_39560 CDS complement(17580..18149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038906.1 transl_table 11 codon_start 1 locus_tag LOCUS_39570 CDS complement(18258..18971) product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P484 transl_table 11 codon_start 1 locus_tag LOCUS_39580 CDS 19032..19250 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038908.1 transl_table 11 codon_start 1 locus_tag LOCUS_39590 CDS complement(19271..20146) product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038909.1 transl_table 11 codon_start 1 locus_tag LOCUS_39600 gene cox3 CDS complement(20160..20750) product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038910.1 transl_table 11 codon_start 1 locus_tag LOCUS_39610 gene cox11 CDS complement(20747..21016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39620 CDS complement(21025..22632) product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P479 transl_table 11 codon_start 1 locus_tag LOCUS_39630 gene ctaD CDS complement(22695..23516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39640 CDS 23467..23649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39650 CDS complement(23654..24130) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038914.1 transl_table 11 codon_start 1 locus_tag LOCUS_39660 CDS 24366..27623 product bifunctional protein PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P476 transl_table 11 codon_start 1 locus_tag LOCUS_39670 gene putA CDS complement(27679..28260) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088324.1 transl_table 11 codon_start 1 locus_tag LOCUS_39680 CDS complement(28368..29795) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035275.1 transl_table 11 codon_start 1 locus_tag LOCUS_39690 gene ompP1 CDS 30021..30713 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035276.1 transl_table 11 codon_start 1 locus_tag LOCUS_39700 CDS complement(30781..32241) product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035279.1 transl_table 11 codon_start 1 locus_tag LOCUS_39710 gene ctp CDS complement(32350..33648) product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035280.1 transl_table 11 codon_start 1 locus_tag LOCUS_39720 CDS 33744..34406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035281.1 transl_table 11 codon_start 1 locus_tag LOCUS_39730 CDS 34491..36200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 transl_table 11 codon_start 1 locus_tag LOCUS_39740 rRNA complement(36460..36564) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 sequence45 source 1..33451 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(61..2703) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038446.1 transl_table 11 codon_start 1 locus_tag LOCUS_39750 CDS complement(2770..3936) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038445.1 transl_table 11 codon_start 1 locus_tag LOCUS_39760 gene oprO CDS 3942..4091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39770 CDS 4266..5609 product C4-dicarboxylate transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5J5 transl_table 11 codon_start 1 locus_tag LOCUS_39780 gene dctA CDS 5840..8131 product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638691.2 transl_table 11 codon_start 1 locus_tag LOCUS_39790 gene maeB CDS complement(8551..9285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39800 CDS complement(9291..12635) product alpha-1,2-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638688.2 transl_table 11 codon_start 1 locus_tag LOCUS_39810 CDS 13012..13209 product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038440.1 transl_table 11 codon_start 1 locus_tag LOCUS_39820 CDS 13225..14340 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038439.1 transl_table 11 codon_start 1 locus_tag LOCUS_39830 CDS 14321..15652 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038438.1 transl_table 11 codon_start 1 locus_tag LOCUS_39840 CDS 15789..16238 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247110.1 transl_table 11 codon_start 1 locus_tag LOCUS_39850 CDS complement(16281..17198) product lipid A biosynthesis lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5K2 transl_table 11 codon_start 1 locus_tag LOCUS_39860 gene htrB CDS 17259..18557 product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038436.1 transl_table 11 codon_start 1 locus_tag LOCUS_39870 gene kdtA CDS 18799..20025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39880 CDS complement(20124..21482) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038435.1 transl_table 11 codon_start 1 locus_tag LOCUS_39890 gene tolC CDS complement(21499..22146) product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038434.1 transl_table 11 codon_start 1 locus_tag LOCUS_39900 gene pcm CDS complement(22283..22963) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038433.1 transl_table 11 codon_start 1 locus_tag LOCUS_39910 CDS 23089..24216 product resistance-nodulation-cell division efflux membrane fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113855.1 transl_table 11 codon_start 1 locus_tag LOCUS_39920 CDS 24221..27382 product resistance-nodulation-cell division efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092464.1 transl_table 11 codon_start 1 locus_tag LOCUS_39930 CDS complement(27466..28371) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973782.1 transl_table 11 codon_start 1 locus_tag LOCUS_39940 gene gstR CDS 28489..29262 product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973781.1 transl_table 11 codon_start 1 locus_tag LOCUS_39950 gene sdhX CDS complement(29508..30569) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAR7 transl_table 11 codon_start 1 locus_tag LOCUS_39960 gene leuB CDS complement(30559..31137) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC30 transl_table 11 codon_start 1 locus_tag LOCUS_39970 gene leuD CDS complement(31137..32555) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC29 transl_table 11 codon_start 1 locus_tag LOCUS_39980 gene leuC CDS complement(32616..33395) product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887149.1 transl_table 11 codon_start 1 locus_tag LOCUS_39990 sequence46 source 1..31196 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(310..1341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40000 CDS 1430..2764 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551357.1 transl_table 11 codon_start 1 locus_tag LOCUS_40010 CDS 2892..5162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40020 CDS 5200..6069 product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9J5 transl_table 11 codon_start 1 locus_tag LOCUS_40030 gene cheR CDS 6066..6662 product putative chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9J6 transl_table 11 codon_start 1 locus_tag LOCUS_40040 gene cheD CDS 6659..7732 product chemotaxis response regulator protein-glutamate methylesterase