>Feature sequence01 106 462 gene locus_tag LOCUS_00010 106 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 556 1317 gene locus_tag LOCUS_00020 gene exbB 556 1317 CDS product biopolymer transport protein ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C7L9 protein_id gnl|my_center|LOCUS_00020 1375 1800 gene locus_tag LOCUS_00030 gene exbD1 1375 1800 CDS product biopolymer transport protein exbD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C7M0 protein_id gnl|my_center|LOCUS_00030 1804 2217 gene locus_tag LOCUS_00040 gene exbD2 1804 2217 CDS product biopolymer transport protein exbD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C7I9 protein_id gnl|my_center|LOCUS_00040 2320 3780 gene locus_tag LOCUS_00050 gene cls 2320 3780 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035272.1 protein_id gnl|my_center|LOCUS_00050 3821 4090 gene locus_tag LOCUS_00060 3821 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 4100 4843 gene locus_tag LOCUS_00070 gene pdxJ 4100 4843 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PEG8 protein_id gnl|my_center|LOCUS_00070 4988 5239 gene locus_tag LOCUS_00080 4988 5239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 5609 5385 gene locus_tag LOCUS_00090 5609 5385 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205394.1 protein_id gnl|my_center|LOCUS_00090 5690 6025 gene locus_tag LOCUS_00100 5690 6025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 6176 7267 gene locus_tag LOCUS_00110 6176 7267 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035273.1 protein_id gnl|my_center|LOCUS_00110 7984 9186 gene locus_tag LOCUS_00120 7984 9186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 9183 10442 gene locus_tag LOCUS_00130 9183 10442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 11515 12198 gene locus_tag LOCUS_00140 11515 12198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 13238 12690 gene locus_tag LOCUS_00150 13238 12690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 13637 14293 gene locus_tag LOCUS_00160 13637 14293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 14773 15936 gene locus_tag LOCUS_00170 gene xerC 14773 15936 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFZ8 protein_id gnl|my_center|LOCUS_00170 15957 17789 gene locus_tag LOCUS_00180 15957 17789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 17826 19853 gene locus_tag LOCUS_00190 17826 19853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 20244 19828 gene locus_tag LOCUS_00200 20244 19828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 20667 21137 gene locus_tag LOCUS_00210 20667 21137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 22427 21531 gene locus_tag LOCUS_00220 22427 21531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 22803 22558 gene locus_tag LOCUS_00230 22803 22558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 24663 23626 gene locus_tag LOCUS_00240 24663 23626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 25866 24679 gene locus_tag LOCUS_00250 25866 24679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 26855 27313 gene locus_tag LOCUS_00260 26855 27313 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888792.1 protein_id gnl|my_center|LOCUS_00260 27583 28305 gene locus_tag LOCUS_00270 27583 28305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 29103 28396 gene locus_tag LOCUS_00280 29103 28396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635411.2 protein_id gnl|my_center|LOCUS_00280 30227 29211 gene locus_tag LOCUS_00290 gene fbp 30227 29211 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PE85 protein_id gnl|my_center|LOCUS_00290 31768 30566 gene locus_tag LOCUS_00300 gene tyrB 31768 30566 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PE84 protein_id gnl|my_center|LOCUS_00300 31940 34030 gene locus_tag LOCUS_00310 gene yncD 31940 34030 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035356.1 protein_id gnl|my_center|LOCUS_00310 34486 34142 gene locus_tag LOCUS_00320 34486 34142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 34634 35032 gene locus_tag LOCUS_00330 34634 35032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00330 35199 36119 gene locus_tag LOCUS_00340 gene ku 35199 36119 CDS product non-homologous end joining protein Ku inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PE77 protein_id gnl|my_center|LOCUS_00340 36123 38609 gene locus_tag LOCUS_00350 gene lig3 36123 38609 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037451.1 protein_id gnl|my_center|LOCUS_00350 39073 38681 gene locus_tag LOCUS_00360 39073 38681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 40229 39201 gene locus_tag LOCUS_00370 gene adhA 40229 39201 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096816.1 protein_id gnl|my_center|LOCUS_00370 40964 40326 gene locus_tag LOCUS_00380 gene eda 40964 40326 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225133.1 protein_id gnl|my_center|LOCUS_00380 41693 41082 gene locus_tag LOCUS_00390 41693 41082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 41911 42966 gene locus_tag LOCUS_00400 41911 42966 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035407.1 protein_id gnl|my_center|LOCUS_00400 43961 43068 gene locus_tag LOCUS_00410 gene phhA 43961 43068 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035413.1 protein_id gnl|my_center|LOCUS_00410 44129 44572 gene locus_tag LOCUS_00420 44129 44572 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035414.1 protein_id gnl|my_center|LOCUS_00420 44729 45472 gene locus_tag LOCUS_00430 44729 45472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 46556 45519 gene locus_tag LOCUS_00440 46556 45519 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035416.1 protein_id gnl|my_center|LOCUS_00440 47708 46695 gene locus_tag LOCUS_00450 47708 46695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635555.2 protein_id gnl|my_center|LOCUS_00450 47868 50138 gene locus_tag LOCUS_00460 gene fyuA 47868 50138 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036237.1 protein_id gnl|my_center|LOCUS_00460 51090 50251 gene locus_tag LOCUS_00470 gene phoC 51090 50251 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P342 protein_id gnl|my_center|LOCUS_00470 51352 52230 gene locus_tag LOCUS_00480 51352 52230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071847.1 protein_id gnl|my_center|LOCUS_00480 52242 53450 gene locus_tag LOCUS_00490 52242 53450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 54415 53594 gene locus_tag LOCUS_00500 gene ylmA 54415 53594 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035418.1 protein_id gnl|my_center|LOCUS_00500 54567 55769 gene locus_tag LOCUS_00510 54567 55769 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635557.2 protein_id gnl|my_center|LOCUS_00510 55766 56098 gene locus_tag LOCUS_00520 55766 56098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035420.1 protein_id gnl|my_center|LOCUS_00520 56113 56751 gene locus_tag LOCUS_00530 56113 56751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 56805 57617 gene locus_tag LOCUS_00540 gene mutM 56805 57617 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3C4 protein_id gnl|my_center|LOCUS_00540 57723 59327 gene locus_tag LOCUS_00550 gene opgD 57723 59327 CDS product glucans biosynthesis protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3C6 protein_id gnl|my_center|LOCUS_00550 60068 59364 gene locus_tag LOCUS_00560 60068 59364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 60790 60170 gene locus_tag LOCUS_00570 gene tdk 60790 60170 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3C8 protein_id gnl|my_center|LOCUS_00570 60892 62868 gene locus_tag LOCUS_00580 gene rep 60892 62868 CDS product ATP-dependent DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3D2 protein_id gnl|my_center|LOCUS_00580 63155 63679 gene locus_tag LOCUS_00590 63155 63679 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039207.1 protein_id gnl|my_center|LOCUS_00590 64455 63805 gene locus_tag LOCUS_00600 64455 63805 CDS product UPF0502 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3D5 protein_id gnl|my_center|LOCUS_00600 64557 65477 gene locus_tag LOCUS_00610 gene lppC 64557 65477 CDS product 5'-nucleotidase, lipoprotein e(P4) family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039204.1 protein_id gnl|my_center|LOCUS_00610 65474 66199 gene locus_tag LOCUS_00620 gene pyrF 65474 66199 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3D7 protein_id gnl|my_center|LOCUS_00620 66418 67239 gene locus_tag LOCUS_00630 66418 67239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 67571 68473 gene locus_tag LOCUS_00640 67571 68473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639468.2 protein_id gnl|my_center|LOCUS_00640 68473 71109 gene locus_tag LOCUS_00650 gene plsB 68473 71109 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3E3 protein_id gnl|my_center|LOCUS_00650 71431 71228 gene locus_tag LOCUS_00660 71431 71228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039195.1 protein_id gnl|my_center|LOCUS_00660 71523 72443 gene locus_tag LOCUS_00670 gene ttcA 71523 72443 CDS product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3H2 protein_id gnl|my_center|LOCUS_00670 72480 73385 gene locus_tag LOCUS_00680 gene rdgC 72480 73385 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3H3 protein_id gnl|my_center|LOCUS_00680 73445 74224 gene locus_tag LOCUS_00690 73445 74224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039166.1 protein_id gnl|my_center|LOCUS_00690 74360 74656 gene locus_tag LOCUS_00700 74360 74656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 75623 74757 gene locus_tag LOCUS_00710 75623 74757 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039702.1 protein_id gnl|my_center|LOCUS_00710 75790 78192 gene locus_tag LOCUS_00720 75790 78192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 79623 78178 gene locus_tag LOCUS_00730 gene gltD 79623 78178 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035289.1 protein_id gnl|my_center|LOCUS_00730 84170 79716 gene locus_tag LOCUS_00740 gene gltB 84170 79716 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035290.1 protein_id gnl|my_center|LOCUS_00740 84738 84346 gene locus_tag LOCUS_00750 84738 84346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035291.1 protein_id gnl|my_center|LOCUS_00750 84847 85899 gene locus_tag LOCUS_00760 84847 85899 CDS product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035292.1 protein_id gnl|my_center|LOCUS_00760 86241 85933 gene locus_tag LOCUS_00770 86241 85933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 86123 86350 gene locus_tag LOCUS_00780 86123 86350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 86437 87543 gene locus_tag LOCUS_00790 86437 87543 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811351.1 protein_id gnl|my_center|LOCUS_00790 88659 87577 gene locus_tag LOCUS_00800 88659 87577 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143091.1 protein_id gnl|my_center|LOCUS_00800 88851 89237 gene locus_tag LOCUS_00810 gene mecI 88851 89237 CDS product methicillin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035303.1 protein_id gnl|my_center|LOCUS_00810 89241 91241 gene locus_tag LOCUS_00820 89241 91241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035304.1 protein_id gnl|my_center|LOCUS_00820 91600 91286 gene locus_tag LOCUS_00830 91600 91286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 92698 91676 gene locus_tag LOCUS_00840 92698 91676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 95184 92695 gene locus_tag LOCUS_00850 95184 92695 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035312.1 protein_id gnl|my_center|LOCUS_00850 96498 95278 gene locus_tag LOCUS_00860 96498 95278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 96621 97139 gene locus_tag LOCUS_00870 96621 97139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 97180 97854 gene locus_tag LOCUS_00880 97180 97854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035389.1 protein_id gnl|my_center|LOCUS_00880 99733 97925 gene locus_tag LOCUS_00890 99733 97925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035345.1 protein_id gnl|my_center|LOCUS_00890 101904 99730 gene locus_tag LOCUS_00900 101904 99730 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035346.1 protein_id gnl|my_center|LOCUS_00900 103022 101901 gene locus_tag LOCUS_00910 103022 101901 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035347.1 protein_id gnl|my_center|LOCUS_00910 103903 103019 gene locus_tag LOCUS_00920 103903 103019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035348.1 protein_id gnl|my_center|LOCUS_00920 104906 103923 gene locus_tag LOCUS_00930 gene moxR 104906 103923 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035349.1 protein_id gnl|my_center|LOCUS_00930 105630 104923 gene locus_tag LOCUS_00940 105630 104923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635487.2 protein_id gnl|my_center|LOCUS_00940 106964 105630 gene locus_tag LOCUS_00950 gene tldD 106964 105630 CDS product TldD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035351.1 protein_id gnl|my_center|LOCUS_00950 108620 106986 gene locus_tag LOCUS_00960 gene tldD 108620 106986 CDS product TldD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035352.1 protein_id gnl|my_center|LOCUS_00960 110282 108651 gene locus_tag LOCUS_00970 gene tldD 110282 108651 CDS product TldD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035353.1 protein_id gnl|my_center|LOCUS_00970 110894 111508 gene locus_tag LOCUS_00980 110894 111508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035344.1 protein_id gnl|my_center|LOCUS_00980 115279 111593 gene locus_tag LOCUS_00990 gene iorA 115279 111593 CDS product indolepyruvate ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635565.2 protein_id gnl|my_center|LOCUS_00990 115449 116084 gene locus_tag LOCUS_01000 115449 116084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035428.1 protein_id gnl|my_center|LOCUS_01000 118145 116661 gene locus_tag LOCUS_01010 118145 116661 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113173.1 protein_id gnl|my_center|LOCUS_01010 118269 118898 gene locus_tag LOCUS_01020 gene parA 118269 118898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035431.1 protein_id gnl|my_center|LOCUS_01020 118948 119424 gene locus_tag LOCUS_01030 118948 119424 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035432.1 protein_id gnl|my_center|LOCUS_01030 119429 120046 gene locus_tag LOCUS_01040 119429 120046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035433.1 protein_id gnl|my_center|LOCUS_01040 120043 122082 gene locus_tag LOCUS_01050 gene cls 120043 122082 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035434.1 protein_id gnl|my_center|LOCUS_01050 122093 122527 gene locus_tag LOCUS_01060 122093 122527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635573.2 protein_id gnl|my_center|LOCUS_01060 122648 123439 gene locus_tag LOCUS_01070 122648 123439 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035436.1 protein_id gnl|my_center|LOCUS_01070 123447 124481 gene locus_tag LOCUS_01080 123447 124481 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035437.1 protein_id gnl|my_center|LOCUS_01080 124538 126607 gene locus_tag LOCUS_01090 124538 126607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035438.1 protein_id gnl|my_center|LOCUS_01090 126618 127229 gene locus_tag LOCUS_01100 126618 127229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035439.1 protein_id gnl|my_center|LOCUS_01100 127833 127354 gene locus_tag LOCUS_01110 127833 127354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 128789 127962 gene locus_tag LOCUS_01120 128789 127962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040034.1 protein_id gnl|my_center|LOCUS_01120 129657 128863 gene locus_tag LOCUS_01130 gene uppP 129657 128863 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDZ9 protein_id gnl|my_center|LOCUS_01130 129881 131290 gene locus_tag LOCUS_01140 gene glnA 129881 131290 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDZ8 protein_id gnl|my_center|LOCUS_01140 131633 131971 gene locus_tag LOCUS_01150 gene glnB 131633 131971 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005992714.1 protein_id gnl|my_center|LOCUS_01150 131994 133421 gene locus_tag LOCUS_01160 gene amtB 131994 133421 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDZ7 protein_id gnl|my_center|LOCUS_01160 133869 134210 gene locus_tag LOCUS_01170 133869 134210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 134324 134902 gene locus_tag LOCUS_01180 134324 134902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 135131 135457 gene locus_tag LOCUS_01190 135131 135457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 135481 136257 gene locus_tag LOCUS_01200 135481 136257 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038886.1 protein_id gnl|my_center|LOCUS_01200 136386 137561 gene locus_tag LOCUS_01210 136386 137561 CDS product membrane-bound lytic murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY34 protein_id gnl|my_center|LOCUS_01210 137645 137959 gene locus_tag LOCUS_01220 137645 137959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 138041 139102 gene locus_tag LOCUS_01230 gene ntrB 138041 139102 CDS product two-component system sensor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035444.1 protein_id gnl|my_center|LOCUS_01230 139095 140543 gene locus_tag LOCUS_01240 gene ntrC 139095 140543 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035445.1 protein_id gnl|my_center|LOCUS_01240 140637 141206 gene locus_tag LOCUS_01250 gene yojM 140637 141206 CDS product superoxide dismutase [Cu-Zn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDZ4 protein_id gnl|my_center|LOCUS_01250 141238 141864 gene locus_tag LOCUS_01260 141238 141864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 142873 141986 gene locus_tag LOCUS_01270 142873 141986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035449.1 protein_id gnl|my_center|LOCUS_01270 142982 144262 gene locus_tag LOCUS_01280 gene yfcY 142982 144262 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035450.1 protein_id gnl|my_center|LOCUS_01280 145713 144418 gene locus_tag LOCUS_01290 gene hemY 145713 144418 CDS product porphyrin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035452.1 protein_id gnl|my_center|LOCUS_01290 146697 145720 gene locus_tag LOCUS_01300 146697 145720 CDS product uroporphyrin-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035453.1 protein_id gnl|my_center|LOCUS_01300 147611 146802 gene locus_tag LOCUS_01310 gene hemD 147611 146802 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035454.1 protein_id gnl|my_center|LOCUS_01310 147647 148114 gene locus_tag LOCUS_01320 147647 148114 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035456.1 protein_id gnl|my_center|LOCUS_01320 148147 148572 gene locus_tag LOCUS_01330 148147 148572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035457.1 protein_id gnl|my_center|LOCUS_01330 148672 149067 gene locus_tag LOCUS_01340 148672 149067 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035458.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01340 149168 149686 gene locus_tag LOCUS_01350 gene secB 149168 149686 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDY1 protein_id gnl|my_center|LOCUS_01350 149707 150732 gene locus_tag LOCUS_01360 gene gpsA 149707 150732 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDY0 protein_id gnl|my_center|LOCUS_01360 151359 150883 gene locus_tag LOCUS_01370 151359 150883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 151494 152156 gene locus_tag LOCUS_01380 151494 152156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 152279 153406 gene locus_tag LOCUS_01390 152279 153406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 154036 153392 gene locus_tag LOCUS_01400 154036 153392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 154429 154770 gene locus_tag LOCUS_01410 154429 154770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 155895 154870 gene locus_tag LOCUS_01420 155895 154870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 157067 156381 gene locus_tag LOCUS_01430 157067 156381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 157498 157226 gene locus_tag LOCUS_01440 157498 157226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 158783 157755 gene locus_tag LOCUS_01450 158783 157755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 159017 159592 gene locus_tag LOCUS_01460 159017 159592 CDS product Ax21 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035461.1 protein_id gnl|my_center|LOCUS_01460 159762 160088 gene locus_tag LOCUS_01470 159762 160088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247462.1 protein_id gnl|my_center|LOCUS_01470 161027 160110 gene locus_tag LOCUS_01480 161027 160110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038184.1 protein_id gnl|my_center|LOCUS_01480 160972 161154 gene locus_tag LOCUS_01490 160972 161154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 161249 162223 gene locus_tag LOCUS_01500 161249 162223 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531010.1 protein_id gnl|my_center|LOCUS_01500 162375 162791 gene locus_tag LOCUS_01510 162375 162791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 163472 162888 gene locus_tag LOCUS_01520 163472 162888 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766257.1 protein_id gnl|my_center|LOCUS_01520 165658 163469 gene locus_tag LOCUS_01530 165658 163469 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035914.1 protein_id gnl|my_center|LOCUS_01530 167033 165867 gene locus_tag LOCUS_01540 167033 165867 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035915.1 protein_id gnl|my_center|LOCUS_01540 167527 167120 gene locus_tag LOCUS_01550 167527 167120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 168512 167874 gene locus_tag LOCUS_01560 168512 167874 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192810.1 protein_id gnl|my_center|LOCUS_01560 168588 172187 gene locus_tag LOCUS_01570 gene bvgS 168588 172187 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MJS2 protein_id gnl|my_center|LOCUS_01570 172582 172181 gene locus_tag LOCUS_01580 172582 172181 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089377.1 protein_id gnl|my_center|LOCUS_01580 174324 172648 gene locus_tag LOCUS_01590 174324 172648 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065122.1 protein_id gnl|my_center|LOCUS_01590 174582 175745 gene locus_tag LOCUS_01600 gene gcdH 174582 175745 CDS product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036619.1 protein_id gnl|my_center|LOCUS_01600 176381 175902 gene locus_tag LOCUS_01610 gene trmL 176381 175902 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDX5 protein_id gnl|my_center|LOCUS_01610 176927 176451 gene locus_tag LOCUS_01620 176927 176451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035466.1 protein_id gnl|my_center|LOCUS_01620 177294 180191 gene locus_tag LOCUS_01630 177294 180191 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038616.1 protein_id gnl|my_center|LOCUS_01630 180350 180667 gene locus_tag LOCUS_01640 180350 180667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035467.1 protein_id gnl|my_center|LOCUS_01640 180771 181787 gene locus_tag LOCUS_01650 gene fabH 180771 181787 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035468.1 protein_id gnl|my_center|LOCUS_01650 181846 182793 gene locus_tag LOCUS_01660 gene dhaA 181846 182793 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035472.1 protein_id gnl|my_center|LOCUS_01660 182819 183052 gene locus_tag LOCUS_01670 182819 183052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 183596 183165 gene locus_tag LOCUS_01680 gene ykgJ 183596 183165 CDS product zinc/iron-chelating domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035473.1 protein_id gnl|my_center|LOCUS_01680 183701 185359 gene locus_tag LOCUS_01690 183701 185359 CDS product peptide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635613.2 protein_id gnl|my_center|LOCUS_01690 185356 186348 gene locus_tag LOCUS_01700 gene cdh 185356 186348 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035475.1 protein_id gnl|my_center|LOCUS_01700 186431 186586 gene locus_tag LOCUS_01710 186431 186586 CDS product UPF0391 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CLW2 protein_id gnl|my_center|LOCUS_01710 187738 186653 gene locus_tag LOCUS_01720 gene ddlA 187738 186653 CDS product D-alanine--D-alanine ligase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDW3 protein_id gnl|my_center|LOCUS_01720 188784 188023 gene locus_tag LOCUS_01730 188784 188023 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071010.1 protein_id gnl|my_center|LOCUS_01730 190893 188929 gene locus_tag LOCUS_01740 190893 188929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 193157 190899 gene locus_tag LOCUS_01750 193157 190899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 193377 193150 gene locus_tag LOCUS_01760 193377 193150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 193607 193377 gene locus_tag LOCUS_01770 193607 193377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 194401 193619 gene locus_tag LOCUS_01780 194401 193619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951065.1 protein_id gnl|my_center|LOCUS_01780 196098 194398 gene locus_tag LOCUS_01790 196098 194398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 197072 196098 gene locus_tag LOCUS_01800 197072 196098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 198050 197076 gene locus_tag LOCUS_01810 198050 197076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 201556 198053 gene locus_tag LOCUS_01820 201556 198053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 201556 201786 gene locus_tag LOCUS_01830 201556 201786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 202250 201741 gene locus_tag LOCUS_01840 202250 201741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 203005 202250 gene locus_tag LOCUS_01850 203005 202250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 203221 203009 gene locus_tag LOCUS_01860 203221 203009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 203694 203218 gene locus_tag LOCUS_01870 203694 203218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 204224 203691 gene locus_tag LOCUS_01880 204224 203691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 204716 204234 gene locus_tag LOCUS_01890 204716 204234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 205821 204877 gene locus_tag LOCUS_01900 205821 204877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286902.1 protein_id gnl|my_center|LOCUS_01900 206188 205847 gene locus_tag LOCUS_01910 206188 205847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 207416 206211 gene locus_tag LOCUS_01920 207416 206211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273072.1 protein_id gnl|my_center|LOCUS_01920 208282 207713 gene locus_tag LOCUS_01930 208282 207713 CDS product virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938413.1 protein_id gnl|my_center|LOCUS_01930 209559 208282 gene locus_tag LOCUS_01940 209559 208282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 211089 209563 gene locus_tag LOCUS_01950 211089 209563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938419.1 protein_id gnl|my_center|LOCUS_01950 212822 211086 gene locus_tag LOCUS_01960 212822 211086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167501.1 protein_id gnl|my_center|LOCUS_01960 213380 212823 gene locus_tag LOCUS_01970 213380 212823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 213681 213385 gene locus_tag LOCUS_01980 213681 213385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227700.1 protein_id gnl|my_center|LOCUS_01980 214022 213705 gene locus_tag LOCUS_01990 214022 213705 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777272.1 protein_id gnl|my_center|LOCUS_01990 214525 214019 gene locus_tag LOCUS_02000 214525 214019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 215043 214525 gene locus_tag LOCUS_02010 gene ybcS 215043 214525 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N9C0 protein_id gnl|my_center|LOCUS_02010 215738 215238 gene locus_tag LOCUS_02020 215738 215238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 216167 215766 gene locus_tag LOCUS_02030 216167 215766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 216228 216440 gene locus_tag LOCUS_02040 216228 216440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 216437 216670 gene locus_tag LOCUS_02050 216437 216670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 216667 216960 gene locus_tag LOCUS_02060 216667 216960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 216975 217910 gene locus_tag LOCUS_02070 216975 217910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533821.1 protein_id gnl|my_center|LOCUS_02070 217912 219726 gene locus_tag LOCUS_02080 217912 219726 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990532.1 protein_id gnl|my_center|LOCUS_02080 219726 219884 gene locus_tag LOCUS_02090 219726 219884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 219881 221056 gene locus_tag LOCUS_02100 219881 221056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602369.1 protein_id gnl|my_center|LOCUS_02100 221058 221294 gene locus_tag LOCUS_02110 221058 221294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 221287 221532 gene locus_tag LOCUS_02120 221287 221532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 221532 221840 gene locus_tag LOCUS_02130 221532 221840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 221842 222231 gene locus_tag LOCUS_02140 221842 222231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 222221 222496 gene locus_tag LOCUS_02150 222221 222496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 222489 222716 gene locus_tag LOCUS_02160 222489 222716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 222713 223192 gene locus_tag LOCUS_02170 222713 223192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 223192 223446 gene locus_tag LOCUS_02180 223192 223446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 223443 224054 gene locus_tag LOCUS_02190 223443 224054 CDS product sulfate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070973.1 protein_id gnl|my_center|LOCUS_02190 224056 224739 gene locus_tag LOCUS_02200 224056 224739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 224736 225053 gene locus_tag LOCUS_02210 224736 225053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739863.1 protein_id gnl|my_center|LOCUS_02210 225040 225945 gene locus_tag LOCUS_02220 gene rdgC 225040 225945 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3H3 protein_id gnl|my_center|LOCUS_02220 225954 226322 gene locus_tag LOCUS_02230 225954 226322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 226315 226794 gene locus_tag LOCUS_02240 226315 226794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 226784 226960 gene locus_tag LOCUS_02250 226784 226960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 226957 227421 gene locus_tag LOCUS_02260 226957 227421 CDS product GemA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939964.1 protein_id gnl|my_center|LOCUS_02260 227418 227774 gene locus_tag LOCUS_02270 227418 227774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 227953 228588 gene locus_tag LOCUS_02280 227953 228588 CDS product sterol-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035478.1 protein_id gnl|my_center|LOCUS_02280 228585 230240 gene locus_tag LOCUS_02290 gene ubiB 228585 230240 CDS product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDW1 protein_id gnl|my_center|LOCUS_02290 230246 230824 gene locus_tag LOCUS_02300 230246 230824 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706521.1 protein_id gnl|my_center|LOCUS_02300 230931 231698 gene locus_tag LOCUS_02310 230931 231698 CDS product pseudouridylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035480.1 protein_id gnl|my_center|LOCUS_02310 232301 231774 gene locus_tag LOCUS_02320 232301 231774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035481.1 protein_id gnl|my_center|LOCUS_02320 232435 232866 gene locus_tag LOCUS_02330 232435 232866 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035482.1 protein_id gnl|my_center|LOCUS_02330 232871 233473 gene locus_tag LOCUS_02340 232871 233473 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035483.1 protein_id gnl|my_center|LOCUS_02340 233586 235742 gene locus_tag LOCUS_02350 gene dcp 233586 235742 CDS product dipeptidyl carboxypeptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035485.1 protein_id gnl|my_center|LOCUS_02350 236506 236060 gene locus_tag LOCUS_02360 gene aroD 236506 236060 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039151.1 protein_id gnl|my_center|LOCUS_02360 236911 236510 gene locus_tag LOCUS_02370 236911 236510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 237094 237720 gene locus_tag LOCUS_02380 237094 237720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 237844 239100 gene locus_tag LOCUS_02390 237844 239100 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095819.1 protein_id gnl|my_center|LOCUS_02390 240101 239193 gene locus_tag LOCUS_02400 240101 239193 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095817.1 protein_id gnl|my_center|LOCUS_02400 240198 240512 gene locus_tag LOCUS_02410 240198 240512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 241399 240482 gene locus_tag LOCUS_02420 gene rbcR 241399 240482 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035491.1 protein_id gnl|my_center|LOCUS_02420 241561 243183 gene locus_tag LOCUS_02430 gene mls 241561 243183 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035492.1 protein_id gnl|my_center|LOCUS_02430 243250 244551 gene locus_tag LOCUS_02440 gene aceA 243250 244551 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035493.1 protein_id gnl|my_center|LOCUS_02440 244894 245934 gene locus_tag LOCUS_02450 244894 245934 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035494.1 protein_id gnl|my_center|LOCUS_02450 245948 248437 gene locus_tag LOCUS_02460 245948 248437 CDS product putative peptide modification system cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035495.1 protein_id gnl|my_center|LOCUS_02460 248741 248445 gene locus_tag LOCUS_02470 248741 248445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 248880 250046 gene locus_tag LOCUS_02480 248880 250046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 252048 250066 gene locus_tag LOCUS_02490 gene accC 252048 250066 CDS product 3-methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035499.1 protein_id gnl|my_center|LOCUS_02490 253685 252075 gene locus_tag LOCUS_02500 gene accD 253685 252075 CDS product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035500.1 protein_id gnl|my_center|LOCUS_02500 254859 253696 gene locus_tag LOCUS_02510 gene acdA 254859 253696 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035501.1 protein_id gnl|my_center|LOCUS_02510 255020 255628 gene locus_tag LOCUS_02520 255020 255628 CDS product AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035502.1 protein_id gnl|my_center|LOCUS_02520 255848 256366 gene locus_tag LOCUS_02530 255848 256366 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035509.1 protein_id gnl|my_center|LOCUS_02530 256540 257985 gene locus_tag LOCUS_02540 256540 257985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 258954 258097 gene locus_tag LOCUS_02550 258954 258097 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035514.1 protein_id gnl|my_center|LOCUS_02550 258998 259669 gene locus_tag LOCUS_02560 258998 259669 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035515.1 protein_id gnl|my_center|LOCUS_02560 259666 260766 gene locus_tag LOCUS_02570 gene zapE 259666 260766 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDS4 protein_id gnl|my_center|LOCUS_02570 261661 260825 gene locus_tag LOCUS_02580 261661 260825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036593.1 protein_id gnl|my_center|LOCUS_02580 262191 264593 gene locus_tag LOCUS_02590 262191 264593 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K496 protein_id gnl|my_center|LOCUS_02590 264712 265731 gene locus_tag LOCUS_02600 gene nrdB 264712 265731 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K3C2 protein_id gnl|my_center|LOCUS_02600 266524 265889 gene locus_tag LOCUS_02610 266524 265889 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090854.1 protein_id gnl|my_center|LOCUS_02610 266615 267016 gene locus_tag LOCUS_02620 266615 267016 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039053.1 protein_id gnl|my_center|LOCUS_02620 267073 267879 gene locus_tag LOCUS_02630 gene cobB 267073 267879 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDM9 protein_id gnl|my_center|LOCUS_02630 267998 269098 gene locus_tag LOCUS_02640 gene frp 267998 269098 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035562.1 protein_id gnl|my_center|LOCUS_02640 270013 269102 gene locus_tag LOCUS_02650 270013 269102 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036387.1 protein_id gnl|my_center|LOCUS_02650 270128 270979 gene locus_tag LOCUS_02660 gene purU 270128 270979 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDM5 protein_id gnl|my_center|LOCUS_02660 271734 271108 gene locus_tag LOCUS_02670 gene pncA 271734 271108 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968676.1 protein_id gnl|my_center|LOCUS_02670 272461 271790 gene locus_tag LOCUS_02680 272461 271790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703367.1 protein_id gnl|my_center|LOCUS_02680 272978 274852 gene locus_tag LOCUS_02690 gene suhR 272978 274852 CDS product RpoH suppressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P15715 protein_id gnl|my_center|LOCUS_02690 275879 274926 gene locus_tag LOCUS_02700 275879 274926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 277594 276227 gene locus_tag LOCUS_02710 277594 276227 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036453.1 protein_id gnl|my_center|LOCUS_02710 277710 279215 gene locus_tag LOCUS_02720 gene mmsA 277710 279215 CDS product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036454.1 protein_id gnl|my_center|LOCUS_02720 279230 280396 gene locus_tag LOCUS_02730 gene fadE9 279230 280396 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036455.1 protein_id gnl|my_center|LOCUS_02730 280393 281190 gene locus_tag LOCUS_02740 gene paaF 280393 281190 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036456.1 protein_id gnl|my_center|LOCUS_02740 281187 282362 gene locus_tag LOCUS_02750 281187 282362 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036457.1 protein_id gnl|my_center|LOCUS_02750 282359 283249 gene locus_tag LOCUS_02760 gene mmsB 282359 283249 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB60 protein_id gnl|my_center|LOCUS_02760 283823 283398 gene locus_tag LOCUS_02770 gene ohr 283823 283398 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104171.1 protein_id gnl|my_center|LOCUS_02770 284915 283935 gene locus_tag LOCUS_02780 284915 283935 CDS product cation diffusion facilitator transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971314.1 protein_id gnl|my_center|LOCUS_02780 285123 286577 gene locus_tag LOCUS_02790 285123 286577 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331455.1 protein_id gnl|my_center|LOCUS_02790 286942 286634 gene locus_tag LOCUS_02800 gene higA 286942 286634 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920873.1 protein_id gnl|my_center|LOCUS_02800 287140 288171 gene locus_tag LOCUS_02810 gene dusA 287140 288171 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3X4 protein_id gnl|my_center|LOCUS_02810 288385 288759 gene locus_tag LOCUS_02820 288385 288759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039016.1 protein_id gnl|my_center|LOCUS_02820 288833 289516 gene locus_tag LOCUS_02830 gene phoP 288833 289516 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002808458.1 protein_id gnl|my_center|LOCUS_02830 289542 290966 gene locus_tag LOCUS_02840 gene phoQ 289542 290966 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039015.1 protein_id gnl|my_center|LOCUS_02840 291759 291052 gene locus_tag LOCUS_02850 291759 291052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039012.1 protein_id gnl|my_center|LOCUS_02850 292088 291810 gene locus_tag LOCUS_02860 292088 291810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 292233 293201 gene locus_tag LOCUS_02870 gene birA 292233 293201 CDS product bifunctional ligase/repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3Y0 protein_id gnl|my_center|LOCUS_02870 293198 293929 gene locus_tag LOCUS_02880 gene coaX 293198 293929 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3Y1 protein_id gnl|my_center|LOCUS_02880 293939 294793 gene locus_tag LOCUS_02890 293939 294793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 294835 294910 gene locus_tag LOCUS_t00010 294835 294910 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 295525 295232 gene locus_tag LOCUS_02900 295525 295232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 295877 295578 gene locus_tag LOCUS_02910 295877 295578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 296397 296684 gene locus_tag LOCUS_02920 296397 296684 CDS product toxin, RelE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942190.1 protein_id gnl|my_center|LOCUS_02920 296743 297045 gene locus_tag LOCUS_02930 296743 297045 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942189.1 protein_id gnl|my_center|LOCUS_02930 297616 297215 gene locus_tag LOCUS_02940 297616 297215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 298201 298971 gene locus_tag LOCUS_02950 298201 298971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 299343 298996 gene locus_tag LOCUS_02960 299343 298996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 299255 299440 gene locus_tag LOCUS_02970 299255 299440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 299474 300394 gene locus_tag LOCUS_02980 gene argI 299474 300394 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3Z1 protein_id gnl|my_center|LOCUS_02980 300557 300694 gene locus_tag LOCUS_02990 gene ecnA 300557 300694 CDS product entericidin A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038999.1 protein_id gnl|my_center|LOCUS_02990 300901 301122 gene locus_tag LOCUS_03000 300901 301122 CDS product UPF0337 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3Z3 protein_id gnl|my_center|LOCUS_03000 301996 301202 gene locus_tag LOCUS_03010 301996 301202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 302105 303397 gene locus_tag LOCUS_03020 gene trpS 302105 303397 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3Z4 protein_id gnl|my_center|LOCUS_03020 303564 303866 gene locus_tag LOCUS_03030 303564 303866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 304023 304955 gene locus_tag LOCUS_03040 304023 304955 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038996.1 protein_id gnl|my_center|LOCUS_03040 305061 306713 gene locus_tag LOCUS_03050 305061 306713 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639261.2 protein_id gnl|my_center|LOCUS_03050 307087 306788 gene locus_tag LOCUS_03060 307087 306788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 308489 307155 gene locus_tag LOCUS_03070 gene kgtP 308489 307155 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039236.1 protein_id gnl|my_center|LOCUS_03070 308713 309618 gene locus_tag LOCUS_03080 gene yedA 308713 309618 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038991.1 protein_id gnl|my_center|LOCUS_03080 309615 310514 gene locus_tag LOCUS_03090 309615 310514 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038990.1 protein_id gnl|my_center|LOCUS_03090 313461 310636 gene locus_tag LOCUS_03100 gene btuB 313461 310636 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038415.1 protein_id gnl|my_center|LOCUS_03100 313820 314119 gene locus_tag LOCUS_03110 313820 314119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 315517 314195 gene locus_tag LOCUS_03120 315517 314195 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038988.1 protein_id gnl|my_center|LOCUS_03120 316688 315531 gene locus_tag LOCUS_03130 316688 315531 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038987.1 protein_id gnl|my_center|LOCUS_03130 317392 316703 gene locus_tag LOCUS_03140 gene tptC 317392 316703 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038986.1 protein_id gnl|my_center|LOCUS_03140 318742 317495 gene locus_tag LOCUS_03150 gene acrE 318742 317495 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038985.1 protein_id gnl|my_center|LOCUS_03150 318915 319841 gene locus_tag LOCUS_03160 318915 319841 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919031.1 protein_id gnl|my_center|LOCUS_03160 319838 320614 gene locus_tag LOCUS_03170 319838 320614 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919032.1 protein_id gnl|my_center|LOCUS_03170 320621 321835 gene locus_tag LOCUS_03180 320621 321835 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038984.1 protein_id gnl|my_center|LOCUS_03180 321832 322434 gene locus_tag LOCUS_03190 321832 322434 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038983.1 protein_id gnl|my_center|LOCUS_03190 323540 323004 gene locus_tag LOCUS_03200 323540 323004 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038981.1 protein_id gnl|my_center|LOCUS_03200 324640 323537 gene locus_tag LOCUS_03210 gene srpA 324640 323537 CDS product catalase-related peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P411 protein_id gnl|my_center|LOCUS_03210 326144 324777 gene locus_tag LOCUS_03220 326144 324777 CDS product cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038979.1 protein_id gnl|my_center|LOCUS_03220 326867 326148 gene locus_tag LOCUS_03230 326867 326148 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038978.1 protein_id gnl|my_center|LOCUS_03230 328008 326899 gene locus_tag LOCUS_03240 gene yhhT 328008 326899 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038977.1 protein_id gnl|my_center|LOCUS_03240 328531 328076 gene locus_tag LOCUS_03250 328531 328076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038976.1 protein_id gnl|my_center|LOCUS_03250 328998 328528 gene locus_tag LOCUS_03260 328998 328528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038975.1 protein_id gnl|my_center|LOCUS_03260 329369 329007 gene locus_tag LOCUS_03270 329369 329007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038974.1 protein_id gnl|my_center|LOCUS_03270 330904 329471 gene locus_tag LOCUS_03280 gene htrA 330904 329471 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038973.1 protein_id gnl|my_center|LOCUS_03280 331395 332282 gene locus_tag LOCUS_03290 331395 332282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 332345 333070 gene locus_tag LOCUS_03300 332345 333070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 333445 333086 gene locus_tag LOCUS_03310 333445 333086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036378.1 protein_id gnl|my_center|LOCUS_03310 335939 333537 gene locus_tag LOCUS_03320 335939 333537 CDS product putative dipeptidyl peptidase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703651.1 protein_id gnl|my_center|LOCUS_03320 336150 336722 gene locus_tag LOCUS_03330 336150 336722 CDS product Ax21 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035461.1 protein_id gnl|my_center|LOCUS_03330 336920 337597 gene locus_tag LOCUS_03340 336920 337597 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406371.1 protein_id gnl|my_center|LOCUS_03340 337993 337604 gene locus_tag LOCUS_03350 337993 337604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036195.1 protein_id gnl|my_center|LOCUS_03350 338191 338871 gene locus_tag LOCUS_03360 338191 338871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 340019 338868 gene locus_tag LOCUS_03370 340019 338868 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816947.1 protein_id gnl|my_center|LOCUS_03370 340160 341047 gene locus_tag LOCUS_03380 340160 341047 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035743.1 protein_id gnl|my_center|LOCUS_03380 341483 341016 gene locus_tag LOCUS_03390 341483 341016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035532.1 protein_id gnl|my_center|LOCUS_03390 341597 342349 gene locus_tag LOCUS_03400 341597 342349 CDS product NADP-dependent 3-hydroxy acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038939.1 protein_id gnl|my_center|LOCUS_03400 343382 342477 gene locus_tag LOCUS_03410 343382 342477 CDS product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038937.1 protein_id gnl|my_center|LOCUS_03410 345092 343404 gene locus_tag LOCUS_03420 gene argS 345092 343404 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P455 protein_id gnl|my_center|LOCUS_03420 345948 345208 gene locus_tag LOCUS_03430 345948 345208 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P456 protein_id gnl|my_center|LOCUS_03430 346609 345983 gene locus_tag LOCUS_03440 346609 345983 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704956.1 protein_id gnl|my_center|LOCUS_03440 346810 348099 gene locus_tag LOCUS_03450 gene dfp 346810 348099 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038934.1 protein_id gnl|my_center|LOCUS_03450 348096 348569 gene locus_tag LOCUS_03460 gene dut 348096 348569 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P458 protein_id gnl|my_center|LOCUS_03460 348582 350930 gene locus_tag LOCUS_03470 348582 350930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 351739 351026 gene locus_tag LOCUS_03480 gene kdpE 351739 351026 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035945.1 protein_id gnl|my_center|LOCUS_03480 354380 351720 gene locus_tag LOCUS_03490 gene kdpD 354380 351720 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035944.1 protein_id gnl|my_center|LOCUS_03490 355082 354432 gene locus_tag LOCUS_03500 gene kdpC 355082 354432 CDS product potassium-transporting ATPase KdpC subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCM0 protein_id gnl|my_center|LOCUS_03500 357136 355079 gene locus_tag LOCUS_03510 gene kdpB 357136 355079 CDS product potassium-transporting ATPase ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCM1 protein_id gnl|my_center|LOCUS_03510 358856 357147 gene locus_tag LOCUS_03520 gene kdpA 358856 357147 CDS product potassium-transporting ATPase potassium-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCM2 protein_id gnl|my_center|LOCUS_03520 359782 359135 gene locus_tag LOCUS_03530 359782 359135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038923.1 protein_id gnl|my_center|LOCUS_03530 360479 359820 gene locus_tag LOCUS_03540 gene pyrE 360479 359820 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P469 protein_id gnl|my_center|LOCUS_03540 360849 362048 gene locus_tag LOCUS_03550 360849 362048 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098087.1 protein_id gnl|my_center|LOCUS_03550 362205 361975 gene locus_tag LOCUS_03560 362205 361975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 362410 362195 gene locus_tag LOCUS_03570 362410 362195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 362744 362349 gene locus_tag LOCUS_03580 362744 362349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 363376 362741 gene locus_tag LOCUS_03590 363376 362741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 363966 363367 gene locus_tag LOCUS_03600 363966 363367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 364445 363966 gene locus_tag LOCUS_03610 364445 363966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 364737 364423 gene locus_tag LOCUS_03620 364737 364423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 364994 364734 gene locus_tag LOCUS_03630 364994 364734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 365242 364991 gene locus_tag LOCUS_03640 365242 364991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 365621 365235 gene locus_tag LOCUS_03650 365621 365235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 365900 365646 gene locus_tag LOCUS_03660 365900 365646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 366147 365893 gene locus_tag LOCUS_03670 366147 365893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 366404 366144 gene locus_tag LOCUS_03680 366404 366144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 367284 366595 gene locus_tag LOCUS_03690 367284 366595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705721.1 protein_id gnl|my_center|LOCUS_03690 367330 367641 gene locus_tag LOCUS_03700 367330 367641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 367748 368200 gene locus_tag LOCUS_03710 367748 368200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 368197 368541 gene locus_tag LOCUS_03720 368197 368541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 >Feature sequence02 92 439 gene locus_tag LOCUS_03730 92 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 460 1539 gene locus_tag LOCUS_03740 460 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 1536 1988 gene locus_tag LOCUS_03750 1536 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 3541 2045 gene locus_tag LOCUS_03760 3541 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 3974 4858 gene locus_tag LOCUS_03770 3974 4858 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537992.1 protein_id gnl|my_center|LOCUS_03770 4960 6099 gene locus_tag LOCUS_03780 4960 6099 CDS product virion core protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037207.1 protein_id gnl|my_center|LOCUS_03780 6120 7472 gene locus_tag LOCUS_03790 6120 7472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037206.1 protein_id gnl|my_center|LOCUS_03790 7469 7726 gene locus_tag LOCUS_03800 7469 7726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 8717 7821 gene locus_tag LOCUS_03810 8717 7821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 11029 8735 gene locus_tag LOCUS_03820 gene fyuA 11029 8735 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206776.1 protein_id gnl|my_center|LOCUS_03820 11153 11797 gene locus_tag LOCUS_03830 11153 11797 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298113.1 protein_id gnl|my_center|LOCUS_03830 11879 12505 gene locus_tag LOCUS_03840 11879 12505 CDS product putative 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8C7 protein_id gnl|my_center|LOCUS_03840 12621 13475 gene locus_tag LOCUS_03850 12621 13475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03850 13539 14330 gene locus_tag LOCUS_03860 13539 14330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03860 14736 15248 gene locus_tag LOCUS_03870 14736 15248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 16372 15188 gene locus_tag LOCUS_03880 16372 15188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03880 18313 17132 gene locus_tag LOCUS_03890 18313 17132 CDS product efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974436.1 protein_id gnl|my_center|LOCUS_03890 18569 19285 gene locus_tag LOCUS_03900 18569 19285 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705233.1 protein_id gnl|my_center|LOCUS_03900 19286 20365 gene locus_tag LOCUS_03910 19286 20365 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390680.1 protein_id gnl|my_center|LOCUS_03910 20545 21465 gene locus_tag LOCUS_03920 20545 21465 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096386.1 protein_id gnl|my_center|LOCUS_03920 22100 21486 gene locus_tag LOCUS_03930 22100 21486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 22270 23106 gene locus_tag LOCUS_03940 22270 23106 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013339.1 protein_id gnl|my_center|LOCUS_03940 23302 25479 gene locus_tag LOCUS_03950 gene bauA 23302 25479 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207286.1 protein_id gnl|my_center|LOCUS_03950 25532 25831 gene locus_tag LOCUS_03960 25532 25831 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813607.1 protein_id gnl|my_center|LOCUS_03960 25828 27438 gene locus_tag LOCUS_03970 25828 27438 CDS product iron uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065178.1 protein_id gnl|my_center|LOCUS_03970 27435 27713 gene locus_tag LOCUS_03980 27435 27713 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035505.1 protein_id gnl|my_center|LOCUS_03980 28870 27782 gene locus_tag LOCUS_03990 28870 27782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888703.1 protein_id gnl|my_center|LOCUS_03990 29526 28948 gene locus_tag LOCUS_04000 29526 28948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 29836 31971 gene locus_tag LOCUS_04010 gene bauA 29836 31971 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207286.1 protein_id gnl|my_center|LOCUS_04010 32506 32030 gene locus_tag LOCUS_04020 32506 32030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 33145 32780 gene locus_tag LOCUS_04030 33145 32780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 34570 33629 gene locus_tag LOCUS_04040 34570 33629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 35378 34668 gene locus_tag LOCUS_04050 gene cupC2 35378 34668 CDS product chaperone CupC2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112554.1 protein_id gnl|my_center|LOCUS_04050 36540 35572 gene locus_tag LOCUS_04060 36540 35572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 39113 36582 gene locus_tag LOCUS_04070 gene cupB3 39113 36582 CDS product usher CupB3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895669.1 protein_id gnl|my_center|LOCUS_04070 39977 39252 gene locus_tag LOCUS_04080 39977 39252 CDS product fimbrial chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095625.1 protein_id gnl|my_center|LOCUS_04080 40551 40033 gene locus_tag LOCUS_04090 40551 40033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 41236 40976 gene locus_tag LOCUS_04100 41236 40976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 41939 41262 gene locus_tag LOCUS_04110 41939 41262 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529671.1 protein_id gnl|my_center|LOCUS_04110 41996 42640 gene locus_tag LOCUS_04120 41996 42640 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529671.1 protein_id gnl|my_center|LOCUS_04120 43197 42667 gene locus_tag LOCUS_04130 43197 42667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 46075 43100 gene locus_tag LOCUS_04140 46075 43100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 48756 46108 gene locus_tag LOCUS_04150 48756 46108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 48867 49850 gene locus_tag LOCUS_04160 48867 49850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 49947 50906 gene locus_tag LOCUS_04170 gene pip 49947 50906 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC98 protein_id gnl|my_center|LOCUS_04170 52277 50916 gene locus_tag LOCUS_04180 52277 50916 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083034.1 protein_id gnl|my_center|LOCUS_04180 52963 52274 gene locus_tag LOCUS_04190 52963 52274 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764042.1 protein_id gnl|my_center|LOCUS_04190 56073 52960 gene locus_tag LOCUS_04200 56073 52960 CDS product resistance-nodulation-cell division efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147398.1 protein_id gnl|my_center|LOCUS_04200 57248 56070 gene locus_tag LOCUS_04210 57248 56070 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103503.1 protein_id gnl|my_center|LOCUS_04210 57499 57804 gene locus_tag LOCUS_04220 57499 57804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 58126 58425 gene locus_tag LOCUS_04230 58126 58425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 58489 61248 gene locus_tag LOCUS_04240 gene mgtA 58489 61248 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808882.1 protein_id gnl|my_center|LOCUS_04240 61280 62017 gene locus_tag LOCUS_04250 61280 62017 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706774.1 protein_id gnl|my_center|LOCUS_04250 62198 63253 gene locus_tag LOCUS_04260 62198 63253 CDS product two component sensor kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064429.1 protein_id gnl|my_center|LOCUS_04260 63246 63887 gene locus_tag LOCUS_04270 63246 63887 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064428.1 protein_id gnl|my_center|LOCUS_04270 64400 63939 gene locus_tag LOCUS_04280 64400 63939 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217944.1 protein_id gnl|my_center|LOCUS_04280 64675 65871 gene locus_tag LOCUS_04290 64675 65871 CDS product merozoite surface protein 3b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120335.1 protein_id gnl|my_center|LOCUS_04290 65885 67372 gene locus_tag LOCUS_04300 65885 67372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 67389 68816 gene locus_tag LOCUS_04310 67389 68816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 69991 68813 gene locus_tag LOCUS_04320 69991 68813 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088460.1 protein_id gnl|my_center|LOCUS_04320 70267 70001 gene locus_tag LOCUS_04330 70267 70001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101434.1 protein_id gnl|my_center|LOCUS_04330 70469 70993 gene locus_tag LOCUS_04340 70469 70993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 70990 71841 gene locus_tag LOCUS_04350 70990 71841 CDS product sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112389.1 protein_id gnl|my_center|LOCUS_04350 71922 74339 gene locus_tag LOCUS_04360 71922 74339 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074066.1 protein_id gnl|my_center|LOCUS_04360 74435 75307 gene locus_tag LOCUS_04370 74435 75307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 75944 75405 gene locus_tag LOCUS_04380 75944 75405 CDS product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403905.1 protein_id gnl|my_center|LOCUS_04380 78713 76428 gene locus_tag LOCUS_04390 gene fdhF 78713 76428 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083112.1 protein_id gnl|my_center|LOCUS_04390 78959 79804 gene locus_tag LOCUS_04400 gene fdhD 78959 79804 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P888 protein_id gnl|my_center|LOCUS_04400 80443 79907 gene locus_tag LOCUS_04410 gene mip 80443 79907 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P219 protein_id gnl|my_center|LOCUS_04410 80550 81440 gene locus_tag LOCUS_04420 80550 81440 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063703.1 protein_id gnl|my_center|LOCUS_04420 82094 81534 gene locus_tag LOCUS_04430 82094 81534 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015249.1 protein_id gnl|my_center|LOCUS_04430 83631 82099 gene locus_tag LOCUS_04440 83631 82099 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015248.1 protein_id gnl|my_center|LOCUS_04440 84529 83783 gene locus_tag LOCUS_04450 84529 83783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 85155 84529 gene locus_tag LOCUS_04460 85155 84529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 85681 85145 gene locus_tag LOCUS_04470 85681 85145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114096.1 protein_id gnl|my_center|LOCUS_04470 86961 85708 gene locus_tag LOCUS_04480 86961 85708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113046.1 protein_id gnl|my_center|LOCUS_04480 87616 86954 gene locus_tag LOCUS_04490 87616 86954 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093325.1 protein_id gnl|my_center|LOCUS_04490 88179 87646 gene locus_tag LOCUS_04500 88179 87646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 88230 88688 gene locus_tag LOCUS_04510 88230 88688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 90934 88802 gene locus_tag LOCUS_04520 90934 88802 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388620.1 protein_id gnl|my_center|LOCUS_04520 91123 91971 gene locus_tag LOCUS_04530 91123 91971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 92930 92037 gene locus_tag LOCUS_04540 92930 92037 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530651.1 protein_id gnl|my_center|LOCUS_04540 96234 93163 gene locus_tag LOCUS_04550 96234 93163 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765563.1 protein_id gnl|my_center|LOCUS_04550 97403 96231 gene locus_tag LOCUS_04560 97403 96231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 98554 97400 gene locus_tag LOCUS_04570 98554 97400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 98710 99384 gene locus_tag LOCUS_04580 98710 99384 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526208.1 protein_id gnl|my_center|LOCUS_04580 99377 100759 gene locus_tag LOCUS_04590 99377 100759 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930991.1 protein_id gnl|my_center|LOCUS_04590 103531 101180 gene locus_tag LOCUS_04600 103531 101180 CDS product sugar hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036281.1 protein_id gnl|my_center|LOCUS_04600 104087 103803 gene locus_tag LOCUS_04610 104087 103803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 104313 106199 gene locus_tag LOCUS_04620 104313 106199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 106615 106860 gene locus_tag LOCUS_04630 106615 106860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 106936 107532 gene locus_tag LOCUS_04640 106936 107532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 107874 107551 gene locus_tag LOCUS_04650 gene trxA 107874 107551 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035340.1 protein_id gnl|my_center|LOCUS_04650 108296 107880 gene locus_tag LOCUS_04660 gene atsE 108296 107880 CDS product attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035339.1 protein_id gnl|my_center|LOCUS_04660 108803 110290 gene locus_tag LOCUS_04670 gene proP 108803 110290 CDS product proline/betaine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035341.1 protein_id gnl|my_center|LOCUS_04670 110954 110331 gene locus_tag LOCUS_04680 110954 110331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 111299 110958 gene locus_tag LOCUS_04690 111299 110958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 112957 111371 gene locus_tag LOCUS_04700 112957 111371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 113371 112967 gene locus_tag LOCUS_04710 113371 112967 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920851.1 protein_id gnl|my_center|LOCUS_04710 114865 113489 gene locus_tag LOCUS_04720 114865 113489 CDS product peptide signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206010.1 protein_id gnl|my_center|LOCUS_04720 115798 115034 gene locus_tag LOCUS_04730 115798 115034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002041986.1 protein_id gnl|my_center|LOCUS_04730 118975 115853 gene locus_tag LOCUS_04740 118975 115853 CDS product receptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206009.1 protein_id gnl|my_center|LOCUS_04740 120114 119158 gene locus_tag LOCUS_04750 120114 119158 CDS product iron dicitrate transporter FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389193.1 protein_id gnl|my_center|LOCUS_04750 120700 120197 gene locus_tag LOCUS_04760 120700 120197 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389192.1 protein_id gnl|my_center|LOCUS_04760 121765 120839 gene locus_tag LOCUS_04770 121765 120839 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197652.1 protein_id gnl|my_center|LOCUS_04770 121916 122782 gene locus_tag LOCUS_04780 121916 122782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191946.1 protein_id gnl|my_center|LOCUS_04780 122860 123540 gene locus_tag LOCUS_04790 122860 123540 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111283.1 protein_id gnl|my_center|LOCUS_04790 123602 124000 gene locus_tag LOCUS_04800 123602 124000 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190295.1 protein_id gnl|my_center|LOCUS_04800 124393 124064 gene locus_tag LOCUS_04810 124393 124064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 126237 124492 gene locus_tag LOCUS_04820 126237 124492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112715.1 protein_id gnl|my_center|LOCUS_04820 126942 126280 gene locus_tag LOCUS_04830 126942 126280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 127395 126982 gene locus_tag LOCUS_04840 gene exbD2 127395 126982 CDS product transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085366.1 protein_id gnl|my_center|LOCUS_04840 129190 127406 gene locus_tag LOCUS_04850 gene exbB2 129190 127406 CDS product transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112717.1 protein_id gnl|my_center|LOCUS_04850 130788 129229 gene locus_tag LOCUS_04860 130788 129229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112718.1 protein_id gnl|my_center|LOCUS_04860 130721 130942 gene locus_tag LOCUS_04870 130721 130942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 131044 131379 gene locus_tag LOCUS_04880 131044 131379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 131944 131414 gene locus_tag LOCUS_04890 131944 131414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 131991 132437 gene locus_tag LOCUS_04900 131991 132437 CDS product type II secretion system protein GspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112728.1 protein_id gnl|my_center|LOCUS_04900 132434 132796 gene locus_tag LOCUS_04910 132434 132796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 132793 133407 gene locus_tag LOCUS_04920 132793 133407 CDS product pseudopilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112729.1 protein_id gnl|my_center|LOCUS_04920 145449 133627 gene locus_tag LOCUS_04930 145449 133627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147216.1 protein_id gnl|my_center|LOCUS_04930 145714 146103 gene locus_tag LOCUS_04940 145714 146103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 147392 146256 gene locus_tag LOCUS_04950 gene phoA2 147392 146256 CDS product alkaline phosphatase L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35482 protein_id gnl|my_center|LOCUS_04950 148809 147610 gene locus_tag LOCUS_04960 148809 147610 CDS product type II secretion system protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112721.1 protein_id gnl|my_center|LOCUS_04960 150250 148817 gene locus_tag LOCUS_04970 gene hxcR 150250 148817 CDS product putative type II secretion system protein HxcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5N9 protein_id gnl|my_center|LOCUS_04970 152625 150247 gene locus_tag LOCUS_04980 152625 150247 CDS product type II secretion system protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009315212.1 protein_id gnl|my_center|LOCUS_04980 153158 152631 gene locus_tag LOCUS_04990 153158 152631 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112724.1 protein_id gnl|my_center|LOCUS_04990 154318 153155 gene locus_tag LOCUS_05000 154318 153155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 155220 154315 gene locus_tag LOCUS_05010 155220 154315 CDS product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5P3 protein_id gnl|my_center|LOCUS_05010 155667 155230 gene locus_tag LOCUS_05020 155667 155230 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085349.1 protein_id gnl|my_center|LOCUS_05020 156309 155725 gene locus_tag LOCUS_05030 156309 155725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 156980 156429 gene locus_tag LOCUS_05040 156980 156429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 158019 157039 gene locus_tag LOCUS_05050 gene vreR 158019 157039 CDS product sigma factor regulator VreR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106396.1 protein_id gnl|my_center|LOCUS_05050 158619 158089 gene locus_tag LOCUS_05060 158619 158089 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384951.1 protein_id gnl|my_center|LOCUS_05060 159265 158636 gene locus_tag LOCUS_05070 159265 158636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 160002 162527 gene locus_tag LOCUS_05080 gene piuB 160002 162527 CDS product iron-uptake factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039027.1 protein_id gnl|my_center|LOCUS_05080 165125 162573 gene locus_tag LOCUS_05090 165125 162573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 165299 166168 gene locus_tag LOCUS_05100 gene nhoA 165299 166168 CDS product N-hydroxyarylamine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187915.1 protein_id gnl|my_center|LOCUS_05100 166602 166231 gene locus_tag LOCUS_05110 166602 166231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114616.1 protein_id gnl|my_center|LOCUS_05110 167275 166625 gene locus_tag LOCUS_05120 167275 166625 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035367.1 protein_id gnl|my_center|LOCUS_05120 168360 167260 gene locus_tag LOCUS_05130 168360 167260 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035366.1 protein_id gnl|my_center|LOCUS_05130 168522 168944 gene locus_tag LOCUS_05140 168522 168944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 168971 170494 gene locus_tag LOCUS_05150 168971 170494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918222.1 protein_id gnl|my_center|LOCUS_05150 170556 171272 gene locus_tag LOCUS_05160 170556 171272 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225220.1 protein_id gnl|my_center|LOCUS_05160 173937 171325 gene locus_tag LOCUS_05170 gene cirA 173937 171325 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037527.1 protein_id gnl|my_center|LOCUS_05170 175225 174074 gene locus_tag LOCUS_05180 175225 174074 CDS product phosphonate metabolism protein PhnM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113124.1 protein_id gnl|my_center|LOCUS_05180 175317 176063 gene locus_tag LOCUS_05190 175317 176063 CDS product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203732.1 protein_id gnl|my_center|LOCUS_05190 177273 176119 gene locus_tag LOCUS_05200 177273 176119 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813122.1 protein_id gnl|my_center|LOCUS_05200 178580 177285 gene locus_tag LOCUS_05210 178580 177285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918537.1 protein_id gnl|my_center|LOCUS_05210 179266 178577 gene locus_tag LOCUS_05220 179266 178577 CDS product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729800.1 protein_id gnl|my_center|LOCUS_05220 180261 179356 gene locus_tag LOCUS_05230 gene ampR 180261 179356 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038862.1 protein_id gnl|my_center|LOCUS_05230 182083 180536 gene locus_tag LOCUS_05240 182083 180536 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382881.1 protein_id gnl|my_center|LOCUS_05240 182153 182986 gene locus_tag LOCUS_05250 182153 182986 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197725.1 protein_id gnl|my_center|LOCUS_05250 183593 183000 gene locus_tag LOCUS_05260 183593 183000 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390815.1 protein_id gnl|my_center|LOCUS_05260 184206 183610 gene locus_tag LOCUS_05270 184206 183610 CDS product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390814.1 protein_id gnl|my_center|LOCUS_05270 184333 184866 gene locus_tag LOCUS_05280 184333 184866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 185727 184900 gene locus_tag LOCUS_05290 185727 184900 CDS product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919769.1 protein_id gnl|my_center|LOCUS_05290 185891 186631 gene locus_tag LOCUS_05300 185891 186631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 186983 187432 gene locus_tag LOCUS_05310 gene aroQ 186983 187432 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD27 protein_id gnl|my_center|LOCUS_05310 187429 187854 gene locus_tag LOCUS_05320 187429 187854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972297.1 protein_id gnl|my_center|LOCUS_05320 187908 188387 gene locus_tag LOCUS_05330 gene bccP 187908 188387 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035766.1 protein_id gnl|my_center|LOCUS_05330 188398 189765 gene locus_tag LOCUS_05340 gene accC 188398 189765 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035764.1 protein_id gnl|my_center|LOCUS_05340 190267 189893 gene locus_tag LOCUS_05350 190267 189893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035763.1 protein_id gnl|my_center|LOCUS_05350 191229 190264 gene locus_tag LOCUS_05360 191229 190264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035762.1 protein_id gnl|my_center|LOCUS_05360 191348 192301 gene locus_tag LOCUS_05370 gene prmA 191348 192301 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD33 protein_id gnl|my_center|LOCUS_05370 192308 193114 gene locus_tag LOCUS_05380 192308 193114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05380 193308 193505 gene locus_tag LOCUS_05390 193308 193505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 194628 193633 gene locus_tag LOCUS_05400 gene cdsA 194628 193633 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035755.1 protein_id gnl|my_center|LOCUS_05400 195254 194625 gene locus_tag LOCUS_05410 195254 194625 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035754.1 protein_id gnl|my_center|LOCUS_05410 195705 195268 gene locus_tag LOCUS_05420 195705 195268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 197036 195702 gene locus_tag LOCUS_05430 197036 195702 CDS product ser/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035750.1 protein_id gnl|my_center|LOCUS_05430 198787 197036 gene locus_tag LOCUS_05440 198787 197036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035749.1 protein_id gnl|my_center|LOCUS_05440 199446 198826 gene locus_tag LOCUS_05450 gene pgsA 199446 198826 CDS product CDP-alcohol phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035748.1 protein_id gnl|my_center|LOCUS_05450 199656 201239 gene locus_tag LOCUS_05460 gene purH 199656 201239 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD47 protein_id gnl|my_center|LOCUS_05460 201271 202134 gene locus_tag LOCUS_05470 201271 202134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 202193 203476 gene locus_tag LOCUS_05480 gene purD 202193 203476 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD48 protein_id gnl|my_center|LOCUS_05480 203894 203562 gene locus_tag LOCUS_05490 203894 203562 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891162.1 protein_id gnl|my_center|LOCUS_05490 204222 203878 gene locus_tag LOCUS_05500 204222 203878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388677.1 protein_id gnl|my_center|LOCUS_05500 205309 204434 gene locus_tag LOCUS_05510 gene rpoH 205309 204434 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H9L4M9 protein_id gnl|my_center|LOCUS_05510 206301 205588 gene locus_tag LOCUS_05520 gene ung 206301 205588 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4D7 protein_id gnl|my_center|LOCUS_05520 207140 206298 gene locus_tag LOCUS_05530 207140 206298 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038855.1 protein_id gnl|my_center|LOCUS_05530 208095 207148 gene locus_tag LOCUS_05540 gene ftsX 208095 207148 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4D5 protein_id gnl|my_center|LOCUS_05540 208785 208099 gene locus_tag LOCUS_05550 gene ftsE 208785 208099 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003484499.1 protein_id gnl|my_center|LOCUS_05550 210640 208919 gene locus_tag LOCUS_05560 gene rhlB 210640 208919 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4D4 protein_id gnl|my_center|LOCUS_05560 211120 210815 gene locus_tag LOCUS_05570 211120 210815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 211152 211481 gene locus_tag LOCUS_05580 gene trxA 211152 211481 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4D3 protein_id gnl|my_center|LOCUS_05580 211710 213461 gene locus_tag LOCUS_05590 211710 213461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 214598 213531 gene locus_tag LOCUS_05600 214598 213531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 217247 214716 gene locus_tag LOCUS_05610 217247 214716 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229330.1 protein_id gnl|my_center|LOCUS_05610 217134 217346 gene locus_tag LOCUS_05620 217134 217346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 217589 218596 gene locus_tag LOCUS_05630 217589 218596 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919916.1 protein_id gnl|my_center|LOCUS_05630 219891 218614 gene locus_tag LOCUS_05640 gene fucP 219891 218614 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036694.1 protein_id gnl|my_center|LOCUS_05640 220332 223289 gene locus_tag LOCUS_05650 gene iroN 220332 223289 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039035.1 protein_id gnl|my_center|LOCUS_05650 223354 224370 gene locus_tag LOCUS_05660 223354 224370 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039037.1 protein_id gnl|my_center|LOCUS_05660 224485 226059 gene locus_tag LOCUS_05670 224485 226059 CDS product cell signaling regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817287.1 protein_id gnl|my_center|LOCUS_05670 226986 226096 gene locus_tag LOCUS_05680 226986 226096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038860.1 protein_id gnl|my_center|LOCUS_05680 228778 227048 gene locus_tag LOCUS_05690 gene aceK 228778 227048 CDS product isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4D0 protein_id gnl|my_center|LOCUS_05690 229284 228925 gene locus_tag LOCUS_05700 229284 228925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003656109.1 protein_id gnl|my_center|LOCUS_05700 229757 229341 gene locus_tag LOCUS_05710 229757 229341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 230298 229750 gene locus_tag LOCUS_05720 230298 229750 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207703.1 protein_id gnl|my_center|LOCUS_05720 231256 230291 gene locus_tag LOCUS_05730 231256 230291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 233761 231539 gene locus_tag LOCUS_05740 gene icd 233761 231539 CDS product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038863.1 protein_id gnl|my_center|LOCUS_05740 234522 233992 gene locus_tag LOCUS_05750 234522 233992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 235168 234656 gene locus_tag LOCUS_05760 235168 234656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038864.1 protein_id gnl|my_center|LOCUS_05760 235508 235215 gene locus_tag LOCUS_05770 235508 235215 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038865.1 protein_id gnl|my_center|LOCUS_05770 236496 235678 gene locus_tag LOCUS_05780 gene queF 236496 235678 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4C5 protein_id gnl|my_center|LOCUS_05780 >Feature sequence03 86 2245 gene locus_tag LOCUS_05790 gene yoaA 86 2245 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038053.1 protein_id gnl|my_center|LOCUS_05790 2255 2968 gene locus_tag LOCUS_05800 2255 2968 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038052.1 protein_id gnl|my_center|LOCUS_05800 4427 3543 gene locus_tag LOCUS_05810 gene tonB 4427 3543 CDS product cell envelope biogenesis protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038050.1 protein_id gnl|my_center|LOCUS_05810 5374 4427 gene locus_tag LOCUS_05820 gene gshB 5374 4427 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6P1 protein_id gnl|my_center|LOCUS_05820 5663 6016 gene locus_tag LOCUS_05830 gene pilG 5663 6016 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038048.1 protein_id gnl|my_center|LOCUS_05830 6035 6397 gene locus_tag LOCUS_05840 gene pilH 6035 6397 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038047.1 protein_id gnl|my_center|LOCUS_05840 6397 6927 gene locus_tag LOCUS_05850 gene pilI 6397 6927 CDS product pilus biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038046.1 protein_id gnl|my_center|LOCUS_05850 6969 9005 gene locus_tag LOCUS_05860 gene pilJ 6969 9005 CDS product pilus biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038045.1 protein_id gnl|my_center|LOCUS_05860 9106 15675 gene locus_tag LOCUS_05870 9106 15675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 15662 16984 gene locus_tag LOCUS_05880 15662 16984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038043.1 protein_id gnl|my_center|LOCUS_05880 16981 17445 gene locus_tag LOCUS_05890 16981 17445 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038042.1 protein_id gnl|my_center|LOCUS_05890 18261 17524 gene locus_tag LOCUS_05900 18261 17524 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6T0 protein_id gnl|my_center|LOCUS_05900 19643 18252 gene locus_tag LOCUS_05910 gene bioA 19643 18252 CDS product adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038009.1 protein_id gnl|my_center|LOCUS_05910 19721 20284 gene locus_tag LOCUS_05920 gene nudE 19721 20284 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038008.1 protein_id gnl|my_center|LOCUS_05920 20281 21084 gene locus_tag LOCUS_05930 gene cysQ 20281 21084 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638230.2 protein_id gnl|my_center|LOCUS_05930 21098 21937 gene locus_tag LOCUS_05940 gene mazG 21098 21937 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038006.1 protein_id gnl|my_center|LOCUS_05940 21934 22263 gene locus_tag LOCUS_05950 21934 22263 CDS product UPF0060 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6T5 protein_id gnl|my_center|LOCUS_05950 22387 22689 gene locus_tag LOCUS_05960 22387 22689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192500.1 protein_id gnl|my_center|LOCUS_05960 22757 23716 gene locus_tag LOCUS_05970 22757 23716 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038004.1 protein_id gnl|my_center|LOCUS_05970 23718 24161 gene locus_tag LOCUS_05980 23718 24161 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038003.1 protein_id gnl|my_center|LOCUS_05980 24214 25353 gene locus_tag LOCUS_05990 gene gcvT 24214 25353 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6T8 protein_id gnl|my_center|LOCUS_05990 25447 25842 gene locus_tag LOCUS_06000 gene gcvH 25447 25842 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6T9 protein_id gnl|my_center|LOCUS_06000 26385 26603 gene locus_tag LOCUS_06010 26385 26603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 26657 27041 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aagaaggcagtgaagaagg 28823 27423 gene locus_tag LOCUS_06020 gene bla 28823 27423 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037998.1 protein_id gnl|my_center|LOCUS_06020 29091 30437 gene locus_tag LOCUS_06030 29091 30437 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037997.1 protein_id gnl|my_center|LOCUS_06030 30468 30818 gene locus_tag LOCUS_06040 30468 30818 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037996.1 protein_id gnl|my_center|LOCUS_06040 30932 31393 gene locus_tag LOCUS_06050 30932 31393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 31767 31300 gene locus_tag LOCUS_06060 31767 31300 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038810.1 protein_id gnl|my_center|LOCUS_06060 34320 31843 gene locus_tag LOCUS_06070 gene fadE 34320 31843 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037995.1 protein_id gnl|my_center|LOCUS_06070 35234 34317 gene locus_tag LOCUS_06080 35234 34317 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037994.1 protein_id gnl|my_center|LOCUS_06080 35376 35978 gene locus_tag LOCUS_06090 35376 35978 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037993.1 protein_id gnl|my_center|LOCUS_06090 38860 36116 gene locus_tag LOCUS_06100 gene btuB 38860 36116 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037992.1 protein_id gnl|my_center|LOCUS_06100 40100 39252 gene locus_tag LOCUS_06110 40100 39252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037991.1 protein_id gnl|my_center|LOCUS_06110 41110 40217 gene locus_tag LOCUS_06120 41110 40217 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6V0 protein_id gnl|my_center|LOCUS_06120 41188 41937 gene locus_tag LOCUS_06130 gene mtgA 41188 41937 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6V1 protein_id gnl|my_center|LOCUS_06130 42001 43020 gene locus_tag LOCUS_06140 gene gtrB 42001 43020 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037988.1 protein_id gnl|my_center|LOCUS_06140 42980 43411 gene locus_tag LOCUS_06150 42980 43411 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037987.1 protein_id gnl|my_center|LOCUS_06150 45636 43663 gene locus_tag LOCUS_06160 45636 43663 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037986.1 protein_id gnl|my_center|LOCUS_06160 46359 45721 gene locus_tag LOCUS_06170 gene hly3 46359 45721 CDS product hemolysin III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037985.1 protein_id gnl|my_center|LOCUS_06170 48138 46534 gene locus_tag LOCUS_06180 gene prfC 48138 46534 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6V6 protein_id gnl|my_center|LOCUS_06180 49089 48205 gene locus_tag LOCUS_06190 49089 48205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638206.2 protein_id gnl|my_center|LOCUS_06190 49435 50466 gene locus_tag LOCUS_06200 gene metA 49435 50466 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6V8 protein_id gnl|my_center|LOCUS_06200 50463 51698 gene locus_tag LOCUS_06210 gene metB 50463 51698 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037981.1 protein_id gnl|my_center|LOCUS_06210 51695 52762 gene locus_tag LOCUS_06220 51695 52762 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6W0 protein_id gnl|my_center|LOCUS_06220 53790 52795 gene locus_tag LOCUS_06230 53790 52795 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037979.1 protein_id gnl|my_center|LOCUS_06230 55252 53870 gene locus_tag LOCUS_06240 gene sdaA 55252 53870 CDS product L-serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037978.1 protein_id gnl|my_center|LOCUS_06240 55352 55582 gene locus_tag LOCUS_06250 55352 55582 CDS product NrdH-redoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037977.1 protein_id gnl|my_center|LOCUS_06250 56230 55658 gene locus_tag LOCUS_06260 56230 55658 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037976.1 protein_id gnl|my_center|LOCUS_06260 56806 56234 gene locus_tag LOCUS_06270 gene yodB 56806 56234 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037975.1 protein_id gnl|my_center|LOCUS_06270 57449 56817 gene locus_tag LOCUS_06280 57449 56817 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037974.1 protein_id gnl|my_center|LOCUS_06280 57615 61160 gene locus_tag LOCUS_06290 57615 61160 CDS product histidine kinase/response regulator hybrid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638195.2 protein_id gnl|my_center|LOCUS_06290 61256 64783 gene locus_tag LOCUS_06300 61256 64783 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037971.1 protein_id gnl|my_center|LOCUS_06300 66731 65322 gene locus_tag LOCUS_06310 gene emrA 66731 65322 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037970.1 protein_id gnl|my_center|LOCUS_06310 67897 66824 gene locus_tag LOCUS_06320 gene hemE 67897 66824 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6X1 protein_id gnl|my_center|LOCUS_06320 68172 67933 gene locus_tag LOCUS_06330 68172 67933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037968.1 protein_id gnl|my_center|LOCUS_06330 69384 68272 gene locus_tag LOCUS_06340 gene aroB 69384 68272 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6X3 protein_id gnl|my_center|LOCUS_06340 69923 69381 gene locus_tag LOCUS_06350 gene aroK 69923 69381 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6X4 protein_id gnl|my_center|LOCUS_06350 70022 70225 gene locus_tag LOCUS_06360 70022 70225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 71041 70232 gene locus_tag LOCUS_06370 71041 70232 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920748.1 protein_id gnl|my_center|LOCUS_06370 71100 71699 gene locus_tag LOCUS_06380 gene pdxH 71100 71699 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6X5 protein_id gnl|my_center|LOCUS_06380 71908 72381 gene locus_tag LOCUS_06390 71908 72381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097792.1 protein_id gnl|my_center|LOCUS_06390 74042 72459 gene locus_tag LOCUS_06400 gene prpR 74042 72459 CDS product propionate catabolism operon regulatory protein PrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036230.1 protein_id gnl|my_center|LOCUS_06400 74152 75090 gene locus_tag LOCUS_06410 gene prpB 74152 75090 CDS product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBT8 protein_id gnl|my_center|LOCUS_06410 75127 76284 gene locus_tag LOCUS_06420 gene prpC 75127 76284 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBT7 protein_id gnl|my_center|LOCUS_06420 76382 79000 gene locus_tag LOCUS_06430 76382 79000 CDS product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115200.1 protein_id gnl|my_center|LOCUS_06430 79052 80230 gene locus_tag LOCUS_06440 79052 80230 CDS product putative methylaconitate Delta-isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036236.1 protein_id gnl|my_center|LOCUS_06440 80302 81762 gene locus_tag LOCUS_06450 gene prpD 80302 81762 CDS product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930897.1 protein_id gnl|my_center|LOCUS_06450 81909 86816 gene locus_tag LOCUS_06460 81909 86816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036239.1 protein_id gnl|my_center|LOCUS_06460 86878 89247 gene locus_tag LOCUS_06470 gene pbpC 86878 89247 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036244.1 protein_id gnl|my_center|LOCUS_06470 89937 89362 gene locus_tag LOCUS_06480 89937 89362 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036245.1 protein_id gnl|my_center|LOCUS_06480 90449 89967 gene locus_tag LOCUS_06490 90449 89967 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036246.1 protein_id gnl|my_center|LOCUS_06490 90711 91604 gene locus_tag LOCUS_06500 gene cbpA 90711 91604 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036248.1 protein_id gnl|my_center|LOCUS_06500 92050 91679 gene locus_tag LOCUS_06510 gene pilH 92050 91679 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036249.1 protein_id gnl|my_center|LOCUS_06510 93134 92139 gene locus_tag LOCUS_06520 93134 92139 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941435.1 protein_id gnl|my_center|LOCUS_06520 93288 94421 gene locus_tag LOCUS_06530 gene hflK 93288 94421 CDS product HflK protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036250.1 protein_id gnl|my_center|LOCUS_06530 94418 95281 gene locus_tag LOCUS_06540 gene hflC 94418 95281 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBR8 protein_id gnl|my_center|LOCUS_06540 95350 95535 gene locus_tag LOCUS_06550 95350 95535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 95861 97153 gene locus_tag LOCUS_06560 gene purA 95861 97153 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBR6 protein_id gnl|my_center|LOCUS_06560 97713 98183 gene locus_tag LOCUS_06570 97713 98183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 98310 98981 gene locus_tag LOCUS_06580 98310 98981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 99729 99085 gene locus_tag LOCUS_06590 99729 99085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 100693 99734 gene locus_tag LOCUS_06600 100693 99734 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038316.1 protein_id gnl|my_center|LOCUS_06600 100929 103055 gene locus_tag LOCUS_06610 gene tsr 100929 103055 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637243.2 protein_id gnl|my_center|LOCUS_06610 103468 103142 gene locus_tag LOCUS_06620 103468 103142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 103388 104101 gene locus_tag LOCUS_06630 103388 104101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 104527 104111 gene locus_tag LOCUS_06640 104527 104111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 104636 105358 gene locus_tag LOCUS_06650 104636 105358 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036308.1 protein_id gnl|my_center|LOCUS_06650 105441 106808 gene locus_tag LOCUS_06660 gene gabP 105441 106808 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037940.1 protein_id gnl|my_center|LOCUS_06660 106912 107322 gene locus_tag LOCUS_06670 106912 107322 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106807.1 protein_id gnl|my_center|LOCUS_06670 110282 107415 gene locus_tag LOCUS_06680 gene gcvP 110282 107415 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBK7 protein_id gnl|my_center|LOCUS_06680 110724 111974 gene locus_tag LOCUS_06690 gene bcr 110724 111974 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036313.1 protein_id gnl|my_center|LOCUS_06690 112115 113011 gene locus_tag LOCUS_06700 112115 113011 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100352.1 protein_id gnl|my_center|LOCUS_06700 113094 113486 gene locus_tag LOCUS_06710 113094 113486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 115549 113585 gene locus_tag LOCUS_06720 115549 113585 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036316.1 protein_id gnl|my_center|LOCUS_06720 117798 116149 gene locus_tag LOCUS_06730 gene yjdB 117798 116149 CDS product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036317.1 protein_id gnl|my_center|LOCUS_06730 118442 117795 gene locus_tag LOCUS_06740 118442 117795 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036318.1 protein_id gnl|my_center|LOCUS_06740 120362 118659 gene locus_tag LOCUS_06750 120362 118659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636494.2 protein_id gnl|my_center|LOCUS_06750 120478 121206 gene locus_tag LOCUS_06760 gene colR 120478 121206 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036320.1 protein_id gnl|my_center|LOCUS_06760 121193 122479 gene locus_tag LOCUS_06770 gene colS 121193 122479 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036321.1 protein_id gnl|my_center|LOCUS_06770 123024 122635 gene locus_tag LOCUS_06780 123024 122635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 123159 124409 gene locus_tag LOCUS_06790 123159 124409 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037853.1 protein_id gnl|my_center|LOCUS_06790 124595 125725 gene locus_tag LOCUS_06800 124595 125725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707631.1 protein_id gnl|my_center|LOCUS_06800 126455 126231 gene locus_tag LOCUS_06810 126455 126231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037849.1 protein_id gnl|my_center|LOCUS_06810 128536 126455 gene locus_tag LOCUS_06820 gene cstA 128536 126455 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037848.1 protein_id gnl|my_center|LOCUS_06820 128752 129603 gene locus_tag LOCUS_06830 128752 129603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037847.1 protein_id gnl|my_center|LOCUS_06830 130190 129732 gene locus_tag LOCUS_06840 130190 129732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037845.1 protein_id gnl|my_center|LOCUS_06840 131106 130387 gene locus_tag LOCUS_06850 gene aqpZ 131106 130387 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGM8 protein_id gnl|my_center|LOCUS_06850 132090 131227 gene locus_tag LOCUS_06860 132090 131227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037844.1 protein_id gnl|my_center|LOCUS_06860 134746 132683 gene locus_tag LOCUS_06870 gene fadB 134746 132683 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036460.1 protein_id gnl|my_center|LOCUS_06870 134982 135602 gene locus_tag LOCUS_06880 gene algU 134982 135602 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036461.1 protein_id gnl|my_center|LOCUS_06880 135599 136480 gene locus_tag LOCUS_06890 135599 136480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036462.1 protein_id gnl|my_center|LOCUS_06890 136555 138090 gene locus_tag LOCUS_06900 gene mucD 136555 138090 CDS product peptidase S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036463.1 protein_id gnl|my_center|LOCUS_06900 138093 138182 gene locus_tag LOCUS_t00020 138093 138182 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 138256 140064 gene locus_tag LOCUS_06910 gene lepA 138256 140064 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB55 protein_id gnl|my_center|LOCUS_06910 140119 140913 gene locus_tag LOCUS_06920 gene lepB 140119 140913 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB54 protein_id gnl|my_center|LOCUS_06920 140966 141349 gene locus_tag LOCUS_06930 140966 141349 CDS product DUF4845 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036466.1 protein_id gnl|my_center|LOCUS_06930 141339 142019 gene locus_tag LOCUS_06940 gene rnc 141339 142019 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB52 protein_id gnl|my_center|LOCUS_06940 142016 142912 gene locus_tag LOCUS_06950 gene era 142016 142912 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB51 protein_id gnl|my_center|LOCUS_06950 142931 143650 gene locus_tag LOCUS_06960 gene recO 142931 143650 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB50 protein_id gnl|my_center|LOCUS_06960 144907 144179 gene locus_tag LOCUS_06970 144907 144179 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036470.1 protein_id gnl|my_center|LOCUS_06970 145036 146370 gene locus_tag LOCUS_06980 gene rlmD 145036 146370 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB48 protein_id gnl|my_center|LOCUS_06980 146380 146889 gene locus_tag LOCUS_06990 146380 146889 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036473.1 protein_id gnl|my_center|LOCUS_06990 147116 146874 gene locus_tag LOCUS_07000 147116 146874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 147003 147698 gene locus_tag LOCUS_07010 gene frnE 147003 147698 CDS product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036474.1 protein_id gnl|my_center|LOCUS_07010 147864 148871 gene locus_tag LOCUS_07020 gene nagZ 147864 148871 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB42 protein_id gnl|my_center|LOCUS_07020 148871 149425 gene locus_tag LOCUS_07030 gene hpt 148871 149425 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036478.1 protein_id gnl|my_center|LOCUS_07030 149508 150254 gene locus_tag LOCUS_07040 149508 150254 CDS product putative S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB40 protein_id gnl|my_center|LOCUS_07040 150343 150549 gene locus_tag LOCUS_07050 gene scoF 150343 150549 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003488188.1 protein_id gnl|my_center|LOCUS_07050 150652 151920 gene locus_tag LOCUS_07060 150652 151920 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036480.1 protein_id gnl|my_center|LOCUS_07060 152012 152371 gene locus_tag LOCUS_07070 152012 152371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 153014 152373 gene locus_tag LOCUS_07080 153014 152373 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036481.1 protein_id gnl|my_center|LOCUS_07080 155463 153004 gene locus_tag LOCUS_07090 gene lhr2 155463 153004 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036482.1 protein_id gnl|my_center|LOCUS_07090 157067 155460 gene locus_tag LOCUS_07100 gene lig2 157067 155460 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036483.1 protein_id gnl|my_center|LOCUS_07100 158062 157064 gene locus_tag LOCUS_07110 158062 157064 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036484.1 protein_id gnl|my_center|LOCUS_07110 158176 159813 gene locus_tag LOCUS_07120 158176 159813 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268974.1 protein_id gnl|my_center|LOCUS_07120 160502 160092 gene locus_tag LOCUS_07130 160502 160092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 161001 160660 gene locus_tag LOCUS_07140 161001 160660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 162301 161126 gene locus_tag LOCUS_07150 gene atoB 162301 161126 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036490.1 protein_id gnl|my_center|LOCUS_07150 162500 165337 gene locus_tag LOCUS_07160 162500 165337 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636672.2 protein_id gnl|my_center|LOCUS_07160 166481 165384 gene locus_tag LOCUS_07170 gene leu 166481 165384 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036492.1 protein_id gnl|my_center|LOCUS_07170 166761 167834 gene locus_tag LOCUS_07180 166761 167834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635468.2 protein_id gnl|my_center|LOCUS_07180 169403 167838 gene locus_tag LOCUS_07190 gene cls 169403 167838 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037836.1 protein_id gnl|my_center|LOCUS_07190 170217 169519 gene locus_tag LOCUS_07200 170217 169519 CDS product RNA-binding protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038074.1 protein_id gnl|my_center|LOCUS_07200 170765 170274 gene locus_tag LOCUS_07210 170765 170274 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036494.1 protein_id gnl|my_center|LOCUS_07210 170837 171394 gene locus_tag LOCUS_07220 170837 171394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035985.1 protein_id gnl|my_center|LOCUS_07220 171526 171792 gene locus_tag LOCUS_07230 171526 171792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036497.1 protein_id gnl|my_center|LOCUS_07230 172963 172370 gene locus_tag LOCUS_07240 172963 172370 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036498.1 protein_id gnl|my_center|LOCUS_07240 173178 172999 gene locus_tag LOCUS_07250 173178 172999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 173305 173883 gene locus_tag LOCUS_07260 gene algU 173305 173883 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036499.1 protein_id gnl|my_center|LOCUS_07260 173880 174407 gene locus_tag LOCUS_07270 173880 174407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036500.1 protein_id gnl|my_center|LOCUS_07270 174418 175299 gene locus_tag LOCUS_07280 174418 175299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036501.1 protein_id gnl|my_center|LOCUS_07280 175531 175349 gene locus_tag LOCUS_07290 175531 175349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 175794 175543 gene locus_tag LOCUS_07300 175794 175543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 177427 176066 gene locus_tag LOCUS_07310 gene yegD 177427 176066 CDS product heat-shock protein Hsp70 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036502.1 protein_id gnl|my_center|LOCUS_07310 177597 177932 gene locus_tag LOCUS_07320 177597 177932 CDS product phosphonoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036505.1 protein_id gnl|my_center|LOCUS_07320 179091 177940 gene locus_tag LOCUS_07330 179091 177940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 179321 179923 gene locus_tag LOCUS_07340 179321 179923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036513.1 protein_id gnl|my_center|LOCUS_07340 179973 180146 gene locus_tag LOCUS_07350 179973 180146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 180143 180760 gene locus_tag LOCUS_07360 180143 180760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07360 180866 182185 gene locus_tag LOCUS_07370 gene acvB 180866 182185 CDS product virulence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036514.1 protein_id gnl|my_center|LOCUS_07370 184843 182279 gene locus_tag LOCUS_07380 184843 182279 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036515.1 protein_id gnl|my_center|LOCUS_07380 185036 185383 gene locus_tag LOCUS_07390 185036 185383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036517.1 protein_id gnl|my_center|LOCUS_07390 185861 185448 gene locus_tag LOCUS_07400 gene ydgM 185861 185448 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036529.1 protein_id gnl|my_center|LOCUS_07400 186476 185886 gene locus_tag LOCUS_07410 gene cicA 186476 185886 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036530.1 protein_id gnl|my_center|LOCUS_07410 188634 186553 gene locus_tag LOCUS_07420 gene metG 188634 186553 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAY7 protein_id gnl|my_center|LOCUS_07420 189179 188736 gene locus_tag LOCUS_07430 189179 188736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036533.1 protein_id gnl|my_center|LOCUS_07430 189901 189497 gene locus_tag LOCUS_07440 189901 189497 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036534.1 protein_id gnl|my_center|LOCUS_07440 190968 189898 gene locus_tag LOCUS_07450 190968 189898 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143091.1 protein_id gnl|my_center|LOCUS_07450 192925 190985 gene locus_tag LOCUS_07460 192925 190985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636719.2 protein_id gnl|my_center|LOCUS_07460 193805 193020 gene locus_tag LOCUS_07470 193805 193020 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036538.1 protein_id gnl|my_center|LOCUS_07470 194485 193802 gene locus_tag LOCUS_07480 194485 193802 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036539.1 protein_id gnl|my_center|LOCUS_07480 194562 195878 gene locus_tag LOCUS_07490 194562 195878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636722.2 protein_id gnl|my_center|LOCUS_07490 196334 195882 gene locus_tag LOCUS_07500 196334 195882 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037753.1 protein_id gnl|my_center|LOCUS_07500 196669 197013 gene locus_tag LOCUS_07510 196669 197013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 198688 197066 gene locus_tag LOCUS_07520 198688 197066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 200388 198685 gene locus_tag LOCUS_07530 200388 198685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 201374 200496 gene locus_tag LOCUS_07540 gene trx 201374 200496 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037752.1 protein_id gnl|my_center|LOCUS_07540 201868 201494 gene locus_tag LOCUS_07550 201868 201494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 201916 202515 gene locus_tag LOCUS_07560 201916 202515 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037751.1 protein_id gnl|my_center|LOCUS_07560 202621 205263 gene locus_tag LOCUS_07570 gene leuS 202621 205263 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7J1 protein_id gnl|my_center|LOCUS_07570 205370 205984 gene locus_tag LOCUS_07580 gene rlpB 205370 205984 CDS product LPS-assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7J3 protein_id gnl|my_center|LOCUS_07580 205998 207035 gene locus_tag LOCUS_07590 gene holA 205998 207035 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037747.1 protein_id gnl|my_center|LOCUS_07590 207039 207704 gene locus_tag LOCUS_07600 207039 207704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 207763 208173 gene locus_tag LOCUS_07610 gene rsfS 207763 208173 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7J6 protein_id gnl|my_center|LOCUS_07610 208238 208708 gene locus_tag LOCUS_07620 gene rlmH 208238 208708 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7J8 protein_id gnl|my_center|LOCUS_07620 208731 208807 gene locus_tag LOCUS_t00030 208731 208807 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 208955 209920 gene locus_tag LOCUS_07630 gene xynB 208955 209920 CDS product xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038153.1 protein_id gnl|my_center|LOCUS_07630 211362 209941 gene locus_tag LOCUS_07640 gene arcD 211362 209941 CDS product arginine:ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192541.1 protein_id gnl|my_center|LOCUS_07640 214284 211492 gene locus_tag LOCUS_07650 214284 211492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114864.1 protein_id gnl|my_center|LOCUS_07650 215143 214484 gene locus_tag LOCUS_07660 gene tonB 215143 214484 CDS product cell envelope biogenesis protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037742.1 protein_id gnl|my_center|LOCUS_07660 216098 215361 gene locus_tag LOCUS_07670 gene bp26 216098 215361 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037741.1 protein_id gnl|my_center|LOCUS_07670 216230 216838 gene locus_tag LOCUS_07680 216230 216838 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7K1 protein_id gnl|my_center|LOCUS_07680 216831 218318 gene locus_tag LOCUS_07690 gene rng 216831 218318 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037739.1 protein_id gnl|my_center|LOCUS_07690 218349 222194 gene locus_tag LOCUS_07700 218349 222194 CDS product DUF3971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037738.1 protein_id gnl|my_center|LOCUS_07700 222255 223700 gene locus_tag LOCUS_07710 gene tldD 222255 223700 CDS product TldD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037736.1 protein_id gnl|my_center|LOCUS_07710 224329 223742 gene locus_tag LOCUS_07720 224329 223742 CDS product UPF0307 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7K6 protein_id gnl|my_center|LOCUS_07720 224398 225765 gene locus_tag LOCUS_07730 gene pmbA 224398 225765 CDS product PmbA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037734.1 protein_id gnl|my_center|LOCUS_07730 225853 226224 gene locus_tag LOCUS_07740 225853 226224 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037733.1 protein_id gnl|my_center|LOCUS_07740 227195 226317 gene locus_tag LOCUS_07750 gene ispA 227195 226317 CDS product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037730.1 protein_id gnl|my_center|LOCUS_07750 227445 227185 gene locus_tag LOCUS_07760 gene xseB 227445 227185 CDS product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7L2 protein_id gnl|my_center|LOCUS_07760 228768 227482 gene locus_tag LOCUS_07770 gene tilS 228768 227482 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7L3 protein_id gnl|my_center|LOCUS_07770 229856 229311 gene locus_tag LOCUS_07780 229856 229311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 231559 229853 gene locus_tag LOCUS_07790 gene phoA 231559 229853 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037727.1 protein_id gnl|my_center|LOCUS_07790 231713 233047 gene locus_tag LOCUS_07800 gene gltT 231713 233047 CDS product amino acid:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037726.1 protein_id gnl|my_center|LOCUS_07800 234082 233309 gene locus_tag LOCUS_07810 234082 233309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037714.1 protein_id gnl|my_center|LOCUS_07810 234606 234214 gene locus_tag LOCUS_07820 234606 234214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 >Feature sequence04 <1 2285 gene locus_tag LOCUS_07830 <1 2285 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105056.1:heterokaryon incompatibility induction protein PhcA 2282 2905 gene locus_tag LOCUS_07840 2282 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 3034 3507 gene locus_tag LOCUS_07850 3034 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 3507 4106 gene locus_tag LOCUS_07860 3507 4106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 4112 4831 gene locus_tag LOCUS_07870 4112 4831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07870 5017 5985 gene locus_tag LOCUS_07880 5017 5985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 6019 6225 gene locus_tag LOCUS_07890 6019 6225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 6228 7337 gene locus_tag LOCUS_07900 6228 7337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 7395 8489 gene locus_tag LOCUS_07910 7395 8489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 9066 8584 gene locus_tag LOCUS_07920 9066 8584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 9614 9063 gene locus_tag LOCUS_07930 9614 9063 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223369.1 protein_id gnl|my_center|LOCUS_07930 10404 9673 gene locus_tag LOCUS_07940 gene comF 10404 9673 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035643.1 protein_id gnl|my_center|LOCUS_07940 11845 10505 gene locus_tag LOCUS_07950 gene yadQ 11845 10505 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037785.1 protein_id gnl|my_center|LOCUS_07950 12049 13092 gene locus_tag LOCUS_07960 gene bioB 12049 13092 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDF0 protein_id gnl|my_center|LOCUS_07960 13160 14383 gene locus_tag LOCUS_07970 gene bioF 13160 14383 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDF1 protein_id gnl|my_center|LOCUS_07970 14402 15181 gene locus_tag LOCUS_07980 gene bioH 14402 15181 CDS product pimeloyl-[acyl-carrier protein] methyl ester esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDF3 protein_id gnl|my_center|LOCUS_07980 15211 15990 gene locus_tag LOCUS_07990 15211 15990 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035638.1 protein_id gnl|my_center|LOCUS_07990 16003 16887 gene locus_tag LOCUS_08000 gene bioC 16003 16887 CDS product malonyl-[acyl-carrier protein] O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDF5 protein_id gnl|my_center|LOCUS_08000 18157 17525 gene locus_tag LOCUS_08010 18157 17525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035634.1 protein_id gnl|my_center|LOCUS_08010 19116 18154 gene locus_tag LOCUS_08020 gene ilvA 19116 18154 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035633.1 protein_id gnl|my_center|LOCUS_08020 19291 19767 gene locus_tag LOCUS_08030 19291 19767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 20300 22189 gene locus_tag LOCUS_08040 gene mnmG 20300 22189 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDG1 protein_id gnl|my_center|LOCUS_08040 23812 22397 gene locus_tag LOCUS_08050 23812 22397 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268044.1 protein_id gnl|my_center|LOCUS_08050 26958 23809 gene locus_tag LOCUS_08060 26958 23809 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268045.1 protein_id gnl|my_center|LOCUS_08060 28170 26971 gene locus_tag LOCUS_08070 gene acrA 28170 26971 CDS product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158151.1 protein_id gnl|my_center|LOCUS_08070 28287 29690 gene locus_tag LOCUS_08080 28287 29690 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400907.1 protein_id gnl|my_center|LOCUS_08080 29687 30391 gene locus_tag LOCUS_08090 29687 30391 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546865.1 protein_id gnl|my_center|LOCUS_08090 30523 31344 gene locus_tag LOCUS_08100 30523 31344 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704031.1 protein_id gnl|my_center|LOCUS_08100 31496 32026 gene locus_tag LOCUS_08110 31496 32026 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035602.1 protein_id gnl|my_center|LOCUS_08110 32150 32839 gene locus_tag LOCUS_08120 32150 32839 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123273.1 protein_id gnl|my_center|LOCUS_08120 32836 33828 gene locus_tag LOCUS_08130 32836 33828 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268793.1 protein_id gnl|my_center|LOCUS_08130 33818 35440 gene locus_tag LOCUS_08140 33818 35440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112782.1 protein_id gnl|my_center|LOCUS_08140 35437 36621 gene locus_tag LOCUS_08150 35437 36621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 36618 37604 gene locus_tag LOCUS_08160 36618 37604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112780.1 protein_id gnl|my_center|LOCUS_08160 37601 38899 gene locus_tag LOCUS_08170 37601 38899 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104968.1 protein_id gnl|my_center|LOCUS_08170 40284 39106 gene locus_tag LOCUS_08180 40284 39106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037958.1 protein_id gnl|my_center|LOCUS_08180 40864 40292 gene locus_tag LOCUS_08190 40864 40292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339300.1 protein_id gnl|my_center|LOCUS_08190 41355 43193 gene locus_tag LOCUS_08200 gene ilvD 41355 43193 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDJ3 protein_id gnl|my_center|LOCUS_08200 43294 44466 gene locus_tag LOCUS_08210 43294 44466 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202736.1 protein_id gnl|my_center|LOCUS_08210 46661 44559 gene locus_tag LOCUS_08220 gene dinG 46661 44559 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039022.1 protein_id gnl|my_center|LOCUS_08220 47170 46817 gene locus_tag LOCUS_08230 47170 46817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 48019 47174 gene locus_tag LOCUS_08240 gene aroE 48019 47174 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3W6 protein_id gnl|my_center|LOCUS_08240 48071 48931 gene locus_tag LOCUS_08250 48071 48931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039026.1 protein_id gnl|my_center|LOCUS_08250 49298 49029 gene locus_tag LOCUS_08260 49298 49029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 50320 49331 gene locus_tag LOCUS_08270 gene hemB 50320 49331 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3W3 protein_id gnl|my_center|LOCUS_08270 51257 50340 gene locus_tag LOCUS_08280 51257 50340 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929824.1 protein_id gnl|my_center|LOCUS_08280 51628 51380 gene locus_tag LOCUS_08290 51628 51380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 51813 52280 gene locus_tag LOCUS_08300 51813 52280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039030.1 protein_id gnl|my_center|LOCUS_08300 54175 52376 gene locus_tag LOCUS_08310 54175 52376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039031.1 protein_id gnl|my_center|LOCUS_08310 54758 54243 gene locus_tag LOCUS_08320 54758 54243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039032.1 protein_id gnl|my_center|LOCUS_08320 57009 54784 gene locus_tag LOCUS_08330 57009 54784 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039033.1 protein_id gnl|my_center|LOCUS_08330 57857 57168 gene locus_tag LOCUS_08340 gene gst 57857 57168 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039034.1 protein_id gnl|my_center|LOCUS_08340 57968 58609 gene locus_tag LOCUS_08350 57968 58609 CDS product UPF0114 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P0T8 protein_id gnl|my_center|LOCUS_08350 58826 59812 gene locus_tag LOCUS_08360 58826 59812 CDS product cell envelope biogenesis protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039039.1 protein_id gnl|my_center|LOCUS_08360 60149 59895 gene locus_tag LOCUS_08370 60149 59895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528682.1 protein_id gnl|my_center|LOCUS_08370 60251 61024 gene locus_tag LOCUS_08380 60251 61024 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004546577.1 protein_id gnl|my_center|LOCUS_08380 61185 61835 gene locus_tag LOCUS_08390 61185 61835 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387744.1 protein_id gnl|my_center|LOCUS_08390 63045 61861 gene locus_tag LOCUS_08400 gene natB 63045 61861 CDS product sodium ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039040.1 protein_id gnl|my_center|LOCUS_08400 63788 63042 gene locus_tag LOCUS_08410 gene natA 63788 63042 CDS product sodium ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039041.1 protein_id gnl|my_center|LOCUS_08410 65311 63785 gene locus_tag LOCUS_08420 65311 63785 CDS product cysteine proteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039042.1 protein_id gnl|my_center|LOCUS_08420 66582 65380 gene locus_tag LOCUS_08430 66582 65380 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039866.1 protein_id gnl|my_center|LOCUS_08430 66737 67222 gene locus_tag LOCUS_08440 66737 67222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385570.1 protein_id gnl|my_center|LOCUS_08440 67456 68628 gene locus_tag LOCUS_08450 gene cbpD 67456 68628 CDS product chitin-binding protein CbpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I589 protein_id gnl|my_center|LOCUS_08450 68810 69973 gene locus_tag LOCUS_08460 gene cbpD 68810 69973 CDS product chitin-binding protein CbpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I589 protein_id gnl|my_center|LOCUS_08460 70315 70500 gene locus_tag LOCUS_08470 70315 70500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 70555 71331 gene locus_tag LOCUS_08480 70555 71331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 71400 71855 gene locus_tag LOCUS_08490 71400 71855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 72980 73426 gene locus_tag LOCUS_08500 72980 73426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 73441 74004 gene locus_tag LOCUS_08510 73441 74004 CDS product RNA polymerase sigma24 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029464.1 protein_id gnl|my_center|LOCUS_08510 74092 75315 gene locus_tag LOCUS_08520 74092 75315 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244563.1 protein_id gnl|my_center|LOCUS_08520 75316 76485 gene locus_tag LOCUS_08530 75316 76485 CDS product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920568.1 protein_id gnl|my_center|LOCUS_08530 76485 79730 gene locus_tag LOCUS_08540 76485 79730 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920570.1 protein_id gnl|my_center|LOCUS_08540 79828 81162 gene locus_tag LOCUS_08550 79828 81162 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970462.1 protein_id gnl|my_center|LOCUS_08550 81597 81274 gene locus_tag LOCUS_08560 81597 81274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 81977 82627 gene locus_tag LOCUS_08570 81977 82627 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970465.1 protein_id gnl|my_center|LOCUS_08570 82647 83297 gene locus_tag LOCUS_08580 82647 83297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970466.1 protein_id gnl|my_center|LOCUS_08580 83427 83792 gene locus_tag LOCUS_08590 83427 83792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 83881 85131 gene locus_tag LOCUS_08600 83881 85131 CDS product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920567.1 protein_id gnl|my_center|LOCUS_08600 85128 86360 gene locus_tag LOCUS_08610 85128 86360 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920247.1 protein_id gnl|my_center|LOCUS_08610 86370 89507 gene locus_tag LOCUS_08620 86370 89507 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920248.1 protein_id gnl|my_center|LOCUS_08620 89504 90235 gene locus_tag LOCUS_08630 89504 90235 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008460272.1 protein_id gnl|my_center|LOCUS_08630 90252 90893 gene locus_tag LOCUS_08640 90252 90893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970466.1 protein_id gnl|my_center|LOCUS_08640 90933 91178 gene locus_tag LOCUS_08650 90933 91178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 93512 91461 gene locus_tag LOCUS_08660 93512 91461 CDS product catecholate siderophore receptor CirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097960.1 protein_id gnl|my_center|LOCUS_08660 94393 93659 gene locus_tag LOCUS_08670 94393 93659 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976314.1 protein_id gnl|my_center|LOCUS_08670 95539 94469 gene locus_tag LOCUS_08680 95539 94469 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096673.1 protein_id gnl|my_center|LOCUS_08680 95963 96724 gene locus_tag LOCUS_08690 95963 96724 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086503.1 protein_id gnl|my_center|LOCUS_08690 97310 99478 gene locus_tag LOCUS_08700 97310 99478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 99542 101134 gene locus_tag LOCUS_08710 99542 101134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 101683 101177 gene locus_tag LOCUS_08720 101683 101177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087041.1 protein_id gnl|my_center|LOCUS_08720 102669 101680 gene locus_tag LOCUS_08730 102669 101680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 105653 103683 gene locus_tag LOCUS_08740 105653 103683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 105928 105677 gene locus_tag LOCUS_08750 105928 105677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 107800 107078 gene locus_tag LOCUS_08760 gene poxF 107800 107078 CDS product phenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639315.2 protein_id gnl|my_center|LOCUS_08760 107964 108893 gene locus_tag LOCUS_08770 gene yadG 107964 108893 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039048.1 protein_id gnl|my_center|LOCUS_08770 108890 109681 gene locus_tag LOCUS_08780 108890 109681 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3U1 protein_id gnl|my_center|LOCUS_08780 109922 110860 gene locus_tag LOCUS_08790 gene apbA 109922 110860 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3T9 protein_id gnl|my_center|LOCUS_08790 110896 111756 gene locus_tag LOCUS_08800 110896 111756 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918939.1 protein_id gnl|my_center|LOCUS_08800 112650 111823 gene locus_tag LOCUS_08810 gene mttC 112650 111823 CDS product preprotein translocase subunit TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035554.1 protein_id gnl|my_center|LOCUS_08810 112688 115192 gene locus_tag LOCUS_08820 gene hrpB 112688 115192 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035530.1 protein_id gnl|my_center|LOCUS_08820 115328 115702 gene locus_tag LOCUS_08830 115328 115702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035529.1 protein_id gnl|my_center|LOCUS_08830 116345 115776 gene locus_tag LOCUS_08840 gene rluE 116345 115776 CDS product ribosomal large subunit pseudouridine synthase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDR2 protein_id gnl|my_center|LOCUS_08840 116698 116384 gene locus_tag LOCUS_08850 116698 116384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 117606 116749 gene locus_tag LOCUS_08860 117606 116749 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035527.1 protein_id gnl|my_center|LOCUS_08860 117776 118732 gene locus_tag LOCUS_08870 gene mocA 117776 118732 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035526.1 protein_id gnl|my_center|LOCUS_08870 119379 119454 gene locus_tag LOCUS_t00040 119379 119454 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 119808 120932 gene locus_tag LOCUS_08880 119808 120932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038957.1 protein_id gnl|my_center|LOCUS_08880 120989 122209 gene locus_tag LOCUS_08890 gene rtcB 120989 122209 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P433 protein_id gnl|my_center|LOCUS_08890 122898 122278 gene locus_tag LOCUS_08900 122898 122278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 124565 122895 gene locus_tag LOCUS_08910 124565 122895 CDS product sulfate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089295.1 protein_id gnl|my_center|LOCUS_08910 123600 123506 gene locus_tag LOCUS_t00050 123600 123506 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 125647 124742 gene locus_tag LOCUS_08920 125647 124742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118999.1 protein_id gnl|my_center|LOCUS_08920 126146 125637 gene locus_tag LOCUS_08930 126146 125637 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968525.1 protein_id gnl|my_center|LOCUS_08930 126504 126220 gene locus_tag LOCUS_08940 126504 126220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 126388 128397 gene locus_tag LOCUS_08950 gene tsr 126388 128397 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035531.1 protein_id gnl|my_center|LOCUS_08950 129441 128560 gene locus_tag LOCUS_08960 129441 128560 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811189.1 protein_id gnl|my_center|LOCUS_08960 129569 130783 gene locus_tag LOCUS_08970 129569 130783 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705534.1 protein_id gnl|my_center|LOCUS_08970 130871 131680 gene locus_tag LOCUS_08980 gene dkgB 130871 131680 CDS product 2,5-diketo-D-gluconate reductase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035524.1 protein_id gnl|my_center|LOCUS_08980 132538 131795 gene locus_tag LOCUS_08990 132538 131795 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920935.1 protein_id gnl|my_center|LOCUS_08990 132662 133042 gene locus_tag LOCUS_09000 132662 133042 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62KY7 protein_id gnl|my_center|LOCUS_09000 135793 133067 gene locus_tag LOCUS_09010 135793 133067 CDS product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039059.1 protein_id gnl|my_center|LOCUS_09010 137241 135871 gene locus_tag LOCUS_09020 gene mgtE 137241 135871 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3S9 protein_id gnl|my_center|LOCUS_09020 137377 137592 gene locus_tag LOCUS_09030 137377 137592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 137585 139363 gene locus_tag LOCUS_09040 gene kefC 137585 139363 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039063.1 protein_id gnl|my_center|LOCUS_09040 142766 139428 gene locus_tag LOCUS_09050 gene ank2 142766 139428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039067.1 protein_id gnl|my_center|LOCUS_09050 143019 142759 gene locus_tag LOCUS_09060 143019 142759 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3S2 protein_id gnl|my_center|LOCUS_09060 144183 143170 gene locus_tag LOCUS_09070 gene qxtB 144183 143170 CDS product cytochrome D ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037938.1 protein_id gnl|my_center|LOCUS_09070 145582 144185 gene locus_tag LOCUS_09080 145582 144185 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037939.1 protein_id gnl|my_center|LOCUS_09080 146031 145816 gene locus_tag LOCUS_09090 146031 145816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 146681 146028 gene locus_tag LOCUS_09100 gene algU 146681 146028 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036499.1 protein_id gnl|my_center|LOCUS_09100 147048 146719 gene locus_tag LOCUS_09110 147048 146719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 147216 149585 gene locus_tag LOCUS_09120 147216 149585 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039087.1 protein_id gnl|my_center|LOCUS_09120 149582 150001 gene locus_tag LOCUS_09130 149582 150001 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895859.1 protein_id gnl|my_center|LOCUS_09130 150032 150589 gene locus_tag LOCUS_09140 150032 150589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 150625 151731 gene locus_tag LOCUS_09150 150625 151731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 151781 152677 gene locus_tag LOCUS_09160 gene hemF 151781 152677 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3Q0 protein_id gnl|my_center|LOCUS_09160 152772 153935 gene locus_tag LOCUS_09170 152772 153935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 154489 154010 gene locus_tag LOCUS_09180 154489 154010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 157592 154818 gene locus_tag LOCUS_09190 gene polA 157592 154818 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039091.1 protein_id gnl|my_center|LOCUS_09190 157691 157975 gene locus_tag LOCUS_09200 157691 157975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039092.1 protein_id gnl|my_center|LOCUS_09200 158565 158119 gene locus_tag LOCUS_09210 158565 158119 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3P5 protein_id gnl|my_center|LOCUS_09210 159341 158787 gene locus_tag LOCUS_09220 159341 158787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246043.1 protein_id gnl|my_center|LOCUS_09220 159808 159482 gene locus_tag LOCUS_09230 159808 159482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087185.1 protein_id gnl|my_center|LOCUS_09230 159895 160653 gene locus_tag LOCUS_09240 159895 160653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 162947 160755 gene locus_tag LOCUS_09250 gene uvrD 162947 160755 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3P3 protein_id gnl|my_center|LOCUS_09250 164378 162957 gene locus_tag LOCUS_09260 164378 162957 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039098.1 protein_id gnl|my_center|LOCUS_09260 165872 164424 gene locus_tag LOCUS_09270 gene cls 165872 164424 CDS product cardiolipin synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039099.1 protein_id gnl|my_center|LOCUS_09270 166238 166074 gene locus_tag LOCUS_09280 gene rpmG 166238 166074 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66239 protein_id gnl|my_center|LOCUS_09280 166488 166252 gene locus_tag LOCUS_09290 gene rpmB 166488 166252 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66161 protein_id gnl|my_center|LOCUS_09290 167235 166726 gene locus_tag LOCUS_09300 167235 166726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 168211 167318 gene locus_tag LOCUS_09310 168211 167318 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097828.1 protein_id gnl|my_center|LOCUS_09310 168320 168718 gene locus_tag LOCUS_09320 168320 168718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097827.1 protein_id gnl|my_center|LOCUS_09320 168951 169283 gene locus_tag LOCUS_09330 168951 169283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 169340 170593 gene locus_tag LOCUS_09340 gene czcC 169340 170593 CDS product outer membrane protein CzcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113317.1 protein_id gnl|my_center|LOCUS_09340 170590 171795 gene locus_tag LOCUS_09350 170590 171795 CDS product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920568.1 protein_id gnl|my_center|LOCUS_09350 171806 175015 gene locus_tag LOCUS_09360 171806 175015 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920570.1 protein_id gnl|my_center|LOCUS_09360 176921 175149 gene locus_tag LOCUS_09370 176921 175149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039109.1 protein_id gnl|my_center|LOCUS_09370 177609 177262 gene locus_tag LOCUS_09380 177609 177262 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038930.1 protein_id gnl|my_center|LOCUS_09380 178331 177609 gene locus_tag LOCUS_09390 gene dpm1 178331 177609 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038929.1 protein_id gnl|my_center|LOCUS_09390 179386 178421 gene locus_tag LOCUS_09400 gene wbnF 179386 178421 CDS product nucleotide sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038928.1 protein_id gnl|my_center|LOCUS_09400 180169 179438 gene locus_tag LOCUS_09410 180169 179438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038927.1 protein_id gnl|my_center|LOCUS_09410 181132 180296 gene locus_tag LOCUS_09420 gene parB 181132 180296 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038925.1 protein_id gnl|my_center|LOCUS_09420 182016 181219 gene locus_tag LOCUS_09430 gene parA 182016 181219 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038924.1 protein_id gnl|my_center|LOCUS_09430 182767 182129 gene locus_tag LOCUS_09440 gene rsmG 182767 182129 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3N0 protein_id gnl|my_center|LOCUS_09440 183433 182807 gene locus_tag LOCUS_09450 gene hetI 183433 182807 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039112.1 protein_id gnl|my_center|LOCUS_09450 183491 183742 gene locus_tag LOCUS_09460 183491 183742 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039113.1 protein_id gnl|my_center|LOCUS_09460 184628 183846 gene locus_tag LOCUS_09470 gene xthA1 184628 183846 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039115.1 protein_id gnl|my_center|LOCUS_09470 186150 184741 gene locus_tag LOCUS_09480 186150 184741 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8R7 protein_id gnl|my_center|LOCUS_09480 187998 186334 gene locus_tag LOCUS_09490 187998 186334 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820458.1 protein_id gnl|my_center|LOCUS_09490 189568 188141 gene locus_tag LOCUS_09500 189568 188141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639398.2 protein_id gnl|my_center|LOCUS_09500 189814 191757 gene locus_tag LOCUS_09510 gene acsA 189814 191757 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3L1 protein_id gnl|my_center|LOCUS_09510 191838 192503 gene locus_tag LOCUS_09520 gene tcsR 191838 192503 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039130.1 protein_id gnl|my_center|LOCUS_09520 192914 193489 gene locus_tag LOCUS_09530 gene mntP 192914 193489 CDS product putative manganese efflux pump MntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3J6 protein_id gnl|my_center|LOCUS_09530 197028 193582 gene locus_tag LOCUS_09540 197028 193582 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039145.1 protein_id gnl|my_center|LOCUS_09540 199311 197164 gene locus_tag LOCUS_09550 199311 197164 CDS product dipeptidyl peptidase S46 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071328.1 protein_id gnl|my_center|LOCUS_09550 199165 199076 gene locus_tag LOCUS_t00060 199165 199076 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 203343 199483 gene locus_tag LOCUS_09560 203343 199483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639423.2 protein_id gnl|my_center|LOCUS_09560 205136 203340 gene locus_tag LOCUS_09570 205136 203340 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039154.1 protein_id gnl|my_center|LOCUS_09570 207468 205393 gene locus_tag LOCUS_09580 gene glyS 207468 205393 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3I5 protein_id gnl|my_center|LOCUS_09580 208451 207540 gene locus_tag LOCUS_09590 gene glyQ 208451 207540 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3I4 protein_id gnl|my_center|LOCUS_09590 208536 210371 gene locus_tag LOCUS_09600 gene gspE 208536 210371 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039157.1 protein_id gnl|my_center|LOCUS_09600 210343 211089 gene locus_tag LOCUS_09610 gene guaA 210343 211089 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039158.1 protein_id gnl|my_center|LOCUS_09610 211140 212051 gene locus_tag LOCUS_09620 211140 212051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639429.2 protein_id gnl|my_center|LOCUS_09620 212906 212157 gene locus_tag LOCUS_09630 gene tatC 212906 212157 CDS product sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3I0 protein_id gnl|my_center|LOCUS_09630 213367 212903 gene locus_tag LOCUS_09640 213367 212903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 213649 213383 gene locus_tag LOCUS_09650 gene tatA 213649 213383 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3H8 protein_id gnl|my_center|LOCUS_09650 214579 213686 gene locus_tag LOCUS_09660 214579 213686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039163.1 protein_id gnl|my_center|LOCUS_09660 214745 215707 gene locus_tag LOCUS_09670 gene hemH 214745 215707 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3H6 protein_id gnl|my_center|LOCUS_09670 215704 216558 gene locus_tag LOCUS_09680 215704 216558 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039165.1 protein_id gnl|my_center|LOCUS_09680 216849 218954 gene locus_tag LOCUS_09690 216849 218954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 >Feature sequence05 605 75 gene locus_tag LOCUS_09700 605 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038054.1 protein_id gnl|my_center|LOCUS_09700 3049 611 gene locus_tag LOCUS_09710 gene ponB 3049 611 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6N5 protein_id gnl|my_center|LOCUS_09710 3228 2965 gene locus_tag LOCUS_09720 3228 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 3146 5245 gene locus_tag LOCUS_09730 3146 5245 CDS product glycosyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638281.2 protein_id gnl|my_center|LOCUS_09730 6807 5242 gene locus_tag LOCUS_09740 6807 5242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 8958 6838 gene locus_tag LOCUS_09750 gene relA 8958 6838 CDS product ATP--GTP 3'-pyrophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038059.1 protein_id gnl|my_center|LOCUS_09750 9125 9661 gene locus_tag LOCUS_09760 9125 9661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038064.1 protein_id gnl|my_center|LOCUS_09760 13731 9715 gene locus_tag LOCUS_09770 gene hrpA 13731 9715 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038068.1 protein_id gnl|my_center|LOCUS_09770 13884 14432 gene locus_tag LOCUS_09780 13884 14432 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038069.1 protein_id gnl|my_center|LOCUS_09780 14988 16793 gene locus_tag LOCUS_09790 gene recQ 14988 16793 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038070.1 protein_id gnl|my_center|LOCUS_09790 16961 17344 gene locus_tag LOCUS_09800 16961 17344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 17420 19243 gene locus_tag LOCUS_09810 gene copA 17420 19243 CDS product copper resistance protein CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035822.1 protein_id gnl|my_center|LOCUS_09810 19240 20205 gene locus_tag LOCUS_09820 19240 20205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 20287 20799 gene locus_tag LOCUS_09830 20287 20799 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038144.1 protein_id gnl|my_center|LOCUS_09830 21197 20883 gene locus_tag LOCUS_09840 21197 20883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942213.1 protein_id gnl|my_center|LOCUS_09840 21347 22114 gene locus_tag LOCUS_09850 21347 22114 CDS product CAAX amino protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036243.1 protein_id gnl|my_center|LOCUS_09850 22207 22629 gene locus_tag LOCUS_09860 22207 22629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 23706 22768 gene locus_tag LOCUS_09870 23706 22768 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038647.1 protein_id gnl|my_center|LOCUS_09870 24040 23789 gene locus_tag LOCUS_09880 24040 23789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 24640 24104 gene locus_tag LOCUS_09890 24640 24104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09890 25260 25520 gene locus_tag LOCUS_09900 25260 25520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 25557 25739 gene locus_tag LOCUS_09910 25557 25739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 25818 26135 gene locus_tag LOCUS_09920 25818 26135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 26285 26210 gene locus_tag LOCUS_t00070 26285 26210 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 26454 27407 gene locus_tag LOCUS_09930 26454 27407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 27744 27460 gene locus_tag LOCUS_09940 27744 27460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 28424 27759 gene locus_tag LOCUS_09950 gene queC 28424 27759 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6F6 protein_id gnl|my_center|LOCUS_09950 29204 28503 gene locus_tag LOCUS_09960 gene queE 29204 28503 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6F5 protein_id gnl|my_center|LOCUS_09960 30225 29407 gene locus_tag LOCUS_09970 30225 29407 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038132.1 protein_id gnl|my_center|LOCUS_09970 30747 30229 gene locus_tag LOCUS_09980 gene ompP6 30747 30229 CDS product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038133.1 protein_id gnl|my_center|LOCUS_09980 32130 30811 gene locus_tag LOCUS_09990 gene tolB 32130 30811 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6F2 protein_id gnl|my_center|LOCUS_09990 33371 32316 gene locus_tag LOCUS_10000 gene tolA 33371 32316 CDS product protein TolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038135.1 protein_id gnl|my_center|LOCUS_10000 33789 33361 gene locus_tag LOCUS_10010 gene tolR 33789 33361 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038136.1 protein_id gnl|my_center|LOCUS_10010 34593 33814 gene locus_tag LOCUS_10020 gene tolQ 34593 33814 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038137.1 protein_id gnl|my_center|LOCUS_10020 35035 34604 gene locus_tag LOCUS_10030 35035 34604 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038138.1 protein_id