of group 1 operon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9J7 transl_table 11 codon_start 1 locus_tag LOCUS_40050 gene cheB1 CDS 7817..9814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40060 CDS complement(9884..10309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40070 CDS complement(10427..13030) product aconitate hydratase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9K0 transl_table 11 codon_start 1 locus_tag LOCUS_40080 gene acnB CDS complement(13075..13476) product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9K1 transl_table 11 codon_start 1 locus_tag LOCUS_40090 gene vapC CDS complement(13480..13704) product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037031.1 transl_table 11 codon_start 1 locus_tag LOCUS_40100 CDS 14006..16759 product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9K3 transl_table 11 codon_start 1 locus_tag LOCUS_40110 gene rpfA CDS complement(16911..18461) product choline transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206021.1 transl_table 11 codon_start 1 locus_tag LOCUS_40120 gene betT CDS 18632..19222 product HTH-type transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTJ0 transl_table 11 codon_start 1 locus_tag LOCUS_40130 gene betI CDS 19262..20734 product NAD/NADP-dependent betaine aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG77 transl_table 11 codon_start 1 locus_tag LOCUS_40140 gene betB CDS 20836..22518 product oxygen-dependent choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTJ2 transl_table 11 codon_start 1 locus_tag LOCUS_40150 gene betA CDS 22777..24453 product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037028.1 transl_table 11 codon_start 1 locus_tag LOCUS_40160 gene rpfB CDS 24653..25522 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037027.1 transl_table 11 codon_start 1 locus_tag LOCUS_40170 gene rpfF CDS complement(25535..28258) product sensory/regulatory protein RpfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C0F6 transl_table 11 codon_start 1 locus_tag LOCUS_40180 gene rpfC CDS complement(28260..29273) product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037024.1 transl_table 11 codon_start 1 locus_tag LOCUS_40190 gene rpfG CDS complement(29617..31128) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L3G6 transl_table 11 codon_start 1 locus_tag LOCUS_40200 gene lysS sequence47 source 1..30130 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 122..1870 product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCB3 transl_table 11 codon_start 1 locus_tag LOCUS_40210 gene glnS CDS 1914..2576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40220 CDS 2626..3348 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40230 CDS 3446..4006 product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036053.1 transl_table 11 codon_start 1 locus_tag LOCUS_40240 CDS 3990..5057 product ribosomal RNA large subunit methyltransferase M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCB8 transl_table 11 codon_start 1 locus_tag LOCUS_40250 gene rlmM CDS 5107..5502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40260 CDS complement(5619..6800) product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036035.1 transl_table 11 codon_start 1 locus_tag LOCUS_40270 gene visC CDS complement(6797..8005) product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036034.1 transl_table 11 codon_start 1 locus_tag LOCUS_40280 gene ubiH CDS 8113..8697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036033.1 transl_table 11 codon_start 1 locus_tag LOCUS_40290 CDS 8706..9260 product ATP--cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036032.1 transl_table 11 codon_start 1 locus_tag LOCUS_40300 CDS 9270..10208 product acetoin utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036031.1 transl_table 11 codon_start 1 locus_tag LOCUS_40310 CDS 10256..12796 product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCE0 transl_table 11 codon_start 1 locus_tag LOCUS_40320 gene lptD CDS 12793..14136 product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCE1 transl_table 11 codon_start 1 locus_tag LOCUS_40330 gene surA CDS 14140..15120 product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCE2 transl_table 11 codon_start 1 locus_tag LOCUS_40340 gene pdxA CDS 15117..15920 product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCE3 transl_table 11 codon_start 1 locus_tag LOCUS_40350 gene rsmA CDS 15934..16317 product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCE4 transl_table 11 codon_start 1 locus_tag LOCUS_40360 gene apaG CDS 16333..17352 product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCE5 transl_table 11 codon_start 1 locus_tag LOCUS_40370 gene apaH CDS 17352..17996 product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104401.1 transl_table 11 codon_start 1 locus_tag LOCUS_40380 CDS complement(18074..18565) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCE6 transl_table 11 codon_start 1 locus_tag LOCUS_40390 gene folA CDS complement(18571..19365) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCE7 transl_table 11 codon_start 1 locus_tag LOCUS_40400 gene thyA CDS complement(19362..20249) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCE8 transl_table 11 codon_start 1 locus_tag LOCUS_40410 gene lgt CDS complement(20301..20795) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036021.1 transl_table 11 codon_start 1 locus_tag LOCUS_40420 CDS complement(20795..21475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40430 CDS complement(21479..22099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036019.1 transl_table 11 codon_start 1 locus_tag LOCUS_40440 CDS complement(22655..23815) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811192.1 transl_table 11 codon_start 1 locus_tag LOCUS_40450 CDS complement(24012..24761) product UPF0053 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43932 transl_table 11 codon_start 1 locus_tag LOCUS_40460 CDS complement(24795..25241) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036018.1 transl_table 11 codon_start 1 locus_tag LOCUS_40470 gene dgkA CDS 25370..26104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036017.1 transl_table 11 codon_start 1 locus_tag LOCUS_40480 CDS complement(26239..27510) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036016.1 transl_table 11 codon_start 1 locus_tag LOCUS_40490 gene colS CDS complement(27667..28380) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036015.1 transl_table 11 codon_start 1 locus_tag LOCUS_40500 gene colR CDS complement(28468..29112) product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036014.1 transl_table 11 codon_start 1 locus_tag LOCUS_40510 gene tesA CDS 29105..29836 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036013.1 transl_table 11 codon_start 1 locus_tag LOCUS_40520 gene ftsE sequence48 source 