gnl|my_center|LOCUS_10030 36065 35025 gene locus_tag LOCUS_10040 gene ruvB 36065 35025 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6E7 protein_id gnl|my_center|LOCUS_10040 38370 36451 gene locus_tag LOCUS_10050 gene kup 38370 36451 CDS product putative potassium transport system protein kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6E6 protein_id gnl|my_center|LOCUS_10050 39013 38420 gene locus_tag LOCUS_10060 gene ruvA 39013 38420 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6E5 protein_id gnl|my_center|LOCUS_10060 39548 39027 gene locus_tag LOCUS_10070 gene ruvC 39548 39027 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6E4 protein_id gnl|my_center|LOCUS_10070 40384 39653 gene locus_tag LOCUS_10080 40384 39653 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6E3 protein_id gnl|my_center|LOCUS_10080 41202 40570 gene locus_tag LOCUS_10090 41202 40570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038143.1 protein_id gnl|my_center|LOCUS_10090 41799 41278 gene locus_tag LOCUS_10100 41799 41278 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038144.1 protein_id gnl|my_center|LOCUS_10100 42154 41831 gene locus_tag LOCUS_10110 42154 41831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 43922 42171 gene locus_tag LOCUS_10120 gene aspS 43922 42171 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6E0 protein_id gnl|my_center|LOCUS_10120 44080 44820 gene locus_tag LOCUS_10130 44080 44820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038146.1 protein_id gnl|my_center|LOCUS_10130 45524 44886 gene locus_tag LOCUS_10140 45524 44886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038147.1 protein_id gnl|my_center|LOCUS_10140 47140 45584 gene locus_tag LOCUS_10150 47140 45584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 48474 47245 gene locus_tag LOCUS_10160 48474 47245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 49474 48560 gene locus_tag LOCUS_10170 gene bla 49474 48560 CDS product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6D1 protein_id gnl|my_center|LOCUS_10170 49649 50515 gene locus_tag LOCUS_10180 gene ampR 49649 50515 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038155.1 protein_id gnl|my_center|LOCUS_10180 50960 50781 gene locus_tag LOCUS_10190 50960 50781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 52832 50967 gene locus_tag LOCUS_10200 gene yheS 52832 50967 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038157.1 protein_id gnl|my_center|LOCUS_10200 53169 55556 gene locus_tag LOCUS_10210 gene bfeA 53169 55556 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038158.1 protein_id gnl|my_center|LOCUS_10210 55756 57453 gene locus_tag LOCUS_10220 gene ybaL 55756 57453 CDS product cation:proton antiport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038163.1 protein_id gnl|my_center|LOCUS_10220 59022 57736 gene locus_tag LOCUS_10230 gene metB 59022 57736 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038183.1 protein_id gnl|my_center|LOCUS_10230 59205 59942 gene locus_tag LOCUS_10240 gene parR 59205 59942 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098126.1 protein_id gnl|my_center|LOCUS_10240 59939 61228 gene locus_tag LOCUS_10250 gene parS 59939 61228 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113589.1 protein_id gnl|my_center|LOCUS_10250 61369 62169 gene locus_tag LOCUS_10260 61369 62169 CDS product structural protein MipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096744.1 protein_id gnl|my_center|LOCUS_10260 64827 62242 gene locus_tag LOCUS_10270 gene clpB 64827 62242 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6A0 protein_id gnl|my_center|LOCUS_10270 65081 65575 gene locus_tag LOCUS_10280 gene femI 65081 65575 CDS product ECF sigma factor FemI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088185.1 protein_id gnl|my_center|LOCUS_10280 65565 66533 gene locus_tag LOCUS_10290 65565 66533 CDS product sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112303.1 protein_id gnl|my_center|LOCUS_10290 66587 69376 gene locus_tag LOCUS_10300 66587 69376 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815398.1 protein_id gnl|my_center|LOCUS_10300 69412 70509 gene locus_tag LOCUS_10310 gene mauG 69412 70509 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402885.1 protein_id gnl|my_center|LOCUS_10310 71869 70517 gene locus_tag LOCUS_10320 71869 70517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 72768 71944 gene locus_tag LOCUS_10330 72768 71944 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038189.1 protein_id gnl|my_center|LOCUS_10330 72940 73650 gene locus_tag LOCUS_10340 72940 73650 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038188.1 protein_id gnl|my_center|LOCUS_10340 75334 73730 gene locus_tag LOCUS_10350 75334 73730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038191.1 protein_id gnl|my_center|LOCUS_10350 77683 75965 gene locus_tag LOCUS_10360 gene poxB 77683 75965 CDS product pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098265.1 protein_id gnl|my_center|LOCUS_10360 78668 77793 gene locus_tag LOCUS_10370 78668 77793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10370 79169 78687 gene locus_tag LOCUS_10380 79169 78687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038193.1 protein_id gnl|my_center|LOCUS_10380 79387 81822 gene locus_tag LOCUS_10390 gene bfeA 79387 81822 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038194.1 protein_id gnl|my_center|LOCUS_10390 81970 82728 gene locus_tag LOCUS_10400 gene ostB 81970 82728 CDS product trehalose 6-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P690 protein_id gnl|my_center|LOCUS_10400 82718 84553 gene locus_tag LOCUS_10410 82718 84553 CDS product glucoamylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 protein_id gnl|my_center|LOCUS_10410 84550 85914 gene locus_tag LOCUS_10420 gene ostA 84550 85914 CDS product alpha,alpha-trehalose-phosphate synthase (UDP-forming) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P688 protein_id gnl|my_center|LOCUS_10420 86266 87564 gene locus_tag LOCUS_10430 86266 87564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 88015 87584 gene locus_tag LOCUS_10440 88015 87584 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038200.1 protein_id gnl|my_center|LOCUS_10440 88496 87990 gene locus_tag LOCUS_10450 88496 87990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038201.1 protein_id gnl|my_center|LOCUS_10450 89287 88517 gene locus_tag LOCUS_10460 89287 88517 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P683 protein_id gnl|my_center|LOCUS_10460 90276 89287 gene locus_tag LOCUS_10470 gene rluD 90276 89287 CDS product ribosomal large subunit pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P682 protein_id gnl|my_center|LOCUS_10470 90408 91277 gene locus_tag LOCUS_10480 gene comL 90408 91277 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P681 protein_id gnl|my_center|LOCUS_10480 93059 91425 gene locus_tag LOCUS_10490 gene nadE 93059 91425 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038206.1 protein_id gnl|my_center|LOCUS_10490 94141 93266 gene locus_tag LOCUS_10500 gene sucD 94141 93266 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P677 protein_id gnl|my_center|LOCUS_10500 95332 94163 gene locus_tag LOCUS_10510 gene sucC 95332 94163 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P676 protein_id gnl|my_center|LOCUS_10510 95737 97350 gene locus_tag LOCUS_10520 gene pilS 95737 97350 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038210.1 protein_id gnl|my_center|LOCUS_10520 97411 98784 gene locus_tag LOCUS_10530 gene pilR 97411 98784 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038211.1 protein_id gnl|my_center|LOCUS_10530 100718 98892 gene locus_tag LOCUS_10540 gene pilB 100718 98892 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038212.1 protein_id gnl|my_center|LOCUS_10540 101257 100844 gene locus_tag LOCUS_10550 gene pilA 101257 100844 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P04739 protein_id gnl|my_center|LOCUS_10550 101807 101385 gene locus_tag LOCUS_10560 gene pilE 101807 101385 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038214.1 protein_id gnl|my_center|LOCUS_10560 102162 103421 gene locus_tag LOCUS_10570 gene pilC 102162 103421 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038215.1 protein_id gnl|my_center|LOCUS_10570 103429 104292 gene locus_tag LOCUS_10580 gene xpsO 103429 104292 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56763 protein_id gnl|my_center|LOCUS_10580 104304 104915 gene locus_tag LOCUS_10590 gene coaE 104304 104915 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56764 protein_id gnl|my_center|LOCUS_10590 105360 104974 gene locus_tag LOCUS_10600 105360 104974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 107762 105777 gene locus_tag LOCUS_10610 107762 105777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536040.1 protein_id gnl|my_center|LOCUS_10610 108565 107939 gene locus_tag LOCUS_10620 108565 107939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 109200 108562 gene locus_tag LOCUS_10630 109200 108562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 110012 109197 gene locus_tag LOCUS_10640 110012 109197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535790.1 protein_id gnl|my_center|LOCUS_10640 112614 110005 gene locus_tag LOCUS_10650 112614 110005 CDS product type IV secretion protein Rhs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196687.1 protein_id gnl|my_center|LOCUS_10650 113251 112847 gene locus_tag LOCUS_10660 113251 112847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 114844 113516 gene locus_tag LOCUS_10670 gene colS 114844 113516 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038221.1 protein_id gnl|my_center|LOCUS_10670 115526 114849 gene locus_tag LOCUS_10680 gene colR 115526 114849 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003490678.1 protein_id gnl|my_center|LOCUS_10680 116008 115535 gene locus_tag LOCUS_10690 116008 115535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 116574 116098 gene locus_tag LOCUS_10700 116574 116098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 117699 116821 gene locus_tag LOCUS_10710 gene rimK 117699 116821 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P665 protein_id gnl|my_center|LOCUS_10710 117865 118230 gene locus_tag LOCUS_10720 117865 118230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 119173 118217 gene locus_tag LOCUS_10730 119173 118217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 120132 119491 gene locus_tag LOCUS_10740 120132 119491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037262.1 protein_id gnl|my_center|LOCUS_10740 120239 120559 gene locus_tag LOCUS_10750 120239 120559 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003282197.1 protein_id gnl|my_center|LOCUS_10750 121485 120595 gene locus_tag LOCUS_10760 121485 120595 CDS product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038250.1 protein_id gnl|my_center|LOCUS_10760 121764 122672 gene locus_tag LOCUS_10770 121764 122672 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277248.1 protein_id gnl|my_center|LOCUS_10770 123012 125918 gene locus_tag LOCUS_10780 123012 125918 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932586.1 protein_id gnl|my_center|LOCUS_10780 125933 127720 gene locus_tag LOCUS_10790 125933 127720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031064.1 protein_id gnl|my_center|LOCUS_10790 127717 128511 gene locus_tag LOCUS_10800 127717 128511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932587.1 protein_id gnl|my_center|LOCUS_10800 128523 130523 gene locus_tag LOCUS_10810 gene mod 128523 130523 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932588.1 protein_id gnl|my_center|LOCUS_10810 130535 133540 gene locus_tag LOCUS_10820 gene res 130535 133540 CDS product type III restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932591.1 protein_id gnl|my_center|LOCUS_10820 133621 134355 gene locus_tag LOCUS_10830 133621 134355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 134355 134624 gene locus_tag LOCUS_10840 134355 134624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 134641 135951 gene locus_tag LOCUS_10850 134641 135951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 135948 136292 gene locus_tag LOCUS_10860 135948 136292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 136285 136515 gene locus_tag LOCUS_10870 136285 136515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 136512 139187 gene locus_tag LOCUS_10880 136512 139187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 139184 140947 gene locus_tag LOCUS_10890 139184 140947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 140944 141432 gene locus_tag LOCUS_10900 140944 141432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 141423 142145 gene locus_tag LOCUS_10910 141423 142145 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001863367.1 protein_id gnl|my_center|LOCUS_10910 142138 143481 gene locus_tag LOCUS_10920 142138 143481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 143478 146834 gene locus_tag LOCUS_10930 143478 146834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 146828 148768 gene locus_tag LOCUS_10940 146828 148768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 148771 151407 gene locus_tag LOCUS_10950 148771 151407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 151404 154739 gene locus_tag LOCUS_10960 151404 154739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 156626 154770 gene locus_tag LOCUS_10970 156626 154770 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038851.1 protein_id gnl|my_center|LOCUS_10970 156924 157241 gene locus_tag LOCUS_10980 156924 157241 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888282.1 protein_id gnl|my_center|LOCUS_10980 157241 157699 gene locus_tag LOCUS_10990 157241 157699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084500.1 protein_id gnl|my_center|LOCUS_10990 157727 158086 gene locus_tag LOCUS_11000 157727 158086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038854.1 protein_id gnl|my_center|LOCUS_11000 159616 158093 gene locus_tag LOCUS_11010 159616 158093 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038230.1 protein_id gnl|my_center|LOCUS_11010 160003 159632 gene locus_tag LOCUS_11020 160003 159632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 161406 160000 gene locus_tag LOCUS_11030 161406 160000 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038229.1 protein_id gnl|my_center|LOCUS_11030 162364 161417 gene locus_tag LOCUS_11040 162364 161417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638462.2 protein_id gnl|my_center|LOCUS_11040 162735 162361 gene locus_tag LOCUS_11050 162735 162361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 163466 162972 gene locus_tag LOCUS_11060 163466 162972 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878135.1 protein_id gnl|my_center|LOCUS_11060 164409 163645 gene locus_tag LOCUS_11070 164409 163645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038859.1 protein_id gnl|my_center|LOCUS_11070 167334 164425 gene locus_tag LOCUS_11080 167334 164425 CDS product conjugative transfer ATPase, PFL_4706 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038860.1 protein_id gnl|my_center|LOCUS_11080 167783 167334 gene locus_tag LOCUS_11090 167783 167334 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038861.1 protein_id gnl|my_center|LOCUS_11090 169173 167764 gene locus_tag LOCUS_11100 169173 167764 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038862.1 protein_id gnl|my_center|LOCUS_11100 170089 169163 gene locus_tag LOCUS_11110 170089 169163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11110 170778 170086 gene locus_tag LOCUS_11120 170778 170086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 171185 170775 gene locus_tag LOCUS_11130 171185 170775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267025.1 protein_id gnl|my_center|LOCUS_11130 171558 171199 gene locus_tag LOCUS_11140 171558 171199 CDS product integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003294215.1 protein_id gnl|my_center|LOCUS_11140 171808 171575 gene locus_tag LOCUS_11150 171808 171575 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267027.1 protein_id gnl|my_center|LOCUS_11150 172188 171805 gene locus_tag LOCUS_11160 172188 171805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 173036 172287 gene locus_tag LOCUS_11170 173036 172287 CDS product integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038879.1 protein_id gnl|my_center|LOCUS_11170 175216 173033 gene locus_tag LOCUS_11180 175216 173033 CDS product conjugative coupling factor TraD, PFGI-1 class inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038880.1 protein_id gnl|my_center|LOCUS_11180 175769 175221 gene locus_tag LOCUS_11190 175769 175221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038881.1 protein_id gnl|my_center|LOCUS_11190 176371 175766 gene locus_tag LOCUS_11200 176371 175766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038882.1 protein_id gnl|my_center|LOCUS_11200 177090 176353 gene locus_tag LOCUS_11210 177090 176353 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038883.1 protein_id gnl|my_center|LOCUS_11210 177746 177105 gene locus_tag LOCUS_11220 177746 177105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 178321 177743 gene locus_tag LOCUS_11230 178321 177743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 >Feature sequence06 1494 208 gene locus_tag LOCUS_11240 1494 208 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037502.1 protein_id gnl|my_center|LOCUS_11240 2491 1613 gene locus_tag LOCUS_11250 2491 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037501.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11250 3907 2555 gene locus_tag LOCUS_11260 3907 2555 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037500.1 protein_id gnl|my_center|LOCUS_11260 4012 5508 gene locus_tag LOCUS_11270 4012 5508 CDS product gamma-glutamyl-gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102988.1 protein_id gnl|my_center|LOCUS_11270 6299 5664 gene locus_tag LOCUS_11280 6299 5664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 6447 7748 gene locus_tag LOCUS_11290 gene yhjE 6447 7748 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037495.1 protein_id gnl|my_center|LOCUS_11290 8190 7729 gene locus_tag LOCUS_11300 8190 7729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037494.1 protein_id gnl|my_center|LOCUS_11300 9619 8276 gene locus_tag LOCUS_11310 gene rrpX 9619 8276 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037493.1 protein_id gnl|my_center|LOCUS_11310 11268 9715 gene locus_tag LOCUS_11320 11268 9715 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038243.1 protein_id gnl|my_center|LOCUS_11320 13077 11467 gene locus_tag LOCUS_11330 13077 11467 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038243.1 protein_id gnl|my_center|LOCUS_11330 14399 13122 gene locus_tag LOCUS_11340 14399 13122 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037492.1 protein_id gnl|my_center|LOCUS_11340 14561 15322 gene locus_tag LOCUS_11350 gene guaA 14561 15322 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037490.1 protein_id gnl|my_center|LOCUS_11350 15319 16713 gene locus_tag LOCUS_11360 gene glnA 15319 16713 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037489.1 protein_id gnl|my_center|LOCUS_11360 16805 17914 gene locus_tag LOCUS_11370 gene potF 16805 17914 CDS product putrescine-binding periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P899 protein_id gnl|my_center|LOCUS_11370 18102 19238 gene locus_tag LOCUS_11380 gene potG 18102 19238 CDS product polyamine-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8A3 protein_id gnl|my_center|LOCUS_11380 19235 20167 gene locus_tag LOCUS_11390 gene potH 19235 20167 CDS product polyamine transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637693.2 protein_id gnl|my_center|LOCUS_11390 20164 21006 gene locus_tag LOCUS_11400 gene potI 20164 21006 CDS product putrescine ABC transporter permease PotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037481.1 protein_id gnl|my_center|LOCUS_11400 21106 22470 gene locus_tag LOCUS_11410 gene gabD 21106 22470 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037479.1 protein_id gnl|my_center|LOCUS_11410 23558 22545 gene locus_tag LOCUS_11420 gene corA 23558 22545 CDS product magnesium transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037478.1 protein_id gnl|my_center|LOCUS_11420 24836 23574 gene locus_tag LOCUS_11430 24836 23574 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037477.1 protein_id gnl|my_center|LOCUS_11430 25714 24833 gene locus_tag LOCUS_11440 gene ybeX 25714 24833 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037476.1 protein_id gnl|my_center|LOCUS_11440 26387 25779 gene locus_tag LOCUS_11450 26387 25779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037475.1 protein_id gnl|my_center|LOCUS_11450 26995 26387 gene locus_tag LOCUS_11460 26995 26387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 27534 27049 gene locus_tag LOCUS_11470 gene ybeY 27534 27049 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8B2 protein_id gnl|my_center|LOCUS_11470 28517 27531 gene locus_tag LOCUS_11480 28517 27531 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037472.1 protein_id gnl|my_center|LOCUS_11480 28893 32075 gene locus_tag LOCUS_11490 28893 32075 CDS product type IV secretion protein Rhs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196687.1 protein_id gnl|my_center|LOCUS_11490 32075 35380 gene locus_tag LOCUS_11500 gene pldA 32075 35380 CDS product phospholipase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112916.1 protein_id gnl|my_center|LOCUS_11500 36196 36987 gene locus_tag LOCUS_11510 36196 36987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 37241 38191 gene locus_tag LOCUS_11520 37241 38191 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616206.1 protein_id gnl|my_center|LOCUS_11520 38212 39135 gene locus_tag LOCUS_11530 38212 39135 CDS product ABC drugE1 family efflux system ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071850.1 protein_id gnl|my_center|LOCUS_11530 39132 40244 gene locus_tag LOCUS_11540 39132 40244 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFJ3 protein_id gnl|my_center|LOCUS_11540 41733 40318 gene locus_tag LOCUS_11550 gene miaB 41733 40318 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8B5 protein_id gnl|my_center|LOCUS_11550 42460 41840 gene locus_tag LOCUS_11560 gene gstA 42460 41840 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037470.1 protein_id gnl|my_center|LOCUS_11560 42541 43509 gene locus_tag LOCUS_11570 gene dnrO 42541 43509 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037469.1 protein_id gnl|my_center|LOCUS_11570 43556 44482 gene locus_tag LOCUS_11580 gene yjbJ 43556 44482 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037468.1 protein_id gnl|my_center|LOCUS_11580 44677 45297 gene locus_tag LOCUS_11590 gene petA 44677 45297 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8B9 protein_id gnl|my_center|LOCUS_11590 45297 46556 gene locus_tag LOCUS_11600 gene petB 45297 46556 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8C0 protein_id gnl|my_center|LOCUS_11600 46549 47298 gene locus_tag LOCUS_11610 gene petC 46549 47298 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037465.1 protein_id gnl|my_center|LOCUS_11610 47433 48068 gene locus_tag LOCUS_11620 gene sspA 47433 48068 CDS product stringent starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037464.1 protein_id gnl|my_center|LOCUS_11620 48153 48605 gene locus_tag LOCUS_11630 gene sspB 48153 48605 CDS product stringent starvation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037463.1 protein_id gnl|my_center|LOCUS_11630 48994 48644 gene locus_tag LOCUS_11640 48994 48644 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037461.1 protein_id gnl|my_center|LOCUS_11640 50063 49062 gene locus_tag LOCUS_11650 50063 49062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037639.1 protein_id gnl|my_center|LOCUS_11650 51019 50168 gene locus_tag LOCUS_11660 gene nadC 51019 50168 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037638.1 protein_id gnl|my_center|LOCUS_11660 51285 51016 gene locus_tag LOCUS_11670 51285 51016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037637.1 protein_id gnl|my_center|LOCUS_11670 51344 51847 gene locus_tag LOCUS_11680 gene purE 51344 51847 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7V5 protein_id gnl|my_center|LOCUS_11680 51844 52992 gene locus_tag LOCUS_11690 gene purK 51844 52992 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7V6 protein_id gnl|my_center|LOCUS_11690 53105 53446 gene locus_tag LOCUS_11700 53105 53446 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MAX0 protein_id gnl|my_center|LOCUS_11700 54180 53560 gene locus_tag LOCUS_11710 gene sodB 54180 53560 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7V7 protein_id gnl|my_center|LOCUS_11710 54260 54580 gene locus_tag LOCUS_11720 54260 54580 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7V8 protein_id gnl|my_center|LOCUS_11720 54577 55353 gene locus_tag LOCUS_11730 54577 55353 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037632.1 protein_id gnl|my_center|LOCUS_11730 55604 58807 gene locus_tag LOCUS_11740 gene oar 55604 58807 CDS product Oar protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037631.1 protein_id gnl|my_center|LOCUS_11740 59349 59711 gene locus_tag LOCUS_11750 59349 59711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 59754 60185 gene locus_tag LOCUS_11760 59754 60185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 60434 61828 gene locus_tag LOCUS_11770 60434 61828 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037630.1 protein_id gnl|my_center|LOCUS_11770 61990 62505 gene locus_tag LOCUS_11780 gene fimT 61990 62505 CDS product pre-pilin like leader sequence inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037629.1 protein_id gnl|my_center|LOCUS_11780 62502 62975 gene locus_tag LOCUS_11790 gene pilV 62502 62975 CDS product type IV pilus modification protein PilV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037628.1 protein_id gnl|my_center|LOCUS_11790 62978 64138 gene locus_tag LOCUS_11800 62978 64138 CDS product pilus assembly protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037627.1 protein_id gnl|my_center|LOCUS_11800 64141 64659 gene locus_tag LOCUS_11810 gene pilX 64141 64659 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037626.1 protein_id gnl|my_center|LOCUS_11810 64671 68423 gene locus_tag LOCUS_11820 64671 68423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 68462 68884 gene locus_tag LOCUS_11830 gene pilE1 68462 68884 CDS product type IV pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037623.1 protein_id gnl|my_center|LOCUS_11830 68964 69040 gene locus_tag LOCUS_t00080 68964 69040 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 69625 69089 gene locus_tag LOCUS_11840 69625 69089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 69754 71778 gene locus_tag LOCUS_11850 gene uvrB 69754 71778 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7X1 protein_id gnl|my_center|LOCUS_11850 71885 71959 gene locus_tag LOCUS_t00090 71885 71959 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 72058 72132 gene locus_tag LOCUS_t00100 72058 72132 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 72553 72227 gene locus_tag LOCUS_11860 72553 72227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 72963 72775 gene locus_tag LOCUS_11870 72963 72775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 73633 73064 gene locus_tag LOCUS_11880 73633 73064 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039132.1 protein_id gnl|my_center|LOCUS_11880 73796 73936 gene locus_tag LOCUS_11890 73796 73936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 74270 73986 gene locus_tag LOCUS_11900 74270 73986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 75069 74302 gene locus_tag LOCUS_11910 75069 74302 CDS product MltA-interacting protein MipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169267.1 protein_id gnl|my_center|LOCUS_11910 75215 75886 gene locus_tag LOCUS_11920 75215 75886 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973316.1 protein_id gnl|my_center|LOCUS_11920 75888 77231 gene locus_tag LOCUS_11930 75888 77231 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087571.1 protein_id gnl|my_center|LOCUS_11930 77291 79690 gene locus_tag LOCUS_11940 gene comA 77291 79690 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037274.1 protein_id gnl|my_center|LOCUS_11940 79694 80356 gene locus_tag LOCUS_11950 gene exbB 79694 80356 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037273.1 protein_id gnl|my_center|LOCUS_11950 80360 80782 gene locus_tag LOCUS_11960 gene exbD 80360 80782 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037272.1 protein_id gnl|my_center|LOCUS_11960 80779 82527 gene locus_tag LOCUS_11970 gene msbA 80779 82527 CDS product lipid A export ATP-binding/permease protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8W4 protein_id gnl|my_center|LOCUS_11970 82527 83546 gene locus_tag LOCUS_11980 gene lpxK 82527 83546 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8W5 protein_id gnl|my_center|LOCUS_11980 83622 84395 gene locus_tag LOCUS_11990 gene kdsB 83622 84395 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8W6 protein_id gnl|my_center|LOCUS_11990 84392 84880 gene locus_tag LOCUS_12000 84392 84880 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037268.1 protein_id gnl|my_center|LOCUS_12000 84877 86289 gene locus_tag LOCUS_12010 84877 86289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037267.1 protein_id gnl|my_center|LOCUS_12010 86286 88130 gene locus_tag LOCUS_12020 gene uvrC 86286 88130 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8W9 protein_id gnl|my_center|LOCUS_12020 88150 88779 gene locus_tag LOCUS_12030 gene pgsA 88150 88779 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037265.1 protein_id gnl|my_center|LOCUS_12030 88925 89000 gene locus_tag LOCUS_t00110 88925 89000 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 89418 90833 gene locus_tag LOCUS_12040 89418 90833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038813.1 protein_id gnl|my_center|LOCUS_12040 90830 91969 gene locus_tag LOCUS_12050 gene devC 90830 91969 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124973.1 protein_id gnl|my_center|LOCUS_12050 91980 92708 gene locus_tag LOCUS_12060 91980 92708 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919952.1 protein_id gnl|my_center|LOCUS_12060 92705 93094 gene locus_tag LOCUS_12070 92705 93094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 93055 93675 gene locus_tag LOCUS_12080 93055 93675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 94127 93678 gene locus_tag LOCUS_12090 94127 93678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 94521 94120 gene locus_tag LOCUS_12100 94521 94120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 94650 94725 gene locus_tag LOCUS_t00120 94650 94725 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 94953 96887 gene locus_tag LOCUS_12110 gene intS 94953 96887 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037264.1 protein_id gnl|my_center|LOCUS_12110 100194 97075 gene locus_tag LOCUS_12120 gene cusA 100194 97075 CDS product cation efflux system protein CusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38054 protein_id gnl|my_center|LOCUS_12120 101723 100191 gene locus_tag LOCUS_12130 101723 100191 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817192.1 protein_id gnl|my_center|LOCUS_12130 103031 101724 gene locus_tag LOCUS_12140 103031 101724 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189952.1 protein_id gnl|my_center|LOCUS_12140 103475 103107 gene locus_tag LOCUS_12150 103475 103107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 103627 103869 gene locus_tag LOCUS_12160 103627 103869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 104454 104759 gene locus_tag LOCUS_12170 104454 104759 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003282197.1 protein_id gnl|my_center|LOCUS_12170 105654 104764 gene locus_tag LOCUS_12180 105654 104764 CDS product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038250.1 protein_id gnl|my_center|LOCUS_12180 106170 105886 gene locus_tag LOCUS_12190 106170 105886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 107225 106299 gene locus_tag LOCUS_12200 107225 106299 CDS product copper resistance protein CopD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267053.1 protein_id gnl|my_center|LOCUS_12200 107616 107230 gene locus_tag LOCUS_12210 107616 107230 CDS product copper resistance protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267052.1 protein_id gnl|my_center|LOCUS_12210 109833 107758 gene locus_tag LOCUS_12220 109833 107758 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083526.1 protein_id gnl|my_center|LOCUS_12220 109937 110152 gene locus_tag LOCUS_12230 109937 110152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 110623 110351 gene locus_tag LOCUS_12240 110623 110351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 111142 110657 gene locus_tag LOCUS_12250 111142 110657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064916.1 protein_id gnl|my_center|LOCUS_12250 112160 111180 gene locus_tag LOCUS_12260 gene copB 112160 111180 CDS product copper resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040630.1 protein_id gnl|my_center|LOCUS_12260 114078 112186 gene locus_tag LOCUS_12270 gene copA 114078 112186 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931403.1 protein_id gnl|my_center|LOCUS_12270 114360 115052 gene locus_tag LOCUS_12280 gene cusR 114360 115052 CDS product transcriptional regulatory protein CusR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AD00 protein_id gnl|my_center|LOCUS_12280 115132 116460 gene locus_tag LOCUS_12290 115132 116460 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704248.1 protein_id gnl|my_center|LOCUS_12290 117408 117737 gene locus_tag LOCUS_12300 117408 117737 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811464.1 protein_id gnl|my_center|LOCUS_12300 117751 118221 gene locus_tag LOCUS_12310 117751 118221 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184724.1 protein_id gnl|my_center|LOCUS_12310 118234 118731 gene locus_tag LOCUS_12320 118234 118731 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140066.1 protein_id gnl|my_center|LOCUS_12320 118742 119827 gene locus_tag LOCUS_12330 118742 119827 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272375.1 protein_id gnl|my_center|LOCUS_12330 119842 120264 gene locus_tag LOCUS_12340 gene arsC 119842 120264 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MIZ5 protein_id gnl|my_center|LOCUS_12340 120336 120665 gene locus_tag LOCUS_12350 120336 120665 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879039.1 protein_id gnl|my_center|LOCUS_12350 120662 121891 gene locus_tag LOCUS_12360 120662 121891 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040344.1 protein_id gnl|my_center|LOCUS_12360 121897 122427 gene locus_tag LOCUS_12370 121897 122427 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112705.1 protein_id gnl|my_center|LOCUS_12370 124473 122635 gene locus_tag LOCUS_12380 124473 122635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 124826 124425 gene locus_tag LOCUS_12390 124826 124425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12390 125887 124919 gene locus_tag LOCUS_12400 gene mexE 125887 124919 CDS product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036629.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12400 128331 126409 gene locus_tag LOCUS_12410 128331 126409 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038851.1 protein_id gnl|my_center|LOCUS_12410 128572 129198 gene locus_tag LOCUS_12420 128572 129198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 129211 129843 gene locus_tag LOCUS_12430 129211 129843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 129928 130293 gene locus_tag LOCUS_12440 129928 130293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 131825 130305 gene locus_tag LOCUS_12450 131825 130305 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038230.1 protein_id gnl|my_center|LOCUS_12450 132198 131839 gene locus_tag LOCUS_12460 132198 131839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 133589 132195 gene locus_tag LOCUS_12470 133589 132195 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038229.1 protein_id gnl|my_center|LOCUS_12470 134549 133599 gene locus_tag LOCUS_12480 134549 133599 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038857.1 protein_id gnl|my_center|LOCUS_12480 134938 134546 gene locus_tag LOCUS_12490 134938 134546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 135651 135157 gene locus_tag LOCUS_12500 135651 135157 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263378.1 protein_id gnl|my_center|LOCUS_12500 136594 135827 gene locus_tag LOCUS_12510 136594 135827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038859.1 protein_id gnl|my_center|LOCUS_12510 139510 136619 gene locus_tag LOCUS_12520 139510 136619 CDS product conjugative transfer ATPase, PFL_4706 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038860.1 protein_id gnl|my_center|LOCUS_12520 139959 139510 gene locus_tag LOCUS_12530 139959 139510 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038861.1 protein_id gnl|my_center|LOCUS_12530 141358 139940 gene locus_tag LOCUS_12540 141358 139940 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038862.1 protein_id gnl|my_center|LOCUS_12540 142259 141348 gene locus_tag LOCUS_12550 142259 141348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12550 142948 142256 gene locus_tag LOCUS_12560 142948 142256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 143343 142945 gene locus_tag LOCUS_12570 143343 142945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267025.1 protein_id gnl|my_center|LOCUS_12570 143714 143355 gene locus_tag LOCUS_12580 143714 143355 CDS product integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003294215.1 protein_id gnl|my_center|LOCUS_12580 143964 143731 gene locus_tag LOCUS_12590 143964 143731 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267027.1 protein_id gnl|my_center|LOCUS_12590 144344 143961 gene locus_tag LOCUS_12600 144344 143961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103322.1 protein_id gnl|my_center|LOCUS_12600 144548 145018 gene locus_tag LOCUS_12610 144548 145018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 145015 145590 gene locus_tag LOCUS_12620 145015 145590 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887596.1 protein_id gnl|my_center|LOCUS_12620 145608 146522 gene locus_tag LOCUS_12630 145608 146522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 146519 146989 gene locus_tag LOCUS_12640 146519 146989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 146986 147486 gene locus_tag LOCUS_12650 146986 147486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 147486 148388 gene locus_tag LOCUS_12660 147486 148388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 148427 149152 gene locus_tag LOCUS_12670 148427 149152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 149162 151786 gene locus_tag LOCUS_12680 149162 151786 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267002.1 protein_id gnl|my_center|LOCUS_12680 152576 151827 gene locus_tag LOCUS_12690 152576 151827 CDS product integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038879.1 protein_id gnl|my_center|LOCUS_12690 154765 152573 gene locus_tag LOCUS_12700 154765 152573 CDS product conjugative coupling factor TraD, PFGI-1 class inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038880.1 protein_id gnl|my_center|LOCUS_12700 155318 154770 gene locus_tag LOCUS_12710 155318 154770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038881.1 protein_id gnl|my_center|LOCUS_12710 155884 155315 gene locus_tag LOCUS_12720 155884 155315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038882.1 protein_id gnl|my_center|LOCUS_12720 156624 155887 gene locus_tag LOCUS_12730 156624 155887 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038883.1 protein_id gnl|my_center|LOCUS_12730 157281 156637 gene locus_tag LOCUS_12740 157281 156637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 157877 157278 gene locus_tag LOCUS_12750 157877 157278 CDS product secreted protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038885.1 protein_id gnl|my_center|LOCUS_12750 >Feature sequence07 142 501 gene locus_tag LOCUS_12760 142 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 506 1018 gene locus_tag LOCUS_12770 506 1018 CDS product pathogenicity-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036344.1 protein_id gnl|my_center|LOCUS_12770 1174 2391 gene locus_tag LOCUS_12780 gene rfaY 1174 2391 CDS product putative RNA polymerase sigma factor RfaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46358 protein_id gnl|my_center|LOCUS_12780 3003 2443 gene locus_tag LOCUS_12790 3003 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036342.1 protein_id gnl|my_center|LOCUS_12790 3166 3915 gene locus_tag LOCUS_12800 gene ate 3166 3915 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBH8 protein_id gnl|my_center|LOCUS_12800 3954 5162 gene locus_tag LOCUS_12810 3954 5162 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036340.1 protein_id gnl|my_center|LOCUS_12810 6431 5244 gene locus_tag LOCUS_12820 gene purT 6431 5244 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBI2 protein_id gnl|my_center|LOCUS_12820 6569 7450 gene locus_tag LOCUS_12830 6569 7450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 7496 7675 gene locus_tag LOCUS_12840 7496 7675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036334.1 protein_id gnl|my_center|LOCUS_12840 7672 7851 gene locus_tag LOCUS_12850 7672 7851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036333.1 protein_id gnl|my_center|LOCUS_12850 7855 8448 gene locus_tag LOCUS_12860 7855 8448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 8458 9267 gene locus_tag LOCUS_12870 8458 9267 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036332.1 protein_id gnl|my_center|LOCUS_12870 10076 9705 gene locus_tag LOCUS_12880 10076 9705 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036330.1 protein_id gnl|my_center|LOCUS_12880 11254 10181 gene locus_tag LOCUS_12890 11254 10181 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036329.1 protein_id gnl|my_center|LOCUS_12890 12129 11488 gene locus_tag LOCUS_12900 12129 11488 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036328.1 protein_id gnl|my_center|LOCUS_12900 13337 12129 gene locus_tag LOCUS_12910 13337 12129 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036327.1 protein_id gnl|my_center|LOCUS_12910 13487 14083 gene locus_tag LOCUS_12920 13487 14083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636501.2 protein_id gnl|my_center|LOCUS_12920 14029 14874 gene locus_tag LOCUS_12930 gene minC 14029 14874 CDS product putative septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBJ4 protein_id gnl|my_center|LOCUS_12930 14910 15719 gene locus_tag LOCUS_12940 gene minD 14910 15719 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBJ5 protein_id gnl|my_center|LOCUS_12940 15722 15982 gene locus_tag LOCUS_12950 gene minE 15722 15982 CDS product cell division topological specificity factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBJ6 protein_id gnl|my_center|LOCUS_12950 16020 16508 gene locus_tag LOCUS_12960 16020 16508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036322.1 protein_id gnl|my_center|LOCUS_12960 17841 16597 gene locus_tag LOCUS_12970 17841 16597 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037853.1 protein_id gnl|my_center|LOCUS_12970 20051 17973 gene locus_tag LOCUS_12980 20051 17973 CDS product alanyl dipeptidyl peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636480.2 protein_id gnl|my_center|LOCUS_12980 22271 20307 gene locus_tag LOCUS_12990 gene oliA 22271 20307 CDS product oligopeptide transporter, OPT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036303.1 protein_id gnl|my_center|LOCUS_12990 22527 24281 gene locus_tag LOCUS_13000 gene yclF 22527 24281 CDS product putative transporter YclF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94408 protein_id gnl|my_center|LOCUS_13000 26288 24303 gene locus_tag LOCUS_13010 26288 24303 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073927.1 protein_id gnl|my_center|LOCUS_13010 28331 26361 gene locus_tag LOCUS_13020 28331 26361 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073927.1 protein_id gnl|my_center|LOCUS_13020 29147 28512 gene locus_tag LOCUS_13030 29147 28512 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807274.1 protein_id gnl|my_center|LOCUS_13030 29287 30192 gene locus_tag LOCUS_13040 29287 30192 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818466.1 protein_id gnl|my_center|LOCUS_13040 30284 30730 gene locus_tag LOCUS_13050 30284 30730 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389455.1 protein_id gnl|my_center|LOCUS_13050 31281 30793 gene locus_tag LOCUS_13060 31281 30793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 32384 31266 gene locus_tag LOCUS_13070 32384 31266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 32606 34312 gene locus_tag LOCUS_13080 gene mqo1 32606 34312 CDS product putative malate:quinone oxidoreductase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYF4 protein_id gnl|my_center|LOCUS_13080 34577 36769 gene locus_tag LOCUS_13090 gene fpvA 34577 36769 CDS product ferripyoverdine receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635553.2 protein_id gnl|my_center|LOCUS_13090 36992 38635 gene locus_tag LOCUS_13100 gene mdcA 36992 38635 CDS product malonate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038693.1 protein_id gnl|my_center|LOCUS_13100 38646 38966 gene locus_tag LOCUS_13110 gene mdcC 38646 38966 CDS product malonate decarboxylase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4U6 protein_id gnl|my_center|LOCUS_13110 38963 39871 gene locus_tag LOCUS_13120 gene mdcB 38963 39871 CDS product biotin-independent malonate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038695.1 protein_id gnl|my_center|LOCUS_13120 39868 40578 gene locus_tag LOCUS_13130 gene mdcC 39868 40578 CDS product malonate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038696.1 protein_id gnl|my_center|LOCUS_13130 40571 41212 gene locus_tag LOCUS_13140 gene mdcG 40571 41212 CDS product phosphoribosyl-dephospho-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4U3 protein_id gnl|my_center|LOCUS_13140 41251 42066 gene locus_tag LOCUS_13150 gene citG 41251 42066 CDS product putative 2-(5''-triphosphoribosyl)-3'-dephosphocoenzyme-A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4U2 protein_id gnl|my_center|LOCUS_13150 42063 42983 gene locus_tag LOCUS_13160 gene mdcH 42063 42983 CDS product malonate decarboxylase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038699.1 protein_id gnl|my_center|LOCUS_13160 43088 44455 gene locus_tag LOCUS_13170 gene matC 43088 44455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038700.1 protein_id gnl|my_center|LOCUS_13170 44561 45280 gene locus_tag LOCUS_13180 gene mdcY 44561 45280 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038701.1 protein_id gnl|my_center|LOCUS_13180 45694 45362 gene locus_tag LOCUS_13190 45694 45362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 45846 46793 gene locus_tag LOCUS_13200 45846 46793 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709461.1 protein_id gnl|my_center|LOCUS_13200 48066 46798 gene locus_tag LOCUS_13210 48066 46798 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730167.1 protein_id gnl|my_center|LOCUS_13210 48886 48113 gene locus_tag LOCUS_13220 gene algR 48886 48113 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038759.1 protein_id gnl|my_center|LOCUS_13220 49956 48883 gene locus_tag LOCUS_13230 49956 48883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 50839 49979 gene locus_tag LOCUS_13240 50839 49979 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918777.1 protein_id gnl|my_center|LOCUS_13240 51992 50979 gene locus_tag LOCUS_13250 51992 50979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 52500 52090 gene locus_tag LOCUS_13260 52500 52090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 53674 52532 gene locus_tag LOCUS_13270 53674 52532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 55274 53736 gene locus_tag LOCUS_13280 55274 53736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390497.1 protein_id gnl|my_center|LOCUS_13280 55578 55318 gene locus_tag LOCUS_13290 55578 55318 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639890.1 protein_id gnl|my_center|LOCUS_13290 56065 55556 gene locus_tag LOCUS_13300 56065 55556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 57197 56274 gene locus_tag LOCUS_13310 57197 56274 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860032.1 protein_id gnl|my_center|LOCUS_13310 57350 58324 gene locus_tag LOCUS_13320 57350 58324 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464546.1 protein_id gnl|my_center|LOCUS_13320 58828 58328 gene locus_tag LOCUS_13330 58828 58328 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972320.1 protein_id gnl|my_center|LOCUS_13330 59279 58842 gene locus_tag LOCUS_13340 59279 58842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 61092 59350 gene locus_tag LOCUS_13350 61092 59350 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971995.1 protein_id gnl|my_center|LOCUS_13350 62278 61253 gene locus_tag LOCUS_13360 62278 61253 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105224.1 protein_id gnl|my_center|LOCUS_13360 63427 62360 gene locus_tag LOCUS_13370 63427 62360 CDS product diguanylate cyclase AdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096607.1 protein_id gnl|my_center|LOCUS_13370 64578 63544 gene locus_tag LOCUS_13380 64578 63544 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919500.1 protein_id gnl|my_center|LOCUS_13380 64674 65726 gene locus_tag LOCUS_13390 64674 65726 CDS product AP endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919504.1 protein_id gnl|my_center|LOCUS_13390 65754 66971 gene locus_tag LOCUS_13400 65754 66971 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097691.1 protein_id gnl|my_center|LOCUS_13400 66984 68108 gene locus_tag LOCUS_13410 66984 68108 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097689.1 protein_id gnl|my_center|LOCUS_13410 68128 68994 gene locus_tag LOCUS_13420 68128 68994 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973789.1 protein_id gnl|my_center|LOCUS_13420 69013 69309 gene locus_tag LOCUS_13430 69013 69309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 70086 69340 gene locus_tag LOCUS_13440 70086 69340 CDS product large, multifunctional secreted protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384321.1 protein_id gnl|my_center|LOCUS_13440 70673 70098 gene locus_tag LOCUS_13450 70673 70098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973791.1 protein_id gnl|my_center|LOCUS_13450 72358 70673 gene locus_tag LOCUS_13460 72358 70673 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973790.1 protein_id gnl|my_center|LOCUS_13460 73282 72386 gene locus_tag LOCUS_13470 73282 72386 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_13470 74169 73891 gene locus_tag LOCUS_13480 74169 73891 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103251.1 protein_id gnl|my_center|LOCUS_13480 74290 75108 gene locus_tag LOCUS_13490 74290 75108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 75105 75566 gene locus_tag LOCUS_13500 75105 75566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 75766 76263 gene locus_tag LOCUS_13510 75766 76263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 77064 77891 gene locus_tag LOCUS_13520 77064 77891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837429.1 protein_id gnl|my_center|LOCUS_13520 77888 80008 gene locus_tag LOCUS_13530 77888 80008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816646.1 protein_id gnl|my_center|LOCUS_13530 80316 81266 gene locus_tag LOCUS_13540 80316 81266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 81632 82747 gene locus_tag LOCUS_13550 81632 82747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 83537 83097 gene locus_tag LOCUS_13560 83537 83097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 85255 83540 gene locus_tag LOCUS_13570 85255 83540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 87036 85483 gene locus_tag LOCUS_13580 87036 85483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 88291 87020 gene locus_tag LOCUS_13590 88291 87020 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815728.1 protein_id gnl|my_center|LOCUS_13590 89008 88418 gene locus_tag LOCUS_13600 gene ssb 89008 88418 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P778 protein_id gnl|my_center|LOCUS_13600 89301 90332 gene locus_tag LOCUS_13610 89301 90332 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037601.1 protein_id gnl|my_center|LOCUS_13610 90670 90377 gene locus_tag LOCUS_13620 90670 90377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 91131 90667 gene locus_tag LOCUS_13630 91131 90667 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705267.1 protein_id gnl|my_center|LOCUS_13630 91668 91282 gene locus_tag LOCUS_13640 91668 91282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 93523 91808 gene locus_tag LOCUS_13650 gene cgt 93523 91808 CDS product cyclomaltodextrin glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037602.1 protein_id gnl|my_center|LOCUS_13650 95010 93523 gene locus_tag LOCUS_13660 gene suc1 95010 93523 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037603.1 protein_id gnl|my_center|LOCUS_13660 97205 95007 gene locus_tag LOCUS_13670 97205 95007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637819.2 protein_id gnl|my_center|LOCUS_13670 97448 99493 gene locus_tag LOCUS_13680 gene aglA 97448 99493 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037605.1 protein_id gnl|my_center|LOCUS_13680 99745 102513 gene locus_tag LOCUS_13690 gene btuB 99745 102513 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037606.1 protein_id gnl|my_center|LOCUS_13690 104460 102847 gene locus_tag LOCUS_13700 gene aglA 104460 102847 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037608.1 protein_id gnl|my_center|LOCUS_13700 104675 105673 gene locus_tag LOCUS_13710 gene ispB 104675 105673 CDS product octaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037866.1 protein_id gnl|my_center|LOCUS_13710 106540 105770 gene locus_tag LOCUS_13720 106540 105770 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037867.1 protein_id gnl|my_center|LOCUS_13720 106694 107287 gene locus_tag LOCUS_13730 106694 107287 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181700.1 protein_id gnl|my_center|LOCUS_13730 108757 107348 gene locus_tag LOCUS_13740 gene murD 108757 107348 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P775 protein_id gnl|my_center|LOCUS_13740 110090 108738 gene locus_tag LOCUS_13750 110090 108738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037869.1 protein_id gnl|my_center|LOCUS_13750 112761 110167 gene locus_tag LOCUS_13760 gene lysA 112761 110167 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037871.1 protein_id gnl|my_center|LOCUS_13760 112771 113712 gene locus_tag LOCUS_13770 112771 113712 CDS product phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037872.1 protein_id gnl|my_center|LOCUS_13770 113834 114712 gene locus_tag LOCUS_13780 113834 114712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037873.1 protein_id gnl|my_center|LOCUS_13780 115215 114784 gene locus_tag LOCUS_13790 gene osmC 115215 114784 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037875.1 protein_id gnl|my_center|LOCUS_13790 115587 115985 gene locus_tag LOCUS_13800 gene hup 115587 115985 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037886.1 protein_id gnl|my_center|LOCUS_13800 116239 116547 gene locus_tag LOCUS_13810 116239 116547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 116604 117152 gene locus_tag LOCUS_13820 116604 117152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037889.1 protein_id gnl|my_center|LOCUS_13820 117253 117831 gene locus_tag LOCUS_13830 117253 117831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037890.1 protein_id gnl|my_center|LOCUS_13830 118387 117845 gene locus_tag LOCUS_13840 gene pfpI 118387 117845 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037891.1 protein_id gnl|my_center|LOCUS_13840 119063 118551 gene locus_tag LOCUS_13850 119063 118551 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037892.1 protein_id gnl|my_center|LOCUS_13850 119229 119684 gene locus_tag LOCUS_13860 119229 119684 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037893.1 protein_id gnl|my_center|LOCUS_13860 119702 121177 gene locus_tag LOCUS_13870 gene ynhE 119702 121177 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037894.1 protein_id gnl|my_center|LOCUS_13870 121251 122015 gene locus_tag LOCUS_13880 gene ynhD 121251 122015 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037895.1 protein_id gnl|my_center|LOCUS_13880 122015 123277 gene locus_tag LOCUS_13890 gene ynhC 122015 123277 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037896.1 protein_id gnl|my_center|LOCUS_13890 123274 124530 gene locus_tag LOCUS_13900 gene nifS 123274 124530 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P745 protein_id gnl|my_center|LOCUS_13900 124949 124638 gene locus_tag LOCUS_13910 124949 124638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 125650 125144 gene locus_tag LOCUS_13920 125650 125144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 126600 125647 gene locus_tag LOCUS_13930 126600 125647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 131934 126604 gene locus_tag LOCUS_13940 131934 126604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 132158 132697 gene locus_tag LOCUS_13950 132158 132697 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037898.1 protein_id gnl|my_center|LOCUS_13950 132694 133026 gene locus_tag LOCUS_13960 gene bedB 132694 133026 CDS product benzene 1,2-dioxygenase ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037899.1 protein_id gnl|my_center|LOCUS_13960 133202 133603 gene locus_tag LOCUS_13970 133202 133603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 133748 136048 gene locus_tag LOCUS_13980 133748 136048 CDS product iron transport receptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551717.1 protein_id gnl|my_center|LOCUS_13980 136117 136836 gene locus_tag LOCUS_13990 136117 136836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037902.1 protein_id gnl|my_center|LOCUS_13990 136847 137524 gene locus_tag LOCUS_14000 gene piuC 136847 137524 CDS product PKHD-type hydroxylase PiuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVQ7 protein_id gnl|my_center|LOCUS_14000 137690 138091 gene locus_tag LOCUS_14010 137690 138091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 138252 140672 gene locus_tag LOCUS_14020 gene bfrA 138252 140672 CDS product exogenous ferric siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815626.1 protein_id gnl|my_center|LOCUS_14020 140969 141583 gene locus_tag LOCUS_14030 140969 141583 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037903.1 protein_id gnl|my_center|LOCUS_14030 141611 142129 gene locus_tag LOCUS_14040 141611 142129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037904.1 protein_id gnl|my_center|LOCUS_14040 142205 143008 gene locus_tag LOCUS_14050 142205 143008 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037905.1 protein_id gnl|my_center|LOCUS_14050 143061 144032 gene locus_tag LOCUS_14060 gene apbE 143061 144032 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P736 protein_id gnl|my_center|LOCUS_14060 144029 145633 gene locus_tag LOCUS_14070 144029 145633 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037907.1 protein_id gnl|my_center|LOCUS_14070 146397 145786 gene locus_tag LOCUS_14080 146397 145786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037908.1 protein_id gnl|my_center|LOCUS_14080 147157 146432 gene locus_tag LOCUS_14090 147157 146432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036974.1 protein_id gnl|my_center|LOCUS_14090 148260 147175 gene locus_tag LOCUS_14100 148260 147175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098363.1 protein_id gnl|my_center|LOCUS_14100 149010 148612 gene locus_tag LOCUS_14110 gene comEA 149010 148612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005913333.1 protein_id gnl|my_center|LOCUS_14110 149140 150633 gene locus_tag LOCUS_14120 gene dapE 149140 150633 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037909.1 protein_id gnl|my_center|LOCUS_14120 150696 150971 gene locus_tag LOCUS_14130 150696 150971 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037910.1 protein_id gnl|my_center|LOCUS_14130 151035 152060 gene locus_tag LOCUS_14140 151035 152060 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037911.1 protein_id gnl|my_center|LOCUS_14140 152057 152767 gene locus_tag LOCUS_14150 gene glgC 152057 152767 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037912.1 protein_id gnl|my_center|LOCUS_14150 >Feature sequence08 490 903 gene locus_tag LOCUS_14160 490 903 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143935.1 protein_id gnl|my_center|LOCUS_14160 966 1388 gene locus_tag LOCUS_14170 966 1388 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704080.1 protein_id gnl|my_center|LOCUS_14170 1425 1835 gene locus_tag LOCUS_14180 1425 1835 CDS product extradiol dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809248.1 protein_id gnl|my_center|LOCUS_14180 1885 3171 gene locus_tag LOCUS_14190 1885 3171 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525075.1 protein_id gnl|my_center|LOCUS_14190 3281 4930 gene locus_tag LOCUS_14200 3281 4930 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038609.1 protein_id gnl|my_center|LOCUS_14200 5130 6389 gene locus_tag LOCUS_14210 5130 6389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 6379 7149 gene locus_tag LOCUS_14220 gene algR 6379 7149 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038759.1 protein_id gnl|my_center|LOCUS_14220 7168 7512 gene locus_tag LOCUS_14230 7168 7512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038758.1 protein_id gnl|my_center|LOCUS_14230 8166 7552 gene locus_tag LOCUS_14240 8166 7552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038756.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14240 9109 8522 gene locus_tag LOCUS_14250 9109 8522 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113746.1 protein_id gnl|my_center|LOCUS_14250 9243 10460 gene locus_tag LOCUS_14260 9243 10460 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113745.1 protein_id gnl|my_center|LOCUS_14260 10457 11629 gene locus_tag LOCUS_14270 10457 11629 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026832.1 protein_id gnl|my_center|LOCUS_14270 13874 11763 gene locus_tag LOCUS_14280 13874 11763 CDS product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038754.1 protein_id gnl|my_center|LOCUS_14280 14162 17113 gene locus_tag LOCUS_14290 14162 17113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 18089 17208 gene locus_tag LOCUS_14300 18089 17208 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038750.1 protein_id gnl|my_center|LOCUS_14300 18186 18596 gene locus_tag LOCUS_14310 18186 18596 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089292.1 protein_id gnl|my_center|LOCUS_14310 18628 19416 gene locus_tag LOCUS_14320 18628 19416 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038749.1 protein_id gnl|my_center|LOCUS_14320 19534 21183 gene locus_tag LOCUS_14330 gene yjcE 19534 21183 CDS product Na+:H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639007.2 protein_id gnl|my_center|LOCUS_14330 21525 21232 gene locus_tag LOCUS_14340 21525 21232 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038741.1 protein_id gnl|my_center|LOCUS_14340 21571 22113 gene locus_tag LOCUS_14350 21571 22113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038740.1 protein_id gnl|my_center|LOCUS_14350 22562 22287 gene locus_tag LOCUS_14360 22562 22287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038739.1 protein_id gnl|my_center|LOCUS_14360 23064 22576 gene locus_tag LOCUS_14370 23064 22576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14370 24156 23194 gene locus_tag LOCUS_14380 gene motB 24156 23194 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038737.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14380 25026 24160 gene locus_tag LOCUS_14390 gene motA 25026 24160 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038736.1 protein_id gnl|my_center|LOCUS_14390 25573 25106 gene locus_tag LOCUS_14400 gene msrB 25573 25106 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4Q6 protein_id gnl|my_center|LOCUS_14400 25713 26084 gene locus_tag LOCUS_14410 25713 26084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 26218 26373 gene locus_tag LOCUS_14420 26218 26373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 26908 26429 gene locus_tag LOCUS_14430 gene lrp 26908 26429 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038732.1 protein_id gnl|my_center|LOCUS_14430 27058 28362 gene locus_tag LOCUS_14440 gene dadA1 27058 28362 CDS product D-amino acid dehydrogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTQ0 protein_id gnl|my_center|LOCUS_14440 28341 29411 gene locus_tag LOCUS_14450 gene alr 28341 29411 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4R0 protein_id gnl|my_center|LOCUS_14450 30106 29540 gene locus_tag LOCUS_14460 30106 29540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 30354 32339 gene locus_tag LOCUS_14470 30354 32339 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038726.1 protein_id gnl|my_center|LOCUS_14470 32383 32676 gene locus_tag LOCUS_14480 32383 32676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038725.1 protein_id gnl|my_center|LOCUS_14480 33017 32754 gene locus_tag LOCUS_14490 33017 32754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038723.1 protein_id gnl|my_center|LOCUS_14490 33175 34239 gene locus_tag LOCUS_14500 gene rsmC 33175 34239 CDS product 16S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038722.1 protein_id gnl|my_center|LOCUS_14500 34236 34937 gene locus_tag LOCUS_14510 gene rsuA 34236 34937 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038721.1 protein_id gnl|my_center|LOCUS_14510 34934 35617 gene locus_tag LOCUS_14520 34934 35617 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038720.1 protein_id gnl|my_center|LOCUS_14520 36884 35676 gene locus_tag LOCUS_14530 gene fabB 36884 35676 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035826.1 protein_id gnl|my_center|LOCUS_14530 37399 36884 gene locus_tag LOCUS_14540 gene fabA 37399 36884 CDS product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCW9 protein_id gnl|my_center|LOCUS_14540 37591 38685 gene locus_tag LOCUS_14550 gene dinB 37591 38685 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCW8 protein_id gnl|my_center|LOCUS_14550 39735 38821 gene locus_tag LOCUS_14560 39735 38821 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083599.1 protein_id gnl|my_center|LOCUS_14560 40538 39900 gene locus_tag LOCUS_14570 40538 39900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936948.1 protein_id gnl|my_center|LOCUS_14570 40647 41576 gene locus_tag LOCUS_14580 40647 41576 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083596.1 protein_id gnl|my_center|LOCUS_14580 41573 42364 gene locus_tag LOCUS_14590 41573 42364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113379.1 protein_id gnl|my_center|LOCUS_14590 42430 43086 gene locus_tag LOCUS_14600 gene gph 42430 43086 CDS product phosphoglycolate phosphatase, bacterial inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035829.1 protein_id gnl|my_center|LOCUS_14600 45072 43228 gene locus_tag LOCUS_14610 gene btuB 45072 43228 CDS product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038182.1 protein_id gnl|my_center|LOCUS_14610 45554 46132 gene locus_tag LOCUS_14620 45554 46132 CDS product alpha-ribazole-5'-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404266.1 protein_id gnl|my_center|LOCUS_14620 46532 46170 gene locus_tag LOCUS_14630 46532 46170 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035830.1 protein_id gnl|my_center|LOCUS_14630 47011 46529 gene locus_tag LOCUS_14640 47011 46529 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035831.1 protein_id gnl|my_center|LOCUS_14640 47080 47763 gene locus_tag LOCUS_14650 gene bioD 47080 47763 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCW4 protein_id gnl|my_center|LOCUS_14650 49287 47839 gene locus_tag LOCUS_14660 49287 47839 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817442.1 protein_id gnl|my_center|LOCUS_14660 50173 49436 gene locus_tag LOCUS_14670 gene msrA 50173 49436 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89EN0 protein_id gnl|my_center|LOCUS_14670 51954 50188 gene locus_tag LOCUS_14680 51954 50188 CDS product cytochrome C biogenesis protein DipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975109.1 protein_id gnl|my_center|LOCUS_14680 52529 51957 gene locus_tag LOCUS_14690 52529 51957 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088596.1 protein_id gnl|my_center|LOCUS_14690 52673 53392 gene locus_tag LOCUS_14700 52673 53392 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704857.1 protein_id gnl|my_center|LOCUS_14700 53389 54858 gene locus_tag LOCUS_14710 53389 54858 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704858.1 protein_id gnl|my_center|LOCUS_14710 56207 54855 gene locus_tag LOCUS_14720 56207 54855 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096876.1 protein_id gnl|my_center|LOCUS_14720 56887 56198 gene locus_tag LOCUS_14730 gene rstA 56887 56198 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076440.1 protein_id gnl|my_center|LOCUS_14730 57234 59135 gene locus_tag LOCUS_14740 gene wbpS 57234 59135 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036622.1 protein_id gnl|my_center|LOCUS_14740 59824 59477 gene locus_tag LOCUS_14750 59824 59477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 60303 59941 gene locus_tag LOCUS_14760 gene ptps 60303 59941 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCW2 protein_id gnl|my_center|LOCUS_14760 60497 63136 gene locus_tag LOCUS_14770 gene btuB 60497 63136 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206610.1 protein_id gnl|my_center|LOCUS_14770 63211 65805 gene locus_tag LOCUS_14780 63211 65805 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404296.1 protein_id gnl|my_center|LOCUS_14780 67746 66325 gene locus_tag LOCUS_14790 gene rhlE 67746 66325 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035834.1 protein_id gnl|my_center|LOCUS_14790 68626 69600 gene locus_tag LOCUS_14800 gene uptA 68626 69600 CDS product fumarylacetoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035835.1 protein_id gnl|my_center|LOCUS_14800 69615 70283 gene locus_tag LOCUS_14810 gene uptB 69615 70283 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035836.1 protein_id gnl|my_center|LOCUS_14810 71790 70330 gene locus_tag LOCUS_14820 71790 70330 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038747.1 protein_id gnl|my_center|LOCUS_14820 73054 71771 gene locus_tag LOCUS_14830 73054 71771 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038748.1 protein_id gnl|my_center|LOCUS_14830 74257 73130 gene locus_tag LOCUS_14840 gene uptC 74257 73130 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035837.1 protein_id gnl|my_center|LOCUS_14840 74379 74744 gene locus_tag LOCUS_14850 gene uptD 74379 74744 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035838.1 protein_id gnl|my_center|LOCUS_14850 74741 75625 gene locus_tag LOCUS_14860 gene uptE 74741 75625 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035839.1 protein_id gnl|my_center|LOCUS_14860 75793 75957 gene locus_tag LOCUS_14870 75793 75957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 75950 76186 gene locus_tag LOCUS_14880 75950 76186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 76487 77857 gene locus_tag LOCUS_14890 gene cysB 76487 77857 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035841.1 protein_id gnl|my_center|LOCUS_14890 77991 79193 gene locus_tag LOCUS_14900 gene metB 77991 79193 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035842.1 protein_id gnl|my_center|LOCUS_14900 79190 80020 gene locus_tag LOCUS_14910 79190 80020 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FYB8 protein_id gnl|my_center|LOCUS_14910 80010 81437 gene locus_tag LOCUS_14920 80010 81437 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705992.1 protein_id gnl|my_center|LOCUS_14920 81479 85792 gene locus_tag LOCUS_14930 81479 85792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 86980 85850 gene locus_tag LOCUS_14940 gene rffE 86980 85850 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NF91 protein_id gnl|my_center|LOCUS_14940 87584 87126 gene locus_tag LOCUS_14950 87584 87126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 87730 88152 gene locus_tag LOCUS_14960 87730 88152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 89675 88173 gene locus_tag LOCUS_14970 89675 88173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 90805 89675 gene locus_tag LOCUS_14980 90805 89675 CDS product dTDP-4-amino-4,6-dideoxy-D-glucose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950550.1 protein_id gnl|my_center|LOCUS_14980 91215 90841 gene locus_tag LOCUS_14990 91215 90841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 91970 91212 gene locus_tag LOCUS_15000 91970 91212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 92931 91975 gene locus_tag LOCUS_15010 92931 91975 CDS product glucosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525085.1 protein_id gnl|my_center|LOCUS_15010 94190 93252 gene locus_tag LOCUS_15020 gene etfA 94190 93252 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035862.1 protein_id gnl|my_center|LOCUS_15020 94936 94190 gene locus_tag LOCUS_15030 gene etfB 94936 94190 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035863.1 protein_id gnl|my_center|LOCUS_15030 95233 96288 gene locus_tag LOCUS_15040 gene rfbB 95233 96288 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C7J0 protein_id gnl|my_center|LOCUS_15040 96303 97190 gene locus_tag LOCUS_15050 gene rmlA 96303 97190 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C7J4 protein_id gnl|my_center|LOCUS_15050 97187 97744 gene locus_tag LOCUS_15060 gene rmlC 97187 97744 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035866.1 protein_id gnl|my_center|LOCUS_15060 97741 98634 gene locus_tag LOCUS_15070 gene rmlD 97741 98634 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035867.1 protein_id gnl|my_center|LOCUS_15070 100113 98710 gene locus_tag LOCUS_15080 gene xanB 100113 98710 CDS product xanthan biosynthesis protein XanB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C7J3 protein_id gnl|my_center|LOCUS_15080 101471 100125 gene locus_tag LOCUS_15090 gene xanA 101471 100125 CDS product phosphohexose mutases inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C7J2 protein_id gnl|my_center|LOCUS_15090 101952 101560 gene locus_tag LOCUS_15100 101952 101560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 103235 101949 gene locus_tag LOCUS_15110 103235 101949 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229161.1 protein_id gnl|my_center|LOCUS_15110 104198 103239 gene locus_tag LOCUS_15120 104198 103239 CDS product NAD-dependent nucleoside diphosphate-sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941053.1 protein_id gnl|my_center|LOCUS_15120 104932 104195 gene locus_tag LOCUS_15130 104932 104195 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267576.1 protein_id gnl|my_center|LOCUS_15130 106239 104935 gene locus_tag LOCUS_15140 106239 104935 CDS product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267577.1 protein_id gnl|my_center|LOCUS_15140 107633 106239 gene locus_tag LOCUS_15150 107633 106239 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931866.1 protein_id gnl|my_center|LOCUS_15150 107854 108585 gene locus_tag LOCUS_15160 gene lpsI 107854 108585 CDS product succinyl-CoA:3-ketoacid coenzyme A transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C7I7 protein_id gnl|my_center|LOCUS_15160 108587 109219 gene locus_tag LOCUS_15170 gene lpsJ 108587 109219 CDS product succinyl-CoA:3-ketoacid coenzyme A transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C7I8 protein_id gnl|my_center|LOCUS_15170 109266 109853 gene locus_tag LOCUS_15180 gene alkB 109266 109853 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035874.1 protein_id gnl|my_center|LOCUS_15180 110538 109897 gene locus_tag LOCUS_15190 110538 109897 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035875.1 protein_id gnl|my_center|LOCUS_15190 111461 110535 gene locus_tag LOCUS_15200 111461 110535 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035876.1 protein_id gnl|my_center|LOCUS_15200 112292 111465 gene locus_tag LOCUS_15210 gene yrbF 112292 111465 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035877.1 protein_id gnl|my_center|LOCUS_15210 113415 112294 gene locus_tag LOCUS_15220 gene yrbE 113415 112294 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035878.1 protein_id gnl|my_center|LOCUS_15220 113508 114767 gene locus_tag LOCUS_15230 113508 114767 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035879.1 protein_id gnl|my_center|LOCUS_15230 115261 114878 gene locus_tag LOCUS_15240 115261 114878 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035880.1 protein_id gnl|my_center|LOCUS_15240 117188 115485 gene locus_tag LOCUS_15250 gene proS 117188 115485 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCS4 protein_id gnl|my_center|LOCUS_15250 118268 117852 gene locus_tag LOCUS_15260 118268 117852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035882.1 protein_id gnl|my_center|LOCUS_15260 118307 119083 gene locus_tag LOCUS_15270 gene pssA 118307 119083 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035883.1 protein_id gnl|my_center|LOCUS_15270 119080 119592 gene locus_tag LOCUS_15280 119080 119592 CDS product alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035884.1 protein_id gnl|my_center|LOCUS_15280 119589 120086 gene locus_tag LOCUS_15290 gene rimI 119589 120086 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCS0 protein_id gnl|my_center|LOCUS_15290 121012 120191 gene locus_tag LOCUS_15300 121012 120191 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703884.1 protein_id gnl|my_center|LOCUS_15300 123975 121147 gene locus_tag LOCUS_15310 gene valS 123975 121147 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCR7 protein_id gnl|my_center|LOCUS_15310 124473 124048 gene locus_tag LOCUS_15320 gene holC 124473 124048 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005995970.1 protein_id gnl|my_center|LOCUS_15320 126034 124556 gene locus_tag LOCUS_15330 gene pepA 126034 124556 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCR4 protein_id gnl|my_center|LOCUS_15330 126139 127221 gene locus_tag LOCUS_15340 126139 127221 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035891.1 protein_id gnl|my_center|LOCUS_15340 127233 128324 gene locus_tag LOCUS_15350 127233 128324 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035892.1 protein_id gnl|my_center|LOCUS_15350 128858 128412 gene locus_tag LOCUS_15360 128858 128412 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035894.1 protein_id gnl|my_center|LOCUS_15360 128960 129937 gene locus_tag LOCUS_15370 gene xerD 128960 129937 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCQ9 protein_id gnl|my_center|LOCUS_15370 130038 130829 gene locus_tag LOCUS_15380 gene dsbC 130038 130829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035896.1 protein_id gnl|my_center|LOCUS_15380 133044 130945 gene locus_tag LOCUS_15390 133044 130945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 >Feature sequence09 156 2357 gene locus_tag LOCUS_15400 gene fpvA 156 2357 CDS product ferripyoverdine receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635553.2 protein_id gnl|my_center|LOCUS_15400 2464 2778 gene locus_tag LOCUS_15410 2464 2778 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035507.1 protein_id gnl|my_center|LOCUS_15410 2775 4412 gene locus_tag LOCUS_15420 2775 4412 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035506.1 protein_id gnl|my_center|LOCUS_15420 4409 4738 gene locus_tag LOCUS_15430 4409 4738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 7077 4939 gene locus_tag LOCUS_15440 gene rlmL 7077 4939 CDS product ribosomal RNA large subunit methyltransferase K/L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAE0 protein_id gnl|my_center|LOCUS_15440 7873 7223 gene locus_tag LOCUS_15450 7873 7223 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036725.1 protein_id gnl|my_center|LOCUS_15450 7823 8389 gene locus_tag LOCUS_15460 7823 8389 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036723.1 protein_id gnl|my_center|LOCUS_15460 9531 8629 gene locus_tag LOCUS_15470 gene sseA 9531 8629 CDS product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036721.1 protein_id gnl|my_center|LOCUS_15470 10214 9528 gene locus_tag LOCUS_15480 10214 9528 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036720.1 protein_id gnl|my_center|LOCUS_15480 11182 10481 gene locus_tag LOCUS_15490 11182 10481 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CLT3 protein_id gnl|my_center|LOCUS_15490 11350 12132 gene locus_tag LOCUS_15500 gene crt 11350 12132 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036719.1 protein_id gnl|my_center|LOCUS_15500 12137 12490 gene locus_tag LOCUS_15510 12137 12490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 12490 13182 gene locus_tag LOCUS_15520 gene nth 12490 13182 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAF2 protein_id gnl|my_center|LOCUS_15520 14495 13263 gene locus_tag LOCUS_15530 14495 13263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 14994 16010 gene locus_tag LOCUS_15540 gene phoX 14994 16010 CDS product phosphate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAF6 protein_id gnl|my_center|LOCUS_15540 16603 17691 gene locus_tag LOCUS_15550 gene pstS 16603 17691 CDS product phosphate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAF7 protein_id gnl|my_center|LOCUS_15550 17774 18742 gene locus_tag LOCUS_15560 gene pstC 17774 18742 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAF8 protein_id gnl|my_center|LOCUS_15560 18742 19605 gene locus_tag LOCUS_15570 gene pstA 18742 19605 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAF9 protein_id gnl|my_center|LOCUS_15570 19625 20455 gene locus_tag LOCUS_15580 gene pstB 19625 20455 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAG0 protein_id gnl|my_center|LOCUS_15580 20521 21228 gene locus_tag LOCUS_15590 gene phoU 20521 21228 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAG1 protein_id gnl|my_center|LOCUS_15590 21453 21809 gene locus_tag LOCUS_15600 21453 21809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 21865 22671 gene locus_tag LOCUS_15610 21865 22671 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWS2 protein_id gnl|my_center|LOCUS_15610 22664 23419 gene locus_tag LOCUS_15620 22664 23419 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114075.1 protein_id gnl|my_center|LOCUS_15620 23443 23964 gene locus_tag LOCUS_15630 23443 23964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113020.1 protein_id gnl|my_center|LOCUS_15630 24146 24796 gene locus_tag LOCUS_15640 gene rnt 24146 24796 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAG3 protein_id gnl|my_center|LOCUS_15640 27831 24868 gene locus_tag LOCUS_15650 27831 24868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636891.2 protein_id gnl|my_center|LOCUS_15650 29482 28073 gene locus_tag LOCUS_15660 29482 28073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 30217 29489 gene locus_tag LOCUS_15670 30217 29489 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096597.1 protein_id gnl|my_center|LOCUS_15670 30421 31662 gene locus_tag LOCUS_15680 gene macA 30421 31662 CDS product MacA family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208368.1 protein_id gnl|my_center|LOCUS_15680 31659 33617 gene locus_tag LOCUS_15690 gene macB 31659 33617 CDS product macrolide export ATP-binding/permease protein MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIL8 protein_id gnl|my_center|LOCUS_15690 33614 35053 gene locus_tag LOCUS_15700 33614 35053 CDS product outer membrane efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535038.1 protein_id gnl|my_center|LOCUS_15700 35873 35130 gene locus_tag LOCUS_15710 gene rlmB 35873 35130 CDS product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAG5 protein_id gnl|my_center|LOCUS_15710 36462 35980 gene locus_tag LOCUS_15720 36462 35980 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036703.1 protein_id gnl|my_center|LOCUS_15720 39016 36557 gene locus_tag LOCUS_15730 gene vacB 39016 36557 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAG7 protein_id gnl|my_center|LOCUS_15730 39145 39229 gene locus_tag LOCUS_t00130 39145 39229 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 39384 39468 gene locus_tag LOCUS_t00140 39384 39468 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 40400 39654 gene locus_tag LOCUS_15740 40400 39654 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972224.1 protein_id gnl|my_center|LOCUS_15740 40500 41399 gene locus_tag LOCUS_15750 40500 41399 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184803.1 protein_id gnl|my_center|LOCUS_15750 41450 41536 gene locus_tag LOCUS_t00150 41450 41536 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 43370 41781 gene locus_tag LOCUS_15760 gene pmrB 43370 41781 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036592.1 protein_id gnl|my_center|LOCUS_15760 44559 43378 gene locus_tag LOCUS_15770 gene pmrA 44559 43378 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036591.1 protein_id gnl|my_center|LOCUS_15770 46064 44571 gene locus_tag LOCUS_15780 gene yjcP 46064 44571 CDS product multidrug RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036590.1 protein_id gnl|my_center|LOCUS_15780 46504 46061 gene locus_tag LOCUS_15790 gene yybA 46504 46061 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036589.1 protein_id gnl|my_center|LOCUS_15790 46680 47558 gene locus_tag LOCUS_15800 46680 47558 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036588.1 protein_id gnl|my_center|LOCUS_15800 47619 49862 gene locus_tag LOCUS_15810 gene parC 47619 49862 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAT2 protein_id gnl|my_center|LOCUS_15810 50690 50202 gene locus_tag LOCUS_15820 gene brf 50690 50202 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAT4 protein_id gnl|my_center|LOCUS_15820 50814 53141 gene locus_tag LOCUS_15830 gene acyII 50814 53141 CDS product penicillin acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036584.1 protein_id gnl|my_center|LOCUS_15830 54864 53173 gene locus_tag LOCUS_15840 gene asnB 54864 53173 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036581.1 protein_id gnl|my_center|LOCUS_15840 55211 56095 gene locus_tag LOCUS_15850 55211 56095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636762.2 protein_id gnl|my_center|LOCUS_15850 57277 56150 gene locus_tag LOCUS_15860 gene dapE 57277 56150 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAU0 protein_id gnl|my_center|LOCUS_15860 57645 57274 gene locus_tag LOCUS_15870 57645 57274 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036578.1 protein_id gnl|my_center|LOCUS_15870 58543 57677 gene locus_tag LOCUS_15880 58543 57677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 59607 58546 gene locus_tag LOCUS_15890 gene dapD 59607 58546 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAU3 protein_id gnl|my_center|LOCUS_15890 62234 59607 gene locus_tag LOCUS_15900 gene glnD 62234 59607 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAU4 protein_id gnl|my_center|LOCUS_15900 63022 62237 gene locus_tag LOCUS_15910 gene map 63022 62237 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAU5 protein_id gnl|my_center|LOCUS_15910 63434 63222 gene locus_tag LOCUS_15920 63434 63222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 63316 63783 gene locus_tag LOCUS_15930 gene pru 63316 63783 CDS product protein U inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036573.1 protein_id gnl|my_center|LOCUS_15930 63783 64532 gene locus_tag LOCUS_15940 gene ecpD 63783 64532 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036572.1 protein_id gnl|my_center|LOCUS_15940 64540 66918 gene locus_tag LOCUS_15950 gene fasD 64540 66918 CDS product outer membrane usher protein FasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636753.2 protein_id gnl|my_center|LOCUS_15950 66915 67949 gene locus_tag LOCUS_15960 66915 67949 CDS product spore coat protein U inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036570.1 protein_id gnl|my_center|LOCUS_15960 67951 68319 gene locus_tag LOCUS_15970 67951 68319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 68319 69017 gene locus_tag LOCUS_15980 68319 69017 CDS product type 1 pili usher pathway chaperone CsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096058.1 protein_id gnl|my_center|LOCUS_15980 69237 70043 gene locus_tag LOCUS_15990 gene rpsB 69237 70043 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAV2 protein_id gnl|my_center|LOCUS_15990 70170 71045 gene locus_tag LOCUS_16000 gene tsf 70170 71045 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAV3 protein_id gnl|my_center|LOCUS_16000 71308 72846 gene locus_tag LOCUS_16010 71308 72846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 72968 73696 gene locus_tag LOCUS_16020 gene pyrH 72968 73696 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59009 protein_id gnl|my_center|LOCUS_16020 73793 74347 gene locus_tag LOCUS_16030 gene frr 73793 74347 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAV6 protein_id gnl|my_center|LOCUS_16030 74410 75120 gene locus_tag LOCUS_16040 gene uppS 74410 75120 CDS product ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAV7 protein_id gnl|my_center|LOCUS_16040 75117 75953 gene locus_tag LOCUS_16050 gene cdsA 75117 75953 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAV8 protein_id gnl|my_center|LOCUS_16050 75956 77146 gene locus_tag LOCUS_16060 gene dxr 75956 77146 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAV9 protein_id gnl|my_center|LOCUS_16060 77202 78560 gene locus_tag LOCUS_16070 77202 78560 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAW0 protein_id gnl|my_center|LOCUS_16070 78635 80998 gene locus_tag LOCUS_16080 gene oma 78635 80998 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAW1 protein_id gnl|my_center|LOCUS_16080 81384 82406 gene locus_tag LOCUS_16090 gene lpxD 81384 82406 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAW3 protein_id gnl|my_center|LOCUS_16090 82403 82861 gene locus_tag LOCUS_16100 gene fabZ 82403 82861 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAW4 protein_id gnl|my_center|LOCUS_16100 82877 83668 gene locus_tag LOCUS_16110 gene lpxA 82877 83668 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAW5 protein_id gnl|my_center|LOCUS_16110 83665 84924 gene locus_tag LOCUS_16120 gene lpxB 83665 84924 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAW6 protein_id gnl|my_center|LOCUS_16120 84921 85586 gene locus_tag LOCUS_16130 gene rnhB 84921 85586 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAW7 protein_id gnl|my_center|LOCUS_16130 85857 89447 gene locus_tag LOCUS_16140 gene dnaE1 85857 89447 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAW8 protein_id gnl|my_center|LOCUS_16140 89512 90381 gene locus_tag LOCUS_16150 89512 90381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 90495 91454 gene locus_tag LOCUS_16160 gene accA 90495 91454 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAW9 protein_id gnl|my_center|LOCUS_16160 92084 91629 gene locus_tag LOCUS_16170 92084 91629 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036547.1 protein_id gnl|my_center|LOCUS_16170 92234 92824 gene locus_tag LOCUS_16180 92234 92824 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036546.1 protein_id gnl|my_center|LOCUS_16180 92918 94225 gene locus_tag LOCUS_16190 gene phaZ 92918 94225 CDS product PHB depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636727.2 protein_id gnl|my_center|LOCUS_16190 95351 94362 gene locus_tag LOCUS_16200 95351 94362 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036544.1 protein_id gnl|my_center|LOCUS_16200 95713 95348 gene locus_tag LOCUS_16210 95713 95348 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036543.1 protein_id gnl|my_center|LOCUS_16210 95850 96752 gene locus_tag LOCUS_16220 95850 96752 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037755.1 protein_id gnl|my_center|LOCUS_16220 98206 97334 gene locus_tag LOCUS_16230 98206 97334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037756.1 protein_id gnl|my_center|LOCUS_16230 98576 98328 gene locus_tag LOCUS_16240 98576 98328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 98460 99266 gene locus_tag LOCUS_16250 98460 99266 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037757.1 protein_id gnl|my_center|LOCUS_16250 99336 99629 gene locus_tag LOCUS_16260 99336 99629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037760.1 protein_id gnl|my_center|LOCUS_16260 100453 99671 gene locus_tag LOCUS_16270 100453 99671 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037761.1 protein_id gnl|my_center|LOCUS_16270 100842 100486 gene locus_tag LOCUS_16280 100842 100486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189643.1 protein_id gnl|my_center|LOCUS_16280 100955 102763 gene locus_tag LOCUS_16290 100955 102763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037762.1 protein_id gnl|my_center|LOCUS_16290 102919 103614 gene locus_tag LOCUS_16300 102919 103614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 103557 103916 gene locus_tag LOCUS_16310 103557 103916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16310 105137 103926 gene locus_tag LOCUS_16320 105137 103926 CDS product bifunctional glucose-1-phosphatase/inositol phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749190.1 protein_id gnl|my_center|LOCUS_16320 106966 105134 gene locus_tag LOCUS_16330 gene bapA 106966 105134 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037763.1 protein_id gnl|my_center|LOCUS_16330 108685 107117 gene locus_tag LOCUS_16340 108685 107117 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037766.1 protein_id gnl|my_center|LOCUS_16340 108796 109239 gene locus_tag LOCUS_16350 108796 109239 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808385.1 protein_id gnl|my_center|LOCUS_16350 109236 110066 gene locus_tag LOCUS_16360 109236 110066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037768.1 protein_id gnl|my_center|LOCUS_16360 110101 111048 gene locus_tag LOCUS_16370 110101 111048 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037769.1 protein_id gnl|my_center|LOCUS_16370 112269 111109 gene locus_tag LOCUS_16380 112269 111109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109755.1 protein_id gnl|my_center|LOCUS_16380 113503 112433 gene locus_tag LOCUS_16390 113503 112433 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259351.1 protein_id gnl|my_center|LOCUS_16390 114360 113638 gene locus_tag LOCUS_16400 114360 113638 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7H1 protein_id gnl|my_center|LOCUS_16400 116026 114395 gene locus_tag LOCUS_16410 116026 114395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 118547 116169 gene locus_tag LOCUS_16420 118547 116169 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037771.1 protein_id gnl|my_center|LOCUS_16420 120763 118817 gene locus_tag LOCUS_16430 gene deaD 120763 118817 CDS product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7G9 protein_id gnl|my_center|LOCUS_16430 121032 121253 gene locus_tag LOCUS_16440 121032 121253 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037775.1 protein_id gnl|my_center|LOCUS_16440 122443 121265 gene locus_tag LOCUS_16450 gene visC 122443 121265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037777.1 protein_id gnl|my_center|LOCUS_16450 122913 122524 gene locus_tag LOCUS_16460 122913 122524 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037778.1 protein_id gnl|my_center|LOCUS_16460 123470 122925 gene locus_tag LOCUS_16470 123470 122925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 124725 123529 gene locus_tag LOCUS_16480 124725 123529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037781.1 protein_id gnl|my_center|LOCUS_16480 125111 126589 gene locus_tag LOCUS_16490 gene Ada 125111 126589 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037782.1 protein_id gnl|my_center|LOCUS_16490 126586 127077 gene locus_tag LOCUS_16500 gene ogt 126586 127077 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7F8 protein_id gnl|my_center|LOCUS_16500 127239 128489 gene locus_tag LOCUS_16510 127239 128489 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037784.1 protein_id gnl|my_center|LOCUS_16510 128769 128590 gene locus_tag LOCUS_16520 128769 128590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 129293 128880 gene locus_tag LOCUS_16530 129293 128880 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037787.1 protein_id gnl|my_center|LOCUS_16530 >Feature sequence10 544 1596 gene locus_tag LOCUS_16540 544 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 1864 1604 gene locus_tag LOCUS_16550 1864 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 2210 1851 gene locus_tag LOCUS_16560 2210 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268497.1 protein_id gnl|my_center|LOCUS_16560 2866 2285 gene locus_tag LOCUS_16570 2866 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 3756 3187 gene locus_tag LOCUS_16580 3756 3187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 4337 3753 gene locus_tag LOCUS_16590 4337 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056538.1 protein_id gnl|my_center|LOCUS_16590 5004 4534 gene locus_tag LOCUS_16600 5004 4534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 5246 5001 gene locus_tag LOCUS_16610 5246 5001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 5470 5243 gene locus_tag LOCUS_16620 5470 5243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 5592 7517 gene locus_tag LOCUS_16630 5592 7517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 8757 7549 gene locus_tag LOCUS_16640 8757 7549 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387953.1 protein_id gnl|my_center|LOCUS_16640 8834 9616 gene locus_tag LOCUS_16650 8834 9616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 10138 9638 gene locus_tag LOCUS_16660 10138 9638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 10596 10213 gene locus_tag LOCUS_16670 10596 10213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 11416 10598 gene locus_tag LOCUS_16680 11416 10598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 11523 11879 gene locus_tag LOCUS_16690 11523 11879 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036785.1 protein_id gnl|my_center|LOCUS_16690 11958 12218 gene locus_tag LOCUS_16700 11958 12218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 12350 14956 gene locus_tag LOCUS_16710 12350 14956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038875.1 protein_id gnl|my_center|LOCUS_16710 15298 14990 gene locus_tag LOCUS_16720 15298 14990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 15483 15298 gene locus_tag LOCUS_16730 15483 15298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 15771 15520 gene locus_tag LOCUS_16740 15771 15520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 16620 16246 gene locus_tag LOCUS_16750 16620 16246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 16856 16617 gene locus_tag LOCUS_16760 16856 16617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 17118 16897 gene locus_tag LOCUS_16770 17118 16897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 17411 17115 gene locus_tag LOCUS_16780 17411 17115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 18235 17849 gene locus_tag LOCUS_16790 18235 17849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 19541 18597 gene locus_tag LOCUS_16800 19541 18597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 20431 22119 gene locus_tag LOCUS_16810 20431 22119 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039285.1 protein_id gnl|my_center|LOCUS_16810 22116 22493 gene locus_tag LOCUS_16820 22116 22493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 22500 22778 gene locus_tag LOCUS_16830 22500 22778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037162.1 protein_id gnl|my_center|LOCUS_16830 23115 22834 gene locus_tag LOCUS_16840 23115 22834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 24329 23334 gene locus_tag LOCUS_16850 24329 23334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 24933 24520 gene locus_tag LOCUS_16860 24933 24520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 25151 25672 gene locus_tag LOCUS_16870 25151 25672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038765.1 protein_id gnl|my_center|LOCUS_16870 25720 26358 gene locus_tag LOCUS_16880 25720 26358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038777.1 protein_id gnl|my_center|LOCUS_16880 26360 26950 gene locus_tag LOCUS_16890 gene entB 26360 26950 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038763.1 protein_id gnl|my_center|LOCUS_16890 27909 26980 gene locus_tag LOCUS_16900 27909 26980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118999.1 protein_id gnl|my_center|LOCUS_16900 28536 27976 gene locus_tag LOCUS_16910 28536 27976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036824.1 protein_id gnl|my_center|LOCUS_16910 31198 28652 gene locus_tag LOCUS_16920 gene lig3 31198 28652 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037451.1 protein_id gnl|my_center|LOCUS_16920 31387 31211 gene locus_tag LOCUS_16930 31387 31211 CDS product DUF3606 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037452.1 protein_id gnl|my_center|LOCUS_16930 32350 31406 gene locus_tag LOCUS_16940 gene ku 32350 31406 CDS product non-homologous end joining protein Ku inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PE77 protein_id gnl|my_center|LOCUS_16940 32944 32435 gene locus_tag LOCUS_16950 32944 32435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037183.1 protein_id gnl|my_center|LOCUS_16950 32994 33749 gene locus_tag LOCUS_16960 32994 33749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16960 33677 34942 gene locus_tag LOCUS_16970 33677 34942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16970 35364 34987 gene locus_tag LOCUS_16980 35364 34987 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967059.1 protein_id gnl|my_center|LOCUS_16980 35526 36668 gene locus_tag LOCUS_16990 35526 36668 CDS product two-component system sensor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636560.2 protein_id gnl|my_center|LOCUS_16990 36670 37032 gene locus_tag LOCUS_17000 36670 37032 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036384.1 protein_id gnl|my_center|LOCUS_17000 37524 37072 gene locus_tag LOCUS_17010 37524 37072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 37663 38502 gene locus_tag LOCUS_17020 37663 38502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 40700 38499 gene locus_tag LOCUS_17030 40700 38499 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096059.1 protein_id gnl|my_center|LOCUS_17030 41366 40710 gene locus_tag LOCUS_17040 41366 40710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 41980 41483 gene locus_tag LOCUS_17050 41980 41483 CDS product spore coat protein U inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366014.1 protein_id gnl|my_center|LOCUS_17050 42424 43413 gene locus_tag LOCUS_17060 42424 43413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 43970 43503 gene locus_tag LOCUS_17070 43970 43503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 44335 43967 gene locus_tag LOCUS_17080 44335 43967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 44852 44340 gene locus_tag LOCUS_17090 44852 44340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 45027 45518 gene locus_tag LOCUS_17100 45027 45518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 46330 45557 gene locus_tag LOCUS_17110 46330 45557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 49102 46451 gene locus_tag LOCUS_17120 49102 46451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 50670 49105 gene locus_tag LOCUS_17130 50670 49105 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035470.1 protein_id gnl|my_center|LOCUS_17130 51211 50798 gene locus_tag LOCUS_17140 51211 50798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 51660 51277 gene locus_tag LOCUS_17150 51660 51277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 51971 51657 gene locus_tag LOCUS_17160 51971 51657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 52288 51968 gene locus_tag LOCUS_17170 52288 51968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 52685 52476 gene locus_tag LOCUS_17180 52685 52476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 53269 52685 gene locus_tag LOCUS_17190 53269 52685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 54950 53376 gene locus_tag LOCUS_17200 54950 53376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 56511 55498 gene locus_tag LOCUS_17210 56511 55498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55426 protein_id gnl|my_center|LOCUS_17210 56823 56578 gene locus_tag LOCUS_17220 56823 56578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 58571 56886 gene locus_tag LOCUS_17230 58571 56886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 58752 58582 gene locus_tag LOCUS_17240 58752 58582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 59914 59252 gene locus_tag LOCUS_17250 59914 59252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 60695 59907 gene locus_tag LOCUS_17260 60695 59907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 61377 60688 gene locus_tag LOCUS_17270 61377 60688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 62030 61464 gene locus_tag LOCUS_17280 62030 61464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 62531 62193 gene locus_tag LOCUS_17290 62531 62193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 63034 62681 gene locus_tag LOCUS_17300 63034 62681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 63963 63418 gene locus_tag LOCUS_17310 63963 63418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 64902 64132 gene locus_tag LOCUS_17320 64902 64132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 66832 64889 gene locus_tag LOCUS_17330 66832 64889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 67036 69591 gene locus_tag LOCUS_17340 gene mutS 67036 69591 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBB5 protein_id gnl|my_center|LOCUS_17340 69784 71427 gene locus_tag LOCUS_17350 69784 71427 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F601 protein_id gnl|my_center|LOCUS_17350 71536 72138 gene locus_tag LOCUS_17360 71536 72138 CDS product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036403.1 protein_id gnl|my_center|LOCUS_17360 73398 72211 gene locus_tag LOCUS_17370 73398 72211 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870481.1 protein_id gnl|my_center|LOCUS_17370 73919 73512 gene locus_tag LOCUS_17380 gene hslR 73919 73512 CDS product heat shock protein 15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBB8 protein_id gnl|my_center|LOCUS_17380 74168 73929 gene locus_tag LOCUS_17390 74168 73929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 74231 75703 gene locus_tag LOCUS_17400 74231 75703 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036400.1 protein_id gnl|my_center|LOCUS_17400 76230 75820 gene locus_tag LOCUS_17410 76230 75820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089492.1 protein_id gnl|my_center|LOCUS_17410 76703 76269 gene locus_tag LOCUS_17420 76703 76269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063677.1 protein_id gnl|my_center|LOCUS_17420 77164 76784 gene locus_tag LOCUS_17430 77164 76784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 77648 77247 gene locus_tag LOCUS_17440 gene rplS 77648 77247 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBC0 protein_id gnl|my_center|LOCUS_17440 78561 77803 gene locus_tag LOCUS_17450 gene trmD 78561 77803 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBC1 protein_id gnl|my_center|LOCUS_17450 79082 78570 gene locus_tag LOCUS_17460 gene rimM 79082 78570 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBC2 protein_id gnl|my_center|LOCUS_17460 79387 79127 gene locus_tag LOCUS_17470 gene rpsP 79387 79127 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBC3 protein_id gnl|my_center|LOCUS_17470 80300 79518 gene locus_tag LOCUS_17480 80300 79518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036395.1 protein_id gnl|my_center|LOCUS_17480 81319 80297 gene locus_tag LOCUS_17490 81319 80297 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036394.1 protein_id gnl|my_center|LOCUS_17490 82840 81464 gene locus_tag LOCUS_17500 gene ffh 82840 81464 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBC8 protein_id gnl|my_center|LOCUS_17500 82963 83757 gene locus_tag LOCUS_17510 82963 83757 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036390.1 protein_id gnl|my_center|LOCUS_17510 84365 83859 gene locus_tag LOCUS_17520 84365 83859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 86722 84416 gene locus_tag LOCUS_17530 86722 84416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036366.1 protein_id gnl|my_center|LOCUS_17530 88627 86771 gene locus_tag LOCUS_17540 gene hsp90xc 88627 86771 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036365.1 protein_id gnl|my_center|LOCUS_17540 90179 88803 gene locus_tag LOCUS_17550 gene radA 90179 88803 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBF8 protein_id gnl|my_center|LOCUS_17550 90330 92390 gene locus_tag LOCUS_17560 90330 92390 CDS product putative signaling protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I310 protein_id gnl|my_center|LOCUS_17560 92849 92508 gene locus_tag LOCUS_17570 gene cyoD 92849 92508 CDS product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036359.1 protein_id gnl|my_center|LOCUS_17570 93487 92849 gene locus_tag LOCUS_17580 gene cyoC 93487 92849 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036358.1 protein_id gnl|my_center|LOCUS_17580 95481 93484 gene locus_tag LOCUS_17590 gene cyoB 95481 93484 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036357.1 protein_id gnl|my_center|LOCUS_17590 96524 95484 gene locus_tag LOCUS_17600 gene cyoA 96524 95484 CDS product ubiquinol oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBG3 protein_id gnl|my_center|LOCUS_17600 97197 96841 gene locus_tag LOCUS_17610 97197 96841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 99307 98453 gene locus_tag LOCUS_17620 99307 98453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 101294 100170 gene locus_tag LOCUS_17630 101294 100170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 101812 101737 gene locus_tag LOCUS_t00160 101812 101737 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 102867 101863 gene locus_tag LOCUS_17640 102867 101863 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056558.1 protein_id gnl|my_center|LOCUS_17640 105838 102965 gene locus_tag LOCUS_17650 105838 102965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 106074 106601 gene locus_tag LOCUS_17660 106074 106601 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402962.1 protein_id gnl|my_center|LOCUS_17660 106598 107566 gene locus_tag LOCUS_17670 106598 107566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 107581 110367 gene locus_tag LOCUS_17680 gene btuB 107581 110367 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207266.1 protein_id gnl|my_center|LOCUS_17680 111120 110455 gene locus_tag LOCUS_17690 111120 110455 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704333.1 protein_id gnl|my_center|LOCUS_17690 112985 111117 gene locus_tag LOCUS_17700 112985 111117 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036360.1 protein_id gnl|my_center|LOCUS_17700 114164 113214 gene locus_tag LOCUS_17710 gene ispH 114164 113214 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBG4 protein_id gnl|my_center|LOCUS_17710 114716 114192 gene locus_tag LOCUS_17720 gene lspA 114716 114192 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBG5 protein_id gnl|my_center|LOCUS_17720 117547 114716 gene locus_tag LOCUS_17730 gene ileS 117547 114716 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBG6 protein_id gnl|my_center|LOCUS_17730 118491 117544 gene locus_tag LOCUS_17740 gene ribF 118491 117544 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBG7 protein_id gnl|my_center|LOCUS_17740 120186 118567 gene locus_tag LOCUS_17750 gene mviN 120186 118567 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBG8 protein_id gnl|my_center|LOCUS_17750 120289 120558 gene locus_tag LOCUS_17760 gene rpsT 120289 120558 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBG9 protein_id gnl|my_center|LOCUS_17760 121806 120754 gene locus_tag LOCUS_17770 gene obg 121806 120754 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBH0 protein_id gnl|my_center|LOCUS_17770 122273 122010 gene locus_tag LOCUS_17780 gene rpmA 122273 122010 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBH1 protein_id gnl|my_center|LOCUS_17780 122600 122292 gene locus_tag LOCUS_17790 gene rplU 122600 122292 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBH2 protein_id gnl|my_center|LOCUS_17790 122919 125921 gene locus_tag LOCUS_17800 gene uvrA 122919 125921 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBH3 protein_id gnl|my_center|LOCUS_17800 125921 126328 gene locus_tag LOCUS_17810 125921 126328 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036347.1 protein_id gnl|my_center|LOCUS_17810 126419 127144 gene locus_tag LOCUS_17820 126419 127144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 127698 127384 gene locus_tag LOCUS_17830 127698 127384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 127865 128641 gene locus_tag LOCUS_17840 127865 128641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036346.1 protein_id gnl|my_center|LOCUS_17840 >Feature sequence11 296 1147 gene locus_tag LOCUS_17850 296 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035911.1 protein_id gnl|my_center|LOCUS_17850 1144 1983 gene locus_tag LOCUS_17860 gene gtrB 1144 1983 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035916.1 protein_id gnl|my_center|LOCUS_17860 2037 3218 gene locus_tag LOCUS_17870 gene pncB 2037 3218 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCP3 protein_id gnl|my_center|LOCUS_17870 3606 3241 gene locus_tag LOCUS_17880 3606 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 4066 4605 gene locus_tag LOCUS_17890 gene pilin 4066 4605 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113678.1 protein_id gnl|my_center|LOCUS_17890 4691 5422 gene locus_tag LOCUS_17900 gene mrkB 4691 5422 CDS product fimbrial chaperone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206740.1 protein_id gnl|my_center|LOCUS_17900 5494 8079 gene locus_tag LOCUS_17910 gene mrkC 5494 8079 CDS product outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206739.1 protein_id gnl|my_center|LOCUS_17910 8070 9107 gene locus_tag LOCUS_17920 8070 9107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 9372 10859 gene locus_tag LOCUS_17930 gene bcsE 9372 10859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817396.1 protein_id gnl|my_center|LOCUS_17930 10856 11035 gene locus_tag LOCUS_17940 10856 11035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 11032 12663 gene locus_tag LOCUS_17950 11032 12663 CDS product cellulose biosynthesis protein BcsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192026.1 protein_id gnl|my_center|LOCUS_17950 12663 12842 gene locus_tag LOCUS_17960 12663 12842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 12839 13594 gene locus_tag LOCUS_17970 gene bcsF 12839 13594 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174891.1 protein_id gnl|my_center|LOCUS_17970 13594 16218 gene locus_tag LOCUS_17980 gene bcsA 13594 16218 CDS product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369239.1 protein_id gnl|my_center|LOCUS_17980 16215 18584 gene locus_tag LOCUS_17990 gene bcsB 16215 18584 CDS product cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z290 protein_id gnl|my_center|LOCUS_17990 18584 22165 gene locus_tag LOCUS_18000 gene bcsC 18584 22165 CDS product cellulose biosynthesis protein BcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817392.1 protein_id gnl|my_center|LOCUS_18000 22149 23291 gene locus_tag LOCUS_18010 gene wssD 22149 23291 CDS product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770923.1 protein_id gnl|my_center|LOCUS_18010 24647 23331 gene locus_tag LOCUS_18020 gene yieG 24647 23331 CDS product xanthine/uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035550.1 protein_id gnl|my_center|LOCUS_18020 26396 24732 gene locus_tag LOCUS_18030 gene yjjK 26396 24732 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035928.1 protein_id gnl|my_center|LOCUS_18030 26650 27123 gene locus_tag LOCUS_18040 26650 27123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 27296 28549 gene locus_tag LOCUS_18050 gene glyA 27296 28549 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCN4 protein_id gnl|my_center|LOCUS_18050 28617 29033 gene locus_tag LOCUS_18060 28617 29033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 29061 29510 gene locus_tag LOCUS_18070 29061 29510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 29845 29764 gene locus_tag LOCUS_t00170 29845 29764 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 30287 31372 gene locus_tag LOCUS_18080 gene ribD 30287 31372 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCN1 protein_id gnl|my_center|LOCUS_18080 31630 31412 gene locus_tag LOCUS_18090 31630 31412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 32236 33333 gene locus_tag LOCUS_18100 32236 33333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 34259 33375 gene locus_tag LOCUS_18110 34259 33375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 35017 34361 gene locus_tag LOCUS_18120 35017 34361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 35780 35160 gene locus_tag LOCUS_18130 35780 35160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035933.1 protein_id gnl|my_center|LOCUS_18130 36230 36832 gene locus_tag LOCUS_18140 gene ribE 36230 36832 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035934.1 protein_id gnl|my_center|LOCUS_18140 36829 37929 gene locus_tag LOCUS_18150 gene ribA 36829 37929 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035935.1 protein_id gnl|my_center|LOCUS_18150 38114 38581 gene locus_tag LOCUS_18160 gene ribH 38114 38581 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCM7 protein_id gnl|my_center|LOCUS_18160 38578 39057 gene locus_tag LOCUS_18170 gene nusB 38578 39057 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCM6 protein_id gnl|my_center|LOCUS_18170 39178 40140 gene locus_tag LOCUS_18180 gene thiL 39178 40140 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCM5 protein_id gnl|my_center|LOCUS_18180 41091 40720 gene locus_tag LOCUS_18190 41091 40720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 41965 41252 gene locus_tag LOCUS_18200 41965 41252 CDS product fimbrial chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484311.1 protein_id gnl|my_center|LOCUS_18200 42528 42019 gene locus_tag LOCUS_18210 42528 42019 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704062.1 protein_id gnl|my_center|LOCUS_18210 42927 45380 gene locus_tag LOCUS_18220 gene htrE 42927 45380 CDS product outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210844.1 protein_id gnl|my_center|LOCUS_18220 45377 45883 gene locus_tag LOCUS_18230 45377 45883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 45990 46892 gene locus_tag LOCUS_18240 45990 46892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 46925 47944 gene locus_tag LOCUS_18250 46925 47944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 48436 48035 gene locus_tag LOCUS_18260 48436 48035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 48906 49466 gene locus_tag LOCUS_18270 48906 49466 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947704.1 protein_id gnl|my_center|LOCUS_18270 51068 49683 gene locus_tag LOCUS_18280 gene dld 51068 49683 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035947.1 protein_id gnl|my_center|LOCUS_18280 51741 51373 gene locus_tag LOCUS_18290 51741 51373 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCL4 protein_id gnl|my_center|LOCUS_18290 53464 51731 gene locus_tag LOCUS_18300 53464 51731 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035950.1 protein_id gnl|my_center|LOCUS_18300 53534 54352 gene locus_tag LOCUS_18310 gene rsmI 53534 54352 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCL2 protein_id gnl|my_center|LOCUS_18310 55483 55004 gene locus_tag LOCUS_18320 55483 55004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184771.1 protein_id gnl|my_center|LOCUS_18320 56337 55585 gene locus_tag LOCUS_18330 56337 55585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035954.1 protein_id gnl|my_center|LOCUS_18330 56661 57107 gene locus_tag LOCUS_18340 gene mraZ 56661 57107 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCK8 protein_id gnl|my_center|LOCUS_18340 57122 58090 gene locus_tag LOCUS_18350 gene rsmH 57122 58090 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCK7 protein_id gnl|my_center|LOCUS_18350 58087 58350 gene locus_tag LOCUS_18360 gene ftsL 58087 58350 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCK6 protein_id gnl|my_center|LOCUS_18360 58347 60191 gene locus_tag LOCUS_18370 gene ftsI 58347 60191 CDS product penicillin-binding protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035957.1 protein_id gnl|my_center|LOCUS_18370 60188 61696 gene locus_tag LOCUS_18380 gene murE 60188 61696 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCK4 protein_id gnl|my_center|LOCUS_18380 61693 63087 gene locus_tag LOCUS_18390 gene murF 61693 63087 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCK3 protein_id gnl|my_center|LOCUS_18390 63077 64162 gene locus_tag LOCUS_18400 gene mraY 63077 64162 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCK2 protein_id gnl|my_center|LOCUS_18400 64164 65483 gene locus_tag LOCUS_18410 gene ftsW 64164 65483 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCK1 protein_id gnl|my_center|LOCUS_18410 65480 66565 gene locus_tag LOCUS_18420 gene murG 65480 66565 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCK0 protein_id gnl|my_center|LOCUS_18420 66606 68042 gene locus_tag LOCUS_18430 gene murC 66606 68042 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCJ9 protein_id gnl|my_center|LOCUS_18430 68039 69001 gene locus_tag LOCUS_18440 gene ddlB 68039 69001 CDS product D-alanine--D-alanine ligase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCJ8 protein_id gnl|my_center|LOCUS_18440 68998 69747 gene locus_tag LOCUS_18450 gene ftsQ 68998 69747 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCJ7 protein_id gnl|my_center|LOCUS_18450 69744 70979 gene locus_tag LOCUS_18460 gene ftsA 69744 70979 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CLU9 protein_id gnl|my_center|LOCUS_18460 71150 72385 gene locus_tag LOCUS_18470 gene ftsZ 71150 72385 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCJ6 protein_id gnl|my_center|LOCUS_18470 72579 73490 gene locus_tag LOCUS_18480 gene lpxC 72579 73490 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCJ5 protein_id gnl|my_center|LOCUS_18480 74222 73773 gene locus_tag LOCUS_18490 74222 73773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035968.1 protein_id gnl|my_center|LOCUS_18490 74235 75191 gene locus_tag LOCUS_18500 74235 75191 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035969.1 protein_id gnl|my_center|LOCUS_18500 75464 78196 gene locus_tag LOCUS_18510 gene secA 75464 78196 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCJ2 protein_id gnl|my_center|LOCUS_18510 78329 79255 gene locus_tag LOCUS_18520 78329 79255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035972.1 protein_id gnl|my_center|LOCUS_18520 79929 79345 gene locus_tag LOCUS_18530 79929 79345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035974.1 protein_id gnl|my_center|LOCUS_18530 80797 79970 gene locus_tag LOCUS_18540 gene metF 80797 79970 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCI7 protein_id gnl|my_center|LOCUS_18540 81000 81932 gene locus_tag LOCUS_18550 81000 81932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 81951 83003 gene locus_tag LOCUS_18560 81951 83003 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403193.1 protein_id gnl|my_center|LOCUS_18560 83000 83731 gene locus_tag LOCUS_18570 gene algR 83000 83731 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403194.1 protein_id gnl|my_center|LOCUS_18570 85255 83738 gene locus_tag LOCUS_18580 85255 83738 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_18580 85391 85948 gene locus_tag LOCUS_18590 85391 85948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035986.1 protein_id gnl|my_center|LOCUS_18590 86049 86684 gene locus_tag LOCUS_18600 86049 86684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 87239 86754 gene locus_tag LOCUS_18610 87239 86754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 87712 87239 gene locus_tag LOCUS_18620 87712 87239 CDS product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XCT4 protein_id gnl|my_center|LOCUS_18620 89322 87877 gene locus_tag LOCUS_18630 gene ahcY 89322 87877 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCH5 protein_id gnl|my_center|LOCUS_18630 89563 92079 gene locus_tag LOCUS_18640 89563 92079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035989.1 protein_id gnl|my_center|LOCUS_18640 92252 94963 gene locus_tag LOCUS_18650 gene ppc 92252 94963 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P336 protein_id gnl|my_center|LOCUS_18650 95537 95031 gene locus_tag LOCUS_18660 95537 95031 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815410.1 protein_id gnl|my_center|LOCUS_18660 96889 95678 gene locus_tag LOCUS_18670 gene metK 96889 95678 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCH3 protein_id gnl|my_center|LOCUS_18670 97215 98930 gene locus_tag LOCUS_18680 97215 98930 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705506.1 protein_id gnl|my_center|LOCUS_18680 98927 99727 gene locus_tag LOCUS_18690 98927 99727 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921173.1 protein_id gnl|my_center|LOCUS_18690 99823 100890 gene locus_tag LOCUS_18700 99823 100890 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035998.1 protein_id gnl|my_center|LOCUS_18700 101815 100988 gene locus_tag LOCUS_18710 101815 100988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 102989 101925 gene locus_tag LOCUS_18720 gene dusB 102989 101925 CDS product tRNA-dihydrouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCH1 protein_id gnl|my_center|LOCUS_18720 103514 103068 gene locus_tag LOCUS_18730 103514 103068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 104613 103648 gene locus_tag LOCUS_18740 gene rbsK 104613 103648 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCH0 protein_id gnl|my_center|LOCUS_18740 105937 104639 gene locus_tag LOCUS_18750 gene yeiM 105937 104639 CDS product nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036001.1 protein_id gnl|my_center|LOCUS_18750 106014 107102 gene locus_tag LOCUS_18760 106014 107102 CDS product NADP-dependent aryl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036002.1 protein_id gnl|my_center|LOCUS_18760 107314 107514 gene locus_tag LOCUS_18770 107314 107514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036003.1 protein_id gnl|my_center|LOCUS_18770 107668 109860 gene locus_tag LOCUS_18780 gene phuR 107668 109860 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036004.1 protein_id gnl|my_center|LOCUS_18780 109865 110464 gene locus_tag LOCUS_18790 109865 110464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 110533 111468 gene locus_tag LOCUS_18800 110533 111468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636161.2 protein_id gnl|my_center|LOCUS_18800 <114062 111703 gene locus_tag LOCUS_18810 <114062 111703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036012.1:oxidoreductase >Feature sequence12 858 2003 gene locus_tag LOCUS_18820 gene mltB 858 2003 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038556.1 protein_id gnl|my_center|LOCUS_18820 2000 3268 gene locus_tag LOCUS_18830 gene rlpA 2000 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038555.1 protein_id gnl|my_center|LOCUS_18830 3369 4589 gene locus_tag LOCUS_18840 gene dacC 3369 4589 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038554.1 protein_id gnl|my_center|LOCUS_18840 5807 4842 gene locus_tag LOCUS_18850 5807 4842 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038553.1 protein_id gnl|my_center|LOCUS_18850 5745 6038 gene locus_tag LOCUS_18860 5745 6038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 6259 7251 gene locus_tag LOCUS_18870 6259 7251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638800.2 protein_id gnl|my_center|LOCUS_18870 7413 7700 gene locus_tag LOCUS_18880 7413 7700 CDS product UPF0250 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P588 protein_id gnl|my_center|LOCUS_18880 7688 8398 gene locus_tag LOCUS_18890 gene lipB 7688 8398 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P589 protein_id gnl|my_center|LOCUS_18890 8417 9427 gene locus_tag LOCUS_18900 gene lipA 8417 9427 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P590 protein_id gnl|my_center|LOCUS_18900 9710 11887 gene locus_tag LOCUS_18910 gene prc 9710 11887 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038548.1 protein_id gnl|my_center|LOCUS_18910 12038 12637 gene locus_tag LOCUS_18920 12038 12637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 12661 13893 gene locus_tag LOCUS_18930 12661 13893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038538.1 protein_id gnl|my_center|LOCUS_18930 13904 14809 gene locus_tag LOCUS_18940 gene gndA 13904 14809 CDS product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038537.1 protein_id gnl|my_center|LOCUS_18940 16063 15020 gene locus_tag LOCUS_18950 gene ydgJ 16063 15020 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038536.1 protein_id gnl|my_center|LOCUS_18950 16235 16618 gene locus_tag LOCUS_18960 16235 16618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 16821 18638 gene locus_tag LOCUS_18970 16821 18638 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038534.1 protein_id gnl|my_center|LOCUS_18970 18635 19075 gene locus_tag LOCUS_18980 18635 19075 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038533.1 protein_id gnl|my_center|LOCUS_18980 19080 20591 gene locus_tag LOCUS_18990 19080 20591 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038532.1 protein_id gnl|my_center|LOCUS_18990 21410 20667 gene locus_tag LOCUS_19000 21410 20667 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531816.1 protein_id gnl|my_center|LOCUS_19000 21501 21986 gene locus_tag LOCUS_19010 gene folK 21501 21986 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038531.1 protein_id gnl|my_center|LOCUS_19010 22784 22047 gene locus_tag LOCUS_19020 gene ptr1 22784 22047 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_19020 22844 24028 gene locus_tag LOCUS_19030 22844 24028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638777.2 protein_id gnl|my_center|LOCUS_19030 24025 24417 gene locus_tag LOCUS_19040 24025 24417 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038528.1 protein_id gnl|my_center|LOCUS_19040 26910 24553 gene locus_tag LOCUS_19050 26910 24553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 29685 27022 gene locus_tag LOCUS_19060 gene iroN 29685 27022 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038012.1 protein_id gnl|my_center|LOCUS_19060 30845 29829 gene locus_tag LOCUS_19070 gene glk 30845 29829 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038011.1 protein_id gnl|my_center|LOCUS_19070 30766 30984 gene locus_tag LOCUS_19080 30766 30984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 31222 32511 gene locus_tag LOCUS_19090 gene gluP 31222 32511 CDS product glucose/galactose MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038511.1 protein_id gnl|my_center|LOCUS_19090 32518 33618 gene locus_tag LOCUS_19100 32518 33618 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038510.1 protein_id gnl|my_center|LOCUS_19100 33626 34654 gene locus_tag LOCUS_19110 gene glmS 33626 34654 CDS product glucosamine-fructose-6-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638757.2 protein_id gnl|my_center|LOCUS_19110 34654 35802 gene locus_tag LOCUS_19120 gene nagA 34654 35802 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5D1 protein_id gnl|my_center|LOCUS_19120 35802 36869 gene locus_tag LOCUS_19130 35802 36869 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428415.1 protein_id gnl|my_center|LOCUS_19130 37185 40211 gene locus_tag LOCUS_19140 37185 40211 CDS product autotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974616.1 protein_id gnl|my_center|LOCUS_19140 40823 40392 gene locus_tag LOCUS_19150 40823 40392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 41074 42108 gene locus_tag LOCUS_19160 41074 42108 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038507.1 protein_id gnl|my_center|LOCUS_19160 42112 42447 gene locus_tag LOCUS_19170 42112 42447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 42497 42931 gene locus_tag LOCUS_19180 42497 42931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 44494 43274 gene locus_tag LOCUS_19190 gene cca 44494 43274 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5D4 protein_id gnl|my_center|LOCUS_19190 44806 44570 gene locus_tag LOCUS_19200 44806 44570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 46858 44873 gene locus_tag LOCUS_19210 gene slt 46858 44873 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038504.1 protein_id gnl|my_center|LOCUS_19210 47167 46877 gene locus_tag LOCUS_19220 47167 46877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 47079 47417 gene locus_tag LOCUS_19230 gene exbD2 47079 47417 CDS product biopolymer transport protein exbD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C7I9 protein_id gnl|my_center|LOCUS_19230 47476 47706 gene locus_tag LOCUS_19240 47476 47706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 47938 50799 gene locus_tag LOCUS_19250 gene btuB 47938 50799 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038503.1 protein_id gnl|my_center|LOCUS_19250 53017 50876 gene locus_tag LOCUS_19260 gene fhuE 53017 50876 CDS product ferric-rhodotorulic acid/ferric-coprogen receptor FhuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953420.1 protein_id gnl|my_center|LOCUS_19260 53744 53193 gene locus_tag LOCUS_19270 53744 53193 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037887.1 protein_id gnl|my_center|LOCUS_19270 54303 53821 gene locus_tag LOCUS_19280 54303 53821 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532463.1 protein_id gnl|my_center|LOCUS_19280 54376 55251 gene locus_tag LOCUS_19290 54376 55251 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921297.1 protein_id gnl|my_center|LOCUS_19290 56110 55343 gene locus_tag LOCUS_19300 56110 55343 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038499.1 protein_id gnl|my_center|LOCUS_19300 56967 56134 gene locus_tag LOCUS_19310 gene dsbA 56967 56134 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038498.1 protein_id gnl|my_center|LOCUS_19310 57724 57074 gene locus_tag LOCUS_19320 gene dsbA 57724 57074 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5E2 protein_id gnl|my_center|LOCUS_19320 58631 57831 gene locus_tag LOCUS_19330 gene cycA 58631 57831 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038496.1 protein_id gnl|my_center|LOCUS_19330 58788 59390 gene locus_tag LOCUS_19340 gene engB 58788 59390 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5E4 protein_id gnl|my_center|LOCUS_19340 60462 59491 gene locus_tag LOCUS_19350 60462 59491 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815405.1 protein_id gnl|my_center|LOCUS_19350 62008 61184 gene locus_tag LOCUS_19360 62008 61184 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973637.1 protein_id gnl|my_center|LOCUS_19360 62709 62005 gene locus_tag LOCUS_19370 62709 62005 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888239.1 protein_id gnl|my_center|LOCUS_19370 62862 64226 gene locus_tag LOCUS_19380 gene gsh1 62862 64226 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038494.1 protein_id gnl|my_center|LOCUS_19380 65408 64350 gene locus_tag LOCUS_19390 65408 64350 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113749.1 protein_id gnl|my_center|LOCUS_19390 65516 66400 gene locus_tag LOCUS_19400 65516 66400 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067687.1 protein_id gnl|my_center|LOCUS_19400 67097 66444 gene locus_tag LOCUS_19410 67097 66444 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706988.1 protein_id gnl|my_center|LOCUS_19410 67183 67878 gene locus_tag LOCUS_19420 67183 67878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706987.1 protein_id gnl|my_center|LOCUS_19420 68307 67891 gene locus_tag LOCUS_19430 68307 67891 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087011.1 protein_id gnl|my_center|LOCUS_19430 69584 68406 gene locus_tag LOCUS_19440 69584 68406 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267094.1 protein_id gnl|my_center|LOCUS_19440 69641 70546 gene locus_tag LOCUS_19450 69641 70546 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400772.1 protein_id gnl|my_center|LOCUS_19450 70618 70893 gene locus_tag LOCUS_19460 70618 70893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038488.1 protein_id gnl|my_center|LOCUS_19460 70952 72061 gene locus_tag LOCUS_19470 gene adhC 70952 72061 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7L9 protein_id gnl|my_center|LOCUS_19470 72112 72942 gene locus_tag LOCUS_19480 72112 72942 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5F4 protein_id gnl|my_center|LOCUS_19480 73138 74574 gene locus_tag LOCUS_19490 73138 74574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 75090 74650 gene locus_tag LOCUS_19500 75090 74650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114763.1 protein_id gnl|my_center|LOCUS_19500 75232 76140 gene locus_tag LOCUS_19510 75232 76140 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003143729.1 protein_id gnl|my_center|LOCUS_19510 76317 77831 gene locus_tag LOCUS_19520 76317 77831 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114761.1 protein_id gnl|my_center|LOCUS_19520 77855 78937 gene locus_tag LOCUS_19530 77855 78937 CDS product secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114760.1 protein_id gnl|my_center|LOCUS_19530 78934 80346 gene locus_tag LOCUS_19540 78934 80346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114759.1 protein_id gnl|my_center|LOCUS_19540 80797 80459 gene locus_tag LOCUS_19550 80797 80459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038481.1 protein_id gnl|my_center|LOCUS_19550 81816 80875 gene locus_tag LOCUS_19560 81816 80875 CDS product DegV domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5F9 protein_id gnl|my_center|LOCUS_19560 82544 81912 gene locus_tag LOCUS_19570 82544 81912 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186002.1 protein_id gnl|my_center|LOCUS_19570 83848 82565 gene locus_tag LOCUS_19580 83848 82565 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038470.1 protein_id gnl|my_center|LOCUS_19580 85257 83848 gene locus_tag LOCUS_19590 85257 83848 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038469.1 protein_id gnl|my_center|LOCUS_19590 85417 86193 gene locus_tag LOCUS_19600 85417 86193 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761555.1 protein_id gnl|my_center|LOCUS_19600 86237 86776 gene locus_tag LOCUS_19610 86237 86776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531871.1 protein_id gnl|my_center|LOCUS_19610 87777 86851 gene locus_tag LOCUS_19620 87777 86851 CDS product glutaredoxin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638714.2 protein_id gnl|my_center|LOCUS_19620 88568 87951 gene locus_tag LOCUS_19630 88568 87951 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038463.1 protein_id gnl|my_center|LOCUS_19630 89870 88572 gene locus_tag LOCUS_19640 gene aspC 89870 88572 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038462.1 protein_id gnl|my_center|LOCUS_19640 89970 91070 gene locus_tag LOCUS_19650 gene rsgA 89970 91070 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5H9 protein_id gnl|my_center|LOCUS_19650 91215 92468 gene locus_tag LOCUS_19660 91215 92468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038459.1 protein_id gnl|my_center|LOCUS_19660 92624 94927 gene locus_tag LOCUS_19670 gene fecA 92624 94927 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639569.2 protein_id gnl|my_center|LOCUS_19670 95358 95143 gene locus_tag LOCUS_19680 95358 95143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 96007 95471 gene locus_tag LOCUS_19690 96007 95471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 96897 96157 gene locus_tag LOCUS_19700 gene fabG 96897 96157 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038453.1 protein_id gnl|my_center|LOCUS_19700 98253 96922 gene locus_tag LOCUS_19710 gene citM 98253 96922 CDS product citrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038452.1 protein_id gnl|my_center|LOCUS_19710 99498 98326 gene locus_tag LOCUS_19720 gene oprO 99498 98326 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038451.1 protein_id gnl|my_center|LOCUS_19720 99695 100384 gene locus_tag LOCUS_19730 gene tctD 99695 100384 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038450.1 protein_id gnl|my_center|LOCUS_19730 100377 101768 gene locus_tag LOCUS_19740 gene tctE 100377 101768 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038449.1 protein_id gnl|my_center|LOCUS_19740 101765 102820 gene locus_tag LOCUS_19750 gene afuA 101765 102820 CDS product periplasmic iron-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638696.2 protein_id gnl|my_center|LOCUS_19750 102849 103499 gene locus_tag LOCUS_19760 102849 103499 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038447.1 protein_id gnl|my_center|LOCUS_19760 >Feature sequence13 726 205 gene locus_tag LOCUS_19770 726 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 2799 892 gene locus_tag LOCUS_19780 2799 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 3419 2799 gene locus_tag LOCUS_19790 3419 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 4551 3466 gene locus_tag LOCUS_19800 4551 3466 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706124.1 protein_id gnl|my_center|LOCUS_19800 4655 5575 gene locus_tag LOCUS_19810 4655 5575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 6158 6496 gene locus_tag LOCUS_19820 gene orf112 6158 6496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037228.1 protein_id gnl|my_center|LOCUS_19820 6564 6869 gene locus_tag LOCUS_19830 6564 6869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 8075 6879 gene locus_tag LOCUS_19840 8075 6879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689773.1 protein_id gnl|my_center|LOCUS_19840 8386 8072 gene locus_tag LOCUS_19850 8386 8072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 9963 8392 gene locus_tag LOCUS_19860 9963 8392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 10341 10090 gene locus_tag LOCUS_19870 10341 10090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 10541 10338 gene locus_tag LOCUS_19880 10541 10338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 10969 10667 gene locus_tag LOCUS_19890 10969 10667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 12078 10966 gene locus_tag LOCUS_19900 12078 10966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 12286 12071 gene locus_tag LOCUS_19910 12286 12071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 12567 12283 gene locus_tag LOCUS_19920 12567 12283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 12727 12557 gene locus_tag LOCUS_19930 12727 12557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 14803 13484 gene locus_tag LOCUS_19940 14803 13484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 15393 14908 gene locus_tag LOCUS_19950 15393 14908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 15483 16331 gene locus_tag LOCUS_19960 15483 16331 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222419.1 protein_id gnl|my_center|LOCUS_19960 17151 16378 gene locus_tag LOCUS_19970 17151 16378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 17693 17214 gene locus_tag LOCUS_19980 17693 17214 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210231.1 protein_id gnl|my_center|LOCUS_19980 17878 20022 gene locus_tag LOCUS_19990 17878 20022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038673.1 protein_id gnl|my_center|LOCUS_19990 20080 20580 gene locus_tag LOCUS_20000 gene tspO 20080 20580 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036969.1 protein_id gnl|my_center|LOCUS_20000 20890 20597 gene locus_tag LOCUS_20010 20890 20597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 21157 23394 gene locus_tag LOCUS_20020 21157 23394 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971984.1 protein_id gnl|my_center|LOCUS_20020 23391 23858 gene locus_tag LOCUS_20030 23391 23858 