1..29856 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1889 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001883956.1:hydrolase locus_tag LOCUS_40530 CDS 1909..3054 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816230.1 transl_table 11 codon_start 1 locus_tag LOCUS_40540 CDS 3047..3904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813227.1 transl_table 11 codon_start 1 locus_tag LOCUS_40550 CDS complement(3867..5318) product outer membrane efflux lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204730.1 transl_table 11 codon_start 1 locus_tag LOCUS_40560 note possible pseudo, internal stop codon CDS complement(5315..8527) product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038869.1 transl_table 11 codon_start 1 locus_tag LOCUS_40570 gene acrD CDS complement(8524..11649) product transport system membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204974.1 transl_table 11 codon_start 1 locus_tag LOCUS_40580 CDS complement(11649..12797) product transport system membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534674.1 transl_table 11 codon_start 1 locus_tag LOCUS_40590 CDS complement(13001..13483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40600 CDS complement(13768..15129) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7S2 transl_table 11 codon_start 1 locus_tag LOCUS_40610 gene glmM CDS complement(15129..16004) product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7S1 transl_table 11 codon_start 1 locus_tag LOCUS_40620 gene accD CDS complement(16218..17027) product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7S0 transl_table 11 codon_start 1 locus_tag LOCUS_40630 gene trpA CDS complement(17029..17709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40640 CDS complement(17715..18932) product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7R8 transl_table 11 codon_start 1 locus_tag LOCUS_40650 gene trpB CDS 19030..19917 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266143.1 transl_table 11 codon_start 1 locus_tag LOCUS_40660 CDS complement(19945..20601) product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7R6 transl_table 11 codon_start 1 locus_tag LOCUS_40670 gene trpF CDS complement(20598..21368) product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7R5 transl_table 11 codon_start 1 locus_tag LOCUS_40680 gene truA CDS complement(21401..21793) product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037677.1 transl_table 11 codon_start 1 locus_tag LOCUS_40690 CDS complement(21790..23781) product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037678.1 transl_table 11 codon_start 1 locus_tag LOCUS_40700 gene fimV CDS complement(23932..24960) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7R2 transl_table 11 codon_start 1 locus_tag LOCUS_40710 gene asd CDS complement(25052..26089) product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037680.1 transl_table 11 codon_start 1 locus_tag LOCUS_40720 CDS complement(26082..27185) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7R0 transl_table 11 codon_start 1 locus_tag LOCUS_40730 gene aroC CDS complement(27182..28111) product 50S ribosomal protein L3 glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7Q8 transl_table 11 codon_start 1 locus_tag LOCUS_40740 gene prmB CDS 28234..28884 product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037684.1 transl_table 11 codon_start 1 locus_tag LOCUS_40750 CDS 28881..29723 product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7Q6 transl_table 11 codon_start 1 locus_tag LOCUS_40760 gene psd sequence49 source 1..28388 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 168..596 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CLV7 transl_table 11 codon_start 1 locus_tag LOCUS_40770 gene rplM CDS 599..991 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD66 transl_table 11 codon_start 1 locus_tag LOCUS_40780 gene rpsI tRNA complement(1274..1348) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 tRNA complement(1404..1480) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 CDS 1602..2222 product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD65 transl_table 11 codon_start 1 locus_tag LOCUS_40790 gene rppH CDS 2331..2540 product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035730.1 transl_table 11 codon_start 1 locus_tag LOCUS_40800 CDS 2684..3154 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD63 transl_table 11 codon_start 1 locus_tag LOCUS_40810 gene bfr CDS complement(3178..5379) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035732.1 transl_table 11 codon_start 1 locus_tag LOCUS_40820 CDS complement(5381..7267) product two-component system regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635876.2 transl_table 11 codon_start 1 locus_tag LOCUS_40830 CDS complement(7312..7929) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035734.1 transl_table 11 codon_start 1 locus_tag LOCUS_40840 CDS 8109..8852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635878.2 transl_table 11 codon_start 1 locus_tag LOCUS_40850 CDS 8857..9321 product cell shape determination protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035736.1 transl_table 11 codon_start 1 locus_tag LOCUS_40860 CDS 9353..9745 product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD57 transl_table 11 codon_start 1 locus_tag LOCUS_40870 gene erpA CDS 9883..10788 product NADH pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035738.1 transl_table 11 codon_start 1 locus_tag LOCUS_40880 gene nudC CDS 10922..11809 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035739.1 transl_table 11 codon_start 1 locus_tag LOCUS_40890 CDS complement(12401..12826) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035740.1 transl_table 11 codon_start 1 locus_tag LOCUS_40900 CDS complement(12870..13148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40910 CDS complement(13183..13470) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40920 CDS complement(13652..15541) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035742.1 transl_table 11 codon_start 1 locus_tag LOCUS_40930 gene aas CDS complement(15695..16489) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703218.1 transl_table 11 codon_start 1 locus_tag LOCUS_40940 CDS complement(16633..18810) product TIGR01666 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035745.1 transl_table 11 codon_start 1 locus_tag LOCUS_40950 CDS complement(18950..22072) product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038870.1 transl_table 11 codon_start 1 locus_tag LOCUS_40960 gene acrA CDS complement(22104..25337) product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038869.1 transl_table 11 codon_start 1 locus_tag LOCUS_40970 gene acrD CDS complement(25412..26656) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038868.1 transl_table 11 codon_start 1 locus_tag