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316403.1 protein_id gnl|my_center|LOCUS_20030 23851 26250 gene locus_tag LOCUS_20040 23851 26250 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088025.1 protein_id gnl|my_center|LOCUS_20040 26945 26253 gene locus_tag LOCUS_20050 26945 26253 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084072.1 protein_id gnl|my_center|LOCUS_20050 27630 26956 gene locus_tag LOCUS_20060 27630 26956 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770944.1 protein_id gnl|my_center|LOCUS_20060 28250 27627 gene locus_tag LOCUS_20070 28250 27627 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404802.1 protein_id gnl|my_center|LOCUS_20070 28382 29149 gene locus_tag LOCUS_20080 28382 29149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036528.1 protein_id gnl|my_center|LOCUS_20080 29231 30181 gene locus_tag LOCUS_20090 gene desC 29231 30181 CDS product delta 9 acyl-lipid fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036524.1 protein_id gnl|my_center|LOCUS_20090 30183 31460 gene locus_tag LOCUS_20100 30183 31460 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036523.1 protein_id gnl|my_center|LOCUS_20100 31457 32224 gene locus_tag LOCUS_20110 31457 32224 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036522.1 protein_id gnl|my_center|LOCUS_20110 32221 33480 gene locus_tag LOCUS_20120 gene cfaA 32221 33480 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636703.2 protein_id gnl|my_center|LOCUS_20120 33482 34030 gene locus_tag LOCUS_20130 33482 34030 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036520.1 protein_id gnl|my_center|LOCUS_20130 34027 34812 gene locus_tag LOCUS_20140 34027 34812 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036519.1 protein_id gnl|my_center|LOCUS_20140 34809 35882 gene locus_tag LOCUS_20150 34809 35882 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036518.1 protein_id gnl|my_center|LOCUS_20150 35891 36424 gene locus_tag LOCUS_20160 gene blc 35891 36424 CDS product outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639462.2 protein_id gnl|my_center|LOCUS_20160 36549 37085 gene locus_tag LOCUS_20170 36549 37085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 38446 36995 gene locus_tag LOCUS_20180 38446 36995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 38508 39104 gene locus_tag LOCUS_20190 38508 39104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 39200 39892 gene locus_tag LOCUS_20200 39200 39892 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406371.1 protein_id gnl|my_center|LOCUS_20200 39889 42210 gene locus_tag LOCUS_20210 39889 42210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 42966 42211 gene locus_tag LOCUS_20220 42966 42211 CDS product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528770.1 protein_id gnl|my_center|LOCUS_20220 43349 43077 gene locus_tag LOCUS_20230 43349 43077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 45586 43550 gene locus_tag LOCUS_20240 gene fusA 45586 43550 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ES7 protein_id gnl|my_center|LOCUS_20240 46745 45996 gene locus_tag LOCUS_20250 46745 45996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 47766 47005 gene locus_tag LOCUS_20260 gene hmuV 47766 47005 CDS product hemin import ATP-binding protein HmuV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RKQ4 protein_id gnl|my_center|LOCUS_20260 48767 47763 gene locus_tag LOCUS_20270 48767 47763 CDS product hemin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405433.1 protein_id gnl|my_center|LOCUS_20270 49849 48803 gene locus_tag LOCUS_20280 49849 48803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 51277 49901 gene locus_tag LOCUS_20290 51277 49901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 52368 51400 gene locus_tag LOCUS_20300 52368 51400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090549.1 protein_id gnl|my_center|LOCUS_20300 52255 52497 gene locus_tag LOCUS_20310 52255 52497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 52695 52510 gene locus_tag LOCUS_20320 52695 52510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 52710 53084 gene locus_tag LOCUS_20330 52710 53084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 53547 53158 gene locus_tag LOCUS_20340 53547 53158 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036362.1 protein_id gnl|my_center|LOCUS_20340 55097 53736 gene locus_tag LOCUS_20350 55097 53736 CDS product recombination factor protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637341.2 protein_id gnl|my_center|LOCUS_20350 55924 55286 gene locus_tag LOCUS_20360 gene lolA 55924 55286 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P991 protein_id gnl|my_center|LOCUS_20360 57979 56036 gene locus_tag LOCUS_20370 57979 56036 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037137.1 protein_id gnl|my_center|LOCUS_20370 60379 58019 gene locus_tag LOCUS_20380 gene ftsK 60379 58019 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P993 protein_id gnl|my_center|LOCUS_20380 60613 61584 gene locus_tag LOCUS_20390 gene trxB 60613 61584 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P994 protein_id gnl|my_center|LOCUS_20390 62315 61686 gene locus_tag LOCUS_20400 62315 61686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 64046 62580 gene locus_tag LOCUS_20410 64046 62580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 64221 65372 gene locus_tag LOCUS_20420 64221 65372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037134.1 protein_id gnl|my_center|LOCUS_20420 66685 65417 gene locus_tag LOCUS_20430 66685 65417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 66759 67499 gene locus_tag LOCUS_20440 gene aat 66759 67499 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P996 protein_id gnl|my_center|LOCUS_20440 67586 67804 gene locus_tag LOCUS_20450 gene infA 67586 67804 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P997 protein_id gnl|my_center|LOCUS_20450 68009 67860 gene locus_tag LOCUS_20460 68009 67860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 68008 68385 gene locus_tag LOCUS_20470 68008 68385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 70742 68457 gene locus_tag LOCUS_20480 gene clpA 70742 68457 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037131.1 protein_id gnl|my_center|LOCUS_20480 70881 71693 gene locus_tag LOCUS_20490 gene str 70881 71693 CDS product streptomycin 3''-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113610.1 protein_id gnl|my_center|LOCUS_20490 72213 71887 gene locus_tag LOCUS_20500 gene clpS 72213 71887 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P999 protein_id gnl|my_center|LOCUS_20500 72326 72799 gene locus_tag LOCUS_20510 72326 72799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056178.1 protein_id gnl|my_center|LOCUS_20510 72801 73262 gene locus_tag LOCUS_20520 gene mutT 72801 73262 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037129.1 protein_id gnl|my_center|LOCUS_20520 73259 74401 gene locus_tag LOCUS_20530 gene mnmA 73259 74401 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9A1 protein_id gnl|my_center|LOCUS_20530 74398 75012 gene locus_tag LOCUS_20540 gene hflD 74398 75012 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9A2 protein_id gnl|my_center|LOCUS_20540 75177 76367 gene locus_tag LOCUS_20550 gene mcp 75177 76367 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037126.1 protein_id gnl|my_center|LOCUS_20550 76373 76678 gene locus_tag LOCUS_20560 76373 76678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 76708 77002 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcaggcatccgtgccgaccaa 79828 77069 gene locus_tag LOCUS_20570 79828 77069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637325.2 protein_id gnl|my_center|LOCUS_20570 79960 82062 gene locus_tag LOCUS_20580 gene hrpX 79960 82062 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037123.1 protein_id gnl|my_center|LOCUS_20580 82067 83839 gene locus_tag LOCUS_20590 gene pdeA 82067 83839 CDS product c-di-GMP phosphodiesterase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037122.1 protein_id gnl|my_center|LOCUS_20590 85150 83930 gene locus_tag LOCUS_20600 85150 83930 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037121.1 protein_id gnl|my_center|LOCUS_20600 85580 85242 gene locus_tag LOCUS_20610 85580 85242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037120.1 protein_id gnl|my_center|LOCUS_20610 85882 85577 gene locus_tag LOCUS_20620 gene flgM 85882 85577 CDS product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037119.1 protein_id gnl|my_center|LOCUS_20620 86614 85958 gene locus_tag LOCUS_20630 gene flgA 86614 85958 CDS product flagellar basal body P-ring biosynthesis protein FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637319.2 protein_id gnl|my_center|LOCUS_20630 86797 87741 gene locus_tag LOCUS_20640 gene cheV 86797 87741 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037117.1 protein_id gnl|my_center|LOCUS_20640 87881 88276 gene locus_tag LOCUS_20650 gene flgB 87881 88276 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9B3 protein_id gnl|my_center|LOCUS_20650 88280 88687 gene locus_tag LOCUS_20660 gene flgC 88280 88687 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9B4 protein_id gnl|my_center|LOCUS_20660 88711 89394 gene locus_tag LOCUS_20670 gene flgD 88711 89394 CDS product basal-body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9B5 protein_id gnl|my_center|LOCUS_20670 89427 90650 gene locus_tag LOCUS_20680 gene flgE 89427 90650 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9B6 protein_id gnl|my_center|LOCUS_20680 90683 91432 gene locus_tag LOCUS_20690 gene flgF 90683 91432 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9B7 protein_id gnl|my_center|LOCUS_20690 91535 92320 gene locus_tag LOCUS_20700 gene flgG 91535 92320 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9B8 protein_id gnl|my_center|LOCUS_20700 92343 93035 gene locus_tag LOCUS_20710 gene flgH 92343 93035 CDS product flagellar L-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9B9 protein_id gnl|my_center|LOCUS_20710 93119 94180 gene locus_tag LOCUS_20720 gene flgI 93119 94180 CDS product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9C0 protein_id gnl|my_center|LOCUS_20720 94182 95381 gene locus_tag LOCUS_20730 gene flgJ 94182 95381 CDS product flagellar rod assembly protein/muramidase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637309.2 protein_id gnl|my_center|LOCUS_20730 95390 97270 gene locus_tag LOCUS_20740 gene flgK 95390 97270 CDS product flagellar hook protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037108.1 protein_id gnl|my_center|LOCUS_20740 97267 98469 gene locus_tag LOCUS_20750 gene flgL 97267 98469 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037107.1 protein_id gnl|my_center|LOCUS_20750 98855 100075 gene locus_tag LOCUS_20760 gene fliC 98855 100075 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9C4 protein_id gnl|my_center|LOCUS_20760 100148 101335 gene locus_tag LOCUS_20770 gene fliC 100148 101335 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9C4 protein_id gnl|my_center|LOCUS_20770 >Feature sequence14 971 1405 gene locus_tag LOCUS_20780 971 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 2722 1472 gene locus_tag LOCUS_20790 gene umuC 2722 1472 CDS product DNA polymerase V subunit UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038087.1 protein_id gnl|my_center|LOCUS_20790 3188 2706 gene locus_tag LOCUS_20800 gene umuD 3188 2706 CDS product peptidase S24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038086.1 protein_id gnl|my_center|LOCUS_20800 4928 3573 gene locus_tag LOCUS_20810 4928 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 5286 5852 gene locus_tag LOCUS_20820 5286 5852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 6483 5986 gene locus_tag LOCUS_20830 6483 5986 CDS product fasciclin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083338.1 protein_id gnl|my_center|LOCUS_20830 6976 6725 gene locus_tag LOCUS_20840 6976 6725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 7314 7069 gene locus_tag LOCUS_20850 7314 7069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 8336 7506 gene locus_tag LOCUS_20860 8336 7506 CDS product non-heme chloroperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096737.1 protein_id gnl|my_center|LOCUS_20860 8538 9530 gene locus_tag LOCUS_20870 8538 9530 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974642.1 protein_id gnl|my_center|LOCUS_20870 10005 9607 gene locus_tag LOCUS_20880 10005 9607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 10126 10545 gene locus_tag LOCUS_20890 10126 10545 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035880.1 protein_id gnl|my_center|LOCUS_20890 10595 11002 gene locus_tag LOCUS_20900 10595 11002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 11667 11026 gene locus_tag LOCUS_20910 11667 11026 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089404.1 protein_id gnl|my_center|LOCUS_20910 12142 12594 gene locus_tag LOCUS_20920 12142 12594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036511.1 protein_id gnl|my_center|LOCUS_20920 16103 12744 gene locus_tag LOCUS_20930 16103 12744 CDS product outer membrane autotransporter barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103649.1 protein_id gnl|my_center|LOCUS_20930 16292 16492 gene locus_tag LOCUS_20940 16292 16492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 16614 16964 gene locus_tag LOCUS_20950 16614 16964 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971965.1 protein_id gnl|my_center|LOCUS_20950 17597 16980 gene locus_tag LOCUS_20960 17597 16980 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082696.1 protein_id gnl|my_center|LOCUS_20960 17723 19195 gene locus_tag LOCUS_20970 17723 19195 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112370.1 protein_id gnl|my_center|LOCUS_20970 19509 19207 gene locus_tag LOCUS_20980 19509 19207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 20137 19673 gene locus_tag LOCUS_20990 20137 19673 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038649.1 protein_id gnl|my_center|LOCUS_20990 20203 21099 gene locus_tag LOCUS_21000 20203 21099 CDS product interphotoreceptor retinoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222113.1 protein_id gnl|my_center|LOCUS_21000 21189 22091 gene locus_tag LOCUS_21010 21189 22091 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971752.1 protein_id gnl|my_center|LOCUS_21010 22302 24833 gene locus_tag LOCUS_21020 22302 24833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 25054 25224 gene locus_tag LOCUS_21030 25054 25224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 27334 25283 gene locus_tag LOCUS_21040 27334 25283 CDS product catecholate siderophore receptor CirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706114.1 protein_id gnl|my_center|LOCUS_21040 27824 29749 gene locus_tag LOCUS_21050 gene opgH 27824 29749 CDS product glucans biosynthesis glucosyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P532 protein_id gnl|my_center|LOCUS_21050 29800 30459 gene locus_tag LOCUS_21060 29800 30459 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038606.1 protein_id gnl|my_center|LOCUS_21060 30463 31506 gene locus_tag LOCUS_21070 gene algZ 30463 31506 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038605.1 protein_id gnl|my_center|LOCUS_21070 31517 32248 gene locus_tag LOCUS_21080 gene algR 31517 32248 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038604.1 protein_id gnl|my_center|LOCUS_21080 32796 33707 gene locus_tag LOCUS_21090 gene hemC 32796 33707 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P536 protein_id gnl|my_center|LOCUS_21090 34601 33825 gene locus_tag LOCUS_21100 34601 33825 CDS product salt-induced outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038602.1 protein_id gnl|my_center|LOCUS_21100 35424 34708 gene locus_tag LOCUS_21110 35424 34708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 35392 36363 gene locus_tag LOCUS_21120 35392 36363 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038601.1 protein_id gnl|my_center|LOCUS_21120 36390 37184 gene locus_tag LOCUS_21130 36390 37184 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4S9 protein_id gnl|my_center|LOCUS_21130 38790 37291 gene locus_tag LOCUS_21140 gene glpK 38790 37291 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDI0 protein_id gnl|my_center|LOCUS_21140 40351 38870 gene locus_tag LOCUS_21150 gene glpD 40351 38870 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDH8 protein_id gnl|my_center|LOCUS_21150 41140 40505 gene locus_tag LOCUS_21160 gene ompW 41140 40505 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035787.1 protein_id gnl|my_center|LOCUS_21160 41327 41896 gene locus_tag LOCUS_21170 41327 41896 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035788.1 protein_id gnl|my_center|LOCUS_21170 42010 43713 gene locus_tag LOCUS_21180 gene phdB 42010 43713 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD06 protein_id gnl|my_center|LOCUS_21180 43821 45629 gene locus_tag LOCUS_21190 gene lpdA 43821 45629 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD04 protein_id gnl|my_center|LOCUS_21190 46921 46079 gene locus_tag LOCUS_21200 46921 46079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035794.1 protein_id gnl|my_center|LOCUS_21200 47357 47722 gene locus_tag LOCUS_21210 47357 47722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035795.1 protein_id gnl|my_center|LOCUS_21210 47754 48554 gene locus_tag LOCUS_21220 gene atpB 47754 48554 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD00 protein_id gnl|my_center|LOCUS_21220 48628 48933 gene locus_tag LOCUS_21230 gene atpE 48628 48933 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CLV6 protein_id gnl|my_center|LOCUS_21230 48956 49510 gene locus_tag LOCUS_21240 gene atpF 48956 49510 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCZ9 protein_id gnl|my_center|LOCUS_21240 49513 50040 gene locus_tag LOCUS_21250 gene atpH 49513 50040 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCZ8 protein_id gnl|my_center|LOCUS_21250 50085 51632 gene locus_tag LOCUS_21260 gene atpA 50085 51632 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCZ7 protein_id gnl|my_center|LOCUS_21260 51730 52593 gene locus_tag LOCUS_21270 gene atpG 51730 52593 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCZ6 protein_id gnl|my_center|LOCUS_21270 52631 54037 gene locus_tag LOCUS_21280 gene atpD 52631 54037 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCZ5 protein_id gnl|my_center|LOCUS_21280 54151 54573 gene locus_tag LOCUS_21290 gene atpC 54151 54573 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCZ4 protein_id gnl|my_center|LOCUS_21290 55063 54677 gene locus_tag LOCUS_21300 55063 54677 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035804.1 protein_id gnl|my_center|LOCUS_21300 55147 56514 gene locus_tag LOCUS_21310 gene glmU 55147 56514 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCZ1 protein_id gnl|my_center|LOCUS_21310 56483 57016 gene locus_tag LOCUS_21320 56483 57016 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I1K2 protein_id gnl|my_center|LOCUS_21320 58425 57073 gene locus_tag LOCUS_21330 58425 57073 CDS product histidine kinase/response regulator hybrid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635954.2 protein_id gnl|my_center|LOCUS_21330 59849 58422 gene locus_tag LOCUS_21340 gene ntrC 59849 58422 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035809.1 protein_id gnl|my_center|LOCUS_21340 60270 59890 gene locus_tag LOCUS_21350 60270 59890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 61489 60272 gene locus_tag LOCUS_21360 gene ybjZ 61489 60272 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035811.1 protein_id gnl|my_center|LOCUS_21360 62808 61510 gene locus_tag LOCUS_21370 gene ybjZ 62808 61510 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035812.1 protein_id gnl|my_center|LOCUS_21370 63544 62819 gene locus_tag LOCUS_21380 gene ycfV 63544 62819 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035813.1 protein_id gnl|my_center|LOCUS_21380 64857 63580 gene locus_tag LOCUS_21390 gene ybjY 64857 63580 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035814.1 protein_id gnl|my_center|LOCUS_21390 65061 66899 gene locus_tag LOCUS_21400 gene glmS 65061 66899 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCY1 protein_id gnl|my_center|LOCUS_21400 67347 67778 gene locus_tag LOCUS_21410 67347 67778 CDS product signal transduction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224278.1 protein_id gnl|my_center|LOCUS_21410 68274 67846 gene locus_tag LOCUS_21420 68274 67846 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530756.1 protein_id gnl|my_center|LOCUS_21420 68881 68366 gene locus_tag LOCUS_21430 gene gloA 68881 68366 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCX6 protein_id gnl|my_center|LOCUS_21430 69007 70119 gene locus_tag LOCUS_21440 gene cysM 69007 70119 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035824.1 protein_id gnl|my_center|LOCUS_21440 70593 70189 gene locus_tag LOCUS_21450 70593 70189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 70764 72794 gene locus_tag LOCUS_21460 gene prlC 70764 72794 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035825.1 protein_id gnl|my_center|LOCUS_21460 73679 72876 gene locus_tag LOCUS_21470 73679 72876 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038719.1 protein_id gnl|my_center|LOCUS_21470 74272 73676 gene locus_tag LOCUS_21480 74272 73676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038716.1 protein_id gnl|my_center|LOCUS_21480 74826 74344 gene locus_tag LOCUS_21490 74826 74344 CDS product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4S5 protein_id gnl|my_center|LOCUS_21490 74973 75869 gene locus_tag LOCUS_21500 74973 75869 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038714.1 protein_id gnl|my_center|LOCUS_21500 76084 77091 gene locus_tag LOCUS_21510 gene metN 76084 77091 CDS product methionine import ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4S7 protein_id gnl|my_center|LOCUS_21510 77088 77777 gene locus_tag LOCUS_21520 gene yaeE 77088 77777 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038712.1 protein_id gnl|my_center|LOCUS_21520 78443 77847 gene locus_tag LOCUS_21530 78443 77847 CDS product outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638854.2 protein_id gnl|my_center|LOCUS_21530 78571 78897 gene locus_tag LOCUS_21540 78571 78897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 78967 81063 gene locus_tag LOCUS_21550 78967 81063 CDS product prolyl oligopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038598.1 protein_id gnl|my_center|LOCUS_21550 82374 81181 gene locus_tag LOCUS_21560 gene aspC 82374 81181 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P544 protein_id gnl|my_center|LOCUS_21560 82571 84682 gene locus_tag LOCUS_21570 gene ptrB 82571 84682 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038594.1 protein_id gnl|my_center|LOCUS_21570 84737 85162 gene locus_tag LOCUS_21580 84737 85162 CDS product inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P546 protein_id gnl|my_center|LOCUS_21580 85245 85517 gene locus_tag LOCUS_21590 85245 85517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 85510 86361 gene locus_tag LOCUS_21600 gene dapF 85510 86361 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P548 protein_id gnl|my_center|LOCUS_21600 86358 87032 gene locus_tag LOCUS_21610 86358 87032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038590.1 protein_id gnl|my_center|LOCUS_21610 87049 87939 gene locus_tag LOCUS_21620 gene xerC 87049 87939 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P550 protein_id gnl|my_center|LOCUS_21620 87987 88217 gene locus_tag LOCUS_21630 87987 88217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 88292 88843 gene locus_tag LOCUS_21640 gene hslV 88292 88843 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P551 protein_id gnl|my_center|LOCUS_21640 88977 90320 gene locus_tag LOCUS_21650 gene hslU 88977 90320 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P552 protein_id gnl|my_center|LOCUS_21650 91372 90386 gene locus_tag LOCUS_21660 91372 90386 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795082.1 protein_id gnl|my_center|LOCUS_21660 92093 91434 gene locus_tag LOCUS_21670 gene bpeR 92093 91434 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526226.1 protein_id gnl|my_center|LOCUS_21670 92304 93488 gene locus_tag LOCUS_21680 gene acrA 92304 93488 CDS product MexX family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943335.1 protein_id gnl|my_center|LOCUS_21680 93501 96623 gene locus_tag LOCUS_21690 gene vmeB 93501 96623 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074281.1 protein_id gnl|my_center|LOCUS_21690 96729 98114 gene locus_tag LOCUS_21700 gene oprM 96729 98114 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037811.1 protein_id gnl|my_center|LOCUS_21700 98618 98196 gene locus_tag LOCUS_21710 98618 98196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113677.1 protein_id gnl|my_center|LOCUS_21710 99007 98681 gene locus_tag LOCUS_21720 99007 98681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035523.1 protein_id gnl|my_center|LOCUS_21720 99342 99082 gene locus_tag LOCUS_21730 99342 99082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 99994 99542 gene locus_tag LOCUS_21740 gene codA 99994 99542 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038585.1 protein_id gnl|my_center|LOCUS_21740 100075 100836 gene locus_tag LOCUS_21750 gene ubiE 100075 100836 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P558 protein_id gnl|my_center|LOCUS_21750 >Feature sequence15 16 92 gene locus_tag LOCUS_t00180 16 92 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 199 275 gene locus_tag LOCUS_t00190 199 275 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 423 2378 gene locus_tag LOCUS_21760 gene ppiD 423 2378 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBY3 protein_id gnl|my_center|LOCUS_21760 3773 2574 gene locus_tag LOCUS_21770 gene dniR 3773 2574 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036189.1 protein_id gnl|my_center|LOCUS_21770 4534 3770 gene locus_tag LOCUS_21780 gene gloB 4534 3770 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBY0 protein_id gnl|my_center|LOCUS_21780 4546 5190 gene locus_tag LOCUS_21790 4546 5190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036191.1 protein_id gnl|my_center|LOCUS_21790 5203 5655 gene locus_tag LOCUS_21800 gene rnhA 5203 5655 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBX8 protein_id gnl|my_center|LOCUS_21800 5660 6391 gene locus_tag LOCUS_21810 gene dnaQ 5660 6391 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036193.1 protein_id gnl|my_center|LOCUS_21810 7161 6457 gene locus_tag LOCUS_21820 7161 6457 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036194.1 protein_id gnl|my_center|LOCUS_21820 7327 7417 gene locus_tag LOCUS_t00200 7327 7417 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7683 8087 gene locus_tag LOCUS_21830 7683 8087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036195.1 protein_id gnl|my_center|LOCUS_21830 9161 8136 gene locus_tag LOCUS_21840 gene opsX 9161 8136 CDS product ADP-heptose--LPS heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036196.1 protein_id gnl|my_center|LOCUS_21840 9164 9952 gene locus_tag LOCUS_21850 gene kdkA 9164 9952 CDS product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBX3 protein_id gnl|my_center|LOCUS_21850 9952 10719 gene locus_tag LOCUS_21860 9952 10719 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036198.1 protein_id gnl|my_center|LOCUS_21860 10716 11105 gene locus_tag LOCUS_21870 10716 11105 CDS product DUF4440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036200.1 protein_id gnl|my_center|LOCUS_21870 11580 11897 gene locus_tag LOCUS_21880 gene sugE 11580 11897 CDS product QacE family quaternary ammonium compound efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115842.1 protein_id gnl|my_center|LOCUS_21880 12407 23158 gene locus_tag LOCUS_21890 12407 23158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 23659 23216 gene locus_tag LOCUS_21900 23659 23216 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384944.1 protein_id gnl|my_center|LOCUS_21900 24857 23736 gene locus_tag LOCUS_21910 24857 23736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 25457 25365 gene locus_tag LOCUS_t00210 25457 25365 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 25736 25500 gene locus_tag LOCUS_21920 25736 25500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 25620 27653 gene locus_tag LOCUS_21930 gene dnaX 25620 27653 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036204.1 protein_id gnl|my_center|LOCUS_21930 27660 27980 gene locus_tag LOCUS_21940 27660 27980 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBW5 protein_id gnl|my_center|LOCUS_21940 28122 28721 gene locus_tag LOCUS_21950 gene recR 28122 28721 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBW4 protein_id gnl|my_center|LOCUS_21950 28789 29148 gene locus_tag LOCUS_21960 28789 29148 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036207.1 protein_id gnl|my_center|LOCUS_21960 29754 29227 gene locus_tag LOCUS_21970 gene slp 29754 29227 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036208.1 protein_id gnl|my_center|LOCUS_21970 31682 29751 gene locus_tag LOCUS_21980 31682 29751 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036209.1 protein_id gnl|my_center|LOCUS_21980 32637 31693 gene locus_tag LOCUS_21990 32637 31693 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036210.1 protein_id gnl|my_center|LOCUS_21990 33566 32640 gene locus_tag LOCUS_22000 gene moxR 33566 32640 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036211.1 protein_id gnl|my_center|LOCUS_22000 33636 35471 gene locus_tag LOCUS_22010 33636 35471 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036212.1 protein_id gnl|my_center|LOCUS_22010 36127 35558 gene locus_tag LOCUS_22020 36127 35558 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBV4 protein_id gnl|my_center|LOCUS_22020 36313 36750 gene locus_tag LOCUS_22030 36313 36750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036217.1 protein_id gnl|my_center|LOCUS_22030 36858 37052 gene locus_tag LOCUS_22040 gene rpmF 36858 37052 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBV2 protein_id gnl|my_center|LOCUS_22040 37144 38121 gene locus_tag LOCUS_22050 gene fabH 37144 38121 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBV1 protein_id gnl|my_center|LOCUS_22050 38200 38982 gene locus_tag LOCUS_22060 38200 38982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 39118 40062 gene locus_tag LOCUS_22070 gene fabD 39118 40062 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBV0 protein_id gnl|my_center|LOCUS_22070 40144 40887 gene locus_tag LOCUS_22080 gene fabG 40144 40887 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036220.1 protein_id gnl|my_center|LOCUS_22080 41040 41279 gene locus_tag LOCUS_22090 gene acpP 41040 41279 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63447 protein_id gnl|my_center|LOCUS_22090 41423 42685 gene locus_tag LOCUS_22100 gene fabF 41423 42685 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBU8 protein_id gnl|my_center|LOCUS_22100 42787 44151 gene locus_tag LOCUS_22110 gene trpE 42787 44151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036222.1 protein_id gnl|my_center|LOCUS_22110 44365 45426 gene locus_tag LOCUS_22120 44365 45426 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036223.1 protein_id gnl|my_center|LOCUS_22120 45423 46088 gene locus_tag LOCUS_22130 gene tmk 45423 46088 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YH1 protein_id gnl|my_center|LOCUS_22130 46085 47041 gene locus_tag LOCUS_22140 gene holB 46085 47041 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036224.1 protein_id gnl|my_center|LOCUS_22140 47038 47391 gene locus_tag LOCUS_22150 gene pilZ 47038 47391 CDS product type IV fimbriae assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036225.1 protein_id gnl|my_center|LOCUS_22150 47525 47599 gene locus_tag LOCUS_t00220 47525 47599 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 48247 47684 gene locus_tag LOCUS_22160 48247 47684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 48707 48300 gene locus_tag LOCUS_22170 48707 48300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 49226 49606 gene locus_tag LOCUS_22180 49226 49606 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190990.1 protein_id gnl|my_center|LOCUS_22180 50761 49688 gene locus_tag LOCUS_22190 gene D 50761 49688 CDS product phage late control protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038112.1 protein_id gnl|my_center|LOCUS_22190 50967 50752 gene locus_tag LOCUS_22200 50967 50752 CDS product tail protein X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970908.1 protein_id gnl|my_center|LOCUS_22200 51418 50951 gene locus_tag LOCUS_22210 gene gpU 51418 50951 CDS product tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140365.1 protein_id gnl|my_center|LOCUS_22210 53883 51421 gene locus_tag LOCUS_22220 53883 51421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 54294 54004 gene locus_tag LOCUS_22230 54294 54004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 54879 54376 gene locus_tag LOCUS_22240 54879 54376 CDS product phage major tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247634.1 protein_id gnl|my_center|LOCUS_22240 56084 54882 gene locus_tag LOCUS_22250 56084 54882 CDS product bacteriophage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113197.1 protein_id gnl|my_center|LOCUS_22250 56819 56187 gene locus_tag LOCUS_22260 56819 56187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 58902 56821 gene locus_tag LOCUS_22270 58902 56821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 59689 58910 gene locus_tag LOCUS_22280 59689 58910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 60578 59682 gene locus_tag LOCUS_22290 gene J 60578 59682 CDS product baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038101.1 protein_id gnl|my_center|LOCUS_22290 60919 60581 gene locus_tag LOCUS_22300 60919 60581 CDS product baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177595.1 protein_id gnl|my_center|LOCUS_22300 61562 60972 gene locus_tag LOCUS_22310 61562 60972 CDS product baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271909.1 protein_id gnl|my_center|LOCUS_22310 62113 61559 gene locus_tag LOCUS_22320 62113 61559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 62482 62207 gene locus_tag LOCUS_22330 62482 62207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 62834 62457 gene locus_tag LOCUS_22340 62834 62457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 63316 62831 gene locus_tag LOCUS_22350 63316 62831 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EHE9 protein_id gnl|my_center|LOCUS_22350 63663 63313 gene locus_tag LOCUS_22360 63663 63313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 64109 63660 gene locus_tag LOCUS_22370 64109 63660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 64822 64439 gene locus_tag LOCUS_22380 64822 64439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 65525 64974 gene locus_tag LOCUS_22390 65525 64974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 65793 65566 gene locus_tag LOCUS_22400 65793 65566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 68230 65945 gene locus_tag LOCUS_22410 68230 65945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 68762 68986 gene locus_tag LOCUS_22420 68762 68986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 68998 69252 gene locus_tag LOCUS_22430 68998 69252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 69413 69850 gene locus_tag LOCUS_22440 69413 69850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 69979 72117 gene locus_tag LOCUS_22450 gene fhuA 69979 72117 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035647.1 protein_id gnl|my_center|LOCUS_22450 72129 73634 gene locus_tag LOCUS_22460 72129 73634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114902.1 protein_id gnl|my_center|LOCUS_22460 74777 73644 gene locus_tag LOCUS_22470 74777 73644 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619360.1 protein_id gnl|my_center|LOCUS_22470 75565 74789 gene locus_tag LOCUS_22480 75565 74789 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310903.1 protein_id gnl|my_center|LOCUS_22480 75714 76373 gene locus_tag LOCUS_22490 75714 76373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704297.1 protein_id gnl|my_center|LOCUS_22490 77064 76390 gene locus_tag LOCUS_22500 77064 76390 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090698.1 protein_id gnl|my_center|LOCUS_22500 78522 77143 gene locus_tag LOCUS_22510 78522 77143 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531252.1 protein_id gnl|my_center|LOCUS_22510 78611 79519 gene locus_tag LOCUS_22520 78611 79519 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531253.1 protein_id gnl|my_center|LOCUS_22520 79677 80558 gene locus_tag LOCUS_22530 79677 80558 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730663.1 protein_id gnl|my_center|LOCUS_22530 80597 80827 gene locus_tag LOCUS_22540 80597 80827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22540 80882 81475 gene locus_tag LOCUS_22550 80882 81475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22550 82430 81489 gene locus_tag LOCUS_22560 82430 81489 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529929.1 protein_id gnl|my_center|LOCUS_22560 82495 84012 gene locus_tag LOCUS_22570 82495 84012 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529928.1 protein_id gnl|my_center|LOCUS_22570 84856 84452 gene locus_tag LOCUS_22580 84856 84452 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707472.1 protein_id gnl|my_center|LOCUS_22580 85029 86003 gene locus_tag LOCUS_22590 85029 86003 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035992.1 protein_id gnl|my_center|LOCUS_22590 86003 88024 gene locus_tag LOCUS_22600 86003 88024 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035993.1 protein_id gnl|my_center|LOCUS_22600 89473 88112 gene locus_tag LOCUS_22610 89473 88112 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223556.1 protein_id gnl|my_center|LOCUS_22610 89563 89997 gene locus_tag LOCUS_22620 gene soxR 89563 89997 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037956.1 protein_id gnl|my_center|LOCUS_22620 90642 90040 gene locus_tag LOCUS_22630 90642 90040 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703478.1 protein_id gnl|my_center|LOCUS_22630 90704 91618 gene locus_tag LOCUS_22640 90704 91618 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703477.1 protein_id gnl|my_center|LOCUS_22640 92479 91658 gene locus_tag LOCUS_22650 gene proC 92479 91658 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P757 protein_id gnl|my_center|LOCUS_22650 93175 92498 gene locus_tag LOCUS_22660 93175 92498 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037884.1 protein_id gnl|my_center|LOCUS_22660 93263 94300 gene locus_tag LOCUS_22670 gene pilT 93263 94300 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003489919.1 protein_id gnl|my_center|LOCUS_22670 94400 95542 gene locus_tag LOCUS_22680 gene pilU 94400 95542 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005990431.1 protein_id gnl|my_center|LOCUS_22680 95664 96647 gene locus_tag LOCUS_22690 95664 96647 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037809.1 protein_id gnl|my_center|LOCUS_22690 97586 96690 gene locus_tag LOCUS_22700 97586 96690 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037808.1 protein_id gnl|my_center|LOCUS_22700 97680 97889 gene locus_tag LOCUS_22710 97680 97889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975334.1 protein_id gnl|my_center|LOCUS_22710 >Feature sequence16 36 2612 gene locus_tag LOCUS_22720 gene bfeA 36 2612 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038158.1 protein_id gnl|my_center|LOCUS_22720 2727 3281 gene locus_tag LOCUS_22730 gene msuE 2727 3281 CDS product FMN reductase (NADPH) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31038 protein_id gnl|my_center|LOCUS_22730 3438 3800 gene locus_tag LOCUS_22740 3438 3800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 3815 4792 gene locus_tag LOCUS_22750 3815 4792 CDS product alkanal monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187562.1 protein_id gnl|my_center|LOCUS_22750 4811 6154 gene locus_tag LOCUS_22760 4811 6154 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525217.1 protein_id gnl|my_center|LOCUS_22760 6159 7379 gene locus_tag LOCUS_22770 6159 7379 CDS product hippurate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973024.1 protein_id gnl|my_center|LOCUS_22770 7376 7927 gene locus_tag LOCUS_22780 7376 7927 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973023.1 protein_id gnl|my_center|LOCUS_22780 7924 9669 gene locus_tag LOCUS_22790 7924 9669 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315104.1 protein_id gnl|my_center|LOCUS_22790 9686 10660 gene locus_tag LOCUS_22800 9686 10660 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973022.1 protein_id gnl|my_center|LOCUS_22800 13864 10748 gene locus_tag LOCUS_22810 13864 10748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 14363 14860 gene locus_tag LOCUS_22820 14363 14860 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812293.1 protein_id gnl|my_center|LOCUS_22820 15847 14954 gene locus_tag LOCUS_22830 15847 14954 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975353.1 protein_id gnl|my_center|LOCUS_22830 16368 15871 gene locus_tag LOCUS_22840 16368 15871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 17128 16385 gene locus_tag LOCUS_22850 17128 16385 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816333.1 protein_id gnl|my_center|LOCUS_22850 18428 17352 gene locus_tag LOCUS_22860 18428 17352 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074216.1 protein_id gnl|my_center|LOCUS_22860 18533 19144 gene locus_tag LOCUS_22870 18533 19144 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035488.1 protein_id gnl|my_center|LOCUS_22870 21087 19141 gene locus_tag LOCUS_22880 21087 19141 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971403.1 protein_id gnl|my_center|LOCUS_22880 21890 21183 gene locus_tag LOCUS_22890 21890 21183 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143931.1 protein_id gnl|my_center|LOCUS_22890 22078 22887 gene locus_tag LOCUS_22900 22078 22887 CDS product aminoglycoside phosphotransferase APH(3') inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970345.1 protein_id gnl|my_center|LOCUS_22900 22969 23559 gene locus_tag LOCUS_22910 22969 23559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 23556 24590 gene locus_tag LOCUS_22920 23556 24590 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704524.1 protein_id gnl|my_center|LOCUS_22920 24689 25693 gene locus_tag LOCUS_22930 24689 25693 CDS product spectinomycin phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947221.1 protein_id gnl|my_center|LOCUS_22930 26686 25760 gene locus_tag LOCUS_22940 26686 25760 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036959.1 protein_id gnl|my_center|LOCUS_22940 27741 26680 gene locus_tag LOCUS_22950 gene murB 27741 26680 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9R1 protein_id gnl|my_center|LOCUS_22950 28805 27750 gene locus_tag LOCUS_22960 gene pyrD 28805 27750 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9R0 protein_id gnl|my_center|LOCUS_22960 29584 28814 gene locus_tag LOCUS_22970 29584 28814 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036962.1 protein_id gnl|my_center|LOCUS_22970 29874 29590 gene locus_tag LOCUS_22980 29874 29590 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036963.1 protein_id gnl|my_center|LOCUS_22980 30856 30053 gene locus_tag LOCUS_22990 30856 30053 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035669.1 protein_id gnl|my_center|LOCUS_22990 32388 30856 gene locus_tag LOCUS_23000 32388 30856 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036964.1 protein_id gnl|my_center|LOCUS_23000 32574 32650 gene locus_tag LOCUS_t00230 32574 32650 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 33733 32744 gene locus_tag LOCUS_23010 33733 32744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 34727 34215 gene locus_tag LOCUS_23020 34727 34215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 34864 35106 gene locus_tag LOCUS_23030 34864 35106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 35364 35735 gene locus_tag LOCUS_23040 35364 35735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 37646 35967 gene locus_tag LOCUS_23050 gene funZ 37646 35967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222614.1 protein_id gnl|my_center|LOCUS_23050 37989 37747 gene locus_tag LOCUS_23060 37989 37747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 39254 38364 gene locus_tag LOCUS_23070 39254 38364 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705975.1 protein_id gnl|my_center|LOCUS_23070 39424 39882 gene locus_tag LOCUS_23080 39424 39882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 40078 39860 gene locus_tag LOCUS_23090 40078 39860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 40019 40873 gene locus_tag LOCUS_23100 40019 40873 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108071.1 protein_id gnl|my_center|LOCUS_23100 41651 40821 gene locus_tag LOCUS_23110 41651 40821 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720879.1 protein_id gnl|my_center|LOCUS_23110 41820 42383 gene locus_tag LOCUS_23120 gene nfxB 41820 42383 CDS product HTH-type transcriptional regulator nfxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P32265 protein_id gnl|my_center|LOCUS_23120 42849 48896 gene locus_tag LOCUS_23130 42849 48896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 48893 52582 gene locus_tag LOCUS_23140 48893 52582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462999.1 protein_id gnl|my_center|LOCUS_23140 53008 52649 gene locus_tag LOCUS_23150 53008 52649 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036384.1 protein_id gnl|my_center|LOCUS_23150 54089 52998 gene locus_tag LOCUS_23160 54089 52998 CDS product two-component system sensor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636560.2 protein_id gnl|my_center|LOCUS_23160 54352 57426 gene locus_tag LOCUS_23170 54352 57426 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036382.1 protein_id gnl|my_center|LOCUS_23170 57423 58247 gene locus_tag LOCUS_23180 gene cheR 57423 58247 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036381.1 protein_id gnl|my_center|LOCUS_23180 58247 58822 gene locus_tag LOCUS_23190 gene cheB 58247 58822 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036380.1 protein_id gnl|my_center|LOCUS_23190 58819 59952 gene locus_tag LOCUS_23200 58819 59952 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036379.1 protein_id gnl|my_center|LOCUS_23200 60036 60464 gene locus_tag LOCUS_23210 60036 60464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 60787 60467 gene locus_tag LOCUS_23220 60787 60467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 60874 61311 gene locus_tag LOCUS_23230 60874 61311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038731.1 protein_id gnl|my_center|LOCUS_23230 61308 61721 gene locus_tag LOCUS_23240 61308 61721 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967549.1 protein_id gnl|my_center|LOCUS_23240 61819 62841 gene locus_tag LOCUS_23250 61819 62841 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929827.1 protein_id gnl|my_center|LOCUS_23250 63617 62838 gene locus_tag LOCUS_23260 63617 62838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036506.1 protein_id gnl|my_center|LOCUS_23260 63699 64397 gene locus_tag LOCUS_23270 63699 64397 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036056.1 protein_id gnl|my_center|LOCUS_23270 64557 65507 gene locus_tag LOCUS_23280 64557 65507 CDS product multidrug DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036055.1 protein_id gnl|my_center|LOCUS_23280 65646 65780 gene locus_tag LOCUS_23290 65646 65780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 65865 68369 gene locus_tag LOCUS_23300 gene thrA 65865 68369 CDS product bifunctional aspartokinase I/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036970.1 protein_id gnl|my_center|LOCUS_23300 68366 69280 gene locus_tag LOCUS_23310 gene thrB 68366 69280 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9Q0 protein_id gnl|my_center|LOCUS_23310 69310 70596 gene locus_tag LOCUS_23320 gene thrC 69310 70596 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637168.2 protein_id gnl|my_center|LOCUS_23320 71533 70781 gene locus_tag LOCUS_23330 gene fnr 71533 70781 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036975.1 protein_id gnl|my_center|LOCUS_23330 71660 73057 gene locus_tag LOCUS_23340 gene hisS 71660 73057 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9P5 protein_id gnl|my_center|LOCUS_23340 73054 73350 gene locus_tag LOCUS_23350 73054 73350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 73758 74066 gene locus_tag LOCUS_23360 73758 74066 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036977.1 protein_id gnl|my_center|LOCUS_23360 74101 75012 gene locus_tag LOCUS_23370 gene hisG 74101 75012 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9P3 protein_id gnl|my_center|LOCUS_23370 75009 76304 gene locus_tag LOCUS_23380 gene hisD 75009 76304 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9P2 protein_id gnl|my_center|LOCUS_23380 76301 77392 gene locus_tag LOCUS_23390 gene hisC 76301 77392 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58892 protein_id gnl|my_center|LOCUS_23390 77389 78462 gene locus_tag LOCUS_23400 gene hisB 77389 78462 CDS product histidine biosynthesis bifunctional protein HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58882 protein_id gnl|my_center|LOCUS_23400 78459 79061 gene locus_tag LOCUS_23410 gene hisH 78459 79061 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9P1 protein_id gnl|my_center|LOCUS_23410 79058 79792 gene locus_tag LOCUS_23420 gene hisA 79058 79792 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9P0 protein_id gnl|my_center|LOCUS_23420 79786 80562 gene locus_tag LOCUS_23430 gene hisF 79786 80562 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9N9 protein_id gnl|my_center|LOCUS_23430 80552 81172 gene locus_tag LOCUS_23440 gene hisI 80552 81172 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9N8 protein_id gnl|my_center|LOCUS_23440 81327 82916 gene locus_tag LOCUS_23450 81327 82916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637181.2 protein_id gnl|my_center|LOCUS_23450 82952 83236 gene locus_tag LOCUS_23460 82952 83236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 83321 84343 gene locus_tag LOCUS_23470 gene glk 83321 84343 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038011.1 protein_id gnl|my_center|LOCUS_23470 84395 85393 gene locus_tag LOCUS_23480 gene aspG 84395 85393 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638262.2 protein_id gnl|my_center|LOCUS_23480 85390 86121 gene locus_tag LOCUS_23490 gene cutC 85390 86121 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6Q4 protein_id gnl|my_center|LOCUS_23490 86459 89416 gene locus_tag LOCUS_23500 86459 89416 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039283.1 protein_id gnl|my_center|LOCUS_23500 89568 92060 gene locus_tag LOCUS_23510 89568 92060 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931165.1 protein_id gnl|my_center|LOCUS_23510 92076 92531 gene locus_tag LOCUS_23520 92076 92531 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886859.1 protein_id gnl|my_center|LOCUS_23520 92804 92610 gene locus_tag LOCUS_23530 92804 92610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008991978.1 protein_id gnl|my_center|LOCUS_23530 96106 93029 gene locus_tag LOCUS_23540 gene cirA 96106 93029 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037060.1 protein_id gnl|my_center|LOCUS_23540 >Feature sequence17 1188 637 gene locus_tag LOCUS_23550 1188 637 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194069.1 protein_id gnl|my_center|LOCUS_23550 3569 1185 gene locus_tag LOCUS_23560 gene dsbD 3569 1185 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035768.1 protein_id gnl|my_center|LOCUS_23560 3904 3566 gene locus_tag LOCUS_23570 gene cutA 3904 3566 CDS product divalent cation tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035769.1 protein_id gnl|my_center|LOCUS_23570 5763 3973 gene locus_tag LOCUS_23580 5763 3973 CDS product ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635913.2 protein_id gnl|my_center|LOCUS_23580 6120 6407 gene locus_tag LOCUS_23590 gene groS 6120 6407 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A0R6 protein_id gnl|my_center|LOCUS_23590 6489 8138 gene locus_tag LOCUS_23600 gene groL 6489 8138 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD23 protein_id gnl|my_center|LOCUS_23600 8565 8299 gene locus_tag LOCUS_23610 8565 8299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 8721 9221 gene locus_tag LOCUS_23620 gene yetL 8721 9221 CDS product putative HTH-type transcriptional regulator YetL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31541 protein_id gnl|my_center|LOCUS_23620 9218 9955 gene locus_tag LOCUS_23630 9218 9955 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389300.1 protein_id gnl|my_center|LOCUS_23630 10069 10326 gene locus_tag LOCUS_23640 10069 10326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 10621 11694 gene locus_tag LOCUS_23650 gene aroG 10621 11694 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4W9 protein_id gnl|my_center|LOCUS_23650 12623 11973 gene locus_tag LOCUS_23660 12623 11973 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393544.1 protein_id gnl|my_center|LOCUS_23660 12574 13185 gene locus_tag LOCUS_23670 12574 13185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 13238 13723 gene locus_tag LOCUS_23680 13238 13723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918731.1 protein_id gnl|my_center|LOCUS_23680 15086 13806 gene locus_tag LOCUS_23690 gene ndh 15086 13806 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038851.1 protein_id gnl|my_center|LOCUS_23690 15210 15989 gene locus_tag LOCUS_23700 15210 15989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038849.1 protein_id gnl|my_center|LOCUS_23700 16130 16750 gene locus_tag LOCUS_23710 gene gst 16130 16750 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038848.1 protein_id gnl|my_center|LOCUS_23710 19044 16846 gene locus_tag LOCUS_23720 gene priA 19044 16846 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4E3 protein_id gnl|my_center|LOCUS_23720 19436 20440 gene locus_tag LOCUS_23730 19436 20440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038846.1 protein_id gnl|my_center|LOCUS_23730 20433 21008 gene locus_tag LOCUS_23740 20433 21008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038845.1 protein_id gnl|my_center|LOCUS_23740 21133 22497 gene locus_tag LOCUS_23750 gene norM 21133 22497 CDS product putative multidrug resistance protein NorM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4E6 protein_id gnl|my_center|LOCUS_23750 22614 24536 gene locus_tag LOCUS_23760 gene sppA 22614 24536 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4E7 protein_id gnl|my_center|LOCUS_23760 24824 24612 gene locus_tag LOCUS_23770 24824 24612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 24936 25712 gene locus_tag LOCUS_23780 gene trn2 24936 25712 CDS product tropinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038842.1 protein_id gnl|my_center|LOCUS_23780 26227 25805 gene locus_tag LOCUS_23790 26227 25805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 27246 26578 gene locus_tag LOCUS_23800 27246 26578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038839.1 protein_id gnl|my_center|LOCUS_23800 27907 27317 gene locus_tag LOCUS_23810 gene tsaC 27907 27317 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4F2 protein_id gnl|my_center|LOCUS_23810 30508 28031 gene locus_tag LOCUS_23820 gene topA 30508 28031 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4F3 protein_id gnl|my_center|LOCUS_23820 31634 30702 gene locus_tag LOCUS_23830 31634 30702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 32436 31684 gene locus_tag LOCUS_23840 32436 31684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 32949 32476 gene locus_tag LOCUS_23850 gene smg 32949 32476 CDS product protein Smg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4F6 protein_id gnl|my_center|LOCUS_23850 34120 32993 gene locus_tag LOCUS_23860 gene smf 34120 32993 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038833.1 protein_id gnl|my_center|LOCUS_23860 35348 34251 gene locus_tag LOCUS_23870 35348 34251 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038832.1 protein_id gnl|my_center|LOCUS_23870 35454 36023 gene locus_tag LOCUS_23880 gene def2 35454 36023 CDS product peptide deformylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4F9 protein_id gnl|my_center|LOCUS_23880 36144 37067 gene locus_tag LOCUS_23890 gene fmt 36144 37067 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4G0 protein_id gnl|my_center|LOCUS_23890 37071 38402 gene locus_tag LOCUS_23900 gene rsmB 37071 38402 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4G1 protein_id gnl|my_center|LOCUS_23900 38426 40135 gene locus_tag LOCUS_23910 38426 40135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639091.2 protein_id gnl|my_center|LOCUS_23910 40294 41550 gene locus_tag LOCUS_23920 40294 41550 CDS product polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038827.1 protein_id gnl|my_center|LOCUS_23920 42384 41578 gene locus_tag LOCUS_23930 42384 41578 CDS product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038826.1 protein_id gnl|my_center|LOCUS_23930 42362 43441 gene locus_tag LOCUS_23940 42362 43441 CDS product CDP-glycerol glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038825.1 protein_id gnl|my_center|LOCUS_23940 45056 43518 gene locus_tag LOCUS_23950 45056 43518 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038824.1 protein_id gnl|my_center|LOCUS_23950 45553 45053 gene locus_tag LOCUS_23960 45553 45053 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038823.1 protein_id gnl|my_center|LOCUS_23960 46762 45629 gene locus_tag LOCUS_23970 gene ribA 46762 45629 CDS product GTP cyclohydrolase-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4G8 protein_id gnl|my_center|LOCUS_23970 47803 46865 gene locus_tag LOCUS_23980 gene htrB 47803 46865 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038820.1 protein_id gnl|my_center|LOCUS_23980 47848 48288 gene locus_tag LOCUS_23990 gene dtd 47848 48288 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4H1 protein_id gnl|my_center|LOCUS_23990 48379 50232 gene locus_tag LOCUS_24000 gene rpoD 48379 50232 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4H2 protein_id gnl|my_center|LOCUS_24000 50499 50810 gene locus_tag LOCUS_24010 50499 50810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 50851 50926 gene locus_tag LOCUS_t00240 50851 50926 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 51258 51004 gene locus_tag LOCUS_24020 51258 51004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 51655 51245 gene locus_tag LOCUS_24030 51655 51245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 52224 51652 gene locus_tag LOCUS_24040 52224 51652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 52469 52221 gene locus_tag LOCUS_24050 52469 52221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 52691 53518 gene locus_tag LOCUS_24060 52691 53518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 55503 53536 gene locus_tag LOCUS_24070 55503 53536 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268015.1 protein_id gnl|my_center|LOCUS_24070 55607 55828 gene locus_tag LOCUS_24080 55607 55828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 56025 55855 gene locus_tag LOCUS_24090 56025 55855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 56671 56018 gene locus_tag LOCUS_24100 56671 56018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 57168 56668 gene locus_tag LOCUS_24110 57168 56668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 57425 57180 gene locus_tag LOCUS_24120 57425 57180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 57630 57406 gene locus_tag LOCUS_24130 57630 57406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 57891 57646 gene locus_tag LOCUS_24140 57891 57646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 58085 57891 gene locus_tag LOCUS_24150 58085 57891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 58378 58082 gene locus_tag LOCUS_24160 58378 58082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 58599 58375 gene locus_tag LOCUS_24170 58599 58375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 58880 58596 gene locus_tag LOCUS_24180 58880 58596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 59395 58877 gene locus_tag LOCUS_24190 59395 58877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 59800 60021 gene locus_tag LOCUS_24200 59800 60021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 60741 60040 gene locus_tag LOCUS_24210 60741 60040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705721.1 protein_id gnl|my_center|LOCUS_24210 60820 61083 gene locus_tag LOCUS_24220 60820 61083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 61481 61179 gene locus_tag LOCUS_24230 61481 61179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 61608 62210 gene locus_tag LOCUS_24240 61608 62210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 62207 62545 gene locus_tag LOCUS_24250 62207 62545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 62542 62895 gene locus_tag LOCUS_24260 62542 62895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 62892 63872 gene locus_tag LOCUS_24270 62892 63872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 63889 64449 gene locus_tag LOCUS_24280 63889 64449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 64436 64966 gene locus_tag LOCUS_24290 64436 64966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 64966 65478 gene locus_tag LOCUS_24300 64966 65478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 65475 66266 gene locus_tag LOCUS_24310 65475 66266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 66266 66694 gene locus_tag LOCUS_24320 66266 66694 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028460.1 protein_id gnl|my_center|LOCUS_24320 66751 67125 gene locus_tag LOCUS_24330 66751 67125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 67125 68873 gene locus_tag LOCUS_24340 67125 68873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 68870 69022 gene locus_tag LOCUS_24350 68870 69022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 69022 69786 gene locus_tag LOCUS_24360 69022 69786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 70182 69841 gene locus_tag LOCUS_24370 70182 69841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 70402 70476 gene locus_tag LOCUS_t00250 70402 70476 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 70755 71267 gene locus_tag LOCUS_24380 gene r 70755 71267 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NA40 protein_id gnl|my_center|LOCUS_24380 71264 71719 gene locus_tag LOCUS_24390 71264 71719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 71716 72198 gene locus_tag LOCUS_24400 71716 72198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 72200 72487 gene locus_tag LOCUS_24410 72200 72487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 72744 73184 gene locus_tag LOCUS_24420 72744 73184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001389340.1 protein_id gnl|my_center|LOCUS_24420 73252 75246 gene locus_tag LOCUS_24430 73252 75246 CDS product DNA packaging protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640155.1 protein_id gnl|my_center|LOCUS_24430 75248 75463 gene locus_tag LOCUS_24440 75248 75463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377401.1 protein_id gnl|my_center|LOCUS_24440 75456 76937 gene locus_tag LOCUS_24450 75456 76937 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104536.1 protein_id gnl|my_center|LOCUS_24450 76927 78288 gene locus_tag LOCUS_24460 76927 78288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 78291 78980 gene locus_tag LOCUS_24470 78291 78980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 79067 80068 gene locus_tag LOCUS_24480 79067 80068 CDS product minor capsid protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104533.1 protein_id gnl|my_center|LOCUS_24480 80114 80872 gene locus_tag LOCUS_24490 80114 80872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384017.1 protein_id gnl|my_center|LOCUS_24490 80869 81201 gene locus_tag LOCUS_24500 80869 81201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 81194 81649 gene locus_tag LOCUS_24510 81194 81649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 81686 82441 gene locus_tag LOCUS_24520 81686 82441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 82438 82863 gene locus_tag LOCUS_24530 82438 82863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 82890 83087 gene locus_tag LOCUS_24540 82890 83087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 83080 85869 gene locus_tag LOCUS_24550 gene H 83080 85869 CDS product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072857.1 protein_id gnl|my_center|LOCUS_24550 85869 86225 gene locus_tag LOCUS_24560 85869 86225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 86222 86683 gene locus_tag LOCUS_24570 86222 86683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 86683 87078 gene locus_tag LOCUS_24580 86683 87078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 >Feature sequence18 665 66 gene locus_tag LOCUS_24590 gene nfuA 665 66 CDS product Fe/S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8Z9 protein_id gnl|my_center|LOCUS_24590 756 1106 gene locus_tag LOCUS_24600 gene phhB 756 1106 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8Z8 protein_id gnl|my_center|LOCUS_24600 1103 1519 gene locus_tag LOCUS_24610 1103 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037237.1 protein_id gnl|my_center|LOCUS_24610 1618 2427 gene locus_tag LOCUS_24620 gene zupT 1618 2427 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8Z6 protein_id gnl|my_center|LOCUS_24620 3515 2541 gene locus_tag LOCUS_24630 gene rluC 3515 2541 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8Z5 protein_id gnl|my_center|LOCUS_24630 3924 7193 gene locus_tag LOCUS_24640 3924 7193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 8359 7472 gene locus_tag LOCUS_24650 8359 7472 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037347.1 protein_id gnl|my_center|LOCUS_24650 11529 8362 gene locus_tag LOCUS_24660 11529 8362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037348.1 protein_id gnl|my_center|LOCUS_24660 12362 11526 gene locus_tag LOCUS_24670 gene lacG 12362 11526 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037349.1 protein_id gnl|my_center|LOCUS_24670 13240 12359 gene locus_tag LOCUS_24680 gene lacF 13240 12359 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037350.1 protein_id gnl|my_center|LOCUS_24680 14577 13237 gene locus_tag LOCUS_24690 gene malE 14577 13237 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037351.1 protein_id gnl|my_center|LOCUS_24690 16186 14582 gene locus_tag LOCUS_24700 16186 14582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637563.2 protein_id gnl|my_center|LOCUS_24700 19493 16437 gene locus_tag LOCUS_24710 19493 16437 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039201.1 protein_id gnl|my_center|LOCUS_24710 20607 19570 gene locus_tag LOCUS_24720 20607 19570 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037354.1 protein_id gnl|my_center|LOCUS_24720 21032 20757 gene locus_tag LOCUS_24730 21032 20757 CDS product cell division protein BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037355.1 protein_id gnl|my_center|LOCUS_24730 21328 21029 gene locus_tag LOCUS_24740 21328 21029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037356.1 protein_id gnl|my_center|LOCUS_24740 21701 21507 gene locus_tag LOCUS_24750 21701 21507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 21771 22610 gene locus_tag LOCUS_24760 21771 22610 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8M8 protein_id gnl|my_center|LOCUS_24760 22624 23499 gene locus_tag LOCUS_24770 22624 23499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24770 23492 25132 gene locus_tag LOCUS_24780 gene rluB 23492 25132 CDS product ribosomal large subunit pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8M6 protein_id gnl|my_center|LOCUS_24780 25333 25593 gene locus_tag LOCUS_24790 25333 25593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 26124 25687 gene locus_tag LOCUS_24800 26124 25687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037360.1 protein_id gnl|my_center|LOCUS_24800 26959 26153 gene locus_tag LOCUS_24810 26959 26153 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037362.1 protein_id gnl|my_center|LOCUS_24810 28122 26974 gene locus_tag LOCUS_24820 gene ybdL 28122 26974 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037363.1 protein_id gnl|my_center|LOCUS_24820 28308 28937 gene locus_tag LOCUS_24830 gene ccmA 28308 28937 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8M1 protein_id gnl|my_center|LOCUS_24830 28934 29629 gene locus_tag LOCUS_24840 gene cycW 28934 29629 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8M0 protein_id gnl|my_center|LOCUS_24840 29673 30443 gene locus_tag LOCUS_24850 gene cycZ 29673 30443 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037366.1 protein_id gnl|my_center|LOCUS_24850 30440 30628 gene locus_tag LOCUS_24860 30440 30628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 30625 31086 gene locus_tag LOCUS_24870 gene ccmE2 30625 31086 CDS product cytochrome c-type biogenesis protein CcmE 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8L7 protein_id gnl|my_center|LOCUS_24870 31087 33006 gene locus_tag LOCUS_24880 gene cycK 31087 33006 CDS product c-type cytochrome biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037369.1 protein_id gnl|my_center|LOCUS_24880 33015 33632 gene locus_tag LOCUS_24890 gene dsbE 33015 33632 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037370.1 protein_id gnl|my_center|LOCUS_24890 33637 34086 gene locus_tag LOCUS_24900 gene cycL 33637 34086 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037371.1 protein_id gnl|my_center|LOCUS_24900 34080 35069 gene locus_tag LOCUS_24910 gene cycH 34080 35069 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037372.1 protein_id gnl|my_center|LOCUS_24910 35221 36333 gene locus_tag LOCUS_24920 gene metX 35221 36333 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8L2 protein_id gnl|my_center|LOCUS_24920 36334 36678 gene locus_tag LOCUS_24930 36334 36678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 38423 36750 gene locus_tag LOCUS_24940 gene cydC 38423 36750 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037375.1 protein_id gnl|my_center|LOCUS_24940 40165 38420 gene locus_tag LOCUS_24950 gene strW 40165 38420 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037376.1 protein_id gnl|my_center|LOCUS_24950 40394 41983 gene locus_tag LOCUS_24960 gene cydA 40394 41983 CDS product cytochrome d ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037377.1 protein_id gnl|my_center|LOCUS_24960 41999 43150 gene locus_tag LOCUS_24970 gene cydB 41999 43150 CDS product cytochrome D ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037378.1 protein_id gnl|my_center|LOCUS_24970 43377 43453 gene locus_tag LOCUS_t00260 43377 43453 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 43594 43670 gene locus_tag LOCUS_t00270 43594 43670 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 44313 43702 gene locus_tag LOCUS_24980 44313 43702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 44611 44535 gene locus_tag LOCUS_t00280 44611 44535 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 44828 44752 gene locus_tag LOCUS_t00290 44828 44752 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 46206 45055 gene locus_tag LOCUS_24990 gene cydB 46206 45055 CDS product cytochrome D ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037378.1 protein_id gnl|my_center|LOCUS_24990 47811 46222 gene locus_tag LOCUS_25000 gene cydA 47811 46222 CDS product cytochrome d ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037377.1 protein_id gnl|my_center|LOCUS_25000 48040 49785 gene locus_tag LOCUS_25010 gene strW 48040 49785 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037376.1 protein_id gnl|my_center|LOCUS_25010 49782 51455 gene locus_tag LOCUS_25020 gene cydC 49782 51455 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037375.1 protein_id gnl|my_center|LOCUS_25020 51871 51527 gene locus_tag LOCUS_25030 51871 51527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 52984 51872 gene locus_tag LOCUS_25040 gene metX 52984 51872 