LOCUS_40980 gene mtrC CDS 26789..28162 product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 transl_table 11 codon_start 1 locus_tag LOCUS_40990 gene amaA sequence50 source 1..27264 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..727 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037883.1:membrane protein locus_tag LOCUS_41000 CDS complement(801..1343) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037880.1 transl_table 11 codon_start 1 locus_tag LOCUS_41010 gene tag CDS 1433..1999 product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P765 transl_table 11 codon_start 1 locus_tag LOCUS_41020 CDS 1992..2486 product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P766 transl_table 11 codon_start 1 locus_tag LOCUS_41030 CDS 2503..3453 product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P767 transl_table 11 codon_start 1 locus_tag LOCUS_41040 gene pyrB CDS 3791..4282 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269020.1 transl_table 11 codon_start 1 locus_tag LOCUS_41050 CDS complement(4384..5181) product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037937.1 transl_table 11 codon_start 1 locus_tag LOCUS_41060 CDS complement(5252..5518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41070 CDS complement(5579..6940) product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P704 transl_table 11 codon_start 1 locus_tag LOCUS_41080 gene mgtE CDS complement(7067..8836) product phosphoenolpyruvate-protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P705 transl_table 11 codon_start 1 locus_tag LOCUS_41090 gene ptsI CDS complement(8839..9108) product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037934.1 transl_table 11 codon_start 1 locus_tag LOCUS_41100 gene ptsH CDS complement(9101..9493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037933.1 transl_table 11 codon_start 1 locus_tag LOCUS_41110 CDS complement(9903..10787) product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P708 transl_table 11 codon_start 1 locus_tag LOCUS_41120 CDS complement(10813..11763) product HPr kinase/phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P709 transl_table 11 codon_start 1 locus_tag LOCUS_41130 gene hprK CDS complement(11760..12212) product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037931.1 transl_table 11 codon_start 1 locus_tag LOCUS_41140 gene ptsN CDS complement(12234..12551) product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037930.1 transl_table 11 codon_start 1 locus_tag LOCUS_41150 CDS complement(12610..14007) product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P712 transl_table 11 codon_start 1 locus_tag LOCUS_41160 gene rpoN CDS complement(14072..14791) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037928.1 transl_table 11 codon_start 1 locus_tag LOCUS_41170 gene yhbG CDS complement(14791..15318) product lipopolysaccharide export system protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P714 transl_table 11 codon_start 1 locus_tag LOCUS_41180 gene lptA CDS complement(15418..15993) product lipopolysaccharide export system protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P715 transl_table 11 codon_start 1 locus_tag LOCUS_41190 gene lptC CDS complement(15990..16538) product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037925.1 transl_table 11 codon_start 1 locus_tag LOCUS_41200 CDS complement(16604..17605) product arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P717 transl_table 11 codon_start 1 locus_tag LOCUS_41210 gene kpsF CDS 17660..17890 product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037923.1 transl_table 11 codon_start 1 locus_tag LOCUS_41220 CDS 17912..19183 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P719 transl_table 11 codon_start 1 locus_tag LOCUS_41230 gene murA CDS 19180..19506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037921.1 transl_table 11 codon_start 1 locus_tag LOCUS_41240 CDS complement(19629..20312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638141.2 transl_table 11 codon_start 1 locus_tag LOCUS_41250 CDS complement(20315..21103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638140.2 transl_table 11 codon_start 1 locus_tag LOCUS_41260 CDS complement(21171..21824) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P723 transl_table 11 codon_start 1 locus_tag LOCUS_41270 gene purN CDS complement(21821..22258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41280 CDS complement(22266..22751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037917.1 transl_table 11 codon_start 1 locus_tag LOCUS_41290 CDS complement(22772..23830) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P725 transl_table 11 codon_start 1 locus_tag LOCUS_41300 gene purM CDS 23943..25070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037915.1 transl_table 11 codon_start 1 locus_tag LOCUS_41310 CDS 25067..26236 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037914.1 transl_table 11 codon_start 1 locus_tag LOCUS_41320 gene perM CDS 26236..26943 product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037913.1 transl_table 11 codon_start 1 locus_tag LOCUS_41330 sequence51 source 1..22940 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(208..768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41340 note possible pseudo, frameshifted CDS 895..1518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41350 CDS 1592..2551 product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730062.1 transl_table 11 codon_start 1 locus_tag LOCUS_41360 CDS complement(2623..3012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41370 CDS complement(3009..3293) product K+/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035695.1 transl_table 11 codon_start 1 locus_tag LOCUS_41380 gene phaF CDS complement(3290..3796) product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035696.1 transl_table 11 codon_start 1 locus_tag LOCUS_41390 gene phaE CDS complement(3793..5328) product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035697.1 transl_table 11 codon_start 1 locus_tag LOCUS_41400 gene phaD CDS complement(5325..5717) product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035698.1 transl_table 11 codon_start 1 locus_tag LOCUS_41410 gene phaC CDS complement(5717..8545) product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035699.1 transl_table 11 codon_start 1 locus_tag LOCUS_41420 gene ndhF CDS complement(8879..9364) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035701.1 transl_table 11 codon_start 1 locus_tag LOCUS_41430 CDS complement(9584..10510) product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD87 transl_table 11 codon_start 1 locus_tag LOCUS_41440 gene purC CDS 10652..10981 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035707.1 transl_table 11 codon_start 1 locus_tag LOCUS_41450 CDS 11012..11686 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD84 transl_table 11 codon_start 1 locus_tag LOCUS_41460 gene rpe CDS 11747..12229 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537307.1 transl_table 11 codon_start 1 locus_tag LOCUS_41470 CDS 12478..13431 product putative lipid kinase YegS-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD82 transl_table 11 codon_start 1 locus_tag LOCUS_41480 CDS 13629..15104 product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035712.1 transl_table 11 codon_start 1 locus_tag LOCUS_41490 gene trpE CDS 15171..15950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41500 CDS 15953..16540 product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035720.1 transl_table 11 codon_start 1 locus_tag LOCUS_41510 gene trpG CDS 16557..17588 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD71 transl_table 11 codon_start 1 locus_tag LOCUS_41520 gene trpD CDS 17666..18460 product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD70 transl_table 11 codon_start 1 locus_tag LOCUS_41530 gene trpC CDS 18457..19173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035724.1 transl_table 11 codon_start 1 locus_tag LOCUS_41540 CDS complement(19215..19976) product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UKF4 transl_table 11 codon_start 1 locus_tag LOCUS_41550 CDS complement(20039..20704) product CRP-like protein Clp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22260 transl_table 11 codon_start 1 locus_tag LOCUS_41560 gene clp CDS 20878..21672 product S-adenosylmethionine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X4I6 transl_table 11 codon_start 1 locus_tag LOCUS_41570 gene speD CDS 21840..22160 product QacE family quaternary ammonium compound efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035726.1 transl_table 11 codon_start 1 locus_tag LOCUS_41580 gene sugE CDS complement(22248..22892) product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD67 transl_table 11 codon_start 1 locus_tag LOCUS_41590 gene coq7 sequence52 source 1..20744 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 158..4078 product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCQ7 transl_table 11 codon_start 1 locus_tag LOCUS_41600 gene purL CDS 4520..11698 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035898.1 transl_table 11 codon_start 1 locus_tag LOCUS_41610 gene xadA CDS complement(11950..12339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41620 CDS complement(12772..13566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41630 CDS complement(13576..14148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41640 CDS complement(14220..14717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41650 CDS 14667..14942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41660 CDS complement(14899..18402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41670 CDS complement(18623..18982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41680 CDS complement(19268..19813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41690 sequence53 source 1..19162 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(102..1196) product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038888.1 transl_table 11 codon_start 1 locus_tag LOCUS_41700 gene tcbD CDS complement(1197..2633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038887.1 transl_table 11 codon_start 1 locus_tag LOCUS_41710 CDS 2766..4256 product cysteine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202992.1 transl_table 11 codon_start 1 locus_tag LOCUS_41720 CDS 4308..7307 product Oar protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039298.1 transl_table 11 codon_start 1 locus_tag LOCUS_41730 gene oar CDS 7295..8887 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920922.1 transl_table 11 codon_start 1 locus_tag LOCUS_41740 CDS 8934..9533 product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4A9 transl_table 11 codon_start 1 locus_tag LOCUS_41750 gene ddpX CDS 9601..9972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038880.1 transl_table 11 codon_start 1 locus_tag LOCUS_41760 CDS 10205..10615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038879.1 transl_table 11 codon_start 1 locus_tag LOCUS_41770 CDS 10711..11463 product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038877.1 transl_table 11 codon_start 1 locus_tag LOCUS_41780 CDS 11495..11983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41790 CDS 12149..13513 product DUF1338 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038874.1 transl_table 11 codon_start 1 locus_tag LOCUS_41800 CDS complement(13585..15099) product acetyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038672.1 transl_table 11 codon_start 1 locus_tag LOCUS_41810 CDS 15397..18192 product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4V7 transl_table 11 codon_start 1 locus_tag LOCUS_41820 gene glnE misc_feature complement(18539..>19162) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038685.1:membrane protein locus_tag LOCUS_41830 sequence54 source 1..18136 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2998..3321) product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478614.1 transl_table 11 codon_start 1 locus_tag LOCUS_41840 CDS complement(3321..3674) product multidrug transporter subunit MdtJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478736.1 transl_table 11 codon_start 1 locus_tag LOCUS_41850 CDS 3835..4686 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211617.1 transl_table 11 codon_start 1 locus_tag LOCUS_41860 CDS complement(4760..5680) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037185.1 transl_table 11 codon_start 1 locus_tag LOCUS_41870 CDS 5812..7893 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815510.1 transl_table 11 codon_start 1 locus_tag LOCUS_41880 CDS 7956..9728 product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038079.1 transl_table 11 codon_start 1 locus_tag LOCUS_41890 CDS 9831..10547 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090491.1 transl_table 11 codon_start 1 locus_tag LOCUS_41900 CDS complement(10604..11011) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114472.1 transl_table 11 codon_start 1 locus_tag LOCUS_41910 CDS 11075..11902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199880.1 transl_table 11 codon_start 1 locus_tag LOCUS_41920 CDS complement(11983..12285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41930 CDS complement(12395..13237) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184872.1 transl_table 11 codon_start 1 locus_tag LOCUS_41940 misc_feature complement(13299..