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8L2 protein_id gnl|my_center|LOCUS_25040 54125 53136 gene locus_tag LOCUS_25050 gene cycH 54125 53136 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037372.1 protein_id gnl|my_center|LOCUS_25050 54568 54119 gene locus_tag LOCUS_25060 gene cycL 54568 54119 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037371.1 protein_id gnl|my_center|LOCUS_25060 55190 54573 gene locus_tag LOCUS_25070 gene dsbE 55190 54573 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037370.1 protein_id gnl|my_center|LOCUS_25070 57118 55199 gene locus_tag LOCUS_25080 gene cycK 57118 55199 CDS product c-type cytochrome biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037369.1 protein_id gnl|my_center|LOCUS_25080 57580 57119 gene locus_tag LOCUS_25090 gene ccmE2 57580 57119 CDS product cytochrome c-type biogenesis protein CcmE 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8L7 protein_id gnl|my_center|LOCUS_25090 57765 57577 gene locus_tag LOCUS_25100 57765 57577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 58532 57762 gene locus_tag LOCUS_25110 gene cycZ 58532 57762 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037366.1 protein_id gnl|my_center|LOCUS_25110 59271 58576 gene locus_tag LOCUS_25120 gene cycW 59271 58576 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8M0 protein_id gnl|my_center|LOCUS_25120 59897 59268 gene locus_tag LOCUS_25130 gene ccmA 59897 59268 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8M1 protein_id gnl|my_center|LOCUS_25130 60083 61231 gene locus_tag LOCUS_25140 gene ybdL 60083 61231 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037363.1 protein_id gnl|my_center|LOCUS_25140 61246 62052 gene locus_tag LOCUS_25150 61246 62052 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037362.1 protein_id gnl|my_center|LOCUS_25150 62081 62518 gene locus_tag LOCUS_25160 62081 62518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037360.1 protein_id gnl|my_center|LOCUS_25160 62872 62612 gene locus_tag LOCUS_25170 62872 62612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 64713 63073 gene locus_tag LOCUS_25180 gene rluB 64713 63073 CDS product ribosomal large subunit pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8M6 protein_id gnl|my_center|LOCUS_25180 65581 64706 gene locus_tag LOCUS_25190 65581 64706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25190 66434 65595 gene locus_tag LOCUS_25200 66434 65595 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8M8 protein_id gnl|my_center|LOCUS_25200 66504 66698 gene locus_tag LOCUS_25210 66504 66698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 66877 67176 gene locus_tag LOCUS_25220 66877 67176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037356.1 protein_id gnl|my_center|LOCUS_25220 67173 67448 gene locus_tag LOCUS_25230 67173 67448 CDS product cell division protein BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037355.1 protein_id gnl|my_center|LOCUS_25230 67598 68635 gene locus_tag LOCUS_25240 67598 68635 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037354.1 protein_id gnl|my_center|LOCUS_25240 68712 71768 gene locus_tag LOCUS_25250 68712 71768 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039201.1 protein_id gnl|my_center|LOCUS_25250 72019 73623 gene locus_tag LOCUS_25260 72019 73623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637563.2 protein_id gnl|my_center|LOCUS_25260 73628 74968 gene locus_tag LOCUS_25270 gene malE 73628 74968 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037351.1 protein_id gnl|my_center|LOCUS_25270 74965 75846 gene locus_tag LOCUS_25280 gene lacF 74965 75846 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037350.1 protein_id gnl|my_center|LOCUS_25280 75843 76679 gene locus_tag LOCUS_25290 gene lacG 75843 76679 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037349.1 protein_id gnl|my_center|LOCUS_25290 76676 79843 gene locus_tag LOCUS_25300 76676 79843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037348.1 protein_id gnl|my_center|LOCUS_25300 79846 80733 gene locus_tag LOCUS_25310 79846 80733 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037347.1 protein_id gnl|my_center|LOCUS_25310 84281 81012 gene locus_tag LOCUS_25320 84281 81012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 84690 85664 gene locus_tag LOCUS_25330 gene rluC 84690 85664 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8Z5 protein_id gnl|my_center|LOCUS_25330 86587 85778 gene locus_tag LOCUS_25340 gene zupT 86587 85778 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8Z6 protein_id gnl|my_center|LOCUS_25340 87102 86686 gene locus_tag LOCUS_25350 87102 86686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037237.1 protein_id gnl|my_center|LOCUS_25350 87449 87099 gene locus_tag LOCUS_25360 gene phhB 87449 87099 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8Z8 protein_id gnl|my_center|LOCUS_25360 87540 88139 gene locus_tag LOCUS_25370 gene nfuA 87540 88139 CDS product Fe/S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8Z9 protein_id gnl|my_center|LOCUS_25370 >Feature sequence19 <1 2964 gene locus_tag LOCUS_25380 <1 2964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206610.1:TonB-dependent receptor 3021 4385 gene locus_tag LOCUS_25390 gene nagA 3021 4385 CDS product alpha-N-acetylgalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECL7 protein_id gnl|my_center|LOCUS_25390 4614 4913 gene locus_tag LOCUS_25400 4614 4913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 6816 4957 gene locus_tag LOCUS_25410 6816 4957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 8149 6917 gene locus_tag LOCUS_25420 8149 6917 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039142.1 protein_id gnl|my_center|LOCUS_25420 8192 8116 gene locus_tag LOCUS_t00300 8192 8116 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8342 9235 gene locus_tag LOCUS_25430 gene ubiA 8342 9235 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDE8 protein_id gnl|my_center|LOCUS_25430 9608 11032 gene locus_tag LOCUS_25440 9608 11032 CDS product short-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407630.1 protein_id gnl|my_center|LOCUS_25440 11305 11466 gene locus_tag LOCUS_25450 11305 11466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 12147 11521 gene locus_tag LOCUS_25460 12147 11521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038642.1 protein_id gnl|my_center|LOCUS_25460 12229 12735 gene locus_tag LOCUS_25470 12229 12735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035704.1 protein_id gnl|my_center|LOCUS_25470 12825 14645 gene locus_tag LOCUS_25480 12825 14645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 14642 16051 gene locus_tag LOCUS_25490 14642 16051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 16724 16053 gene locus_tag LOCUS_25500 16724 16053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035555.1 protein_id gnl|my_center|LOCUS_25500 17895 16783 gene locus_tag LOCUS_25510 17895 16783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 18736 17909 gene locus_tag LOCUS_25520 18736 17909 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089438.1 protein_id gnl|my_center|LOCUS_25520 18923 19336 gene locus_tag LOCUS_25530 18923 19336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 19568 21925 gene locus_tag LOCUS_25540 19568 21925 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246690.1 protein_id gnl|my_center|LOCUS_25540 21925 23226 gene locus_tag LOCUS_25550 21925 23226 CDS product isopenicillin-N epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084098.1 protein_id gnl|my_center|LOCUS_25550 24913 23399 gene locus_tag LOCUS_25560 24913 23399 CDS product putative HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q01856 protein_id gnl|my_center|LOCUS_25560 25525 24923 gene locus_tag LOCUS_25570 25525 24923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004352065.1 protein_id gnl|my_center|LOCUS_25570 25785 25525 gene locus_tag LOCUS_25580 25785 25525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 27274 25859 gene locus_tag LOCUS_25590 27274 25859 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708519.1 protein_id gnl|my_center|LOCUS_25590 27458 28363 gene locus_tag LOCUS_25600 gene cyoA 27458 28363 CDS product ubiquinol oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CK33 protein_id gnl|my_center|LOCUS_25600 28369 30345 gene locus_tag LOCUS_25610 gene cyoB 28369 30345 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926118.1 protein_id gnl|my_center|LOCUS_25610 30342 30977 gene locus_tag LOCUS_25620 30342 30977 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179831.1 protein_id gnl|my_center|LOCUS_25620 30979 31311 gene locus_tag LOCUS_25630 gene cyoD 30979 31311 CDS product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208652.1 protein_id gnl|my_center|LOCUS_25630 31323 32003 gene locus_tag LOCUS_25640 31323 32003 CDS product SCO1/SenC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064817.1 protein_id gnl|my_center|LOCUS_25640 32688 32092 gene locus_tag LOCUS_25650 32688 32092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 34454 32688 gene locus_tag LOCUS_25660 34454 32688 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037804.1 protein_id gnl|my_center|LOCUS_25660 34799 35239 gene locus_tag LOCUS_25670 34799 35239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704919.1 protein_id gnl|my_center|LOCUS_25670 35232 36542 gene locus_tag LOCUS_25680 35232 36542 CDS product L-sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113059.1 protein_id gnl|my_center|LOCUS_25680 37404 36682 gene locus_tag LOCUS_25690 gene exoD 37404 36682 CDS product protein ExoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q52923 protein_id gnl|my_center|LOCUS_25690 37466 38329 gene locus_tag LOCUS_25700 37466 38329 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094783.1 protein_id gnl|my_center|LOCUS_25700 38892 41210 gene locus_tag LOCUS_25710 38892 41210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 42965 41466 gene locus_tag LOCUS_25720 gene comM 42965 41466 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038949.1 protein_id gnl|my_center|LOCUS_25720 43334 44740 gene locus_tag LOCUS_25730 43334 44740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 45298 44795 gene locus_tag LOCUS_25740 45298 44795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 45701 45345 gene locus_tag LOCUS_25750 45701 45345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 46271 46744 gene locus_tag LOCUS_25760 46271 46744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 46775 47149 gene locus_tag LOCUS_25770 46775 47149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 47246 47623 gene locus_tag LOCUS_25780 47246 47623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 48156 47716 gene locus_tag LOCUS_25790 48156 47716 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028626.1 protein_id gnl|my_center|LOCUS_25790 48527 48276 gene locus_tag LOCUS_25800 48527 48276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038948.1 protein_id gnl|my_center|LOCUS_25800 48682 49020 gene locus_tag LOCUS_25810 gene glnB 48682 49020 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038947.1 protein_id gnl|my_center|LOCUS_25810 49899 49240 gene locus_tag LOCUS_25820 49899 49240 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038946.1 protein_id gnl|my_center|LOCUS_25820 50332 51240 gene locus_tag LOCUS_25830 gene aspH 50332 51240 CDS product aspartyl/asparaginyl beta-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035636.1 protein_id gnl|my_center|LOCUS_25830 52181 51327 gene locus_tag LOCUS_25840 gene speE 52181 51327 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P447 protein_id gnl|my_center|LOCUS_25840 52372 54261 gene locus_tag LOCUS_25850 gene speA 52372 54261 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P448 protein_id gnl|my_center|LOCUS_25850 54305 54625 gene locus_tag LOCUS_25860 54305 54625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 56013 54685 gene locus_tag LOCUS_25870 56013 54685 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920606.1 protein_id gnl|my_center|LOCUS_25870 56669 56010 gene locus_tag LOCUS_25880 56669 56010 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311298.1 protein_id gnl|my_center|LOCUS_25880 56959 56669 gene locus_tag LOCUS_25890 56959 56669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 57109 57543 gene locus_tag LOCUS_25900 57109 57543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 58150 57671 gene locus_tag LOCUS_25910 58150 57671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 59564 58353 gene locus_tag LOCUS_25920 59564 58353 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037302.1 protein_id gnl|my_center|LOCUS_25920 60071 59577 gene locus_tag LOCUS_25930 gene blc 60071 59577 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038950.1 protein_id gnl|my_center|LOCUS_25930 60253 60501 gene locus_tag LOCUS_25940 60253 60501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 60598 63018 gene locus_tag LOCUS_25950 60598 63018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035655.1 protein_id gnl|my_center|LOCUS_25950 65666 63561 gene locus_tag LOCUS_25960 gene opgB 65666 63561 CDS product phosphoglycerol transferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDD7 protein_id gnl|my_center|LOCUS_25960 67602 65911 gene locus_tag LOCUS_25970 67602 65911 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035657.1 protein_id gnl|my_center|LOCUS_25970 67765 68691 gene locus_tag LOCUS_25980 67765 68691 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035658.1 protein_id gnl|my_center|LOCUS_25980 70335 68797 gene locus_tag LOCUS_25990 70335 68797 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035660.1 protein_id gnl|my_center|LOCUS_25990 70429 71076 gene locus_tag LOCUS_26000 70429 71076 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035668.1 protein_id gnl|my_center|LOCUS_26000 71076 71783 gene locus_tag LOCUS_26010 71076 71783 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710023.1 protein_id gnl|my_center|LOCUS_26010 72033 72419 gene locus_tag LOCUS_26020 72033 72419 CDS product drug:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529579.1 protein_id gnl|my_center|LOCUS_26020 73930 72542 gene locus_tag LOCUS_26030 gene pdhB 73930 72542 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDB3 protein_id gnl|my_center|LOCUS_26030 74280 73927 gene locus_tag LOCUS_26040 74280 73927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035681.1 protein_id gnl|my_center|LOCUS_26040 75349 74282 gene locus_tag LOCUS_26050 gene pdhB 75349 74282 CDS product 2-oxoisovalerate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035682.1 protein_id gnl|my_center|LOCUS_26050 76424 75342 gene locus_tag LOCUS_26060 gene pdhA 76424 75342 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035683.1 protein_id gnl|my_center|LOCUS_26060 76760 77635 gene locus_tag LOCUS_26070 gene kynA 76760 77635 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDA8 protein_id gnl|my_center|LOCUS_26070 77816 79315 gene locus_tag LOCUS_26080 gene yhiP 77816 79315 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035686.1 protein_id gnl|my_center|LOCUS_26080 79336 79935 gene locus_tag LOCUS_26090 79336 79935 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035687.1 protein_id gnl|my_center|LOCUS_26090 80103 81242 gene locus_tag LOCUS_26100 80103 81242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 81813 81322 gene locus_tag LOCUS_26110 81813 81322 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035688.1 protein_id gnl|my_center|LOCUS_26110 81943 83055 gene locus_tag LOCUS_26120 81943 83055 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035689.1 protein_id gnl|my_center|LOCUS_26120 83141 84448 gene locus_tag LOCUS_26130 gene hmgA 83141 84448 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDA2 protein_id gnl|my_center|LOCUS_26130 >Feature sequence20 1427 483 gene locus_tag LOCUS_26140 1427 483 CDS product sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113764.1 protein_id gnl|my_center|LOCUS_26140 1942 1424 gene locus_tag LOCUS_26150 1942 1424 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406891.1 protein_id gnl|my_center|LOCUS_26150 2092 2472 gene locus_tag LOCUS_26160 2092 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889155.1 protein_id gnl|my_center|LOCUS_26160 2617 4596 gene locus_tag LOCUS_26170 gene betT 2617 4596 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038500.1 protein_id gnl|my_center|LOCUS_26170 6337 4697 gene locus_tag LOCUS_26180 6337 4697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 7319 6357 gene locus_tag LOCUS_26190 7319 6357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 8420 7443 gene locus_tag LOCUS_26200 gene mecR 8420 7443 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383116.1 protein_id gnl|my_center|LOCUS_26200 8853 11216 gene locus_tag LOCUS_26210 gene nrdA 8853 11216 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3T3 protein_id gnl|my_center|LOCUS_26210 11316 12356 gene locus_tag LOCUS_26220 gene nrdB 11316 12356 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3T4 protein_id gnl|my_center|LOCUS_26220 12463 12849 gene locus_tag LOCUS_26230 12463 12849 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039055.1 protein_id gnl|my_center|LOCUS_26230 12821 13147 gene locus_tag LOCUS_26240 gene trxA 12821 13147 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039054.1 protein_id gnl|my_center|LOCUS_26240 14590 13259 gene locus_tag LOCUS_26250 gene mntH 14590 13259 CDS product divalent metal cation transporter MntH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8R8 protein_id gnl|my_center|LOCUS_26250 14708 15178 gene locus_tag LOCUS_26260 14708 15178 CDS product transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037316.1 protein_id gnl|my_center|LOCUS_26260 15766 15245 gene locus_tag LOCUS_26270 15766 15245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 17942 15783 gene locus_tag LOCUS_26280 17942 15783 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765027.1 protein_id gnl|my_center|LOCUS_26280 18816 18160 gene locus_tag LOCUS_26290 18816 18160 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038955.1 protein_id gnl|my_center|LOCUS_26290 18954 19979 gene locus_tag LOCUS_26300 18954 19979 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038954.1 protein_id gnl|my_center|LOCUS_26300 19991 21139 gene locus_tag LOCUS_26310 19991 21139 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038953.1 protein_id gnl|my_center|LOCUS_26310 21480 21145 gene locus_tag LOCUS_26320 21480 21145 CDS product TPR repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7B1 protein_id gnl|my_center|LOCUS_26320 22055 21480 gene locus_tag LOCUS_26330 22055 21480 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814305.1 protein_id gnl|my_center|LOCUS_26330 22681 22052 gene locus_tag LOCUS_26340 gene sodA 22681 22052 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53652 protein_id gnl|my_center|LOCUS_26340 24699 23188 gene locus_tag LOCUS_26350 24699 23188 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038903.1 protein_id gnl|my_center|LOCUS_26350 25287 24838 gene locus_tag LOCUS_26360 25287 24838 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704476.1 protein_id gnl|my_center|LOCUS_26360 25354 26289 gene locus_tag LOCUS_26370 25354 26289 CDS product coenzyme F420-dependent N5,N10-methylene tetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_601421.1 protein_id gnl|my_center|LOCUS_26370 26404 26748 gene locus_tag LOCUS_26380 26404 26748 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038641.1 protein_id gnl|my_center|LOCUS_26380 26902 28098 gene locus_tag LOCUS_26390 26902 28098 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147483.1 protein_id gnl|my_center|LOCUS_26390 28095 29288 gene locus_tag LOCUS_26400 gene entC 28095 29288 CDS product isochorismate synthase EntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001954.1 protein_id gnl|my_center|LOCUS_26400 29285 30937 gene locus_tag LOCUS_26410 gene dhbE 29285 30937 CDS product 2,3-dihydroxybenzoate-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40871 protein_id gnl|my_center|LOCUS_26410 30937 31569 gene locus_tag LOCUS_26420 30937 31569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26420 31569 31826 gene locus_tag LOCUS_26430 31569 31826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 31823 35713 gene locus_tag LOCUS_26440 gene entF 31823 35713 CDS product enterobactin synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077698.1 protein_id gnl|my_center|LOCUS_26440 35704 36462 gene locus_tag LOCUS_26450 gene dhbA 35704 36462 CDS product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39071 protein_id gnl|my_center|LOCUS_26450 36607 37053 gene locus_tag LOCUS_26460 36607 37053 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269184.1 protein_id gnl|my_center|LOCUS_26460 38587 37127 gene locus_tag LOCUS_26470 38587 37127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530985.1 protein_id gnl|my_center|LOCUS_26470 40927 38609 gene locus_tag LOCUS_26480 gene fecA 40927 38609 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639569.2 protein_id gnl|my_center|LOCUS_26480 41563 41195 gene locus_tag LOCUS_26490 41563 41195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26490 42191 41553 gene locus_tag LOCUS_26500 42191 41553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639058.2 protein_id gnl|my_center|LOCUS_26500 44452 42188 gene locus_tag LOCUS_26510 44452 42188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038794.1 protein_id gnl|my_center|LOCUS_26510 45116 44463 gene locus_tag LOCUS_26520 45116 44463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038793.1 protein_id gnl|my_center|LOCUS_26520 45261 46184 gene locus_tag LOCUS_26530 45261 46184 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037185.1 protein_id gnl|my_center|LOCUS_26530 46624 46232 gene locus_tag LOCUS_26540 gene dgkA 46624 46232 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY23 protein_id gnl|my_center|LOCUS_26540 47253 46780 gene locus_tag LOCUS_26550 47253 46780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 48248 47370 gene locus_tag LOCUS_26560 48248 47370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280038.1 protein_id gnl|my_center|LOCUS_26560 48520 48849 gene locus_tag LOCUS_26570 48520 48849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 49247 48843 gene locus_tag LOCUS_26580 49247 48843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 49442 50422 gene locus_tag LOCUS_26590 gene moaA 49442 50422 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIL8 protein_id gnl|my_center|LOCUS_26590 50431 51426 gene locus_tag LOCUS_26600 gene moaCB 50431 51426 CDS product molybdenum cofactor biosynthesis bifunctional protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59014 protein_id gnl|my_center|LOCUS_26600 51426 52676 gene locus_tag LOCUS_26610 gene moeA 51426 52676 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037163.1 protein_id gnl|my_center|LOCUS_26610 52679 52939 gene locus_tag LOCUS_26620 52679 52939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 52943 53431 gene locus_tag LOCUS_26630 gene moaE 52943 53431 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207008.1 protein_id gnl|my_center|LOCUS_26630 53516 54064 gene locus_tag LOCUS_26640 gene mobA 53516 54064 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037164.1 protein_id gnl|my_center|LOCUS_26640 54061 54426 gene locus_tag LOCUS_26650 54061 54426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26650 54572 55990 gene locus_tag LOCUS_26660 gene narK2 54572 55990 CDS product nitrite extrusion protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105301.1 protein_id gnl|my_center|LOCUS_26660 56062 59805 gene locus_tag LOCUS_26670 gene narG 56062 59805 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105302.1 protein_id gnl|my_center|LOCUS_26670 59805 61349 gene locus_tag LOCUS_26680 gene narH 59805 61349 CDS product respiratory nitrate reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205549.1 protein_id gnl|my_center|LOCUS_26680 61349 62029 gene locus_tag LOCUS_26690 61349 62029 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705098.1 protein_id gnl|my_center|LOCUS_26690 62026 62733 gene locus_tag LOCUS_26700 gene narI 62026 62733 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105305.1 protein_id gnl|my_center|LOCUS_26700 62737 63636 gene locus_tag LOCUS_26710 62737 63636 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXD5 protein_id gnl|my_center|LOCUS_26710 63660 64991 gene locus_tag LOCUS_26720 63660 64991 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525898.1 protein_id gnl|my_center|LOCUS_26720 65122 66345 gene locus_tag LOCUS_26730 65122 66345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 66357 67133 gene locus_tag LOCUS_26740 gene fnr 66357 67133 CDS product fumarate and nitrate reduction regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z787 protein_id gnl|my_center|LOCUS_26740 67153 67896 gene locus_tag LOCUS_26750 67153 67896 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205679.1 protein_id gnl|my_center|LOCUS_26750 67900 68583 gene locus_tag LOCUS_26760 gene modB 67900 68583 CDS product molybdenum ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190258.1 protein_id gnl|my_center|LOCUS_26760 68573 69241 gene locus_tag LOCUS_26770 gene modC 68573 69241 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190506.1 protein_id gnl|my_center|LOCUS_26770 70332 69532 gene locus_tag LOCUS_26780 70332 69532 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903995.1 protein_id gnl|my_center|LOCUS_26780 71105 70329 gene locus_tag LOCUS_26790 71105 70329 CDS product iron ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392936.1 protein_id gnl|my_center|LOCUS_26790 72115 71102 gene locus_tag LOCUS_26800 72115 71102 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223651.1 protein_id gnl|my_center|LOCUS_26800 73155 72118 gene locus_tag LOCUS_26810 73155 72118 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390967.1 protein_id gnl|my_center|LOCUS_26810 73694 73152 gene locus_tag LOCUS_26820 73694 73152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 75682 73697 gene locus_tag LOCUS_26830 75682 73697 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933422.1 protein_id gnl|my_center|LOCUS_26830 75866 76669 gene locus_tag LOCUS_26840 gene modE 75866 76669 CDS product ModE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204316.1 protein_id gnl|my_center|LOCUS_26840 78399 76870 gene locus_tag LOCUS_26850 gene cysJ 78399 76870 CDS product sulfite reductase [NADPH] flavoprotein alpha-component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32214 protein_id gnl|my_center|LOCUS_26850 78824 78396 gene locus_tag LOCUS_26860 78824 78396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 79321 79007 gene locus_tag LOCUS_26870 79321 79007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522986.1 protein_id gnl|my_center|LOCUS_26870 80052 79318 gene locus_tag LOCUS_26880 80052 79318 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550326.1 protein_id gnl|my_center|LOCUS_26880 80179 80643 gene locus_tag LOCUS_26890 80179 80643 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522988.1 protein_id gnl|my_center|LOCUS_26890 >Feature sequence21 1059 334 gene locus_tag LOCUS_26900 1059 334 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971202.1 protein_id gnl|my_center|LOCUS_26900 1178 2068 gene locus_tag LOCUS_26910 1178 2068 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968210.1 protein_id gnl|my_center|LOCUS_26910 3192 2161 gene locus_tag LOCUS_26920 3192 2161 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036627.1 protein_id gnl|my_center|LOCUS_26920 3340 3567 gene locus_tag LOCUS_26930 3340 3567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 3564 4334 gene locus_tag LOCUS_26940 gene dauE 3564 4334 CDS product aklaviketone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036628.1 protein_id gnl|my_center|LOCUS_26940 4426 5649 gene locus_tag LOCUS_26950 gene mexE 4426 5649 CDS product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036629.1 protein_id gnl|my_center|LOCUS_26950 5777 8947 gene locus_tag LOCUS_26960 gene mexF 5777 8947 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036630.1 protein_id gnl|my_center|LOCUS_26960 9012 9749 gene locus_tag LOCUS_26970 9012 9749 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036631.1 protein_id gnl|my_center|LOCUS_26970 9743 11164 gene locus_tag LOCUS_26980 gene oprN 9743 11164 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036632.1 protein_id gnl|my_center|LOCUS_26980 11414 11677 gene locus_tag LOCUS_26990 11414 11677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 12550 11696 gene locus_tag LOCUS_27000 12550 11696 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038545.1 protein_id gnl|my_center|LOCUS_27000 12933 12688 gene locus_tag LOCUS_27010 12933 12688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 13198 12959 gene locus_tag LOCUS_27020 13198 12959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 13563 13330 gene locus_tag LOCUS_27030 13563 13330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 14355 13651 gene locus_tag LOCUS_27040 14355 13651 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916254.1 protein_id gnl|my_center|LOCUS_27040 15233 14361 gene locus_tag LOCUS_27050 gene hchA 15233 14361 CDS product protein deglycase HchA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706906.1 protein_id gnl|my_center|LOCUS_27050 17327 15318 gene locus_tag LOCUS_27060 17327 15318 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035993.1 protein_id gnl|my_center|LOCUS_27060 17481 17942 gene locus_tag LOCUS_27070 17481 17942 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261733.1 protein_id gnl|my_center|LOCUS_27070 18867 18304 gene locus_tag LOCUS_27080 18867 18304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 19600 20181 gene locus_tag LOCUS_27090 19600 20181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 20964 20380 gene locus_tag LOCUS_27100 20964 20380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 20993 21316 gene locus_tag LOCUS_27110 20993 21316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 22490 22161 gene locus_tag LOCUS_27120 22490 22161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 22845 24566 gene locus_tag LOCUS_27130 22845 24566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 25827 25417 gene locus_tag LOCUS_27140 25827 25417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 26129 25890 gene locus_tag LOCUS_27150 26129 25890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 26330 26809 gene locus_tag LOCUS_27160 26330 26809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 26820 27119 gene locus_tag LOCUS_27170 26820 27119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 27155 27691 gene locus_tag LOCUS_27180 27155 27691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 28007 27777 gene locus_tag LOCUS_27190 28007 27777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 29793 27997 gene locus_tag LOCUS_27200 29793 27997 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105772.1 protein_id gnl|my_center|LOCUS_27200 31724 30267 gene locus_tag LOCUS_27210 31724 30267 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036792.1 protein_id gnl|my_center|LOCUS_27210 32379 31987 gene locus_tag LOCUS_tm00010 32379 31987 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 32599 33171 gene locus_tag LOCUS_27220 32599 33171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 33815 33312 gene locus_tag LOCUS_27230 gene smpB 33815 33312 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAL7 protein_id gnl|my_center|LOCUS_27230 33873 34298 gene locus_tag LOCUS_27240 33873 34298 CDS product ubiquinone-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036653.1 protein_id gnl|my_center|LOCUS_27240 34302 34559 gene locus_tag LOCUS_27250 34302 34559 CDS product UPF0125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAL5 protein_id gnl|my_center|LOCUS_27250 34988 34596 gene locus_tag LOCUS_27260 gene bamE 34988 34596 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAL4 protein_id gnl|my_center|LOCUS_27260 35092 35499 gene locus_tag LOCUS_27270 gene fur 35092 35499 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036656.1 protein_id gnl|my_center|LOCUS_27270 36802 35558 gene locus_tag LOCUS_27280 36802 35558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147894.1 protein_id gnl|my_center|LOCUS_27280 36900 37817 gene locus_tag LOCUS_27290 36900 37817 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115019.1 protein_id gnl|my_center|LOCUS_27290 39600 37924 gene locus_tag LOCUS_27300 gene recN 39600 37924 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAL2 protein_id gnl|my_center|LOCUS_27300 39715 40779 gene locus_tag LOCUS_27310 gene hrcA 39715 40779 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAL1 protein_id gnl|my_center|LOCUS_27310 40843 41358 gene locus_tag LOCUS_27320 gene grpE 40843 41358 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAL0 protein_id gnl|my_center|LOCUS_27320 41542 43467 gene locus_tag LOCUS_27330 gene dnaK 41542 43467 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAK9 protein_id gnl|my_center|LOCUS_27330 43621 44748 gene locus_tag LOCUS_27340 gene dnaJ 43621 44748 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAK8 protein_id gnl|my_center|LOCUS_27340 45606 44809 gene locus_tag LOCUS_27350 45606 44809 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819104.1 protein_id gnl|my_center|LOCUS_27350 45718 46878 gene locus_tag LOCUS_27360 45718 46878 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367899.1 protein_id gnl|my_center|LOCUS_27360 47493 48401 gene locus_tag LOCUS_27370 gene pdxY 47493 48401 CDS product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAK7 protein_id gnl|my_center|LOCUS_27370 48398 49522 gene locus_tag LOCUS_27380 gene tyrA 48398 49522 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036663.1 protein_id gnl|my_center|LOCUS_27380 49967 49773 gene locus_tag LOCUS_27390 49967 49773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 51816 50044 gene locus_tag LOCUS_27400 gene draA 51816 50044 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036668.1 protein_id gnl|my_center|LOCUS_27400 52405 51809 gene locus_tag LOCUS_27410 52405 51809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636855.2 protein_id gnl|my_center|LOCUS_27410 53450 52446 gene locus_tag LOCUS_27420 53450 52446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 54070 53447 gene locus_tag LOCUS_27430 54070 53447 CDS product Ecf-type RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810497.1 protein_id gnl|my_center|LOCUS_27430 54213 57056 gene locus_tag LOCUS_27440 54213 57056 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267676.1 protein_id gnl|my_center|LOCUS_27440 57669 57076 gene locus_tag LOCUS_27450 57669 57076 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAJ9 protein_id gnl|my_center|LOCUS_27450 59267 57771 gene locus_tag LOCUS_27460 59267 57771 CDS product L-lysine 6-aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037523.1 protein_id gnl|my_center|LOCUS_27460 59478 60545 gene locus_tag LOCUS_27470 gene queA 59478 60545 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P867 protein_id gnl|my_center|LOCUS_27470 60685 61815 gene locus_tag LOCUS_27480 gene tgt 60685 61815 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P868 protein_id gnl|my_center|LOCUS_27480 61950 62294 gene locus_tag LOCUS_27490 gene yajC 61950 62294 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037519.1 protein_id gnl|my_center|LOCUS_27490 62356 64212 gene locus_tag LOCUS_27500 gene secD 62356 64212 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P870 protein_id gnl|my_center|LOCUS_27500 64228 65208 gene locus_tag LOCUS_27510 gene secF 64228 65208 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P871 protein_id gnl|my_center|LOCUS_27510 65884 67143 gene locus_tag LOCUS_27520 gene fabV 65884 67143 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP8 protein_id gnl|my_center|LOCUS_27520 69338 67215 gene locus_tag LOCUS_27530 69338 67215 CDS product GGDEF-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037435.1 protein_id gnl|my_center|LOCUS_27530 70560 69376 gene locus_tag LOCUS_27540 70560 69376 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037434.1 protein_id gnl|my_center|LOCUS_27540 71105 70557 gene locus_tag LOCUS_27550 71105 70557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037433.1 protein_id gnl|my_center|LOCUS_27550 71230 72108 gene locus_tag LOCUS_27560 71230 72108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114880.1 protein_id gnl|my_center|LOCUS_27560 72603 72115 gene locus_tag LOCUS_27570 72603 72115 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8F4 protein_id gnl|my_center|LOCUS_27570 72905 73114 gene locus_tag LOCUS_27580 gene cspA 72905 73114 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037431.1 protein_id gnl|my_center|LOCUS_27580 73298 73987 gene locus_tag LOCUS_27590 gene gstA 73298 73987 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037430.1 protein_id gnl|my_center|LOCUS_27590 74020 75585 gene locus_tag LOCUS_27600 74020 75585 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8F8 protein_id gnl|my_center|LOCUS_27600 76180 76716 gene locus_tag LOCUS_27610 gene apt 76180 76716 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8F9 protein_id gnl|my_center|LOCUS_27610 78190 76814 gene locus_tag LOCUS_27620 gene dbpA 78190 76814 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037426.1 protein_id gnl|my_center|LOCUS_27620 <79313 78275 gene locus_tag LOCUS_27630 <79313 78275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HTI1:UPF0324 membrane protein >Feature sequence22 130 1005 gene locus_tag LOCUS_27640 130 1005 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317531.1 protein_id gnl|my_center|LOCUS_27640 1361 3313 gene locus_tag LOCUS_27650 gene uup 1361 3313 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037425.1 protein_id gnl|my_center|LOCUS_27650 3875 3414 gene locus_tag LOCUS_27660 gene cycM 3875 3414 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037296.1 protein_id gnl|my_center|LOCUS_27660 4352 3885 gene locus_tag LOCUS_27670 4352 3885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 4480 5631 gene locus_tag LOCUS_27680 gene czcB 4480 5631 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037294.1 protein_id gnl|my_center|LOCUS_27680 5628 9149 gene locus_tag LOCUS_27690 gene acrD 5628 9149 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037293.1 protein_id gnl|my_center|LOCUS_27690 9146 12232 gene locus_tag LOCUS_27700 gene acrD 9146 12232 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037292.1 protein_id gnl|my_center|LOCUS_27700 13587 12367 gene locus_tag LOCUS_27710 gene traB 13587 12367 CDS product pheromone shutdown protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037346.1 protein_id gnl|my_center|LOCUS_27710 14122 13592 gene locus_tag LOCUS_27720 gene pat 14122 13592 CDS product phosphinothricin N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037345.1 protein_id gnl|my_center|LOCUS_27720 15024 14137 gene locus_tag LOCUS_27730 15024 14137 CDS product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037344.1 protein_id gnl|my_center|LOCUS_27730 16223 15186 gene locus_tag LOCUS_27740 16223 15186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037343.1 protein_id gnl|my_center|LOCUS_27740 16592 16263 gene locus_tag LOCUS_27750 16592 16263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037342.1 protein_id gnl|my_center|LOCUS_27750 17062 17739 gene locus_tag LOCUS_27760 gene cmk 17062 17739 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8P4 protein_id gnl|my_center|LOCUS_27760 17938 19623 gene locus_tag LOCUS_27770 gene rpsA 17938 19623 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8P5 protein_id gnl|my_center|LOCUS_27770 19712 20017 gene locus_tag LOCUS_27780 gene ihfB 19712 20017 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8P6 protein_id gnl|my_center|LOCUS_27780 20095 20379 gene locus_tag LOCUS_27790 20095 20379 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037338.1 protein_id gnl|my_center|LOCUS_27790 20386 21564 gene locus_tag LOCUS_27800 gene lapB 20386 21564 CDS product lipopolysaccharide assembly protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8P8 protein_id gnl|my_center|LOCUS_27800 21568 22557 gene locus_tag LOCUS_27810 gene rfb303 21568 22557 CDS product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037336.1 protein_id gnl|my_center|LOCUS_27810 22561 24474 gene locus_tag LOCUS_27820 22561 24474 CDS product multidrug MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037335.1 protein_id gnl|my_center|LOCUS_27820 24558 25349 gene locus_tag LOCUS_27830 gene galU 24558 25349 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8Q1 protein_id gnl|my_center|LOCUS_27830 25538 25897 gene locus_tag LOCUS_27840 25538 25897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 27109 25901 gene locus_tag LOCUS_27850 gene fadA 27109 25901 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037142.1 protein_id gnl|my_center|LOCUS_27850 29551 27179 gene locus_tag LOCUS_27860 gene fadB 29551 27179 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037143.1 protein_id gnl|my_center|LOCUS_27860 30258 29605 gene locus_tag LOCUS_27870 gene psrA 30258 29605 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037144.1 protein_id gnl|my_center|LOCUS_27870 30584 31009 gene locus_tag LOCUS_27880 gene ndk 30584 31009 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65539 protein_id gnl|my_center|LOCUS_27880 31020 32225 gene locus_tag LOCUS_27890 gene rlmN 31020 32225 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P984 protein_id gnl|my_center|LOCUS_27890 32212 32997 gene locus_tag LOCUS_27900 gene pilF 32212 32997 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037146.1 protein_id gnl|my_center|LOCUS_27900 33016 33885 gene locus_tag LOCUS_27910 33016 33885 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037147.1 protein_id gnl|my_center|LOCUS_27910 33951 34589 gene locus_tag LOCUS_27920 33951 34589 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037148.1 protein_id gnl|my_center|LOCUS_27920 34589 35797 gene locus_tag LOCUS_27930 gene bamB 34589 35797 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P980 protein_id gnl|my_center|LOCUS_27930 35815 37212 gene locus_tag LOCUS_27940 gene der 35815 37212 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P979 protein_id gnl|my_center|LOCUS_27940 37354 38490 gene locus_tag LOCUS_27950 gene moeB 37354 38490 CDS product molybdopterin biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037152.1 protein_id gnl|my_center|LOCUS_27950 38961 40793 gene locus_tag LOCUS_27960 gene kefB 38961 40793 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037333.1 protein_id gnl|my_center|LOCUS_27960 41016 41894 gene locus_tag LOCUS_27970 gene folD 41016 41894 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8Q4 protein_id gnl|my_center|LOCUS_27970 42015 43472 gene locus_tag LOCUS_27980 gene guaB 42015 43472 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8Q5 protein_id gnl|my_center|LOCUS_27980 43577 45142 gene locus_tag LOCUS_27990 gene guaA 43577 45142 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8Q6 protein_id gnl|my_center|LOCUS_27990 45548 50821 gene locus_tag LOCUS_28000 45548 50821 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883981.1 protein_id gnl|my_center|LOCUS_28000 50828 53617 gene locus_tag LOCUS_28010 50828 53617 CDS product ATP-dependent helicase HepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883982.1 protein_id gnl|my_center|LOCUS_28010 53642 58096 gene locus_tag LOCUS_28020 53642 58096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256730.1 protein_id gnl|my_center|LOCUS_28020 58200 60029 gene locus_tag LOCUS_28030 58200 60029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 60079 60846 gene locus_tag LOCUS_28040 60079 60846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 60899 62269 gene locus_tag LOCUS_28050 60899 62269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 62276 62548 gene locus_tag LOCUS_28060 62276 62548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 63184 62828 gene locus_tag LOCUS_28070 63184 62828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 64662 63739 gene locus_tag LOCUS_28080 64662 63739 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095765.1 protein_id gnl|my_center|LOCUS_28080 64759 65598 gene locus_tag LOCUS_28090 64759 65598 CDS product thiazole biosynthesis protein ThiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968037.1 protein_id gnl|my_center|LOCUS_28090 65768 66550 gene locus_tag LOCUS_28100 65768 66550 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814011.1 protein_id gnl|my_center|LOCUS_28100 67311 66547 gene locus_tag LOCUS_28110 67311 66547 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185819.1 protein_id gnl|my_center|LOCUS_28110 67463 67882 gene locus_tag LOCUS_28120 67463 67882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 68375 67917 gene locus_tag LOCUS_28130 68375 67917 CDS product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528593.1 protein_id gnl|my_center|LOCUS_28130 68692 68378 gene locus_tag LOCUS_28140 68692 68378 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528592.1 protein_id gnl|my_center|LOCUS_28140 69159 68704 gene locus_tag LOCUS_28150 69159 68704 CDS product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226555.1 protein_id gnl|my_center|LOCUS_28150 69375 71144 gene locus_tag LOCUS_28160 69375 71144 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082857.1 protein_id gnl|my_center|LOCUS_28160 72032 71193 gene locus_tag LOCUS_28170 72032 71193 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112398.1 protein_id gnl|my_center|LOCUS_28170 72165 73085 gene locus_tag LOCUS_28180 72165 73085 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895557.1 protein_id gnl|my_center|LOCUS_28180 73190 73777 gene locus_tag LOCUS_28190 73190 73777 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086782.1 protein_id gnl|my_center|LOCUS_28190 73871 74374 gene locus_tag LOCUS_28200 73871 74374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 74618 77383 gene locus_tag LOCUS_28210 74618 77383 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PA41 protein_id gnl|my_center|LOCUS_28210 78390 77389 gene locus_tag LOCUS_28220 gene ftrA 78390 77389 CDS product transcriptional regulator FtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194618.1 protein_id gnl|my_center|LOCUS_28220 >Feature sequence23 203 1138 gene locus_tag LOCUS_28230 203 1138 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037668.1 protein_id gnl|my_center|LOCUS_28230 1812 2567 gene locus_tag LOCUS_28240 gene tpiA 1812 2567 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7T0 protein_id gnl|my_center|LOCUS_28240 2599 3036 gene locus_tag LOCUS_28250 gene secG 2599 3036 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637878.2 protein_id gnl|my_center|LOCUS_28250 3088 3172 gene locus_tag LOCUS_t00310 3088 3172 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3284 3640 gene locus_tag LOCUS_28260 gene nuoA 3284 3640 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7T2 protein_id gnl|my_center|LOCUS_28260 3631 4185 gene locus_tag LOCUS_28270 gene nuoB 3631 4185 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7T3 protein_id gnl|my_center|LOCUS_28270 4282 4968 gene locus_tag LOCUS_28280 gene nuoC 4282 4968 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7T4 protein_id gnl|my_center|LOCUS_28280 4965 6272 gene locus_tag LOCUS_28290 gene nuoD 4965 6272 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7T5 protein_id gnl|my_center|LOCUS_28290 6370 6897 gene locus_tag LOCUS_28300 gene nuoE 6370 6897 CDS product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037655.1 protein_id gnl|my_center|LOCUS_28300 6902 8242 gene locus_tag LOCUS_28310 gene nuoF 6902 8242 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037654.1 protein_id gnl|my_center|LOCUS_28310 8239 10473 gene locus_tag LOCUS_28320 gene nuoG 8239 10473 CDS product NADH-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7T8 protein_id gnl|my_center|LOCUS_28320 10470 11564 gene locus_tag LOCUS_28330 gene nuoH 10470 11564 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7T9 protein_id gnl|my_center|LOCUS_28330 11566 12057 gene locus_tag LOCUS_28340 gene nuoI 11566 12057 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7U0 protein_id gnl|my_center|LOCUS_28340 12067 12723 gene locus_tag LOCUS_28350 gene nuoJ 12067 12723 CDS product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037650.1 protein_id gnl|my_center|LOCUS_28350 12720 13025 gene locus_tag LOCUS_28360 gene nuoK 12720 13025 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CLR2 protein_id gnl|my_center|LOCUS_28360 13033 15192 gene locus_tag LOCUS_28370 gene nuoL 13033 15192 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037649.1 protein_id gnl|my_center|LOCUS_28370 15216 16724 gene locus_tag LOCUS_28380 gene nuoM 15216 16724 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037648.1 protein_id gnl|my_center|LOCUS_28380 16740 18200 gene locus_tag LOCUS_28390 gene nuoN 16740 18200 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7U4 protein_id gnl|my_center|LOCUS_28390 18328 18404 gene locus_tag LOCUS_t00320 18328 18404 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 18487 18563 gene locus_tag LOCUS_t00330 18487 18563 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 18952 19542 gene locus_tag LOCUS_28400 gene rimP 18952 19542 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7U5 protein_id gnl|my_center|LOCUS_28400 19547 21058 gene locus_tag LOCUS_28410 gene nusA 19547 21058 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7U6 protein_id gnl|my_center|LOCUS_28410 21151 23796 gene locus_tag LOCUS_28420 gene infB 21151 23796 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7U7 protein_id gnl|my_center|LOCUS_28420 23900 24304 gene locus_tag LOCUS_28430 gene rbfA 23900 24304 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7U8 protein_id gnl|my_center|LOCUS_28430 24410 25318 gene locus_tag LOCUS_28440 gene truB 24410 25318 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7U9 protein_id gnl|my_center|LOCUS_28440 25493 25753 gene locus_tag LOCUS_28450 gene rpsO 25493 25753 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7V0 protein_id gnl|my_center|LOCUS_28450 25905 28013 gene locus_tag LOCUS_28460 gene pnp 25905 28013 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7V1 protein_id gnl|my_center|LOCUS_28460 28076 29713 gene locus_tag LOCUS_28470 28076 29713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 30746 29682 gene locus_tag LOCUS_28480 30746 29682 CDS product 6-aminohexanoate-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640075.1 protein_id gnl|my_center|LOCUS_28480 31956 30955 gene locus_tag LOCUS_28490 31956 30955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973752.1 protein_id gnl|my_center|LOCUS_28490 32173 33366 gene locus_tag LOCUS_28500 32173 33366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 34963 33404 gene locus_tag LOCUS_28510 34963 33404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035397.1 protein_id gnl|my_center|LOCUS_28510 35237 34974 gene locus_tag LOCUS_28520 35237 34974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 35533 35237 gene locus_tag LOCUS_28530 35533 35237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 37667 35541 gene locus_tag LOCUS_28540 gene fiuA 37667 35541 CDS product ferrichrome receptor FiuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113264.1 protein_id gnl|my_center|LOCUS_28540 38030 39931 gene locus_tag LOCUS_28550 gene thrS 38030 39931 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7Z2 protein_id gnl|my_center|LOCUS_28550 39980 40522 gene locus_tag LOCUS_28560 gene infC 39980 40522 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7Z3 protein_id gnl|my_center|LOCUS_28560 40789 40986 gene locus_tag LOCUS_28570 gene rpmI 40789 40986 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66283 protein_id gnl|my_center|LOCUS_28570 40998 41357 gene locus_tag LOCUS_28580 gene rplT 40998 41357 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7Z4 protein_id gnl|my_center|LOCUS_28580 41551 42546 gene locus_tag LOCUS_28590 gene pheS 41551 42546 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7Z5 protein_id gnl|my_center|LOCUS_28590 42607 45003 gene locus_tag LOCUS_28600 gene pheT 42607 45003 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7Z6 protein_id gnl|my_center|LOCUS_28600 45031 45330 gene locus_tag LOCUS_28610 gene ihfA 45031 45330 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A0T9 protein_id gnl|my_center|LOCUS_28610 45311 45667 gene locus_tag LOCUS_28620 45311 45667 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005995911.1 protein_id gnl|my_center|LOCUS_28620 45736 45812 gene locus_tag LOCUS_t00340 45736 45812 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 46351 45878 gene locus_tag LOCUS_28630 46351 45878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 46917 46414 gene locus_tag LOCUS_28640 46917 46414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 47193 47552 gene locus_tag LOCUS_28650 47193 47552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 48269 47577 gene locus_tag LOCUS_28660 48269 47577 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265932.1 protein_id gnl|my_center|LOCUS_28660 48424 49065 gene locus_tag LOCUS_28670 48424 49065 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387809.1 protein_id gnl|my_center|LOCUS_28670 49160 49333 gene locus_tag LOCUS_28680 49160 49333 CDS product UPF0391 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB24 protein_id gnl|my_center|LOCUS_28680 49715 49356 gene locus_tag LOCUS_28690 49715 49356 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814037.1 protein_id gnl|my_center|LOCUS_28690 50271 49702 gene locus_tag LOCUS_28700 50271 49702 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969925.1 protein_id gnl|my_center|LOCUS_28700 50591 50358 gene locus_tag LOCUS_28710 50591 50358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036825.1 protein_id gnl|my_center|LOCUS_28710 50888 50604 gene locus_tag LOCUS_28720 50888 50604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 51116 50949 gene locus_tag LOCUS_28730 51116 50949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 51286 51543 gene locus_tag LOCUS_28740 51286 51543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 51934 51512 gene locus_tag LOCUS_28750 51934 51512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 52651 52196 gene locus_tag LOCUS_28760 gene pilA 52651 52196 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P04739 protein_id gnl|my_center|LOCUS_28760 53122 52736 gene locus_tag LOCUS_28770 53122 52736 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001909686.1 protein_id gnl|my_center|LOCUS_28770 53780 53370 gene locus_tag LOCUS_28780 53780 53370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 54349 53927 gene locus_tag LOCUS_28790 54349 53927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003656109.1 protein_id gnl|my_center|LOCUS_28790 54724 54353 gene locus_tag LOCUS_28800 54724 54353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 55268 54717 gene locus_tag LOCUS_28810 55268 54717 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207703.1 protein_id gnl|my_center|LOCUS_28810 55972 55265 gene locus_tag LOCUS_28820 55972 55265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 56223 56894 gene locus_tag LOCUS_28830 56223 56894 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704956.1 protein_id gnl|my_center|LOCUS_28830 57023 57583 gene locus_tag LOCUS_28840 57023 57583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 57752 57955 gene locus_tag LOCUS_28850 57752 57955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 59979 58072 gene locus_tag LOCUS_28860 gene dxs 59979 58072 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P815 protein_id gnl|my_center|LOCUS_28860 60750 60085 gene locus_tag LOCUS_28870 60750 60085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637786.2 protein_id gnl|my_center|LOCUS_28870 62788 60998 gene locus_tag LOCUS_28880 62788 60998 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037573.1 protein_id gnl|my_center|LOCUS_28880 63329 62853 gene locus_tag LOCUS_28890 63329 62853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037572.1 protein_id gnl|my_center|LOCUS_28890 64045 63494 gene locus_tag LOCUS_28900 gene blc 64045 63494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037571.1 protein_id gnl|my_center|LOCUS_28900 64276 64201 gene locus_tag LOCUS_t00350 64276 64201 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 64425 64350 gene locus_tag LOCUS_t00360 64425 64350 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 64760 65785 gene locus_tag LOCUS_28910 64760 65785 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035525.1 protein_id gnl|my_center|LOCUS_28910 66674 65832 gene locus_tag LOCUS_28920 66674 65832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 66807 67568 gene locus_tag LOCUS_28930 66807 67568 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705864.1 protein_id gnl|my_center|LOCUS_28930 67694 67867 gene locus_tag LOCUS_28940 67694 67867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 68265 68026 gene locus_tag LOCUS_28950 68265 68026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 68561 68262 gene locus_tag LOCUS_28960 68561 68262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 68763 68554 gene locus_tag LOCUS_28970 68763 68554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 69020 68760 gene locus_tag LOCUS_28980 69020 68760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 69916 69017 gene locus_tag LOCUS_28990 69916 69017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 70251 69913 gene locus_tag LOCUS_29000 70251 69913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 72257 70248 gene locus_tag LOCUS_29010 72257 70248 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268028.1 protein_id gnl|my_center|LOCUS_29010 72570 72250 gene locus_tag LOCUS_29020 72570 72250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 72707 72567 gene locus_tag LOCUS_29030 72707 72567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 72821 73411 gene locus_tag LOCUS_29040 72821 73411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 73692 73435 gene locus_tag LOCUS_29050 73692 73435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 73910 73689 gene locus_tag LOCUS_29060 73910 73689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 >Feature sequence24 1398 67 gene locus_tag LOCUS_29070 gene pepQ 1398 67 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5S9 protein_id gnl|my_center|LOCUS_29070 1848 1474 gene locus_tag LOCUS_29080 1848 1474 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038358.1 protein_id gnl|my_center|LOCUS_29080 4127 1845 gene locus_tag LOCUS_29090 4127 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638601.2 protein_id gnl|my_center|LOCUS_29090 5553 4327 gene locus_tag LOCUS_29100 5553 4327 CDS product YggW family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038356.1 protein_id gnl|my_center|LOCUS_29100 6207 5611 gene locus_tag LOCUS_29110 6207 5611 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5T3 protein_id gnl|my_center|LOCUS_29110 6593 6204 gene locus_tag LOCUS_29120 6593 6204 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038354.1 protein_id gnl|my_center|LOCUS_29120 7315 6590 gene locus_tag LOCUS_29130 gene rph 7315 6590 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5T5 protein_id gnl|my_center|LOCUS_29130 7452 8300 gene locus_tag LOCUS_29140 7452 8300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038352.1 protein_id gnl|my_center|LOCUS_29140 9422 8343 gene locus_tag LOCUS_29150 gene selD 9422 8343 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WCS1 protein_id gnl|my_center|LOCUS_29150 9544 9449 gene locus_tag LOCUS_t00370 9544 9449 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 11500 9569 gene locus_tag LOCUS_29160 gene selB 11500 9569 CDS product selenocysteine-specific translation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187519.1 protein_id gnl|my_center|LOCUS_29160 12921 11497 gene locus_tag LOCUS_29170 gene selA 12921 11497 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JQ3 protein_id gnl|my_center|LOCUS_29170 13909 12926 gene locus_tag LOCUS_29180 gene fdhE 13909 12926 CDS product protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WAH4 protein_id gnl|my_center|LOCUS_29180 15012 14365 gene locus_tag LOCUS_29190 gene fdoI 15012 14365 CDS product formate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551972.1 protein_id gnl|my_center|LOCUS_29190 15923 15009 gene locus_tag LOCUS_29200 gene fdoH 15923 15009 CDS product formate dehydrogenase-O iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528944.1 protein_id gnl|my_center|LOCUS_29200 19002 15934 gene locus_tag LOCUS_29210 gene fdoG 19002 15934 CDS product formate dehydrogenase-O, alpha subunit, selenocysteine-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:A3NM19 transl_except (pos:complement(18412..18414),aa:Sec) note codon on position 197 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_29210 19296 19961 gene locus_tag LOCUS_29220 gene gmk 19296 19961 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5T7 protein_id gnl|my_center|LOCUS_29220 20072 20371 gene locus_tag LOCUS_29230 gene rpoZ 20072 20371 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66733 protein_id gnl|my_center|LOCUS_29230 20477 22639 gene locus_tag LOCUS_29240 gene spoT 20477 22639 CDS product bifunctional GTP diphosphokinase/guanosine-3',5'-bis(diphosphate) 3'-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038350.1 protein_id gnl|my_center|LOCUS_29240 22872 23258 gene locus_tag LOCUS_29250 gene yjgF 22872 23258 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038342.1 protein_id gnl|my_center|LOCUS_29250 23266 25377 gene locus_tag LOCUS_29260 gene recG 23266 25377 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5U7 protein_id gnl|my_center|LOCUS_29260 25674 26747 gene locus_tag LOCUS_29270 25674 26747 CDS product inosine-uridine preferring nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038340.1 protein_id gnl|my_center|LOCUS_29270 26836 27078 gene locus_tag LOCUS_29280 gene rpmE2 26836 27078 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5U9 protein_id gnl|my_center|LOCUS_29280 27375 28652 gene locus_tag LOCUS_29290 gene gltA 27375 28652 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5V0 protein_id gnl|my_center|LOCUS_29290 28993 30087 gene locus_tag LOCUS_29300 28993 30087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528199.1 protein_id gnl|my_center|LOCUS_29300 30366 31004 gene locus_tag LOCUS_29310 gene tcfB 30366 31004 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287810.1 protein_id gnl|my_center|LOCUS_29310 31058 33790 gene locus_tag LOCUS_29320 gene tsaC 31058 33790 CDS product fimbrial outer membrane usher protein TcfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092510.1 protein_id gnl|my_center|LOCUS_29320 33787 34923 gene locus_tag LOCUS_29330 33787 34923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 34944 35651 gene locus_tag LOCUS_29340 34944 35651 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705402.1 protein_id gnl|my_center|LOCUS_29340 35721 39218 gene locus_tag LOCUS_29350 35721 39218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29350 39422 40306 gene locus_tag LOCUS_29360 39422 40306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29360 40376 41122 gene locus_tag LOCUS_29370 40376 41122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 41874 41224 gene locus_tag LOCUS_29380 41874 41224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038337.1 protein_id gnl|my_center|LOCUS_29380 44444 42021 gene locus_tag LOCUS_29390 gene mrcA 44444 42021 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038336.1 protein_id gnl|my_center|LOCUS_29390 44733 45722 gene locus_tag LOCUS_29400 gene pilM 44733 45722 CDS product fimbrial assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038335.1 protein_id gnl|my_center|LOCUS_29400 45722 46618 gene locus_tag LOCUS_29410 45722 46618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 46615 47289 gene locus_tag LOCUS_29420 gene pilO 46615 47289 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038333.1 protein_id gnl|my_center|LOCUS_29420 47289 47822 gene locus_tag LOCUS_29430 gene pilP 47289 47822 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038332.1 protein_id gnl|my_center|LOCUS_29430 47844 49808 gene locus_tag LOCUS_29440 gene pilQ 47844 49808 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038331.1 protein_id gnl|my_center|LOCUS_29440 49976 51001 gene locus_tag LOCUS_29450 gene moxR 49976 51001 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038330.1 protein_id gnl|my_center|LOCUS_29450 51040 51939 gene locus_tag LOCUS_29460 51040 51939 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038329.1 protein_id gnl|my_center|LOCUS_29460 51936 52385 gene locus_tag LOCUS_29470 51936 52385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038328.1 protein_id gnl|my_center|LOCUS_29470 52382 53386 gene locus_tag LOCUS_29480 52382 53386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038327.1 protein_id gnl|my_center|LOCUS_29480 53383 55194 gene locus_tag LOCUS_29490 53383 55194 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038326.1 protein_id gnl|my_center|LOCUS_29490 55191 56906 gene locus_tag LOCUS_29500 55191 56906 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038325.1 protein_id gnl|my_center|LOCUS_29500 56964 58283 gene locus_tag LOCUS_29510 gene gltP 56964 58283 CDS product proton glutamate symport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038324.1 protein_id gnl|my_center|LOCUS_29510 58482 60479 gene locus_tag LOCUS_29520 gene tktA 58482 60479 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5W5 protein_id gnl|my_center|LOCUS_29520 60491 60796 gene locus_tag LOCUS_29530 60491 60796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 61084 61389 gene locus_tag LOCUS_29540 61084 61389 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103139.1 protein_id gnl|my_center|LOCUS_29540 63427 61475 gene locus_tag LOCUS_29550 63427 61475 CDS product acetyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038313.1 protein_id gnl|my_center|LOCUS_29550 64020 63463 gene locus_tag LOCUS_29560 64020 63463 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038309.1 protein_id gnl|my_center|LOCUS_29560 64139 64504 gene locus_tag LOCUS_29570 gene blaI 64139 64504 CDS product BlaI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038312.1 protein_id gnl|my_center|LOCUS_29570 64497 65738 gene locus_tag LOCUS_29580 64497 65738 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5X8 protein_id gnl|my_center|LOCUS_29580 65735 66295 gene locus_tag LOCUS_29590 65735 66295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 67150 66350 gene locus_tag LOCUS_29600 67150 66350 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038303.1 protein_id gnl|my_center|LOCUS_29600 67980 67162 gene locus_tag LOCUS_29610 67980 67162 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038304.1 protein_id gnl|my_center|LOCUS_29610 68846 68217 gene locus_tag LOCUS_29620 gene ompW 68846 68217 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038301.1 protein_id gnl|my_center|LOCUS_29620 69039 70043 gene locus_tag LOCUS_29630 gene gapA 69039 70043 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5Z0 protein_id gnl|my_center|LOCUS_29630 70169 72838 gene locus_tag LOCUS_29640 70169 72838 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038297.1 protein_id gnl|my_center|LOCUS_29640 72835 74211 gene locus_tag LOCUS_29650 72835 74211 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038296.1 protein_id gnl|my_center|LOCUS_29650 >Feature sequence25 692 105 gene locus_tag LOCUS_29660 gene azoR 692 105 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QI7 protein_id gnl|my_center|LOCUS_29660 820 1812 gene locus_tag LOCUS_29670 820 1812 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036777.1 protein_id gnl|my_center|LOCUS_29670 1914 2003 gene locus_tag LOCUS_t00380 1914 2003 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2626 2171 gene locus_tag LOCUS_29680 2626 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 6158 3408 gene locus_tag LOCUS_29690 6158 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 7268 6279 gene locus_tag LOCUS_29700 7268 6279 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538217.1 protein_id gnl|my_center|LOCUS_29700 7371 7718 gene locus_tag LOCUS_29710 7371 7718 CDS product HxlR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185699.1 protein_id gnl|my_center|LOCUS_29710 9505 8309 gene locus_tag LOCUS_29720 9505 8309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 10136 10543 gene locus_tag LOCUS_29730 10136 10543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 10646 11101 gene locus_tag LOCUS_29740 10646 11101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039246.1 protein_id gnl|my_center|LOCUS_29740 11636 11259 gene locus_tag LOCUS_29750 11636 11259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 12026 11667 gene locus_tag LOCUS_29760 12026 11667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 14115 12145 gene locus_tag LOCUS_29770 gene macB 14115 12145 CDS product macrolide export ATP-binding/permease protein MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIL8 protein_id gnl|my_center|LOCUS_29770 15302 14112 gene locus_tag LOCUS_29780 15302 14112 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815858.1 protein_id gnl|my_center|LOCUS_29780 15857 15429 gene locus_tag LOCUS_29790 15857 15429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 17520 16171 gene locus_tag LOCUS_29800 17520 16171 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087571.1 protein_id gnl|my_center|LOCUS_29800 18194 17520 gene locus_tag LOCUS_29810 18194 17520 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087570.1 protein_id gnl|my_center|LOCUS_29810 18389 18670 gene locus_tag LOCUS_29820 18389 18670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 19218 18748 gene locus_tag LOCUS_29830 19218 18748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 19781 19215 gene locus_tag LOCUS_29840 19781 19215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 22115 19974 gene locus_tag LOCUS_29850 gene fhuA 22115 19974 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036583.1 protein_id gnl|my_center|LOCUS_29850 22834 22190 gene locus_tag LOCUS_29860 22834 22190 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226070.1 protein_id gnl|my_center|LOCUS_29860 22918 24450 gene locus_tag LOCUS_29870 22918 24450 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229883.1 protein_id gnl|my_center|LOCUS_29870 24739 24494 gene locus_tag LOCUS_29880 24739 24494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 25195 24866 gene locus_tag LOCUS_29890 25195 24866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 25632 25231 gene locus_tag LOCUS_29900 25632 25231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 25546 25899 gene locus_tag LOCUS_29910 25546 25899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 26472 25996 gene locus_tag LOCUS_29920 26472 25996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 27803 26565 gene locus_tag LOCUS_29930 27803 26565 CDS product FMN oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114387.1 protein_id gnl|my_center|LOCUS_29930 27893 28375 gene locus_tag LOCUS_29940 27893 28375 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114388.1 protein_id gnl|my_center|LOCUS_29940 29603 28392 gene locus_tag LOCUS_29950 gene araJ 29603 28392 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036509.1 protein_id gnl|my_center|LOCUS_29950 29697 29906 gene locus_tag LOCUS_29960 29697 29906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 30153 30410 gene locus_tag LOCUS_29970 30153 30410 CDS product UPF0386 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5L6 protein_id gnl|my_center|LOCUS_29970 30484 30990 gene locus_tag LOCUS_29980 gene yhbS 30484 30990 CDS product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207057.1 protein_id gnl|my_center|LOCUS_29980 31219 31013 gene locus_tag LOCUS_29990 31219 31013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 31715 31278 gene locus_tag LOCUS_30000 31715 31278 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920126.1 protein_id gnl|my_center|LOCUS_30000 32550 31783 gene locus_tag LOCUS_30010 32550 31783 CDS product NAD(P)H dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525154.1 protein_id gnl|my_center|LOCUS_30010 