>18136) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001033221.1:adhesin locus_tag LOCUS_41950 sequence55 source 1..18117 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(238..933) product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036626.1 transl_table 11 codon_start 1 locus_tag LOCUS_41960 CDS complement(1074..2495) product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036625.1 transl_table 11 codon_start 1 locus_tag LOCUS_41970 gene phr CDS complement(2578..3192) product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846890.1 transl_table 11 codon_start 1 locus_tag LOCUS_41980 CDS complement(3203..4570) product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037525.1 transl_table 11 codon_start 1 locus_tag LOCUS_41990 CDS complement(4567..5682) product phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037526.1 transl_table 11 codon_start 1 locus_tag LOCUS_42000 CDS complement(5682..8243) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037527.1 transl_table 11 codon_start 1 locus_tag LOCUS_42010 gene cirA CDS 8367..9032 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RBJ3 transl_table 11 codon_start 1 locus_tag LOCUS_42020 gene upp CDS complement(9096..9575) product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367985.1 transl_table 11 codon_start 1 locus_tag LOCUS_42030 CDS complement(9556..9981) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088047.1 transl_table 11 codon_start 1 locus_tag LOCUS_42040 CDS 10041..10334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42050 CDS complement(10418..11254) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114721.1 transl_table 11 codon_start 1 locus_tag LOCUS_42060 CDS complement(11426..13156) product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037530.1 transl_table 11 codon_start 1 locus_tag LOCUS_42070 gene ggt CDS complement(13153..13434) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037531.1 transl_table 11 codon_start 1 locus_tag LOCUS_42080 CDS complement(13566..14057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037532.1 transl_table 11 codon_start 1 locus_tag LOCUS_42090 CDS complement(14118..14627) product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P857 transl_table 11 codon_start 1 locus_tag LOCUS_42100 gene coaD CDS complement(14654..15319) product ribosomal RNA small subunit methyltransferase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P856 transl_table 11 codon_start 1 locus_tag LOCUS_42110 CDS 15816..17708 product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3C5 transl_table 11 codon_start 1 locus_tag LOCUS_42120 gene htpG sequence56 source 1..17303 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(111..566) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039231.1 transl_table 11 codon_start 1 locus_tag LOCUS_42130 gene slyA CDS 1179..1790 product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3B0 transl_table 11 codon_start 1 locus_tag LOCUS_42140 gene folE CDS 1903..3372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039229.1 transl_table 11 codon_start 1 locus_tag LOCUS_42150 CDS 3401..4060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039228.1 transl_table 11 codon_start 1 locus_tag LOCUS_42160 CDS 4077..7457 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039227.1 transl_table 11 codon_start 1 locus_tag LOCUS_42170 CDS complement(7554..8342) product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3B5 transl_table 11 codon_start 1 locus_tag LOCUS_42180 CDS 8436..8828 product UPF0225 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3B7 transl_table 11 codon_start 1 locus_tag LOCUS_42190 CDS complement(8832..10112) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103166.1 transl_table 11 codon_start 1 locus_tag LOCUS_42200 CDS 10224..11534 product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035424.1 transl_table 11 codon_start 1 locus_tag LOCUS_42210 CDS 11531..12505 product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035425.1 transl_table 11 codon_start 1 locus_tag LOCUS_42220 CDS 12589..13854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42230 note possible pseudo, internal stop codon, frameshifted CDS 13895..14785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42240 note possible pseudo, internal stop codon, frameshifted CDS 14812..15603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42250 CDS complement(15610..16797) product benzoate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039217.1 transl_table 11 codon_start 1 locus_tag LOCUS_42260 gene benE sequence57 source 1..16386 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2764..3114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42270 CDS complement(3138..5891) product protease associated ATPase ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549921.1 transl_table 11 codon_start 1 locus_tag LOCUS_42280 gene clpB CDS complement(5958..7049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200010.1 transl_table 11 codon_start 1 locus_tag LOCUS_42290 CDS complement(7013..8848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205262.1 transl_table 11 codon_start 1 locus_tag LOCUS_42300 CDS complement(8848..9336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205263.1 transl_table 11 codon_start 1 locus_tag LOCUS_42310 CDS complement(9463..9960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318810.1 transl_table 11 codon_start 1 locus_tag LOCUS_42320 CDS complement(10107..11597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521953.1 transl_table 11 codon_start 1 locus_tag LOCUS_42330 CDS complement(11601..12101) product type VI secretion system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521952.1 transl_table 11 codon_start 1 locus_tag LOCUS_42340 CDS complement(12132..12755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42350 CDS 13105..13617 product type VI secretion system-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521950.1 transl_table 11 codon_start 1 locus_tag LOCUS_42360 CDS 13834..15168 product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521949.1 transl_table 11 codon_start 1 locus_tag LOCUS_42370 CDS 15165..15959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521948.1 transl_table 11 codon_start 1 locus_tag LOCUS_42380 sequence58 source 1..12952 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 251..733 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7M9 transl_table 11 codon_start 1 locus_tag LOCUS_42390 gene slyD CDS 833..2077 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037711.1 transl_table 11 codon_start 1 locus_tag LOCUS_42400 gene yxaH CDS 2081..3331 product D-amino-acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037710.1 transl_table 11 codon_start 1 locus_tag LOCUS_42410 gene dadA CDS 3328..4686 product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037709.1 transl_table 11 codon_start 1 locus_tag LOCUS_42420 CDS 4871..5791 product multidrug DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813145.1 transl_table 11 codon_start 1 locus_tag LOCUS_42430 CDS 5824..6126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42440 CDS 6220..6894 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037707.1 transl_table 11 codon_start 1 locus_tag LOCUS_42450 CDS complement(7029..8615) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089326.1 transl_table 11 codon_start 1 locus_tag LOCUS_42460 CDS complement(8612..9094) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114391.1 transl_table 11 codon_start 1 locus_tag LOCUS_42470 CDS complement(9220..11229) product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037706.1 transl_table 11 codon_start 1 locus_tag LOCUS_42480 misc_feature complement(11388..>12952) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037704.1:peptidase locus_tag LOCUS_42490 sequence59 source 1..12907 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 396..1037 product methylthioribulose-1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9N3 transl_table 11 codon_start 1 locus_tag LOCUS_42500 gene mtnB CDS 1130..1687 product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9N4 transl_table 11 codon_start 1 locus_tag LOCUS_42510 gene mtnD CDS 1691..2386 product enolase-phosphatase E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9N5 transl_table 11 codon_start 1 locus_tag LOCUS_42520 gene mtnC CDS complement(2495..5113) product beta-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038016.1 transl_table 11 codon_start 1 locus_tag LOCUS_42530 CDS complement(5175..6401) product N-acylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036696.1 transl_table 11 codon_start 1 locus_tag LOCUS_42540 CDS complement(6398..7393) product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036695.1 transl_table 11 codon_start 1 locus_tag LOCUS_42550 gene scrK CDS complement(7401..8714) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036694.1 transl_table 11 codon_start 1 locus_tag LOCUS_42560 gene fucP CDS complement(8774..9823) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036693.1 transl_table 11 codon_start 1 locus_tag LOCUS_42570 CDS complement(9920..12385) product alpha-1 2-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039282.1 transl_table 11 codon_start 1 locus_tag LOCUS_42580 sequence60 source 1..12113 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1826 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038579.1:aminopeptidase locus_tag LOCUS_42590 CDS 1951..2682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038578.1 transl_table 11 codon_start 1 locus_tag LOCUS_42600 CDS 2682..3305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114316.1 transl_table 11 codon_start 1 locus_tag LOCUS_42610 CDS complement(3408..4346) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038567.1 transl_table 11 codon_start 1 locus_tag LOCUS_42620 CDS 4630..5676 product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003482734.1 transl_table 11 codon_start 1 locus_tag LOCUS_42630 gene mreB CDS 5798..6886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42640 CDS 6883..7368 product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P574 transl_table 11 codon_start 1 locus_tag LOCUS_42650 gene mreD CDS 7372..9447 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038564.1 transl_table 11 codon_start 1 locus_tag LOCUS_42660 gene mrdA CDS 9444..10556 product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038563.1 transl_table 11 codon_start 1 locus_tag LOCUS_42670 gene mrdB CDS 10683..11831 product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038563.1 transl_table 11 codon_start 1 locus_tag LOCUS_42680 gene mrdB sequence61 source 1..11743 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(583..2370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42690 CDS complement(2524..3651) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63XP4 transl_table 11 codon_start 1 locus_tag LOCUS_42700 CDS complement(3648..4424) product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704761.1 transl_table 11 codon_start 1 locus_tag LOCUS_42710 CDS complement(4458..5792) product tagatose-6-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209876.1 transl_table 11 codon_start 1 locus_tag LOCUS_42720 gene agaZ CDS complement(5809..6747) product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390380.1 transl_table 11 codon_start 1 locus_tag LOCUS_42730 CDS complement(6740..7924) product putative tagatose-6-phosphate ketose/aldose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O50523 transl_table 11 codon_start 1 locus_tag LOCUS_42740 gene agaS CDS 8217..11576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42750 sequence62 source 1..11316 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(157..232) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 tRNA complement(417..492) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 tRNA complement(547..622) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 CDS complement(725..1123) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429838.1 transl_table 11 codon_start 1 locus_tag LOCUS_42760 CDS 1310..2377 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967910.1 transl_table 11 codon_start 1 locus_tag LOCUS_42770 CDS 2459..3262 product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927928.1 transl_table 11 codon_start 1 locus_tag LOCUS_42780 CDS 3293..4132 product thiol:disulfide interchange protein DsbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I106 transl_table 11 codon_start 1 locus_tag LOCUS_42790 gene dsbG CDS 4648..6093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42800 CDS 6170..7522 product arginine/agmatine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZGS9 transl_table 11 codon_start 1 locus_tag LOCUS_42810 gene adiC CDS 7543..9831 product lysine-specific pyridoxal 5'-phosphate-dependent carboxylase LdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113592.1 transl_table 11 codon_start 1 locus_tag LOCUS_42820 gene ldcA CDS 9860..10762 product cation efflux family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947834.1 transl_table 11 codon_start 1 locus_tag LOCUS_42830 sequence63 source 1..10645 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 37..399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42840 CDS complement(453..710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42850 CDS 839..1771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42860 CDS 1975..2478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42870 CDS complement(2484..2753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42880 CDS 2646..2942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42890 CDS 3222..3497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42900 CDS 3628..4434 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038921.1 transl_table 11 codon_start 1 locus_tag LOCUS_42910 gene exoA CDS 4431..5735 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038920.1 