32629 32988 gene locus_tag LOCUS_30020 32629 32988 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640344.1 protein_id gnl|my_center|LOCUS_30020 33064 33588 gene locus_tag LOCUS_30030 gene tadA 33064 33588 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8S0 protein_id gnl|my_center|LOCUS_30030 33664 34236 gene locus_tag LOCUS_30040 gene orn 33664 34236 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8S1 protein_id gnl|my_center|LOCUS_30040 34396 35271 gene locus_tag LOCUS_30050 34396 35271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106675.1 protein_id gnl|my_center|LOCUS_30050 35411 36526 gene locus_tag LOCUS_30060 35411 36526 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112378.1 protein_id gnl|my_center|LOCUS_30060 37526 36633 gene locus_tag LOCUS_30070 gene yggB 37526 36633 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037313.1 protein_id gnl|my_center|LOCUS_30070 40042 37664 gene locus_tag LOCUS_30080 gene ppsA 40042 37664 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8S3 protein_id gnl|my_center|LOCUS_30080 40188 41009 gene locus_tag LOCUS_30090 40188 41009 CDS product putative phosphoenolpyruvate synthase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8S4 protein_id gnl|my_center|LOCUS_30090 41158 41667 gene locus_tag LOCUS_30100 41158 41667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037310.1 protein_id gnl|my_center|LOCUS_30100 41710 42198 gene locus_tag LOCUS_30110 gene mutT 41710 42198 CDS product 7,8-dihydro-8-oxoguanine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037309.1 protein_id gnl|my_center|LOCUS_30110 42392 42970 gene locus_tag LOCUS_30120 42392 42970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113820.1 protein_id gnl|my_center|LOCUS_30120 43091 44455 gene locus_tag LOCUS_30130 43091 44455 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385416.1 protein_id gnl|my_center|LOCUS_30130 45287 44643 gene locus_tag LOCUS_30140 45287 44643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 45657 46253 gene locus_tag LOCUS_30150 gene pssA 45657 46253 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037307.1 protein_id gnl|my_center|LOCUS_30150 46276 47370 gene locus_tag LOCUS_30160 gene phaE 46276 47370 CDS product class III poly(R)-hydroxyalkanoic acid synthase subunit PhaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037306.1 protein_id gnl|my_center|LOCUS_30160 47367 48434 gene locus_tag LOCUS_30170 gene phbC 47367 48434 CDS product poly-beta-hydroxybutyrate polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037305.1 protein_id gnl|my_center|LOCUS_30170 48468 48836 gene locus_tag LOCUS_30180 48468 48836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035581.1 protein_id gnl|my_center|LOCUS_30180 48903 49106 gene locus_tag LOCUS_30190 48903 49106 CDS product stress-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037304.1 protein_id gnl|my_center|LOCUS_30190 49103 49555 gene locus_tag LOCUS_30200 49103 49555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037303.1 protein_id gnl|my_center|LOCUS_30200 50245 50460 gene locus_tag LOCUS_30210 50245 50460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037301.1 protein_id gnl|my_center|LOCUS_30210 50668 53055 gene locus_tag LOCUS_30220 gene tex 50668 53055 CDS product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037300.1 protein_id gnl|my_center|LOCUS_30220 53264 55447 gene locus_tag LOCUS_30230 53264 55447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 55544 56227 gene locus_tag LOCUS_30240 55544 56227 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381155.1 protein_id gnl|my_center|LOCUS_30240 56205 57584 gene locus_tag LOCUS_30250 56205 57584 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404984.1 protein_id gnl|my_center|LOCUS_30250 58207 61428 gene locus_tag LOCUS_30260 gene ragC 58207 61428 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085718.1 protein_id gnl|my_center|LOCUS_30260 61421 62584 gene locus_tag LOCUS_30270 61421 62584 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085719.1 protein_id gnl|my_center|LOCUS_30270 62571 63965 gene locus_tag LOCUS_30280 62571 63965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089909.1 protein_id gnl|my_center|LOCUS_30280 64043 64285 gene locus_tag LOCUS_30290 64043 64285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 64577 64287 gene locus_tag LOCUS_30300 64577 64287 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388148.1 protein_id gnl|my_center|LOCUS_30300 65242 64640 gene locus_tag LOCUS_30310 65242 64640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30310 65729 65313 gene locus_tag LOCUS_30320 65729 65313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 66279 68105 gene locus_tag LOCUS_30330 66279 68105 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921178.1 protein_id gnl|my_center|LOCUS_30330 69541 68102 gene locus_tag LOCUS_30340 69541 68102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 70163 69654 gene locus_tag LOCUS_30350 70163 69654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 70355 70270 gene locus_tag LOCUS_t00390 70355 70270 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 70488 70868 gene locus_tag LOCUS_30360 70488 70868 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037298.1 protein_id gnl|my_center|LOCUS_30360 70939 71136 gene locus_tag LOCUS_30370 70939 71136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 72138 71182 gene locus_tag LOCUS_30380 72138 71182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 72216 72632 gene locus_tag LOCUS_30390 gene attT 72216 72632 CDS product AttT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035584.1 protein_id gnl|my_center|LOCUS_30390 72768 72693 gene locus_tag LOCUS_t00400 72768 72693 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence26 5132 4137 gene locus_tag LOCUS_30400 5132 4137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 5808 5455 gene locus_tag LOCUS_30410 5808 5455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 6435 6791 gene locus_tag LOCUS_30420 6435 6791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 6861 7262 gene locus_tag LOCUS_30430 6861 7262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 8412 7315 gene locus_tag LOCUS_30440 8412 7315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112913.1 protein_id gnl|my_center|LOCUS_30440 9029 8553 gene locus_tag LOCUS_30450 9029 8553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096727.1 protein_id gnl|my_center|LOCUS_30450 9660 9091 gene locus_tag LOCUS_30460 9660 9091 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196513.1 protein_id gnl|my_center|LOCUS_30460 9829 10782 gene locus_tag LOCUS_30470 9829 10782 CDS product chloroperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969967.1 protein_id gnl|my_center|LOCUS_30470 13488 10837 gene locus_tag LOCUS_30480 gene uvrA2 13488 10837 CDS product excinuclease ABC subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036288.1 protein_id gnl|my_center|LOCUS_30480 15480 13597 gene locus_tag LOCUS_30490 15480 13597 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038680.1 protein_id gnl|my_center|LOCUS_30490 17992 15527 gene locus_tag LOCUS_30500 17992 15527 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267348.1 protein_id gnl|my_center|LOCUS_30500 19129 18092 gene locus_tag LOCUS_30510 19129 18092 CDS product sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082671.1 protein_id gnl|my_center|LOCUS_30510 19935 19126 gene locus_tag LOCUS_30520 19935 19126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 21385 19997 gene locus_tag LOCUS_30530 21385 19997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038717.1 protein_id gnl|my_center|LOCUS_30530 24546 21478 gene locus_tag LOCUS_30540 24546 21478 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919015.1 protein_id gnl|my_center|LOCUS_30540 25699 24659 gene locus_tag LOCUS_30550 25699 24659 CDS product sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113263.1 protein_id gnl|my_center|LOCUS_30550 26193 25702 gene locus_tag LOCUS_30560 26193 25702 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082669.1 protein_id gnl|my_center|LOCUS_30560 27062 26382 gene locus_tag LOCUS_30570 27062 26382 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537687.1 protein_id gnl|my_center|LOCUS_30570 27152 28348 gene locus_tag LOCUS_30580 27152 28348 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706360.1 protein_id gnl|my_center|LOCUS_30580 28933 28406 gene locus_tag LOCUS_30590 28933 28406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098394.1 protein_id gnl|my_center|LOCUS_30590 29046 29414 gene locus_tag LOCUS_30600 29046 29414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 30931 29426 gene locus_tag LOCUS_30610 30931 29426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 31884 31012 gene locus_tag LOCUS_30620 gene metF 31884 31012 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDM1 protein_id gnl|my_center|LOCUS_30620 32798 31884 gene locus_tag LOCUS_30630 gene metR 32798 31884 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035570.1 protein_id gnl|my_center|LOCUS_30630 32974 33555 gene locus_tag LOCUS_30640 gene sflA 32974 33555 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035571.1 protein_id gnl|my_center|LOCUS_30640 33556 34590 gene locus_tag LOCUS_30650 33556 34590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035572.1 protein_id gnl|my_center|LOCUS_30650 34630 35664 gene locus_tag LOCUS_30660 gene metE 34630 35664 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035573.1 protein_id gnl|my_center|LOCUS_30660 35797 37044 gene locus_tag LOCUS_30670 gene arsB 35797 37044 CDS product arsenic transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088028.1 protein_id gnl|my_center|LOCUS_30670 37369 38211 gene locus_tag LOCUS_30680 gene yeaM 37369 38211 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836266.1 protein_id gnl|my_center|LOCUS_30680 39200 38199 gene locus_tag LOCUS_30690 39200 38199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 39397 41583 gene locus_tag LOCUS_30700 39397 41583 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265529.1 protein_id gnl|my_center|LOCUS_30700 41617 42495 gene locus_tag LOCUS_30710 41617 42495 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923326.1 protein_id gnl|my_center|LOCUS_30710 42492 42977 gene locus_tag LOCUS_30720 42492 42977 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531248.1 protein_id gnl|my_center|LOCUS_30720 43014 46652 gene locus_tag LOCUS_30730 43014 46652 CDS product two-component sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114080.1 protein_id gnl|my_center|LOCUS_30730 47160 48806 gene locus_tag LOCUS_30740 47160 48806 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940904.1 protein_id gnl|my_center|LOCUS_30740 50082 48877 gene locus_tag LOCUS_30750 50082 48877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 51865 50393 gene locus_tag LOCUS_30760 51865 50393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 53465 51891 gene locus_tag LOCUS_30770 53465 51891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035939.1 protein_id gnl|my_center|LOCUS_30770 53618 54922 gene locus_tag LOCUS_30780 53618 54922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 55295 55101 gene locus_tag LOCUS_30790 55295 55101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 55213 55953 gene locus_tag LOCUS_30800 gene nucA 55213 55953 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036828.1 protein_id gnl|my_center|LOCUS_30800 56948 56010 gene locus_tag LOCUS_30810 56948 56010 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530060.1 protein_id gnl|my_center|LOCUS_30810 57163 58104 gene locus_tag LOCUS_30820 57163 58104 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530059.1 protein_id gnl|my_center|LOCUS_30820 58127 58822 gene locus_tag LOCUS_30830 58127 58822 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925735.1 protein_id gnl|my_center|LOCUS_30830 59060 58830 gene locus_tag LOCUS_30840 59060 58830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708898.1 protein_id gnl|my_center|LOCUS_30840 59482 59057 gene locus_tag LOCUS_30850 59482 59057 CDS product lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972459.1 protein_id gnl|my_center|LOCUS_30850 59954 59493 gene locus_tag LOCUS_30860 59954 59493 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970370.1 protein_id gnl|my_center|LOCUS_30860 61343 60024 gene locus_tag LOCUS_30870 61343 60024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 61775 62305 gene locus_tag LOCUS_30880 61775 62305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 62302 62919 gene locus_tag LOCUS_30890 62302 62919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113479.1 protein_id gnl|my_center|LOCUS_30890 62962 64278 gene locus_tag LOCUS_30900 62962 64278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 64377 65081 gene locus_tag LOCUS_30910 64377 65081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113481.1 protein_id gnl|my_center|LOCUS_30910 65095 65844 gene locus_tag LOCUS_30920 65095 65844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 65891 67228 gene locus_tag LOCUS_30930 65891 67228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088309.1 protein_id gnl|my_center|LOCUS_30930 67407 68930 gene locus_tag LOCUS_30940 67407 68930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 69007 70059 gene locus_tag LOCUS_30950 69007 70059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 70280 70570 gene locus_tag LOCUS_30960 70280 70570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 70614 70883 gene locus_tag LOCUS_30970 70614 70883 CDS product RebB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197243.1 protein_id gnl|my_center|LOCUS_30970 70910 71176 gene locus_tag LOCUS_30980 gene rebB 70910 71176 CDS product RebB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038031.1 protein_id gnl|my_center|LOCUS_30980 71237 71509 gene locus_tag LOCUS_30990 71237 71509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 71579 71815 gene locus_tag LOCUS_31000 71579 71815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 >Feature sequence27 404 1300 gene locus_tag LOCUS_31010 gene folP 404 1300 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9X9 protein_id gnl|my_center|LOCUS_31010 1300 2253 gene locus_tag LOCUS_31020 gene miaA 1300 2253 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9X8 protein_id gnl|my_center|LOCUS_31020 2350 2625 gene locus_tag LOCUS_31030 gene hfq 2350 2625 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9X7 protein_id gnl|my_center|LOCUS_31030 2640 3950 gene locus_tag LOCUS_31040 gene hflX 2640 3950 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9X6 protein_id gnl|my_center|LOCUS_31040 4073 4567 gene locus_tag LOCUS_31050 4073 4567 CDS product competence damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036895.1 protein_id gnl|my_center|LOCUS_31050 4599 6284 gene locus_tag LOCUS_31060 gene aarF 4599 6284 CDS product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9X3 protein_id gnl|my_center|LOCUS_31060 6493 7128 gene locus_tag LOCUS_31070 gene lexA2 6493 7128 CDS product LexA repressor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9X2 protein_id gnl|my_center|LOCUS_31070 7270 8370 gene locus_tag LOCUS_31080 gene recA 7270 8370 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q60101 protein_id gnl|my_center|LOCUS_31080 8379 8972 gene locus_tag LOCUS_31090 gene recX 8379 8972 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9X1 protein_id gnl|my_center|LOCUS_31090 9082 11730 gene locus_tag LOCUS_31100 gene alaS 9082 11730 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9X0 protein_id gnl|my_center|LOCUS_31100 11879 12082 gene locus_tag LOCUS_31110 gene csrA 11879 12082 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9W9 protein_id gnl|my_center|LOCUS_31110 12161 12253 gene locus_tag LOCUS_t00410 12161 12253 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 12505 13062 gene locus_tag LOCUS_31120 12505 13062 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814464.1 protein_id gnl|my_center|LOCUS_31120 13142 14296 gene locus_tag LOCUS_31130 13142 14296 CDS product sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082671.1 protein_id gnl|my_center|LOCUS_31130 14389 16920 gene locus_tag LOCUS_31140 14389 16920 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267348.1 protein_id gnl|my_center|LOCUS_31140 19305 16975 gene locus_tag LOCUS_31150 19305 16975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 19450 20379 gene locus_tag LOCUS_31160 gene alcR 19450 20379 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814017.1 protein_id gnl|my_center|LOCUS_31160 20491 22662 gene locus_tag LOCUS_31170 gene fauA 20491 22662 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926982.1 protein_id gnl|my_center|LOCUS_31170 22901 22683 gene locus_tag LOCUS_31180 22901 22683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 22786 23268 gene locus_tag LOCUS_31190 22786 23268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 26000 23325 gene locus_tag LOCUS_31200 26000 23325 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVZ9 protein_id gnl|my_center|LOCUS_31200 26275 26790 gene locus_tag LOCUS_31210 26275 26790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 26787 27812 gene locus_tag LOCUS_31220 gene fecR 26787 27812 CDS product FecR protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836262.1 protein_id gnl|my_center|LOCUS_31220 27951 30884 gene locus_tag LOCUS_31230 gene cirA 27951 30884 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635445.2 protein_id gnl|my_center|LOCUS_31230 30895 32490 gene locus_tag LOCUS_31240 30895 32490 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919439.1 protein_id gnl|my_center|LOCUS_31240 34713 32593 gene locus_tag LOCUS_31250 gene plcN 34713 32593 CDS product phospholipase C, phosphocholine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038152.1 protein_id gnl|my_center|LOCUS_31250 37088 34710 gene locus_tag LOCUS_31260 gene fhuA 37088 34710 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038151.1 protein_id gnl|my_center|LOCUS_31260 37263 38771 gene locus_tag LOCUS_31270 37263 38771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 39710 38784 gene locus_tag LOCUS_31280 39710 38784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 41053 39707 gene locus_tag LOCUS_31290 41053 39707 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113742.1 protein_id gnl|my_center|LOCUS_31290 41239 42390 gene locus_tag LOCUS_31300 41239 42390 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038989.1 protein_id gnl|my_center|LOCUS_31300 43613 42474 gene locus_tag LOCUS_31310 43613 42474 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403811.1 protein_id gnl|my_center|LOCUS_31310 43799 44494 gene locus_tag LOCUS_31320 43799 44494 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114420.1 protein_id gnl|my_center|LOCUS_31320 44682 46886 gene locus_tag LOCUS_31330 gene fpvA 44682 46886 CDS product ferripyoverdine receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48632 protein_id gnl|my_center|LOCUS_31330 47644 46943 gene locus_tag LOCUS_31340 47644 46943 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036904.1 protein_id gnl|my_center|LOCUS_31340 47785 48705 gene locus_tag LOCUS_31350 47785 48705 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036906.1 protein_id gnl|my_center|LOCUS_31350 50655 49264 gene locus_tag LOCUS_31360 gene dhs1 50655 49264 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC31 protein_id gnl|my_center|LOCUS_31360 50876 53002 gene locus_tag LOCUS_31370 50876 53002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 53554 53048 gene locus_tag LOCUS_31380 gene dsbB 53554 53048 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC32 protein_id gnl|my_center|LOCUS_31380 54122 53739 gene locus_tag LOCUS_31390 gene rplQ 54122 53739 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z3E6 protein_id gnl|my_center|LOCUS_31390 55312 54314 gene locus_tag LOCUS_31400 gene rpoA 55312 54314 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A0Y1 protein_id gnl|my_center|LOCUS_31400 55998 55369 gene locus_tag LOCUS_31410 gene rpsD 55998 55369 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A0X9 protein_id gnl|my_center|LOCUS_31410 56403 56014 gene locus_tag LOCUS_31420 gene rpsK 56403 56014 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A0X2 protein_id gnl|my_center|LOCUS_31420 56771 56415 gene locus_tag LOCUS_31430 gene rpsM 56771 56415 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z3F0 protein_id gnl|my_center|LOCUS_31430 58486 57119 gene locus_tag LOCUS_31440 gene secY 58486 57119 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC33 protein_id gnl|my_center|LOCUS_31440 58937 58494 gene locus_tag LOCUS_31450 gene rplO 58937 58494 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC34 protein_id gnl|my_center|LOCUS_31450 59135 58944 gene locus_tag LOCUS_31460 gene rpmD 59135 58944 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC35 protein_id gnl|my_center|LOCUS_31460 59670 59128 gene locus_tag LOCUS_31470 gene rpsE 59670 59128 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66587 protein_id gnl|my_center|LOCUS_31470 60185 59832 gene locus_tag LOCUS_31480 gene rplR 60185 59832 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC36 protein_id gnl|my_center|LOCUS_31480 60796 60272 gene locus_tag LOCUS_31490 gene rplF 60796 60272 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC37 protein_id gnl|my_center|LOCUS_31490 61213 60815 gene locus_tag LOCUS_31500 gene rpsH 61213 60815 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC38 protein_id gnl|my_center|LOCUS_31500 61778 61473 gene locus_tag LOCUS_31510 gene rpsN 61778 61473 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CLU4 protein_id gnl|my_center|LOCUS_31510 62339 61797 gene locus_tag LOCUS_31520 gene rplE 62339 61797 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC39 protein_id gnl|my_center|LOCUS_31520 62668 62351 gene locus_tag LOCUS_31530 gene rplX 62668 62351 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC40 protein_id gnl|my_center|LOCUS_31530 63053 62685 gene locus_tag LOCUS_31540 gene rplN 63053 62685 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CLU5 protein_id gnl|my_center|LOCUS_31540 63335 63066 gene locus_tag LOCUS_31550 gene rpsQ 63335 63066 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC41 protein_id gnl|my_center|LOCUS_31550 63532 63347 gene locus_tag LOCUS_31560 gene rpmC 63532 63347 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC42 protein_id gnl|my_center|LOCUS_31560 63945 63532 gene locus_tag LOCUS_31570 gene rplP 63945 63532 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC43 protein_id gnl|my_center|LOCUS_31570 64685 63951 gene locus_tag LOCUS_31580 gene rpsC 64685 63951 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC44 protein_id gnl|my_center|LOCUS_31580 65039 64704 gene locus_tag LOCUS_31590 gene rplV 65039 64704 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CLU6 protein_id gnl|my_center|LOCUS_31590 65321 65052 gene locus_tag LOCUS_31600 gene rpsS 65321 65052 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC45 protein_id gnl|my_center|LOCUS_31600 66155 65328 gene locus_tag LOCUS_31610 gene rplB 66155 65328 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC46 protein_id gnl|my_center|LOCUS_31610 66465 66166 gene locus_tag LOCUS_31620 gene rplW 66465 66166 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC47 protein_id gnl|my_center|LOCUS_31620 67067 66462 gene locus_tag LOCUS_31630 gene rplD 67067 66462 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC48 protein_id gnl|my_center|LOCUS_31630 67730 67080 gene locus_tag LOCUS_31640 gene rplC 67730 67080 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC49 protein_id gnl|my_center|LOCUS_31640 68053 67742 gene locus_tag LOCUS_31650 gene rpsJ 68053 67742 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC50 protein_id gnl|my_center|LOCUS_31650 >Feature sequence28 703 1062 gene locus_tag LOCUS_31660 703 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 1287 1616 gene locus_tag LOCUS_31670 1287 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 1894 1613 gene locus_tag LOCUS_31680 1894 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 2044 2262 gene locus_tag LOCUS_31690 2044 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 3585 3310 gene locus_tag LOCUS_31700 3585 3310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 3648 4262 gene locus_tag LOCUS_31710 3648 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 4547 4248 gene locus_tag LOCUS_31720 4547 4248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 4936 4715 gene locus_tag LOCUS_31730 4936 4715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 5147 5647 gene locus_tag LOCUS_31740 5147 5647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 6859 5651 gene locus_tag LOCUS_31750 6859 5651 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938819.1 protein_id gnl|my_center|LOCUS_31750 7091 7016 gene locus_tag LOCUS_t00420 7091 7016 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 7441 7103 gene locus_tag LOCUS_31760 7441 7103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 7353 7616 gene locus_tag LOCUS_31770 7353 7616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 7797 10127 gene locus_tag LOCUS_31780 gene fyuA 7797 10127 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036376.1 protein_id gnl|my_center|LOCUS_31780 12288 10216 gene locus_tag LOCUS_31790 12288 10216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 13486 12407 gene locus_tag LOCUS_31800 gene rnD 13486 12407 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8D6 protein_id gnl|my_center|LOCUS_31800 13571 15457 gene locus_tag LOCUS_31810 13571 15457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637660.2 protein_id gnl|my_center|LOCUS_31810 15508 16443 gene locus_tag LOCUS_31820 15508 16443 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390203.1 protein_id gnl|my_center|LOCUS_31820 18294 16963 gene locus_tag LOCUS_31830 gene xseA 18294 16963 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8D9 protein_id gnl|my_center|LOCUS_31830 19415 18339 gene locus_tag LOCUS_31840 gene queG 19415 18339 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8E0 protein_id gnl|my_center|LOCUS_31840 19433 20917 gene locus_tag LOCUS_31850 19433 20917 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8E1 protein_id gnl|my_center|LOCUS_31850 20914 21396 gene locus_tag LOCUS_31860 20914 21396 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037444.1 protein_id gnl|my_center|LOCUS_31860 21479 23041 gene locus_tag LOCUS_31870 gene amiC 21479 23041 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037443.1 protein_id gnl|my_center|LOCUS_31870 23163 25067 gene locus_tag LOCUS_31880 gene mutL 23163 25067 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8E4 protein_id gnl|my_center|LOCUS_31880 25079 26008 gene locus_tag LOCUS_31890 25079 26008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037441.1 protein_id gnl|my_center|LOCUS_31890 26010 26972 gene locus_tag LOCUS_31900 26010 26972 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037440.1 protein_id gnl|my_center|LOCUS_31900 27704 27048 gene locus_tag LOCUS_31910 27704 27048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637650.2 protein_id gnl|my_center|LOCUS_31910 28517 27777 gene locus_tag LOCUS_31920 gene phbB 28517 27777 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037438.1 protein_id gnl|my_center|LOCUS_31920 29455 28535 gene locus_tag LOCUS_31930 gene gluQ 29455 28535 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8E9 protein_id gnl|my_center|LOCUS_31930 29549 30415 gene locus_tag LOCUS_31940 gene htpX 29549 30415 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8F0 protein_id gnl|my_center|LOCUS_31940 31799 30972 gene locus_tag LOCUS_31950 gene suhB 31799 30972 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037421.1 protein_id gnl|my_center|LOCUS_31950 31920 32690 gene locus_tag LOCUS_31960 gene trmJ 31920 32690 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8G5 protein_id gnl|my_center|LOCUS_31960 32767 33669 gene locus_tag LOCUS_31970 32767 33669 CDS product phosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037419.1 protein_id gnl|my_center|LOCUS_31970 33666 35792 gene locus_tag LOCUS_31980 33666 35792 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037418.1 protein_id gnl|my_center|LOCUS_31980 36926 35910 gene locus_tag LOCUS_31990 36926 35910 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037417.1 protein_id gnl|my_center|LOCUS_31990 37047 37613 gene locus_tag LOCUS_32000 gene efp 37047 37613 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8G9 protein_id gnl|my_center|LOCUS_32000 37814 39157 gene locus_tag LOCUS_32010 37814 39157 CDS product N-ethylammeline chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037414.1 protein_id gnl|my_center|LOCUS_32010 39183 39899 gene locus_tag LOCUS_32020 gene ubiG 39183 39899 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8H2 protein_id gnl|my_center|LOCUS_32020 39896 40591 gene locus_tag LOCUS_32030 gene gph 39896 40591 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8H3 protein_id gnl|my_center|LOCUS_32030 40603 41307 gene locus_tag LOCUS_32040 40603 41307 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037411.1 protein_id gnl|my_center|LOCUS_32040 42244 41396 gene locus_tag LOCUS_32050 42244 41396 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037402.1 protein_id gnl|my_center|LOCUS_32050 43590 42244 gene locus_tag LOCUS_32060 gene pyrC 43590 42244 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8I4 protein_id gnl|my_center|LOCUS_32060 43846 43592 gene locus_tag LOCUS_32070 43846 43592 CDS product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8I5 protein_id gnl|my_center|LOCUS_32070 44119 45348 gene locus_tag LOCUS_32080 44119 45348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 46965 45718 gene locus_tag LOCUS_32090 gene tetV 46965 45718 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037397.1 protein_id gnl|my_center|LOCUS_32090 47414 46962 gene locus_tag LOCUS_32100 47414 46962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037396.1 protein_id gnl|my_center|LOCUS_32100 48845 47469 gene locus_tag LOCUS_32110 gene cysS 48845 47469 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8J0 protein_id gnl|my_center|LOCUS_32110 49032 49595 gene locus_tag LOCUS_32120 49032 49595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037394.1 protein_id gnl|my_center|LOCUS_32120 49915 50925 gene locus_tag LOCUS_32130 gene argF' 49915 50925 CDS product N-acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8J2 protein_id gnl|my_center|LOCUS_32130 51044 52240 gene locus_tag LOCUS_32140 gene argG 51044 52240 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8J4 protein_id gnl|my_center|LOCUS_32140 52328 53416 gene locus_tag LOCUS_32150 gene argE 52328 53416 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037390.1 protein_id gnl|my_center|LOCUS_32150 53442 54770 gene locus_tag LOCUS_32160 gene argB 53442 54770 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8J6 protein_id gnl|my_center|LOCUS_32160 54774 55376 gene locus_tag LOCUS_32170 gene argA 54774 55376 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037388.1 protein_id gnl|my_center|LOCUS_32170 55373 56326 gene locus_tag LOCUS_32180 gene argC 55373 56326 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8J8 protein_id gnl|my_center|LOCUS_32180 56347 57642 gene locus_tag LOCUS_32190 gene argH 56347 57642 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8J9 protein_id gnl|my_center|LOCUS_32190 57642 57905 gene locus_tag LOCUS_32200 57642 57905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037384.1 protein_id gnl|my_center|LOCUS_32200 57917 59074 gene locus_tag LOCUS_32210 gene proB 57917 59074 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8K2 protein_id gnl|my_center|LOCUS_32210 59071 60342 gene locus_tag LOCUS_32220 gene proA 59071 60342 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8K3 protein_id gnl|my_center|LOCUS_32220 60985 60515 gene locus_tag LOCUS_32230 60985 60515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 62238 60982 gene locus_tag LOCUS_32240 gene hmsR 62238 60982 CDS product poly-beta-1,6 N-acetyl-D-glucosamine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164390.1 protein_id gnl|my_center|LOCUS_32240 64126 62240 gene locus_tag LOCUS_32250 gene hmsF 64126 62240 CDS product poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064163.1 protein_id gnl|my_center|LOCUS_32250 66155 64128 gene locus_tag LOCUS_32260 gene hmsH 66155 64128 CDS product poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816569.1 protein_id gnl|my_center|LOCUS_32260 67708 66503 gene locus_tag LOCUS_32270 gene cynX 67708 66503 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037380.1 protein_id gnl|my_center|LOCUS_32270 >Feature sequence29 2522 1542 gene locus_tag LOCUS_32280 2522 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 3209 3397 gene locus_tag LOCUS_32290 3209 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 3503 4048 gene locus_tag LOCUS_32300 3503 4048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 4045 4521 gene locus_tag LOCUS_32310 4045 4521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 4545 5576 gene locus_tag LOCUS_32320 4545 5576 CDS product membrane fimbriae assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521659.1 protein_id gnl|my_center|LOCUS_32320 5595 6953 gene locus_tag LOCUS_32330 5595 6953 CDS product exported fimbriae assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192085.1 protein_id gnl|my_center|LOCUS_32330 7026 8237 gene locus_tag LOCUS_32340 7026 8237 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193624.1 protein_id gnl|my_center|LOCUS_32340 8222 9571 gene locus_tag LOCUS_32350 8222 9571 CDS product type II/IV secretion system ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521658.1 protein_id gnl|my_center|LOCUS_32350 9574 10530 gene locus_tag LOCUS_32360 9574 10530 CDS product type II secretion protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810181.1 protein_id gnl|my_center|LOCUS_32360 10559 11494 gene locus_tag LOCUS_32370 10559 11494 CDS product type II secretion protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810184.1 protein_id gnl|my_center|LOCUS_32370 11494 12375 gene locus_tag LOCUS_32380 11494 12375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 12372 12842 gene locus_tag LOCUS_32390 12372 12842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 12851 15004 gene locus_tag LOCUS_32400 12851 15004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810187.1 protein_id gnl|my_center|LOCUS_32400 15158 15817 gene locus_tag LOCUS_32410 15158 15817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 16270 15884 gene locus_tag LOCUS_32420 16270 15884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 16457 17281 gene locus_tag LOCUS_32430 gene cpo 16457 17281 CDS product non-heme chloroperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037318.1 protein_id gnl|my_center|LOCUS_32430 18984 17404 gene locus_tag LOCUS_32440 gene tetV 18984 17404 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037320.1 protein_id gnl|my_center|LOCUS_32440 20330 19047 gene locus_tag LOCUS_32450 20330 19047 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941467.1 protein_id gnl|my_center|LOCUS_32450 22279 20309 gene locus_tag LOCUS_32460 22279 20309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637531.2 protein_id gnl|my_center|LOCUS_32460 22701 22276 gene locus_tag LOCUS_32470 22701 22276 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037322.1 protein_id gnl|my_center|LOCUS_32470 22862 22704 gene locus_tag LOCUS_32480 22862 22704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32480 23359 22859 gene locus_tag LOCUS_32490 23359 22859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32490 23772 23356 gene locus_tag LOCUS_32500 23772 23356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 24182 23850 gene locus_tag LOCUS_32510 24182 23850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 24288 27308 gene locus_tag LOCUS_32520 24288 27308 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037325.1 protein_id gnl|my_center|LOCUS_32520 27301 27954 gene locus_tag LOCUS_32530 27301 27954 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037326.1 protein_id gnl|my_center|LOCUS_32530 29545 28088 gene locus_tag LOCUS_32540 29545 28088 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_32540 30298 29597 gene locus_tag LOCUS_32550 30298 29597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067763.1 protein_id gnl|my_center|LOCUS_32550 30421 31302 gene locus_tag LOCUS_32560 30421 31302 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112482.1 protein_id gnl|my_center|LOCUS_32560 31435 31872 gene locus_tag LOCUS_32570 31435 31872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 33077 31917 gene locus_tag LOCUS_32580 33077 31917 CDS product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086627.1 protein_id gnl|my_center|LOCUS_32580 33263 33904 gene locus_tag LOCUS_32590 33263 33904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974912.1 protein_id gnl|my_center|LOCUS_32590 36713 33987 gene locus_tag LOCUS_32600 36713 33987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895598.1 protein_id gnl|my_center|LOCUS_32600 36926 37525 gene locus_tag LOCUS_32610 36926 37525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 38295 37522 gene locus_tag LOCUS_32620 gene cdh 38295 37522 CDS product CDP-diacylglycerol diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036871.1 protein_id gnl|my_center|LOCUS_32620 39086 38469 gene locus_tag LOCUS_32630 39086 38469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 39819 39220 gene locus_tag LOCUS_32640 39819 39220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 41655 39823 gene locus_tag LOCUS_32650 41655 39823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 42232 41741 gene locus_tag LOCUS_32660 42232 41741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 42842 42357 gene locus_tag LOCUS_32670 42842 42357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 43447 42968 gene locus_tag LOCUS_32680 43447 42968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 44339 43458 gene locus_tag LOCUS_32690 44339 43458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 47122 44339 gene locus_tag LOCUS_32700 47122 44339 CDS product type IV secretion protein Rhs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196687.1 protein_id gnl|my_center|LOCUS_32700 47357 48415 gene locus_tag LOCUS_32710 47357 48415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549922.1 protein_id gnl|my_center|LOCUS_32710 49240 48461 gene locus_tag LOCUS_32720 49240 48461 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205261.1 protein_id gnl|my_center|LOCUS_32720 50226 49243 gene locus_tag LOCUS_32730 50226 49243 CDS product type VI secretion-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200003.1 protein_id gnl|my_center|LOCUS_32730 53930 50223 gene locus_tag LOCUS_32740 53930 50223 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206361.1 protein_id gnl|my_center|LOCUS_32740 55382 53946 gene locus_tag LOCUS_32750 55382 53946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 55685 55425 gene locus_tag LOCUS_32760 55685 55425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193592.1 protein_id gnl|my_center|LOCUS_32760 56669 55788 gene locus_tag LOCUS_32770 56669 55788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 56744 57628 gene locus_tag LOCUS_32780 56744 57628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 58642 57668 gene locus_tag LOCUS_32790 58642 57668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 59764 58718 gene locus_tag LOCUS_32800 59764 58718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 59942 59799 gene locus_tag LOCUS_32810 59942 59799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 60010 61059 gene locus_tag LOCUS_32820 60010 61059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 62301 61462 gene locus_tag LOCUS_32830 62301 61462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 63964 62915 gene locus_tag LOCUS_32840 63964 62915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 66709 63968 gene locus_tag LOCUS_32850 66709 63968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205114.1 protein_id gnl|my_center|LOCUS_32850 67553 66702 gene locus_tag LOCUS_32860 67553 66702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526759.1 protein_id gnl|my_center|LOCUS_32860 >Feature sequence30 <1 1126 gene locus_tag LOCUS_32870 <1 1126 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_638835.2:multidrug resistance efflux pump 1726 1235 gene locus_tag LOCUS_32880 1726 1235 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037815.1 protein_id gnl|my_center|LOCUS_32880 3164 1761 gene locus_tag LOCUS_32890 gene gltX 3164 1761 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7C5 protein_id gnl|my_center|LOCUS_32890 4871 3258 gene locus_tag LOCUS_32900 4871 3258 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073369.1 protein_id gnl|my_center|LOCUS_32900 5478 5068 gene locus_tag LOCUS_32910 5478 5068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 6808 5489 gene locus_tag LOCUS_32920 gene creD 6808 5489 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037822.1 protein_id gnl|my_center|LOCUS_32920 8350 6890 gene locus_tag LOCUS_32930 gene creC 8350 6890 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037824.1 protein_id gnl|my_center|LOCUS_32930 9079 8354 gene locus_tag LOCUS_32940 gene creB 9079 8354 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037825.1 protein_id gnl|my_center|LOCUS_32940 9115 9972 gene locus_tag LOCUS_32950 gene rlmJ 9115 9972 CDS product ribosomal RNA large subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7B5 protein_id gnl|my_center|LOCUS_32950 10068 10613 gene locus_tag LOCUS_32960 10068 10613 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037827.1 protein_id gnl|my_center|LOCUS_32960 10824 14288 gene locus_tag LOCUS_32970 gene mfd 10824 14288 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7B3 protein_id gnl|my_center|LOCUS_32970 14339 14950 gene locus_tag LOCUS_32980 14339 14950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813001.1 protein_id gnl|my_center|LOCUS_32980 17307 15139 gene locus_tag LOCUS_32990 17307 15139 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037840.1 protein_id gnl|my_center|LOCUS_32990 18200 17451 gene locus_tag LOCUS_33000 gene gpmA 18200 17451 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7A1 protein_id gnl|my_center|LOCUS_33000 18304 18969 gene locus_tag LOCUS_33010 gene nfi 18304 18969 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7A0 protein_id gnl|my_center|LOCUS_33010 19987 19007 gene locus_tag LOCUS_33020 gene czcD 19987 19007 CDS product cation diffusion facilitator transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036459.1 protein_id gnl|my_center|LOCUS_33020 19946 20197 gene locus_tag LOCUS_33030 19946 20197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 22416 20167 gene locus_tag LOCUS_33040 gene pirA 22416 20167 CDS product outer membrane receptor FepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112590.1 protein_id gnl|my_center|LOCUS_33040 22674 24116 gene locus_tag LOCUS_33050 22674 24116 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931513.1 protein_id gnl|my_center|LOCUS_33050 25324 24119 gene locus_tag LOCUS_33060 25324 24119 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039766.1 protein_id gnl|my_center|LOCUS_33060 25403 25852 gene locus_tag LOCUS_33070 25403 25852 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926470.1 protein_id gnl|my_center|LOCUS_33070 25926 27044 gene locus_tag LOCUS_33080 25926 27044 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073324.1 protein_id gnl|my_center|LOCUS_33080 27177 27860 gene locus_tag LOCUS_33090 27177 27860 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526208.1 protein_id gnl|my_center|LOCUS_33090 27857 29236 gene locus_tag LOCUS_33100 27857 29236 CDS product two-component system sensor kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526207.1 protein_id gnl|my_center|LOCUS_33100 29262 30152 gene locus_tag LOCUS_33110 29262 30152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204045.1 protein_id gnl|my_center|LOCUS_33110 30154 30513 gene locus_tag LOCUS_33120 30154 30513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 30510 30908 gene locus_tag LOCUS_33130 30510 30908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 30919 32127 gene locus_tag LOCUS_33140 30919 32127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 32296 33012 gene locus_tag LOCUS_33150 32296 33012 CDS product 2,3-diketo-5-methylthio-1-phosphopentane phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816647.1 protein_id gnl|my_center|LOCUS_33150 33078 34478 gene locus_tag LOCUS_33160 33078 34478 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251051.1 protein_id gnl|my_center|LOCUS_33160 34507 35571 gene locus_tag LOCUS_33170 34507 35571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 35575 36459 gene locus_tag LOCUS_33180 35575 36459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 36633 36992 gene locus_tag LOCUS_33190 36633 36992 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706716.1 protein_id gnl|my_center|LOCUS_33190 37061 37273 gene locus_tag LOCUS_33200 37061 37273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 37275 38063 gene locus_tag LOCUS_33210 gene map 37275 38063 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I095 protein_id gnl|my_center|LOCUS_33210 38674 38060 gene locus_tag LOCUS_33220 gene yggA 38674 38060 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038077.1 protein_id gnl|my_center|LOCUS_33220 38780 39673 gene locus_tag LOCUS_33230 38780 39673 CDS product chromosome replication initiation inhibitor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038078.1 protein_id gnl|my_center|LOCUS_33230 39779 41158 gene locus_tag LOCUS_33240 39779 41158 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707258.1 protein_id gnl|my_center|LOCUS_33240 41151 42164 gene locus_tag LOCUS_33250 41151 42164 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073793.1 protein_id gnl|my_center|LOCUS_33250 42149 43336 gene locus_tag LOCUS_33260 42149 43336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 43333 44460 gene locus_tag LOCUS_33270 gene ybhR 43333 44460 CDS product multidrug ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207409.1 protein_id gnl|my_center|LOCUS_33270 44939 44577 gene locus_tag LOCUS_33280 44939 44577 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038539.1 protein_id gnl|my_center|LOCUS_33280 47352 45112 gene locus_tag LOCUS_33290 gene tsr 47352 45112 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037053.1 protein_id gnl|my_center|LOCUS_33290 48065 47517 gene locus_tag LOCUS_33300 48065 47517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 48543 48196 gene locus_tag LOCUS_33310 48543 48196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 48784 49176 gene locus_tag LOCUS_33320 48784 49176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 49771 50526 gene locus_tag LOCUS_33330 49771 50526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 50628 52283 gene locus_tag LOCUS_33340 50628 52283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 52415 52897 gene locus_tag LOCUS_33350 52415 52897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 56001 53074 gene locus_tag LOCUS_33360 56001 53074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 57974 56064 gene locus_tag LOCUS_33370 57974 56064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 59034 57952 gene locus_tag LOCUS_33380 59034 57952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 59295 59173 gene locus_tag LOCUS_33390 59295 59173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 60250 59549 gene locus_tag LOCUS_33400 60250 59549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 63177 60250 gene locus_tag LOCUS_33410 63177 60250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 63794 63174 gene locus_tag LOCUS_33420 63794 63174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 65056 63857 gene locus_tag LOCUS_33430 65056 63857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 65737 65123 gene locus_tag LOCUS_33440 65737 65123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 66217 65771 gene locus_tag LOCUS_33450 66217 65771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 >Feature sequence31 52 261 gene locus_tag LOCUS_33460 52 261 CDS product DUF1656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039232.1 protein_id gnl|my_center|LOCUS_33460 258 1175 gene locus_tag LOCUS_33470 gene fusE 258 1175 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039233.1 protein_id gnl|my_center|LOCUS_33470 1172 2641 gene locus_tag LOCUS_33480 gene nodT 1172 2641 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039234.1 protein_id gnl|my_center|LOCUS_33480 2645 4684 gene locus_tag LOCUS_33490 2645 4684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 4746 5141 gene locus_tag LOCUS_33500 4746 5141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 7119 5239 gene locus_tag LOCUS_33510 gene recD 7119 5239 CDS product RecBCD enzyme subunit RecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P380 protein_id gnl|my_center|LOCUS_33510 10796 7116 gene locus_tag LOCUS_33520 gene recB 10796 7116 CDS product RecBCD enzyme subunit RecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P379 protein_id gnl|my_center|LOCUS_33520 14140 10793 gene locus_tag LOCUS_33530 gene recC 14140 10793 CDS product RecBCD enzyme subunit RecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P378 protein_id gnl|my_center|LOCUS_33530 14321 15118 gene locus_tag LOCUS_33540 gene yrbF 14321 15118 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039268.1 protein_id gnl|my_center|LOCUS_33540 15118 15867 gene locus_tag LOCUS_33550 gene yrbE 15118 15867 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039269.1 protein_id gnl|my_center|LOCUS_33550 15927 16451 gene locus_tag LOCUS_33560 gene yrbD 15927 16451 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039270.1 protein_id gnl|my_center|LOCUS_33560 16448 17110 gene locus_tag LOCUS_33570 gene yrbC 16448 17110 CDS product organic solvent ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039271.1 protein_id gnl|my_center|LOCUS_33570 17100 17411 gene locus_tag LOCUS_33580 17100 17411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039272.1 protein_id gnl|my_center|LOCUS_33580 17413 18429 gene locus_tag LOCUS_33590 gene vacJ 17413 18429 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039273.1 protein_id gnl|my_center|LOCUS_33590 24918 18559 gene locus_tag LOCUS_33600 24918 18559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 25212 25751 gene locus_tag LOCUS_33610 25212 25751 CDS product microcystin dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039263.1 protein_id gnl|my_center|LOCUS_33610 25806 26336 gene locus_tag LOCUS_33620 25806 26336 CDS product microcystin dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039264.1 protein_id gnl|my_center|LOCUS_33620 26368 26901 gene locus_tag LOCUS_33630 26368 26901 CDS product microcystin dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039265.1 protein_id gnl|my_center|LOCUS_33630 26898 27449 gene locus_tag LOCUS_33640 26898 27449 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039266.1 protein_id gnl|my_center|LOCUS_33640 27756 27466 gene locus_tag LOCUS_33650 27756 27466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639540.2 protein_id gnl|my_center|LOCUS_33650 28450 27905 gene locus_tag LOCUS_33660 gene btuE 28450 27905 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P365 protein_id gnl|my_center|LOCUS_33660 28935 28537 gene locus_tag LOCUS_33670 28935 28537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 30563 29007 gene locus_tag LOCUS_33680 30563 29007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639549.2 protein_id gnl|my_center|LOCUS_33680 30608 31213 gene locus_tag LOCUS_33690 30608 31213 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096819.1 protein_id gnl|my_center|LOCUS_33690 32247 31240 gene locus_tag LOCUS_33700 32247 31240 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039277.1 protein_id gnl|my_center|LOCUS_33700 32345 33310 gene locus_tag LOCUS_33710 32345 33310 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039278.1 protein_id gnl|my_center|LOCUS_33710 33326 33955 gene locus_tag LOCUS_33720 33326 33955 CDS product leucine efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192135.1 protein_id gnl|my_center|LOCUS_33720 34200 35627 gene locus_tag LOCUS_33730 gene yhdG 34200 35627 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039281.1 protein_id gnl|my_center|LOCUS_33730 36962 35721 gene locus_tag LOCUS_33740 36962 35721 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039289.1 protein_id gnl|my_center|LOCUS_33740 37472 37170 gene locus_tag LOCUS_33750 37472 37170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 38213 37533 gene locus_tag LOCUS_33760 38213 37533 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198318.1 protein_id gnl|my_center|LOCUS_33760 39443 38274 gene locus_tag LOCUS_33770 39443 38274 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039292.1 protein_id gnl|my_center|LOCUS_33770 39734 40696 gene locus_tag LOCUS_33780 gene ygjT 39734 40696 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039293.1 protein_id gnl|my_center|LOCUS_33780 40803 41573 gene locus_tag LOCUS_33790 40803 41573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639567.2 protein_id gnl|my_center|LOCUS_33790 42774 41668 gene locus_tag LOCUS_33800 gene glpQ 42774 41668 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039295.1 protein_id gnl|my_center|LOCUS_33800 44319 42970 gene locus_tag LOCUS_33810 gene mnmE 44319 42970 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P340 protein_id gnl|my_center|LOCUS_33810 46995 44323 gene locus_tag LOCUS_33820 46995 44323 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639573.2 protein_id gnl|my_center|LOCUS_33820 48826 47111 gene locus_tag LOCUS_33830 gene yidC 48826 47111 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P338 protein_id gnl|my_center|LOCUS_33830 49320 48826 gene locus_tag LOCUS_33840 gene rnpA 49320 48826 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P337 protein_id gnl|my_center|LOCUS_33840 49466 49326 gene locus_tag LOCUS_33850 gene rpmH 49466 49326 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66262 protein_id gnl|my_center|LOCUS_33850 49716 51053 gene locus_tag LOCUS_33860 gene dnaA 49716 51053 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PEH5 protein_id gnl|my_center|LOCUS_33860 51329 52429 gene locus_tag LOCUS_33870 gene dnaN 51329 52429 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PEH4 protein_id gnl|my_center|LOCUS_33870 53371 54465 gene locus_tag LOCUS_33880 gene recF 53371 54465 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PEH3 protein_id gnl|my_center|LOCUS_33880 54578 57037 gene locus_tag LOCUS_33890 gene gyrB 54578 57037 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PEH2 protein_id gnl|my_center|LOCUS_33890 57105 57950 gene locus_tag LOCUS_33900 57105 57950 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035263.1 protein_id gnl|my_center|LOCUS_33900 58022 58828 gene locus_tag LOCUS_33910 58022 58828 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035264.1 protein_id gnl|my_center|LOCUS_33910 58961 60151 gene locus_tag LOCUS_33920 58961 60151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035265.1 protein_id gnl|my_center|LOCUS_33920 >Feature sequence32 1202 897 gene locus_tag LOCUS_33930 1202 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038887.1 protein_id gnl|my_center|LOCUS_33930 1583 1272 gene locus_tag LOCUS_33940 1583 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038887.1 protein_id gnl|my_center|LOCUS_33940 2807 1686 gene locus_tag LOCUS_33950 2807 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_33950 3521 2871 gene locus_tag LOCUS_33960 3521 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267038.1 protein_id gnl|my_center|LOCUS_33960 4012 3605 gene locus_tag LOCUS_33970 4012 3605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 4802 4104 gene locus_tag LOCUS_33980 4802 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038889.1 protein_id gnl|my_center|LOCUS_33980 5771 4857 gene locus_tag LOCUS_33990 5771 4857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 6963 6151 gene locus_tag LOCUS_34000 6963 6151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038891.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34000 7522 7244 gene locus_tag LOCUS_34010 7522 7244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 8354 7617 gene locus_tag LOCUS_34020 8354 7617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038892.1 protein_id gnl|my_center|LOCUS_34020 8959 8567 gene locus_tag LOCUS_34030 8959 8567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34030 9193 8981 gene locus_tag LOCUS_34040 9193 8981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958171.1 protein_id gnl|my_center|LOCUS_34040 9769 9524 gene locus_tag LOCUS_34050 9769 9524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 12305 10293 gene locus_tag LOCUS_34060 12305 10293 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038895.1 protein_id gnl|my_center|LOCUS_34060 13015 12575 gene locus_tag LOCUS_34070 13015 12575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34070 13616 13089 gene locus_tag LOCUS_34080 13616 13089 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895541.1 protein_id gnl|my_center|LOCUS_34080 14413 13613 gene locus_tag LOCUS_34090 14413 13613 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038897.1 protein_id gnl|my_center|LOCUS_34090 15975 14731 gene locus_tag LOCUS_34100 15975 14731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34100 16539 15979 gene locus_tag LOCUS_34110 16539 15979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 18183 16555 gene locus_tag LOCUS_34120 18183 16555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038900.1 protein_id gnl|my_center|LOCUS_34120 18424 18176 gene locus_tag LOCUS_34130 18424 18176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 19283 18408 gene locus_tag LOCUS_34140 19283 18408 CDS product chromosome partitioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038901.1 protein_id gnl|my_center|LOCUS_34140 19538 19326 gene locus_tag LOCUS_34150 19538 19326 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002346894.2 protein_id gnl|my_center|LOCUS_34150 20412 19657 gene locus_tag LOCUS_34160 20412 19657 CDS product receptor protein-tyrosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038902.1 protein_id gnl|my_center|LOCUS_34160 22905 20977 gene locus_tag LOCUS_34170 gene intS 22905 20977 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038254.1 protein_id gnl|my_center|LOCUS_34170 23220 23147 gene locus_tag LOCUS_t00430 23220 23147 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 25186 23351 gene locus_tag LOCUS_34180 gene estA 25186 23351 CDS product lipase/esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038255.1 protein_id gnl|my_center|LOCUS_34180 25394 25594 gene locus_tag LOCUS_34190 25394 25594 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038256.1 protein_id gnl|my_center|LOCUS_34190 25727 26521 gene locus_tag LOCUS_34200 gene thiG 25727 26521 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P632 protein_id gnl|my_center|LOCUS_34200 26521 27255 gene locus_tag LOCUS_34210 gene trmB 26521 27255 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P631 protein_id gnl|my_center|LOCUS_34210 27283 29130 gene locus_tag LOCUS_34220 gene sac1 27283 29130 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038259.1 protein_id gnl|my_center|LOCUS_34220 29738 29403 gene locus_tag LOCUS_34230 29738 29403 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038260.1 protein_id gnl|my_center|LOCUS_34230 29860 30198 gene locus_tag LOCUS_34240 29860 30198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038261.1 protein_id gnl|my_center|LOCUS_34240 30274 30990 gene locus_tag LOCUS_34250 30274 30990 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038262.1 protein_id gnl|my_center|LOCUS_34250 31046 31450 gene locus_tag LOCUS_34260 gene mscL 31046 31450 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P626 protein_id gnl|my_center|LOCUS_34260 31676 33097 gene locus_tag LOCUS_34270 31676 33097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 34694 33243 gene locus_tag LOCUS_34280 gene alsT 34694 33243 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387166.1 protein_id gnl|my_center|LOCUS_34280 35163 34705 gene locus_tag LOCUS_34290 35163 34705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 36749 35913 gene locus_tag LOCUS_34300 36749 35913 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038272.1 protein_id gnl|my_center|LOCUS_34300 38258 36750 gene locus_tag LOCUS_34310 38258 36750 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038273.1 protein_id gnl|my_center|LOCUS_34310 38908 38369 gene locus_tag LOCUS_34320 38908 38369 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038274.1 protein_id gnl|my_center|LOCUS_34320 42026 38901 gene locus_tag LOCUS_34330 gene acrF 42026 38901 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038276.1 protein_id gnl|my_center|LOCUS_34330 43129 42023 gene locus_tag LOCUS_34340 43129 42023 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038277.1 protein_id gnl|my_center|LOCUS_34340 45408 43345 gene locus_tag LOCUS_34350 gene oprC 45408 43345 CDS product copper transporter porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119294.1 protein_id gnl|my_center|LOCUS_34350 45912 45481 gene locus_tag LOCUS_34360 45912 45481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 47568 46585 gene locus_tag LOCUS_34370 gene cysB 47568 46585 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038287.1 protein_id gnl|my_center|LOCUS_34370 47777 48736 gene locus_tag LOCUS_34380 gene cysK 47777 48736 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P600 protein_id gnl|my_center|LOCUS_34380 48948 49547 gene locus_tag LOCUS_34390 48948 49547 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5Z8 protein_id gnl|my_center|LOCUS_34390 50782 49640 gene locus_tag LOCUS_34400 50782 49640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 51916 50912 gene locus_tag LOCUS_34410 51916 50912 CDS product putative fructose-bisphosphate aldolase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5Z7 protein_id gnl|my_center|LOCUS_34410 53580 52114 gene locus_tag LOCUS_34420 gene pykA 53580 52114 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5Z6 protein_id gnl|my_center|LOCUS_34420 54408 53755 gene locus_tag LOCUS_34430 gene idgB 54408 53755 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038294.1 protein_id gnl|my_center|LOCUS_34430 55580 54405 gene locus_tag LOCUS_34440 gene pgk 55580 54405 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5Z4 protein_id gnl|my_center|LOCUS_34440 >Feature sequence33 1720 80 gene locus_tag LOCUS_34450 1720 80 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532998.1 protein_id gnl|my_center|LOCUS_34450 3169 1784 gene locus_tag LOCUS_34460 3169 1784 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762699.1 protein_id gnl|my_center|LOCUS_34460 4662 3883 gene locus_tag LOCUS_34470 4662 3883 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530905.1 protein_id gnl|my_center|LOCUS_34470 5637 4711 gene locus_tag LOCUS_34480 gene prfB 5637 4711 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9K7 protein_id gnl|my_center|LOCUS_34480 5974 5759 gene locus_tag LOCUS_34490 5974 5759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 6025 6765 gene locus_tag LOCUS_34500 6025 6765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112931.1 protein_id gnl|my_center|LOCUS_34500 7701 6799 gene locus_tag LOCUS_34510 gene rpfD 7701 6799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037021.1 protein_id gnl|my_center|LOCUS_34510 7838 9046 gene locus_tag LOCUS_34520 7838 9046 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037018.1 protein_id gnl|my_center|LOCUS_34520 9056 10042 gene locus_tag LOCUS_34530 9056 10042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 13022 10104 gene locus_tag LOCUS_34540 13022 10104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 13792 13205 gene locus_tag LOCUS_34550 13792 13205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 14499 14110 gene locus_tag LOCUS_34560 14499 14110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 19003 14507 gene locus_tag LOCUS_34570 19003 14507 CDS product type IV secretion protein Rhs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705805.1 protein_id gnl|my_center|LOCUS_34570 19151 19023 gene locus_tag LOCUS_34580 19151 19023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 19858 19148 gene locus_tag LOCUS_34590 19858 19148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 20943 19858 gene locus_tag LOCUS_34600 20943 19858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 21172 22221 gene locus_tag LOCUS_34610 gene rpfI 21172 22221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037017.1 protein_id gnl|my_center|LOCUS_34610 24063 22306 gene locus_tag LOCUS_34620 gene recJ 24063 22306 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037016.1 protein_id gnl|my_center|LOCUS_34620 25141 24224 gene locus_tag LOCUS_34630 gene rpfE 25141 24224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037015.1 protein_id gnl|my_center|LOCUS_34630 25622 25146 gene locus_tag LOCUS_34640 gene greA 25622 25146 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L4D3 protein_id gnl|my_center|LOCUS_34640 28861 25619 gene locus_tag LOCUS_34650 gene carB 28861 25619 CDS product carbamoyl-phosphate synthase large chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58943 protein_id gnl|my_center|LOCUS_34650 30138 29011 gene locus_tag LOCUS_34660 gene carA 30138 29011 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58896 protein_id gnl|my_center|LOCUS_34660 31167 30448 gene locus_tag LOCUS_34670 gene dapB 31167 30448 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9L3 protein_id gnl|my_center|LOCUS_34670 31258 32019 gene locus_tag LOCUS_34680 31258 32019 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803832.1 protein_id gnl|my_center|LOCUS_34680 32024 32227 gene locus_tag LOCUS_34690 32024 32227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 32436 32230 gene locus_tag LOCUS_34700 32436 32230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 32531 32992 gene locus_tag LOCUS_34710 32531 32992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 33342 33097 gene locus_tag LOCUS_34720 33342 33097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037006.1 protein_id gnl|my_center|LOCUS_34720 35207 33342 gene locus_tag LOCUS_34730 gene feoB 35207 33342 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037005.1 protein_id gnl|my_center|LOCUS_34730 35458 35204 gene locus_tag LOCUS_34740 gene feoA 35458 35204 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037004.1 protein_id gnl|my_center|LOCUS_34740 35578 36366 gene locus_tag LOCUS_34750 35578 36366 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037003.1 protein_id gnl|my_center|LOCUS_34750 36369 36770 gene locus_tag LOCUS_34760 36369 36770 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083350.1 protein_id gnl|my_center|LOCUS_34760 36767 37663 gene locus_tag LOCUS_34770 gene mvaB 36767 37663 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037002.1 protein_id gnl|my_center|LOCUS_34770 37764 38534 gene locus_tag LOCUS_34780 gene hadH2 37764 38534 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037001.1 protein_id gnl|my_center|LOCUS_34780 38583 39149 gene locus_tag LOCUS_34790 38583 39149 CDS product elongation factor P-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9M3 protein_id gnl|my_center|LOCUS_34790 39927 39232 gene locus_tag LOCUS_34800 39927 39232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 40403 40011 gene locus_tag LOCUS_34810 40403 40011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 43533 40384 gene locus_tag LOCUS_34820 43533 40384 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705231.1 protein_id gnl|my_center|LOCUS_34820 44691 43570 gene locus_tag LOCUS_34830 44691 43570 CDS product MexC family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705232.1 protein_id gnl|my_center|LOCUS_34830 44848 45564 gene locus_tag LOCUS_34840 44848 45564 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705233.1 protein_id gnl|my_center|LOCUS_34840 45564 46640 gene locus_tag LOCUS_34850 45564 46640 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705234.1 protein_id gnl|my_center|LOCUS_34850 48414 46618 gene locus_tag LOCUS_34860 48414 46618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036998.1 protein_id gnl|my_center|LOCUS_34860 48754 48455 gene locus_tag LOCUS_34870 48754 48455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 50206 48818 gene locus_tag LOCUS_34880 50206 48818 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036996.1 protein_id gnl|my_center|LOCUS_34880 50376 51617 gene locus_tag LOCUS_34890 gene serA 50376 51617 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036995.1 protein_id gnl|my_center|LOCUS_34890 52297 51728 gene locus_tag LOCUS_34900 52297 51728 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036993.1 protein_id gnl|my_center|LOCUS_34900 52475 53950 gene locus_tag LOCUS_34910 gene yhdG 52475 53950 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036992.1 protein_id gnl|my_center|LOCUS_34910 54033 55460 gene locus_tag LOCUS_34920 gene yhdG 54033 55460 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036991.1 protein_id gnl|my_center|LOCUS_34920 >Feature sequence34 255 698 gene locus_tag LOCUS_34930 255 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 695 2062 gene locus_tag LOCUS_34940 695 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 2055 2261 gene locus_tag LOCUS_34950 2055 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 2258 2842 gene locus_tag LOCUS_34960 2258 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 2839 3159 gene locus_tag LOCUS_34970 2839 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 3156 3386 gene locus_tag LOCUS_34980 3156 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 3406 4611 gene locus_tag LOCUS_34990 gene int 3406 4611 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038129.1 protein_id gnl|my_center|LOCUS_34990 5551 4622 gene locus_tag LOCUS_35000 5551 4622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 5904 5557 gene locus_tag LOCUS_35010 5904 5557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 6160 6084 gene locus_tag LOCUS_t00440 6160 6084 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6276 6200 gene locus_tag LOCUS_t00450 6276 6200 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6457 7215 gene locus_tag LOCUS_35020 6457 7215 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036182.1 protein_id gnl|my_center|LOCUS_35020 8024 7275 gene locus_tag LOCUS_35030 8024 7275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818563.1 protein_id gnl|my_center|LOCUS_35030 8958 8050 gene locus_tag LOCUS_35040 8958 8050 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931482.1 protein_id gnl|my_center|LOCUS_35040 9755 9012 gene locus_tag LOCUS_35050 9755 9012 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096511.1 protein_id gnl|my_center|LOCUS_35050 10962 9958 gene locus_tag LOCUS_35060 gene icd 10962 9958 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036181.1 protein_id gnl|my_center|LOCUS_35060 11677 11285 gene locus_tag LOCUS_35070 11677 11285 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBZ0 protein_id gnl|my_center|LOCUS_35070 11964 11674 gene locus_tag LOCUS_35080 11964 11674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35080 12107 13753 gene locus_tag LOCUS_35090 12107 13753 CDS product putative beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBZ2 protein_id gnl|my_center|LOCUS_35090 13870 14559 gene locus_tag LOCUS_35100 gene phoB 13870 14559 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036177.1 protein_id gnl|my_center|LOCUS_35100 14666 15997 gene locus_tag LOCUS_35110 gene phoR 14666 15997 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036176.1 protein_id gnl|my_center|LOCUS_35110 16002 18089 gene locus_tag LOCUS_35120 gene ppk 16002 18089 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBZ5 protein_id gnl|my_center|LOCUS_35120 18392 19918 gene locus_tag LOCUS_35130 gene ppx 18392 19918 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036174.1 protein_id gnl|my_center|LOCUS_35130 20185 23151 gene locus_tag