transl_table 11 codon_start 1 locus_tag LOCUS_42920 gene ampG CDS 5813..6043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038919.1 transl_table 11 codon_start 1 locus_tag LOCUS_42930 CDS complement(6110..7237) product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P473 transl_table 11 codon_start 1 locus_tag LOCUS_42940 gene anmK CDS complement(7303..8775) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038917.1 transl_table 11 codon_start 1 locus_tag LOCUS_42950 CDS 8942..10153 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P475 transl_table 11 codon_start 1 locus_tag LOCUS_42960 gene tyrS sequence64 source 1..10511 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 176..2053 product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035899.1 transl_table 11 codon_start 1 locus_tag LOCUS_42970 CDS 2190..3911 product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31742 transl_table 11 codon_start 1 locus_tag LOCUS_42980 gene xpsE CDS 3936..5156 product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31744 transl_table 11 codon_start 1 locus_tag LOCUS_42990 gene xpsF CDS 5206..5649 product type II secretion system protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31734 transl_table 11 codon_start 1 locus_tag LOCUS_43000 gene xpsG CDS 5656..6150 product type II secretion system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31736 transl_table 11 codon_start 1 locus_tag LOCUS_43010 gene xpsH CDS 6147..6566 product type II secretion system protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31738 transl_table 11 codon_start 1 locus_tag LOCUS_43020 gene xpsI CDS 6563..7195 product type II secretion system protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31740 transl_table 11 codon_start 1 locus_tag LOCUS_43030 gene xpsJ CDS 7192..8055 product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P34026 transl_table 11 codon_start 1 locus_tag LOCUS_43040 gene pefK CDS 8052..9197 product type II secretion system protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P34027 transl_table 11 codon_start 1 locus_tag LOCUS_43050 gene pefL CDS 9172..9885 product protein XpsM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29039 transl_table 11 codon_start 1 locus_tag LOCUS_43060 gene xpsM sequence65 source 1..8277 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(98..1816) product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038421.1 transl_table 11 codon_start 1 locus_tag LOCUS_43070 gene ggt CDS 2504..3478 product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5L5 transl_table 11 codon_start 1 locus_tag LOCUS_43080 gene ilvC CDS 3518..5254 product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5L4 transl_table 11 codon_start 1 locus_tag LOCUS_43090 gene ilvG CDS 5238..5489 product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038424.1 transl_table 11 codon_start 1 locus_tag LOCUS_43100 gene ilvM CDS 5586..6689 product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038425.1 transl_table 11 codon_start 1 locus_tag LOCUS_43110 gene tdcB sequence66 source 1..7958 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(372..1358) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC25 transl_table 11 codon_start 1 locus_tag LOCUS_43120 gene mdh CDS complement(1477..1968) product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC26 transl_table 11 codon_start 1 locus_tag LOCUS_43130 gene ppiB CDS complement(2064..2294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43140 CDS 2244..4091 product GTP-binding elongation factor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636312.2 transl_table 11 codon_start 1 locus_tag LOCUS_43150 gene typA CDS 4103..4570 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036139.1 transl_table 11 codon_start 1 locus_tag LOCUS_43160 CDS 4612..6234 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036138.1 transl_table 11 codon_start 1 locus_tag LOCUS_43170 gene gatAX CDS complement(6298..7437) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036137.1 transl_table 11 codon_start 1 locus_tag LOCUS_43180 sequence67 source 1..7037 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 238..1611 product D-serine/D-alanine/glycine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038625.1 transl_table 11 codon_start 1 locus_tag LOCUS_43190 gene cycA CDS 1964..2716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43200 CDS complement(2724..4244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43210 CDS 4446..6491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43220 CDS complement(6469..6876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038745.1 transl_table 11 codon_start 1 locus_tag LOCUS_43230 sequence68 source 1..5771 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(425..1591) product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038894.1 transl_table 11 codon_start 1 locus_tag LOCUS_43240 gene yliI CDS 1772..2212 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038893.1 transl_table 11 codon_start 1 locus_tag LOCUS_43250 gene yiaA CDS complement(2260..2583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038892.1 transl_table 11 codon_start 1 locus_tag LOCUS_43260 CDS complement(2692..3993) product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038890.1 transl_table 11 codon_start 1 locus_tag LOCUS_43270 CDS complement(3990..4751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038889.1 transl_table 11 codon_start 1 locus_tag LOCUS_43280 CDS complement(4767..5615) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370295.1 transl_table 11 codon_start 1 locus_tag LOCUS_43290 sequence69 source 1..4669 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2191 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037788.1:ligand-gated channel locus_tag LOCUS_43300 CDS 2419..2985 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035991.1 transl_table 11 codon_start 1 locus_tag LOCUS_43310 sequence70 source 1..3906 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 225..686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43320 CDS 686..1081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43330 sequence71 source 1..3017 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(564..2765) product type II secretion system protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29041 transl_table 11 codon_start 1 locus_tag LOCUS_43340 gene xpsD sequence72 source 1..1846 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 160..1176 product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035484.1 transl_table 11 codon_start 1 locus_tag LOCUS_43350 gene ansA tRNA 1314..1399 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 tRNA 1424..1497 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 tRNA 1547..1622 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00600