LOCUS_35140 gene btuB 20185 23151 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038415.1 protein_id gnl|my_center|LOCUS_35140 23309 24454 gene locus_tag LOCUS_35150 gene gtrB 23309 24454 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036173.1 protein_id gnl|my_center|LOCUS_35150 24435 24974 gene locus_tag LOCUS_35160 24435 24974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 25034 25780 gene locus_tag LOCUS_35170 gene lpxH 25034 25780 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58976 protein_id gnl|my_center|LOCUS_35170 27121 25868 gene locus_tag LOCUS_35180 27121 25868 CDS product peptidyl-Asp metalloendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC00 protein_id gnl|my_center|LOCUS_35180 27112 27017 gene locus_tag LOCUS_t00460 27112 27017 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 27347 28804 gene locus_tag LOCUS_35190 27347 28804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104578.1 protein_id gnl|my_center|LOCUS_35190 29693 28872 gene locus_tag LOCUS_35200 29693 28872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036168.1 protein_id gnl|my_center|LOCUS_35200 31172 29706 gene locus_tag LOCUS_35210 gene purF 31172 29706 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC02 protein_id gnl|my_center|LOCUS_35210 31964 31203 gene locus_tag LOCUS_35220 gene cvpA 31964 31203 CDS product colicin V biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036166.1 protein_id gnl|my_center|LOCUS_35220 33063 32008 gene locus_tag LOCUS_35230 33063 32008 CDS product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036165.1 protein_id gnl|my_center|LOCUS_35230 34416 33145 gene locus_tag LOCUS_35240 gene folC 34416 33145 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036164.1 protein_id gnl|my_center|LOCUS_35240 35102 34458 gene locus_tag LOCUS_35250 gene pgmA 35102 34458 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036162.1 protein_id gnl|my_center|LOCUS_35250 37442 35277 gene locus_tag LOCUS_35260 37442 35277 CDS product dipeptidyl peptidase S46 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071328.1 protein_id gnl|my_center|LOCUS_35260 37720 38757 gene locus_tag LOCUS_35270 gene tdh 37720 38757 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34268 protein_id gnl|my_center|LOCUS_35270 39600 38908 gene locus_tag LOCUS_35280 39600 38908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036158.1 protein_id gnl|my_center|LOCUS_35280 39778 41007 gene locus_tag LOCUS_35290 gene kbl 39778 41007 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC15 protein_id gnl|my_center|LOCUS_35290 41465 41130 gene locus_tag LOCUS_35300 41465 41130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 42357 41551 gene locus_tag LOCUS_35310 42357 41551 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC17 protein_id gnl|my_center|LOCUS_35310 42884 42378 gene locus_tag LOCUS_35320 42884 42378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036150.1 protein_id gnl|my_center|LOCUS_35320 44194 43103 gene locus_tag LOCUS_35330 gene mopB 44194 43103 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036149.1 protein_id gnl|my_center|LOCUS_35330 44552 45571 gene locus_tag LOCUS_35340 44552 45571 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036148.1 protein_id gnl|my_center|LOCUS_35340 45757 46314 gene locus_tag LOCUS_35350 45757 46314 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027777.1 protein_id gnl|my_center|LOCUS_35350 46586 48616 gene locus_tag LOCUS_35360 gene fadH 46586 48616 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036147.1 protein_id gnl|my_center|LOCUS_35360 48913 49371 gene locus_tag LOCUS_35370 48913 49371 CDS product cell wall hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036144.1 protein_id gnl|my_center|LOCUS_35370 49456 50067 gene locus_tag LOCUS_35380 gene gst 49456 50067 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039939.1 protein_id gnl|my_center|LOCUS_35380 51189 50134 gene locus_tag LOCUS_35390 51189 50134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 51739 51236 gene locus_tag LOCUS_35400 51739 51236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 53841 51961 gene locus_tag LOCUS_35410 gene prpE 53841 51961 CDS product propionate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813753.1 protein_id gnl|my_center|LOCUS_35410 <54992 54485 gene locus_tag LOCUS_35420 <54992 54485 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J6D8:pseudouridine synthase >Feature sequence35 7 1149 gene locus_tag LOCUS_35430 gene hisC 7 1149 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036751.1 protein_id gnl|my_center|LOCUS_35430 1939 1202 gene locus_tag LOCUS_35440 gene zipA 1939 1202 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAB7 protein_id gnl|my_center|LOCUS_35440 5489 1986 gene locus_tag LOCUS_35450 gene smc 5489 1986 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAB8 protein_id gnl|my_center|LOCUS_35450 6198 5749 gene locus_tag LOCUS_35460 gene rplI 6198 5749 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAC0 protein_id gnl|my_center|LOCUS_35460 6534 6304 gene locus_tag LOCUS_35470 gene rpsR 6534 6304 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAC1 protein_id gnl|my_center|LOCUS_35470 6983 6546 gene locus_tag LOCUS_35480 gene rpsF 6983 6546 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAC2 protein_id gnl|my_center|LOCUS_35480 7543 7205 gene locus_tag LOCUS_35490 7543 7205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036746.1 protein_id gnl|my_center|LOCUS_35490 7672 9066 gene locus_tag LOCUS_35500 gene asnS 7672 9066 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAC4 protein_id gnl|my_center|LOCUS_35500 9097 9396 gene locus_tag LOCUS_35510 9097 9396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036743.1 protein_id gnl|my_center|LOCUS_35510 9402 9716 gene locus_tag LOCUS_35520 9402 9716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036742.1 protein_id gnl|my_center|LOCUS_35520 9724 10362 gene locus_tag LOCUS_35530 gene paiB 9724 10362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036741.1 protein_id gnl|my_center|LOCUS_35530 10435 11097 gene locus_tag LOCUS_35540 gene yadF 10435 11097 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAC9 protein_id gnl|my_center|LOCUS_35540 11117 11638 gene locus_tag LOCUS_35550 gene nbaC 11117 11638 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAD0 protein_id gnl|my_center|LOCUS_35550 11843 13117 gene locus_tag LOCUS_35560 gene kynU 11843 13117 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAD2 protein_id gnl|my_center|LOCUS_35560 13149 14516 gene locus_tag LOCUS_35570 gene kmo 13149 14516 CDS product kynurenine 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAD3 protein_id gnl|my_center|LOCUS_35570 14516 15955 gene locus_tag LOCUS_35580 gene sbcB 14516 15955 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAD4 protein_id gnl|my_center|LOCUS_35580 15952 16638 gene locus_tag LOCUS_35590 15952 16638 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036734.1 protein_id gnl|my_center|LOCUS_35590 16638 17630 gene locus_tag LOCUS_35600 16638 17630 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388814.1 protein_id gnl|my_center|LOCUS_35600 17673 18224 gene locus_tag LOCUS_35610 17673 18224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036733.1 protein_id gnl|my_center|LOCUS_35610 19261 18317 gene locus_tag LOCUS_35620 19261 18317 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036731.1 protein_id gnl|my_center|LOCUS_35620 20082 19309 gene locus_tag LOCUS_35630 gene nadK 20082 19309 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAD9 protein_id gnl|my_center|LOCUS_35630 25225 20318 gene locus_tag LOCUS_35640 25225 20318 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037508.1 protein_id gnl|my_center|LOCUS_35640 25503 26201 gene locus_tag LOCUS_35650 25503 26201 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037509.1 protein_id gnl|my_center|LOCUS_35650 26201 27469 gene locus_tag LOCUS_35660 gene acrA 26201 27469 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037510.1 protein_id gnl|my_center|LOCUS_35660 27485 30658 gene locus_tag LOCUS_35670 gene acrB 27485 30658 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037511.1 protein_id gnl|my_center|LOCUS_35670 30957 31841 gene locus_tag LOCUS_35680 30957 31841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 33103 31955 gene locus_tag LOCUS_35690 gene acdA 33103 31955 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036700.1 protein_id gnl|my_center|LOCUS_35690 33257 34186 gene locus_tag LOCUS_35700 33257 34186 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036699.1 protein_id gnl|my_center|LOCUS_35700 34199 35293 gene locus_tag LOCUS_35710 gene metH1 34199 35293 CDS product 5-methyltetrahydrofolate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036698.1 protein_id gnl|my_center|LOCUS_35710 35290 37974 gene locus_tag LOCUS_35720 gene metH2 35290 37974 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036697.1 protein_id gnl|my_center|LOCUS_35720 38061 39245 gene locus_tag LOCUS_35730 38061 39245 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103817.1 protein_id gnl|my_center|LOCUS_35730 41330 39258 gene locus_tag LOCUS_35740 41330 39258 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204587.1 protein_id gnl|my_center|LOCUS_35740 42059 41379 gene locus_tag LOCUS_35750 42059 41379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036691.1 protein_id gnl|my_center|LOCUS_35750 42312 42070 gene locus_tag LOCUS_35760 gene slyX 42312 42070 CDS product protein SlyX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAH9 protein_id gnl|my_center|LOCUS_35760 43654 42305 gene locus_tag LOCUS_35770 gene ugd 43654 42305 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036689.1 protein_id gnl|my_center|LOCUS_35770 44655 43678 gene locus_tag LOCUS_35780 gene fkpA 44655 43678 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAI1 protein_id gnl|my_center|LOCUS_35780 45366 44752 gene locus_tag LOCUS_35790 45366 44752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 45707 45952 gene locus_tag LOCUS_35800 45707 45952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 45955 46314 gene locus_tag LOCUS_35810 45955 46314 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036686.1 protein_id gnl|my_center|LOCUS_35810 46314 47189 gene locus_tag LOCUS_35820 gene nodI 46314 47189 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036685.1 protein_id gnl|my_center|LOCUS_35820 47186 48214 gene locus_tag LOCUS_35830 47186 48214 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036684.1 protein_id gnl|my_center|LOCUS_35830 48240 49127 gene locus_tag LOCUS_35840 48240 49127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036683.1 protein_id gnl|my_center|LOCUS_35840 49157 49768 gene locus_tag LOCUS_35850 49157 49768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036682.1 protein_id gnl|my_center|LOCUS_35850 49869 50294 gene locus_tag LOCUS_35860 49869 50294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036681.1 protein_id gnl|my_center|LOCUS_35860 51804 50365 gene locus_tag LOCUS_35870 gene fumC 51804 50365 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAI9 protein_id gnl|my_center|LOCUS_35870 52067 53467 gene locus_tag LOCUS_35880 gene purB 52067 53467 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAJ1 protein_id gnl|my_center|LOCUS_35880 >Feature sequence36 2058 481 gene locus_tag LOCUS_35890 gene betL 2058 481 CDS product glycine/betaine ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731943.1 protein_id gnl|my_center|LOCUS_35890 2489 4333 gene locus_tag LOCUS_35900 gene thiC 2489 4333 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5L9 protein_id gnl|my_center|LOCUS_35900 4428 5099 gene locus_tag LOCUS_35910 4428 5099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207910.1 protein_id gnl|my_center|LOCUS_35910 5359 7686 gene locus_tag LOCUS_35920 5359 7686 CDS product biopolymer transporter Tol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038417.1 protein_id gnl|my_center|LOCUS_35920 7802 8701 gene locus_tag LOCUS_35930 7802 8701 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038416.1 protein_id gnl|my_center|LOCUS_35930 8751 11609 gene locus_tag LOCUS_35940 gene btuB 8751 11609 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038415.1 protein_id gnl|my_center|LOCUS_35940 11780 11989 gene locus_tag LOCUS_35950 11780 11989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 13171 12050 gene locus_tag LOCUS_35960 13171 12050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038414.1 protein_id gnl|my_center|LOCUS_35960 13859 13323 gene locus_tag LOCUS_35970 gene ppa 13859 13323 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5M4 protein_id gnl|my_center|LOCUS_35970 14044 14535 gene locus_tag LOCUS_35980 14044 14535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 14535 15011 gene locus_tag LOCUS_35990 14535 15011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038413.1 protein_id gnl|my_center|LOCUS_35990 15058 15597 gene locus_tag LOCUS_36000 15058 15597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 15702 16634 gene locus_tag LOCUS_36010 gene fecR 15702 16634 CDS product iron dicitrate transporter FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969652.1 protein_id gnl|my_center|LOCUS_36010 16813 19731 gene locus_tag LOCUS_36020 16813 19731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112301.1 protein_id gnl|my_center|LOCUS_36020 20095 19835 gene locus_tag LOCUS_36030 20095 19835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119522.1 protein_id gnl|my_center|LOCUS_36030 20199 20786 gene locus_tag LOCUS_36040 gene hemO 20199 20786 CDS product heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972364.1 protein_id gnl|my_center|LOCUS_36040 20818 21285 gene locus_tag LOCUS_36050 20818 21285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 21251 22000 gene locus_tag LOCUS_36060 21251 22000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36060 22010 22435 gene locus_tag LOCUS_36070 gene exbD 22010 22435 CDS product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385082.1 protein_id gnl|my_center|LOCUS_36070 22432 23151 gene locus_tag LOCUS_36080 22432 23151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 25219 23192 gene locus_tag LOCUS_36090 gene hppA 25219 23192 CDS product K(+)-insensitive pyrophosphate-energized proton pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5M6 protein_id gnl|my_center|LOCUS_36090 25499 26002 gene locus_tag LOCUS_36100 25499 26002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038411.1 protein_id gnl|my_center|LOCUS_36100 26464 26075 gene locus_tag LOCUS_36110 26464 26075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200901.1 protein_id gnl|my_center|LOCUS_36110 28293 26536 gene locus_tag LOCUS_36120 gene kup3 28293 26536 CDS product putative potassium transport system protein kup 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZSY2 protein_id gnl|my_center|LOCUS_36120 28184 28570 gene locus_tag LOCUS_36130 28184 28570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 29854 28598 gene locus_tag LOCUS_36140 gene pfkA 29854 28598 CDS product pyrophosphate--fructose 6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5P4 protein_id gnl|my_center|LOCUS_36140 29991 30554 gene locus_tag LOCUS_36150 gene adk 29991 30554 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5P5 protein_id gnl|my_center|LOCUS_36150 30884 32248 gene locus_tag LOCUS_36160 gene mpl 30884 32248 CDS product UDP-N-acetylmuramate--L-alanyl-gamma-D-glutamyl-meso-2,6-diaminoheptandioate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5P6 protein_id gnl|my_center|LOCUS_36160 32245 32823 gene locus_tag LOCUS_36170 32245 32823 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038391.1 protein_id gnl|my_center|LOCUS_36170 34915 32918 gene locus_tag LOCUS_36180 34915 32918 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038389.1 protein_id gnl|my_center|LOCUS_36180 35001 35663 gene locus_tag LOCUS_36190 35001 35663 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038388.1 protein_id gnl|my_center|LOCUS_36190 35660 36166 gene locus_tag LOCUS_36200 35660 36166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 36961 36278 gene locus_tag LOCUS_36210 36961 36278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 37070 37888 gene locus_tag LOCUS_36220 37070 37888 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038387.1 protein_id gnl|my_center|LOCUS_36220 37982 38974 gene locus_tag LOCUS_36230 37982 38974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038386.1 protein_id gnl|my_center|LOCUS_36230 39152 40084 gene locus_tag LOCUS_36240 39152 40084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038386.1 protein_id gnl|my_center|LOCUS_36240 41019 40147 gene locus_tag LOCUS_36250 gene kch 41019 40147 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038385.1 protein_id gnl|my_center|LOCUS_36250 41083 42309 gene locus_tag LOCUS_36260 gene argD 41083 42309 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5Q4 protein_id gnl|my_center|LOCUS_36260 42945 42343 gene locus_tag LOCUS_36270 42945 42343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 43068 43517 gene locus_tag LOCUS_36280 gene az1 43068 43517 CDS product azurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5R2 protein_id gnl|my_center|LOCUS_36280 44975 43686 gene locus_tag LOCUS_36290 gene hemL 44975 43686 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5R4 protein_id gnl|my_center|LOCUS_36290 45618 44992 gene locus_tag LOCUS_36300 gene thiE 45618 44992 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5R7 protein_id gnl|my_center|LOCUS_36300 45653 45877 gene locus_tag LOCUS_36310 45653 45877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 46777 45926 gene locus_tag LOCUS_36320 46777 45926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038369.1 protein_id gnl|my_center|LOCUS_36320 47397 46954 gene locus_tag LOCUS_36330 47397 46954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038368.1 protein_id gnl|my_center|LOCUS_36330 48065 47418 gene locus_tag LOCUS_36340 gene rpiA 48065 47418 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5S1 protein_id gnl|my_center|LOCUS_36340 48567 48088 gene locus_tag LOCUS_36350 48567 48088 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038366.1 protein_id gnl|my_center|LOCUS_36350 49157 48564 gene locus_tag LOCUS_36360 49157 48564 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5S3 protein_id gnl|my_center|LOCUS_36360 49820 49524 gene locus_tag LOCUS_36370 49820 49524 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5S4 protein_id gnl|my_center|LOCUS_36370 50038 49817 gene locus_tag LOCUS_36380 50038 49817 CDS product TIGR02449 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038363.1 protein_id gnl|my_center|LOCUS_36380 49931 50197 gene locus_tag LOCUS_36390 49931 50197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 50190 50738 gene locus_tag LOCUS_36400 50190 50738 CDS product UPF0149 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5S6 protein_id gnl|my_center|LOCUS_36400 50738 52066 gene locus_tag LOCUS_36410 gene pepP 50738 52066 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038361.1 protein_id gnl|my_center|LOCUS_36410 >Feature sequence37 295 2760 gene locus_tag LOCUS_36420 gene ligA 295 2760 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAB5 protein_id gnl|my_center|LOCUS_36420 2810 3295 gene locus_tag LOCUS_36430 2810 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 3292 4248 gene locus_tag LOCUS_36440 gene lysS 3292 4248 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAB4 protein_id gnl|my_center|LOCUS_36440 4376 5116 gene locus_tag LOCUS_36450 4376 5116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036754.1 protein_id gnl|my_center|LOCUS_36450 5164 6228 gene locus_tag LOCUS_36460 gene mtnA 5164 6228 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAB2 protein_id gnl|my_center|LOCUS_36460 6449 9163 gene locus_tag LOCUS_36470 gene gyrA 6449 9163 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAB1 protein_id gnl|my_center|LOCUS_36470 9294 11846 gene locus_tag LOCUS_36480 gene gcd 9294 11846 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036757.1 protein_id gnl|my_center|LOCUS_36480 12843 11854 gene locus_tag LOCUS_36490 12843 11854 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967019.1 protein_id gnl|my_center|LOCUS_36490 12962 13867 gene locus_tag LOCUS_36500 12962 13867 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388220.1 protein_id gnl|my_center|LOCUS_36500 13916 14401 gene locus_tag LOCUS_36510 13916 14401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 14465 15895 gene locus_tag LOCUS_36520 14465 15895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 16297 15905 gene locus_tag LOCUS_36530 16297 15905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142760.1 protein_id gnl|my_center|LOCUS_36530 17051 16275 gene locus_tag LOCUS_36540 17051 16275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142761.1 protein_id gnl|my_center|LOCUS_36540 17511 17840 gene locus_tag LOCUS_36550 17511 17840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 18010 20472 gene locus_tag LOCUS_36560 18010 20472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920521.1 protein_id gnl|my_center|LOCUS_36560 20583 21350 gene locus_tag LOCUS_36570 20583 21350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 21469 21789 gene locus_tag LOCUS_36580 21469 21789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 22786 21803 gene locus_tag LOCUS_36590 22786 21803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122551.1 protein_id gnl|my_center|LOCUS_36590 22924 23889 gene locus_tag LOCUS_36600 22924 23889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 23981 24748 gene locus_tag LOCUS_36610 23981 24748 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107331.1 protein_id gnl|my_center|LOCUS_36610 25565 24696 gene locus_tag LOCUS_36620 25565 24696 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707685.1 protein_id gnl|my_center|LOCUS_36620 25671 26804 gene locus_tag LOCUS_36630 25671 26804 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707684.1 protein_id gnl|my_center|LOCUS_36630 27356 26811 gene locus_tag LOCUS_36640 27356 26811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 27330 28001 gene locus_tag LOCUS_36650 27330 28001 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401168.1 protein_id gnl|my_center|LOCUS_36650 28054 28437 gene locus_tag LOCUS_36660 28054 28437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 30727 28619 gene locus_tag LOCUS_36670 30727 28619 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973814.1 protein_id gnl|my_center|LOCUS_36670 32360 30924 gene locus_tag LOCUS_36680 32360 30924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 34192 32525 gene locus_tag LOCUS_36690 gene hutU 34192 32525 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58988 protein_id gnl|my_center|LOCUS_36690 35043 34189 gene locus_tag LOCUS_36700 gene hutG 35043 34189 CDS product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036760.1 protein_id gnl|my_center|LOCUS_36700 36581 35040 gene locus_tag LOCUS_36710 gene hutH 36581 35040 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAA7 protein_id gnl|my_center|LOCUS_36710 37801 36578 gene locus_tag LOCUS_36720 gene hutI 37801 36578 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAA6 protein_id gnl|my_center|LOCUS_36720 37869 39239 gene locus_tag LOCUS_36730 gene sdeB 37869 39239 CDS product N-formimino-L-glutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636952.2 protein_id gnl|my_center|LOCUS_36730 39267 39995 gene locus_tag LOCUS_36740 gene hutC 39267 39995 CDS product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636953.2 protein_id gnl|my_center|LOCUS_36740 41086 40097 gene locus_tag LOCUS_36750 41086 40097 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036765.1 protein_id gnl|my_center|LOCUS_36750 41816 41325 gene locus_tag LOCUS_36760 41816 41325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 42172 41897 gene locus_tag LOCUS_36770 42172 41897 CDS product polyhydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036767.1 protein_id gnl|my_center|LOCUS_36770 42298 43104 gene locus_tag LOCUS_36780 42298 43104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636956.2 protein_id gnl|my_center|LOCUS_36780 43357 44442 gene locus_tag LOCUS_36790 gene serC 43357 44442 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PA97 protein_id gnl|my_center|LOCUS_36790 44494 45693 gene locus_tag LOCUS_36800 gene pheA 44494 45693 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036772.1 protein_id gnl|my_center|LOCUS_36800 45770 47077 gene locus_tag LOCUS_36810 gene aroA 45770 47077 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PA95 protein_id gnl|my_center|LOCUS_36810 47808 47236 gene locus_tag LOCUS_36820 47808 47236 CDS product cell envelope biogenesis protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036774.1 protein_id gnl|my_center|LOCUS_36820 48566 47928 gene locus_tag LOCUS_36830 48566 47928 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036775.1 protein_id gnl|my_center|LOCUS_36830 48680 49960 gene locus_tag LOCUS_36840 gene serS 48680 49960 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PA92 protein_id gnl|my_center|LOCUS_36840 50491 50141 gene locus_tag LOCUS_36850 50491 50141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388136.1 protein_id gnl|my_center|LOCUS_36850 >Feature sequence38 87 1853 gene locus_tag LOCUS_36860 87 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037234.1 protein_id gnl|my_center|LOCUS_36860 2512 2099 gene locus_tag LOCUS_36870 2512 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037424.1 protein_id gnl|my_center|LOCUS_36870 2964 2512 gene locus_tag LOCUS_36880 2964 2512 CDS product ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637634.2 protein_id gnl|my_center|LOCUS_36880 3184 3795 gene locus_tag LOCUS_36890 gene sodA 3184 3795 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C0F8 protein_id gnl|my_center|LOCUS_36890 3962 3774 gene locus_tag LOCUS_36900 3962 3774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 4845 3997 gene locus_tag LOCUS_36910 4845 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 5008 6573 gene locus_tag LOCUS_36920 gene ygdR 5008 6573 CDS product oligopeptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636779.2 protein_id gnl|my_center|LOCUS_36920 6581 7207 gene locus_tag LOCUS_36930 6581 7207 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036598.1 protein_id gnl|my_center|LOCUS_36930 7436 7251 gene locus_tag LOCUS_36940 7436 7251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 7622 7924 gene locus_tag LOCUS_36950 7622 7924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636782.2 protein_id gnl|my_center|LOCUS_36950 7958 8842 gene locus_tag LOCUS_36960 7958 8842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036601.1 protein_id gnl|my_center|LOCUS_36960 8862 9977 gene locus_tag LOCUS_36970 8862 9977 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258479.1 protein_id gnl|my_center|LOCUS_36970 12205 10067 gene locus_tag LOCUS_36980 gene dcp 12205 10067 CDS product dipeptidyl carboxypeptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036603.1 protein_id gnl|my_center|LOCUS_36980 12366 12845 gene locus_tag LOCUS_36990 gene gpo 12366 12845 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAR5 protein_id gnl|my_center|LOCUS_36990 13704 12925 gene locus_tag LOCUS_37000 gene fpr 13704 12925 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036605.1 protein_id gnl|my_center|LOCUS_37000 15661 13784 gene locus_tag LOCUS_37010 gene msbA 15661 13784 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036606.1 protein_id gnl|my_center|LOCUS_37010 16280 15810 gene locus_tag LOCUS_37020 16280 15810 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VW5 protein_id gnl|my_center|LOCUS_37020 17192 16296 gene locus_tag LOCUS_37030 17192 16296 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186174.1 protein_id gnl|my_center|LOCUS_37030 17311 18828 gene locus_tag LOCUS_37040 gene fumB 17311 18828 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAR2 protein_id gnl|my_center|LOCUS_37040 18949 19287 gene locus_tag LOCUS_37050 18949 19287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 19345 19980 gene locus_tag LOCUS_37060 gene gst 19345 19980 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036609.1 protein_id gnl|my_center|LOCUS_37060 20395 20054 gene locus_tag LOCUS_37070 gene arsC 20395 20054 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92R44 protein_id gnl|my_center|LOCUS_37070 21549 20395 gene locus_tag LOCUS_37080 21549 20395 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036611.1 protein_id gnl|my_center|LOCUS_37080 22154 21669 gene locus_tag LOCUS_37090 22154 21669 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036612.1 protein_id gnl|my_center|LOCUS_37090 22390 22599 gene locus_tag LOCUS_37100 gene cspA 22390 22599 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003483561.1 protein_id gnl|my_center|LOCUS_37100 23166 22672 gene locus_tag LOCUS_37110 gene pcp 23166 22672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036613.1 protein_id gnl|my_center|LOCUS_37110 23736 23302 gene locus_tag LOCUS_37120 23736 23302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 23816 24640 gene locus_tag LOCUS_37130 gene moeB 23816 24640 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036615.1 protein_id gnl|my_center|LOCUS_37130 25447 24674 gene locus_tag LOCUS_37140 25447 24674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036616.1 protein_id gnl|my_center|LOCUS_37140 25659 25444 gene locus_tag LOCUS_37150 25659 25444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036617.1 protein_id gnl|my_center|LOCUS_37150 25823 26668 gene locus_tag LOCUS_37160 25823 26668 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036618.1 protein_id gnl|my_center|LOCUS_37160 26799 27341 gene locus_tag LOCUS_37170 26799 27341 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918215.1 protein_id gnl|my_center|LOCUS_37170 27401 28174 gene locus_tag LOCUS_37180 gene gst 27401 28174 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036621.1 protein_id gnl|my_center|LOCUS_37180 28237 30516 gene locus_tag LOCUS_37190 28237 30516 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728359.1 protein_id gnl|my_center|LOCUS_37190 30538 32463 gene locus_tag LOCUS_37200 gene wbpS 30538 32463 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036622.1 protein_id gnl|my_center|LOCUS_37200 32530 33090 gene locus_tag LOCUS_37210 32530 33090 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036623.1 protein_id gnl|my_center|LOCUS_37210 33304 34734 gene locus_tag LOCUS_37220 gene dnaB 33304 34734 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAP5 protein_id gnl|my_center|LOCUS_37220 34909 37152 gene locus_tag LOCUS_37230 gene fecA 34909 37152 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639569.2 protein_id gnl|my_center|LOCUS_37230 37152 38741 gene locus_tag LOCUS_37240 37152 38741 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140493.1 protein_id gnl|my_center|LOCUS_37240 38910 39122 gene locus_tag LOCUS_37250 38910 39122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 39128 39370 gene locus_tag LOCUS_37260 39128 39370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 40920 39484 gene locus_tag LOCUS_37270 gene ldp 40920 39484 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAJ8 protein_id gnl|my_center|LOCUS_37270 42183 40984 gene locus_tag LOCUS_37280 gene sucB 42183 40984 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAJ7 protein_id gnl|my_center|LOCUS_37280 45055 42224 gene locus_tag LOCUS_37290 gene sucA 45055 42224 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636859.2 protein_id gnl|my_center|LOCUS_37290 46138 45242 gene locus_tag LOCUS_37300 46138 45242 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036674.1 protein_id gnl|my_center|LOCUS_37300 <47534 46148 gene locus_tag LOCUS_37310 <47534 46148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036675.1:transcriptional regulator >Feature sequence39 1067 48 gene locus_tag LOCUS_37320 1067 48 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942561.1 protein_id gnl|my_center|LOCUS_37320 1253 3976 gene locus_tag LOCUS_37330 gene btuB 1253 3976 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207266.1 protein_id gnl|my_center|LOCUS_37330 5574 4483 gene locus_tag LOCUS_37340 gene ychF 5574 4483 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC60 protein_id gnl|my_center|LOCUS_37340 6304 5726 gene locus_tag LOCUS_37350 gene pth 6304 5726 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC61 protein_id gnl|my_center|LOCUS_37350 6970 6353 gene locus_tag LOCUS_37360 gene rplY 6970 6353 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC62 protein_id gnl|my_center|LOCUS_37360 8087 7080 gene locus_tag LOCUS_37370 gene prs 8087 7080 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC63 protein_id gnl|my_center|LOCUS_37370 8256 8180 gene locus_tag LOCUS_t00470 8256 8180 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 9137 8268 gene locus_tag LOCUS_37380 gene ispE 9137 8268 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC64 protein_id gnl|my_center|LOCUS_37380 9793 9134 gene locus_tag LOCUS_37390 gene lolB 9793 9134 CDS product outer-membrane lipoprotein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC65 protein_id gnl|my_center|LOCUS_37390 11475 9790 gene locus_tag LOCUS_37400 11475 9790 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036105.1 protein_id gnl|my_center|LOCUS_37400 11539 12822 gene locus_tag LOCUS_37410 gene hemA 11539 12822 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC67 protein_id gnl|my_center|LOCUS_37410 12800 13882 gene locus_tag LOCUS_37420 gene prfA 12800 13882 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC68 protein_id gnl|my_center|LOCUS_37420 13888 15594 gene locus_tag LOCUS_37430 13888 15594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036102.1 protein_id gnl|my_center|LOCUS_37430 15641 16423 gene locus_tag LOCUS_37440 15641 16423 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036100.1 protein_id gnl|my_center|LOCUS_37440 17558 16986 gene locus_tag LOCUS_37450 17558 16986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 18829 17555 gene locus_tag LOCUS_37460 18829 17555 CDS product UPF0761 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC75 protein_id gnl|my_center|LOCUS_37460 18907 19500 gene locus_tag LOCUS_37470 18907 19500 CDS product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC76 protein_id gnl|my_center|LOCUS_37470 19497 19832 gene locus_tag LOCUS_37480 19497 19832 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036094.1 protein_id gnl|my_center|LOCUS_37480 19903 20397 gene locus_tag LOCUS_37490 gene aspG 19903 20397 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036092.1 protein_id gnl|my_center|LOCUS_37490 22225 20486 gene locus_tag LOCUS_37500 22225 20486 CDS product extracellular protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23314 protein_id gnl|my_center|LOCUS_37500 23626 22604 gene locus_tag LOCUS_37510 23626 22604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 23963 23628 gene locus_tag LOCUS_37520 23963 23628 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403775.1 protein_id gnl|my_center|LOCUS_37520 24616 23960 gene locus_tag LOCUS_37530 24616 23960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 25879 24785 gene locus_tag LOCUS_37540 gene ilvE 25879 24785 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC84 protein_id gnl|my_center|LOCUS_37540 26436 25939 gene locus_tag LOCUS_37550 26436 25939 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036085.1 protein_id gnl|my_center|LOCUS_37550 26613 27032 gene locus_tag LOCUS_37560 26613 27032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036084.1 protein_id gnl|my_center|LOCUS_37560 28982 27522 gene locus_tag LOCUS_37570 28982 27522 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLT5 protein_id gnl|my_center|LOCUS_37570 29299 28979 gene locus_tag LOCUS_37580 29299 28979 CDS product NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227778.1 protein_id gnl|my_center|LOCUS_37580 29428 29982 gene locus_tag LOCUS_37590 29428 29982 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036083.1 protein_id gnl|my_center|LOCUS_37590 29979 30305 gene locus_tag LOCUS_37600 29979 30305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 30310 30771 gene locus_tag LOCUS_37610 30310 30771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 31914 30835 gene locus_tag LOCUS_37620 gene pntA 31914 30835 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223977.1 protein_id gnl|my_center|LOCUS_37620 34287 31966 gene locus_tag LOCUS_37630 34287 31966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636233.2 protein_id gnl|my_center|LOCUS_37630 34601 35200 gene locus_tag LOCUS_37640 34601 35200 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036076.1 protein_id gnl|my_center|LOCUS_37640 35197 36132 gene locus_tag LOCUS_37650 gene exo 35197 36132 CDS product exodeoxyribonuclease IX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036075.1 protein_id gnl|my_center|LOCUS_37650 36129 36683 gene locus_tag LOCUS_37660 36129 36683 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036074.1 protein_id gnl|my_center|LOCUS_37660 36676 37512 gene locus_tag LOCUS_37670 36676 37512 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036073.1 protein_id gnl|my_center|LOCUS_37670 38990 37575 gene locus_tag LOCUS_37680 38990 37575 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114873.1 protein_id gnl|my_center|LOCUS_37680 39096 39980 gene locus_tag LOCUS_37690 39096 39980 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114872.1 protein_id gnl|my_center|LOCUS_37690 40994 40053 gene locus_tag LOCUS_37700 gene pip 40994 40053 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC98 protein_id gnl|my_center|LOCUS_37700 41900 41043 gene locus_tag LOCUS_37710 gene prmC 41900 41043 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC99 protein_id gnl|my_center|LOCUS_37710 42223 42786 gene locus_tag LOCUS_37720 gene ahpC 42223 42786 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083828.1 protein_id gnl|my_center|LOCUS_37720 43012 44604 gene locus_tag LOCUS_37730 gene ahpF 43012 44604 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036069.1 protein_id gnl|my_center|LOCUS_37730 44690 45655 gene locus_tag LOCUS_37740 gene oxyR 44690 45655 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036068.1 protein_id gnl|my_center|LOCUS_37740 45779 46183 gene locus_tag LOCUS_37750 gene rnk 45779 46183 CDS product regulator of nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636222.2 protein_id gnl|my_center|LOCUS_37750 46234 47190 gene locus_tag LOCUS_37760 gene tal 46234 47190 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCA4 protein_id gnl|my_center|LOCUS_37760 >Feature sequence40 2696 2313 gene locus_tag LOCUS_37770 2696 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010365266.1 protein_id gnl|my_center|LOCUS_37770 3324 2833 gene locus_tag LOCUS_37780 gene cheW 3324 2833 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037040.1 protein_id gnl|my_center|LOCUS_37780 4280 3507 gene locus_tag LOCUS_37790 gene ycgR 4280 3507 CDS product flagellar brake protein YcgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9J1 protein_id gnl|my_center|LOCUS_37790 6733 4484 gene locus_tag LOCUS_37800 gene tsr 6733 4484 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037048.1 protein_id gnl|my_center|LOCUS_37800 9107 7116 gene locus_tag LOCUS_37810 gene cheA 9107 7116 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037054.1 protein_id gnl|my_center|LOCUS_37810 9518 9153 gene locus_tag LOCUS_37820 gene cheY 9518 9153 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806565.1 protein_id gnl|my_center|LOCUS_37820 9823 9515 gene locus_tag LOCUS_37830 9823 9515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037055.1 protein_id gnl|my_center|LOCUS_37830 11128 9905 gene locus_tag LOCUS_37840 11128 9905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 11907 11125 gene locus_tag LOCUS_37850 gene parA 11907 11125 CDS product chromosome partioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637254.2 protein_id gnl|my_center|LOCUS_37850 12928 11912 gene locus_tag LOCUS_37860 gene motB 12928 11912 CDS product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037058.1 protein_id gnl|my_center|LOCUS_37860 13670 12930 gene locus_tag LOCUS_37870 gene motC 13670 12930 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037059.1 protein_id gnl|my_center|LOCUS_37870 15598 13772 gene locus_tag LOCUS_37880 gene cheA 15598 13772 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037070.1 protein_id gnl|my_center|LOCUS_37880 16206 15601 gene locus_tag LOCUS_37890 gene cheZ 16206 15601 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037071.1 protein_id gnl|my_center|LOCUS_37890 16598 16206 gene locus_tag LOCUS_37900 gene cheY 16598 16206 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005996243.1 protein_id gnl|my_center|LOCUS_37900 17399 16656 gene locus_tag LOCUS_37910 gene fliA 17399 16656 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9F9 protein_id gnl|my_center|LOCUS_37910 18283 17396 gene locus_tag LOCUS_37920 gene fleN 18283 17396 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037073.1 protein_id gnl|my_center|LOCUS_37920 19958 18270 gene locus_tag LOCUS_37930 gene flhF 19958 18270 CDS product flagellar biosynthesis regulator FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037074.1 protein_id gnl|my_center|LOCUS_37930 22146 20038 gene locus_tag LOCUS_37940 gene flhA 22146 20038 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037075.1 protein_id gnl|my_center|LOCUS_37940 23273 22143 gene locus_tag LOCUS_37950 gene flhB 23273 22143 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037076.1 protein_id gnl|my_center|LOCUS_37950 25544 23412 gene locus_tag LOCUS_37960 25544 23412 CDS product putative signaling protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I310 protein_id gnl|my_center|LOCUS_37960 26501 25710 gene locus_tag LOCUS_37970 gene fliR 26501 25710 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9F1 protein_id gnl|my_center|LOCUS_37970 26784 26515 gene locus_tag LOCUS_37980 gene fliQ 26784 26515 CDS product flagellar biosynthesis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037081.1 protein_id gnl|my_center|LOCUS_37980 27648 26869 gene locus_tag LOCUS_37990 gene fliP 27648 26869 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9E9 protein_id gnl|my_center|LOCUS_37990 28069 27650 gene locus_tag LOCUS_38000 gene fliO 28069 27650 CDS product flagellar protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9E8 protein_id gnl|my_center|LOCUS_38000 28401 28066 gene locus_tag LOCUS_38010 gene fliN 28401 28066 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9E7 protein_id gnl|my_center|LOCUS_38010 29402 28398 gene locus_tag LOCUS_38020 gene fliM 29402 28398 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9E6 protein_id gnl|my_center|LOCUS_38020 29928 29413 gene locus_tag LOCUS_38030 gene fliL 29928 29413 CDS product flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037086.1 protein_id gnl|my_center|LOCUS_38030 31323 30169 gene locus_tag LOCUS_38040 31323 30169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 31790 31323 gene locus_tag LOCUS_38050 gene fliJ 31790 31323 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037088.1 protein_id gnl|my_center|LOCUS_38050 33191 31794 gene locus_tag LOCUS_38060 gene fliI 33191 31794 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037089.1 protein_id gnl|my_center|LOCUS_38060 33826 33188 gene locus_tag LOCUS_38070 gene fliH 33826 33188 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037090.1 protein_id gnl|my_center|LOCUS_38070 34824 33823 gene locus_tag LOCUS_38080 gene fliG 34824 33823 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9E0 protein_id gnl|my_center|LOCUS_38080 36460 34817 gene locus_tag LOCUS_38090 gene fliF 36460 34817 CDS product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9D9 protein_id gnl|my_center|LOCUS_38090 36842 36474 gene locus_tag LOCUS_38100 gene fliE 36842 36474 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9D8 protein_id gnl|my_center|LOCUS_38100 37744 37328 gene locus_tag LOCUS_38110 37744 37328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 39422 37917 gene locus_tag LOCUS_38120 gene fleQ 39422 37917 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037099.1 protein_id gnl|my_center|LOCUS_38120 39796 39419 gene locus_tag LOCUS_38130 39796 39419 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005997154.1 protein_id gnl|my_center|LOCUS_38130 41220 39811 gene locus_tag LOCUS_38140 gene rpoN 41220 39811 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9D0 protein_id gnl|my_center|LOCUS_38140 42123 41491 gene locus_tag LOCUS_38150 42123 41491 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037101.1 protein_id gnl|my_center|LOCUS_38150 42794 42216 gene locus_tag LOCUS_38160 42794 42216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 43084 42791 gene locus_tag LOCUS_38170 43084 42791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 43497 43081 gene locus_tag LOCUS_38180 gene fliS 43497 43081 CDS product flagellar protein FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9C6 protein_id gnl|my_center|LOCUS_38180 45044 43626 gene locus_tag LOCUS_38190 gene fliD 45044 43626 CDS product flagellar hook-associated protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CIC9 protein_id gnl|my_center|LOCUS_38190 <46501 45486 gene locus_tag LOCUS_38200 <46501 45486 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P9C4:flagellin >Feature sequence41 78 2 gene locus_tag LOCUS_t00480 78 2 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 187 111 gene locus_tag LOCUS_t00490 187 111 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 333 257 gene locus_tag LOCUS_t00500 333 257 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1250 324 gene locus_tag LOCUS_38210 1250 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036908.1 protein_id gnl|my_center|LOCUS_38210 2056 1247 gene locus_tag LOCUS_38220 gene thiD 2056 1247 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036909.1 protein_id gnl|my_center|LOCUS_38220 2789 2121 gene locus_tag LOCUS_38230 2789 2121 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462033.1 protein_id gnl|my_center|LOCUS_38230 3308 2802 gene locus_tag LOCUS_38240 3308 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637103.2 protein_id gnl|my_center|LOCUS_38240 4705 3305 gene locus_tag LOCUS_38250 4705 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637104.2 protein_id gnl|my_center|LOCUS_38250 5269 4790 gene locus_tag LOCUS_38260 5269 4790 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036912.1 protein_id gnl|my_center|LOCUS_38260 5921 5361 gene locus_tag LOCUS_38270 gene gcvR 5921 5361 CDS product glycine cleavage system transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036914.1 protein_id gnl|my_center|LOCUS_38270 6086 6979 gene locus_tag LOCUS_38280 gene dapA 6086 6979 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9V6 protein_id gnl|my_center|LOCUS_38280 7012 7527 gene locus_tag LOCUS_38290 7012 7527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036916.1 protein_id gnl|my_center|LOCUS_38290 8049 7726 gene locus_tag LOCUS_38300 8049 7726 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036917.1 protein_id gnl|my_center|LOCUS_38300 8241 9665 gene locus_tag LOCUS_38310 gene xylE 8241 9665 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036933.1 protein_id gnl|my_center|LOCUS_38310 9248 9333 gene locus_tag LOCUS_t00510 9248 9333 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 10120 10046 gene locus_tag LOCUS_t00520 10120 10046 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 10167 11552 gene locus_tag LOCUS_38320 gene pcnB 10167 11552 CDS product poly(A) polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9T2 protein_id gnl|my_center|LOCUS_38320 11556 12041 gene locus_tag LOCUS_38330 11556 12041 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036940.1 protein_id gnl|my_center|LOCUS_38330 12076 12891 gene locus_tag LOCUS_38340 gene panB 12076 12891 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9T0 protein_id gnl|my_center|LOCUS_38340 12888 13727 gene locus_tag LOCUS_38350 gene panC 12888 13727 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9S9 protein_id gnl|my_center|LOCUS_38350 13794 14297 gene locus_tag LOCUS_38360 13794 14297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 14385 14765 gene locus_tag LOCUS_38370 gene panD 14385 14765 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9S8 protein_id gnl|my_center|LOCUS_38370 14762 16276 gene locus_tag LOCUS_38380 gene pgi 14762 16276 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9S7 protein_id gnl|my_center|LOCUS_38380 16558 16764 gene locus_tag LOCUS_38390 16558 16764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 16845 19745 gene locus_tag LOCUS_38400 16845 19745 CDS product lanthionine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226577.1 protein_id gnl|my_center|LOCUS_38400 20336 19767 gene locus_tag LOCUS_38410 gene regR 20336 19767 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036952.1 protein_id gnl|my_center|LOCUS_38410 21559 20333 gene locus_tag LOCUS_38420 gene regS 21559 20333 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036953.1 protein_id gnl|my_center|LOCUS_38420 21674 22939 gene locus_tag LOCUS_38430 gene ispG 21674 22939 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9R7 protein_id gnl|my_center|LOCUS_38430 22920 23669 gene locus_tag LOCUS_38440 22920 23669 CDS product phosphatidylglycerophosphatase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036955.1 protein_id gnl|my_center|LOCUS_38440 23870 24517 gene locus_tag LOCUS_38450 gene gacA 23870 24517 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037241.1 protein_id gnl|my_center|LOCUS_38450 25466 24807 gene locus_tag LOCUS_38460 gene eda 25466 24807 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037291.1 protein_id gnl|my_center|LOCUS_38460 27618 25702 gene locus_tag LOCUS_38470 gene edd 27618 25702 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037290.1 protein_id gnl|my_center|LOCUS_38470 28399 27677 gene locus_tag LOCUS_38480 gene pgl 28399 27677 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037289.1 protein_id gnl|my_center|LOCUS_38480 29403 28396 gene locus_tag LOCUS_38490 gene glk 29403 28396 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8U7 protein_id gnl|my_center|LOCUS_38490 30836 29400 gene locus_tag LOCUS_38500 gene zwf 30836 29400 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8U8 protein_id gnl|my_center|LOCUS_38500 31190 32272 gene locus_tag LOCUS_38510 gene ugpC 31190 32272 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037286.1 protein_id gnl|my_center|LOCUS_38510 33275 32400 gene locus_tag LOCUS_38520 33275 32400 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037285.1 protein_id gnl|my_center|LOCUS_38520 33602 33934 gene locus_tag LOCUS_38530 gene sdhC 33602 33934 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083343.1 protein_id gnl|my_center|LOCUS_38530 33931 34317 gene locus_tag LOCUS_38540 gene sdhD 33931 34317 CDS product succinate dehydrogenase membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037282.1 protein_id gnl|my_center|LOCUS_38540 34349 36139 gene locus_tag LOCUS_38550 gene sdhA 34349 36139 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8V4 protein_id gnl|my_center|LOCUS_38550 36206 36991 gene locus_tag LOCUS_38560 gene sdhB 36206 36991 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8V5 protein_id gnl|my_center|LOCUS_38560 37065 37313 gene locus_tag LOCUS_38570 37065 37313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8V6 protein_id gnl|my_center|LOCUS_38570 37264 37713 gene locus_tag LOCUS_38580 37264 37713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 37737 38978 gene locus_tag LOCUS_38590 gene lolC 37737 38978 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037277.1 protein_id gnl|my_center|LOCUS_38590 38971 39684 gene locus_tag LOCUS_38600 gene lolD 38971 39684 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8V9 protein_id gnl|my_center|LOCUS_38600 39906 40358 gene locus_tag LOCUS_38610 39906 40358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037562.1 protein_id gnl|my_center|LOCUS_38610 40702 40433 gene locus_tag LOCUS_38620 40702 40433 CDS product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P829 protein_id gnl|my_center|LOCUS_38620 41832 40708 gene locus_tag LOCUS_38630 gene mutY 41832 40708 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037560.1 protein_id gnl|my_center|LOCUS_38630 43231 41918 gene locus_tag LOCUS_38640 43231 41918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_38640 >Feature sequence42 624 2420 gene locus_tag LOCUS_38650 624 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 2423 2989 gene locus_tag LOCUS_38660 2423 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 3108 3317 gene locus_tag LOCUS_38670 3108 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 3402 3707 gene locus_tag LOCUS_38680 3402 3707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 4675 3806 gene locus_tag LOCUS_38690 4675 3806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918751.1 protein_id gnl|my_center|LOCUS_38690 6501 4801 gene locus_tag LOCUS_38700 gene dld 6501 4801 CDS product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIT0 protein_id gnl|my_center|LOCUS_38700 7637 6498 gene locus_tag LOCUS_38710 gene lldD 7637 6498 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV37 protein_id gnl|my_center|LOCUS_38710 8406 7642 gene locus_tag LOCUS_38720 8406 7642 CDS product transcriptional regulator LldR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636695.1 protein_id gnl|my_center|LOCUS_38720 10118 8460 gene locus_tag LOCUS_38730 gene lldP 10118 8460 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z2E3 protein_id gnl|my_center|LOCUS_38730 10903 10343 gene locus_tag LOCUS_38740 10903 10343 CDS product Mg(2+) transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064951.1 protein_id gnl|my_center|LOCUS_38740 11676 10918 gene locus_tag LOCUS_38750 11676 10918 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971780.1 protein_id gnl|my_center|LOCUS_38750 12123 13076 gene locus_tag LOCUS_38760 gene alcR 12123 13076 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814017.1 protein_id gnl|my_center|LOCUS_38760 15436 13526 gene locus_tag LOCUS_38770 gene gaa 15436 13526 CDS product glutaryl-7-ACA acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_38770 16019 15636 gene locus_tag LOCUS_38780 16019 15636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 17377 16022 gene locus_tag LOCUS_38790 17377 16022 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082692.1 protein_id gnl|my_center|LOCUS_38790 17483 18379 gene locus_tag LOCUS_38800 17483 18379 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082689.1 protein_id gnl|my_center|LOCUS_38800 21277 18482 gene locus_tag LOCUS_38810 gene bglS 21277 18482 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036595.1 protein_id gnl|my_center|LOCUS_38810 21616 22050 gene locus_tag LOCUS_38820 21616 22050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118992.1 protein_id gnl|my_center|LOCUS_38820 22338 23042 gene locus_tag LOCUS_38830 22338 23042 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719734.1 protein_id gnl|my_center|LOCUS_38830 23942 23052 gene locus_tag LOCUS_38840 23942 23052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085391.1 protein_id gnl|my_center|LOCUS_38840 24074 25024 gene locus_tag LOCUS_38850 24074 25024 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268540.1 protein_id gnl|my_center|LOCUS_38850 25153 25767 gene locus_tag LOCUS_38860 25153 25767 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379308.1 protein_id gnl|my_center|LOCUS_38860 25801 26808 gene locus_tag LOCUS_38870 25801 26808 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119474.1 protein_id gnl|my_center|LOCUS_38870 27096 26899 gene locus_tag LOCUS_38880 27096 26899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 27028 27642 gene locus_tag LOCUS_38890 27028 27642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762447.1 protein_id gnl|my_center|LOCUS_38890 27652 29061 gene locus_tag LOCUS_38900 27652 29061 CDS product DNA repair nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104196.1 protein_id gnl|my_center|LOCUS_38900 29068 32178 gene locus_tag LOCUS_38910 gene dnaE2 29068 32178 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q881T7 protein_id gnl|my_center|LOCUS_38910 32260 32766 gene locus_tag LOCUS_38920 32260 32766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 34152 32866 gene locus_tag LOCUS_38930 34152 32866 CDS product transcriptional regulator PtsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063850.1 protein_id gnl|my_center|LOCUS_38930 34229 35002 gene locus_tag LOCUS_38940 34229 35002 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811326.1 protein_id gnl|my_center|LOCUS_38940 34999 35700 gene locus_tag LOCUS_38950 34999 35700 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391259.1 protein_id gnl|my_center|LOCUS_38950 35697 35921 gene locus_tag LOCUS_38960 35697 35921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 36070 36579 gene locus_tag LOCUS_38970 36070 36579 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114482.1 protein_id gnl|my_center|LOCUS_38970 36576 37502 gene locus_tag LOCUS_38980 36576 37502 CDS product iron dicitrate transporter FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389193.1 protein_id gnl|my_center|LOCUS_38980 37567 40038 gene locus_tag LOCUS_38990 37567 40038 CDS product hemin receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708869.1 protein_id gnl|my_center|LOCUS_38990 40025 40825 gene locus_tag LOCUS_39000 40025 40825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113451.1 protein_id gnl|my_center|LOCUS_39000 >Feature sequence43 638 123 gene locus_tag LOCUS_39010 638 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038686.1 protein_id gnl|my_center|LOCUS_39010 1525 674 gene locus_tag LOCUS_39020 1525 674 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038687.1 protein_id gnl|my_center|LOCUS_39020 1801 1574 gene locus_tag LOCUS_39030 1801 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 2915 1956 gene locus_tag LOCUS_39040 2915 1956 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038688.1 protein_id gnl|my_center|LOCUS_39040 3042 3632 gene locus_tag LOCUS_39050 3042 3632 CDS product putative NADH dehydrogenase/NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4V1 protein_id gnl|my_center|LOCUS_39050 3708 4424 gene locus_tag LOCUS_39060 3708 4424 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038690.1 protein_id gnl|my_center|LOCUS_39060 5026 4625 gene locus_tag LOCUS_39070 5026 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 5177 6010 gene locus_tag LOCUS_39080 5177 6010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 7189 6392 gene locus_tag LOCUS_39090 gene mxcB 7189 6392 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038691.1 protein_id gnl|my_center|LOCUS_39090 7810 7250 gene locus_tag LOCUS_39100 7810 7250 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038692.1 protein_id gnl|my_center|LOCUS_39100 8356 11043 gene locus_tag LOCUS_39110 gene aceE 8356 11043 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4T1 protein_id gnl|my_center|LOCUS_39110 11106 14144 gene locus_tag LOCUS_39120 11106 14144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 14774 14406 gene locus_tag LOCUS_39130 14774 14406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 14722 14937 gene locus_tag LOCUS_39140 14722 14937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 15654 15229 gene locus_tag LOCUS_39150 15654 15229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 15888 17033 gene locus_tag LOCUS_39160 gene yncE 15888 17033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550675.1 protein_id gnl|my_center|LOCUS_39160 17187 18101 gene locus_tag LOCUS_39170 17187 18101 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530589.1 protein_id gnl|my_center|LOCUS_39170 18843 18160 gene locus_tag LOCUS_39180 18843 18160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 19738 21591 gene locus_tag LOCUS_39190 19738 21591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 21588 22265 gene locus_tag LOCUS_39200 21588 22265 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266570.1 protein_id gnl|my_center|LOCUS_39200 22823 22344 gene locus_tag LOCUS_39210 22823 22344 CDS product DUF4440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918775.1 protein_id gnl|my_center|LOCUS_39210 23044 23856 gene locus_tag LOCUS_39220 23044 23856 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383500.1 protein_id gnl|my_center|LOCUS_39220 23866 24039 gene locus_tag LOCUS_39230 23866 24039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036510.1 protein_id gnl|my_center|LOCUS_39230 24180 24854 gene locus_tag LOCUS_39240 24180 24854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 25993 24851 gene locus_tag LOCUS_39250 25993 24851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 26094 27062 gene locus_tag LOCUS_39260 26094 27062 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947709.1 protein_id gnl|my_center|LOCUS_39260 27787 27182 gene locus_tag LOCUS_39270 27787 27182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 27671 27997 gene locus_tag LOCUS_39280 27671 27997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 29025 28099 gene locus_tag LOCUS_39290 29025 28099 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038631.1 protein_id gnl|my_center|LOCUS_39290 29438 29022 gene locus_tag LOCUS_39300 29438 29022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 29530 29814 gene locus_tag LOCUS_39310 29530 29814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 30185 29811 gene locus_tag LOCUS_39320 30185 29811 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035511.1 protein_id gnl|my_center|LOCUS_39320 30255 31580 gene locus_tag LOCUS_39330 30255 31580 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035512.1 protein_id gnl|my_center|LOCUS_39330 33259 31652 gene locus_tag LOCUS_39340 33259 31652 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895566.1 protein_id gnl|my_center|LOCUS_39340 34322 33423 gene locus_tag LOCUS_39350 34322 33423 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113086.1 protein_id gnl|my_center|LOCUS_39350 34473 35729 gene locus_tag LOCUS_39360 34473 35729 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526239.1 protein_id gnl|my_center|LOCUS_39360 35726 36910 gene locus_tag LOCUS_39370 35726 36910 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188971.1 protein_id gnl|my_center|LOCUS_39370 38839 37223 gene locus_tag LOCUS_39380 38839 37223 CDS product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038952.1 protein_id gnl|my_center|LOCUS_39380 >Feature sequence44 2674 500 gene locus_tag LOCUS_39390 gene bglX 2674 500 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038895.1 protein_id gnl|my_center|LOCUS_39390 4074 2803 gene locus_tag LOCUS_39400 4074 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103754.1 protein_id gnl|my_center|LOCUS_39400 4515 4162 gene locus_tag LOCUS_39410 gene folB 4515 4162 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P495 protein_id gnl|my_center|LOCUS_39410 5262 4933 gene locus_tag LOCUS_39420 5262 4933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 5336 5539 gene locus_tag LOCUS_39430 5336 5539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 6579 5596 gene locus_tag LOCUS_39440 gene tsaD 6579 5596 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P494 protein_id gnl|my_center|LOCUS_39440 6788 7003 gene locus_tag LOCUS_39450 gene rpsU 6788 7003 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66536 protein_id gnl|my_center|LOCUS_39450 7137 7583 gene locus_tag LOCUS_39460 7137 7583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038898.1 protein_id gnl|my_center|LOCUS_39460 8591 7662 gene locus_tag LOCUS_39470 8591 7662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 8883 9731 gene locus_tag LOCUS_39480 gene rbn 8883 9731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038899.1 protein_id gnl|my_center|LOCUS_39480 9792 11531 gene locus_tag LOCUS_39490 gene dnaG 9792 11531 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P491 protein_id gnl|my_center|LOCUS_39490 11559 12059 gene locus_tag LOCUS_39500 11559 12059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038901.1 protein_id gnl|my_center|LOCUS_39500 12088 13059 gene locus_tag LOCUS_39510 12088 13059 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038902.1 protein_id gnl|my_center|LOCUS_39510 13755 13153 gene locus_tag LOCUS_39520 13755 13153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 14201 13902 gene locus_tag LOCUS_39530 14201 13902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 15362 14541 gene locus_tag LOCUS_39540 15362 14541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 16401 15508 gene locus_tag LOCUS_39550 gene cyoE 16401 15508 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P487 protein_id gnl|my_center|LOCUS_39550 17569 16406 gene locus_tag LOCUS_39560 17569 16406 CDS product cytochrome oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038905.1 protein_id gnl|my_center|LOCUS_39560 18149 17580 gene locus_tag LOCUS_39570 18149 17580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038906.1 protein_id gnl|my_center|LOCUS_39570 18971 18258 gene locus_tag LOCUS_39580 18971 18258 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P484 protein_id gnl|my_center|LOCUS_39580 19032 19250 gene locus_tag LOCUS_39590 19032 19250 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038908.1 protein_id gnl|my_center|LOCUS_39590 20146 19271 gene locus_tag LOCUS_39600 gene cox3 20146 19271 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038909.1 protein_id gnl|my_center|LOCUS_39600 20750 20160 gene locus_tag LOCUS_39610 gene cox11 20750 20160 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038910.1 protein_id gnl|my_center|LOCUS_39610 21016 20747 gene locus_tag LOCUS_39620 21016 20747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 22632 21025 gene locus_tag LOCUS_39630 gene ctaD 22632 21025 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P479 protein_id gnl|my_center|LOCUS_39630 23516 22695 gene locus_tag LOCUS_39640 23516 22695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 23467 23649 gene locus_tag LOCUS_39650 23467 23649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 24130 23654 gene locus_tag LOCUS_39660 24130 23654 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038914.1 protein_id gnl|my_center|LOCUS_39660 24366 27623 gene locus_tag LOCUS_39670 gene putA 24366 27623 CDS product bifunctional protein PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P476 protein_id gnl|my_center|LOCUS_39670 28260 27679 gene locus_tag LOCUS_39680 28260 27679 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088324.1 protein_id gnl|my_center|LOCUS_39680 29795 28368 gene locus_tag LOCUS_39690 gene ompP1 29795 28368 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035275.1 protein_id gnl|my_center|LOCUS_39690 30021 30713 gene locus_tag LOCUS_39700 30021 30713 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035276.1 protein_id gnl|my_center|LOCUS_39700 32241 30781 gene locus_tag LOCUS_39710 gene ctp 32241 30781 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035279.1 protein_id gnl|my_center|LOCUS_39710 33648 32350 gene locus_tag LOCUS_39720 33648 32350 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035280.1 protein_id gnl|my_center|LOCUS_39720 33744 34406 gene locus_tag LOCUS_39730 33744 34406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035281.1 protein_id gnl|my_center|LOCUS_39730 34491 36200 gene locus_tag LOCUS_39740 34491 36200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 protein_id gnl|my_center|LOCUS_39740 36564 36460 gene locus_tag LOCUS_r00010 36564 36460 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence45 2703 61 gene locus_tag LOCUS_39750 2703 61 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038446.1 protein_id gnl|my_center|LOCUS_39750 3936 2770 gene locus_tag LOCUS_39760 gene oprO 3936 2770 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038445.1 protein_id gnl|my_center|LOCUS_39760 3942 4091 gene locus_tag LOCUS_39770 3942 4091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39770 4266 5609 gene locus_tag LOCUS_39780 gene dctA 4266 5609 CDS product C4-dicarboxylate transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5J5 protein_id gnl|my_center|LOCUS_39780 5840 8131 gene locus_tag LOCUS_39790 gene maeB 5840 8131 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638691.2 protein_id gnl|my_center|LOCUS_39790 9285 8551 gene locus_tag LOCUS_39800 9285 8551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 12635 9291 gene locus_tag LOCUS_39810 12635 9291 CDS product alpha-1,2-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638688.2 protein_id gnl|my_center|LOCUS_39810 13012 13209 gene locus_tag LOCUS_39820 13012 13209 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038440.1 protein_id gnl|my_center|LOCUS_39820 13225 14340 gene locus_tag LOCUS_39830 13225 14340 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038439.1 protein_id gnl|my_center|LOCUS_39830 14321 15652 gene locus_tag LOCUS_39840 14321 15652 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038438.1 protein_id gnl|my_center|LOCUS_39840 15789 16238 gene locus_tag LOCUS_39850 15789 16238 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247110.1 protein_id gnl|my_center|LOCUS_39850 17198 16281 gene locus_tag LOCUS_39860 gene htrB 17198 16281 CDS product lipid A biosynthesis lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5K2 protein_id gnl|my_center|LOCUS_39860 17259 18557 gene locus_tag LOCUS_39870 gene kdtA 17259 18557 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038436.1 protein_id gnl|my_center|LOCUS_39870 18799 20025 gene locus_tag LOCUS_39880 18799 20025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 21482 20124 gene locus_tag LOCUS_39890 gene tolC 21482 20124 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038435.1 protein_id gnl|my_center|LOCUS_39890 22146 21499 gene locus_tag LOCUS_39900 gene pcm 22146 21499 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038434.1 protein_id gnl|my_center|LOCUS_39900 22963 22283 gene locus_tag LOCUS_39910 22963 22283 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038433.1 protein_id gnl|my_center|LOCUS_39910 23089 24216 gene locus_tag LOCUS_39920 23089 24216 CDS product resistance-nodulation-cell division efflux membrane fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113855.1 protein_id gnl|my_center|LOCUS_39920 24221 27382 gene locus_tag LOCUS_39930 24221 27382 CDS product resistance-nodulation-cell division efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092464.1 protein_id gnl|my_center|LOCUS_39930 28371 27466 gene locus_tag LOCUS_39940 gene gstR 28371 27466 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973782.1 protein_id gnl|my_center|LOCUS_39940 28489 29262 gene locus_tag LOCUS_39950 gene sdhX 28489 29262 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973781.1 protein_id gnl|my_center|LOCUS_39950 30569 29508 gene locus_tag LOCUS_39960 gene leuB 30569 29508 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAR7 protein_id gnl|my_center|LOCUS_39960 31137 30559 gene locus_tag LOCUS_39970 gene leuD 31137 30559 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC30 protein_id gnl|my_center|LOCUS_39970 32555 31137 gene locus_tag LOCUS_39980 gene leuC 32555 31137 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC29 protein_id gnl|my_center|LOCUS_39980 33395 32616 gene locus_tag LOCUS_39990 33395 32616 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887149.1 protein_id gnl|my_center|LOCUS_39990 >Feature sequence46 1341 310 gene locus_tag LOCUS_40000 1341 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 1430 2764 gene locus_tag LOCUS_40010 1430 2764 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551357.1 protein_id gnl|my_center|LOCUS_40010 2892 5162 gene locus_tag LOCUS_40020 2892 5162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 5200 6069 gene locus_tag LOCUS_40030 gene cheR 5200 6069 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9J5 protein_id gnl|my_center|LOCUS_40030 6066 6662 gene locus_tag LOCUS_40040 gene cheD 6066 6662 CDS product putative chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9J6 protein_id gnl|my_center|LOCUS_40040 6659 7732 gene locus_tag LOCUS_40050 gene cheB1 6659 7732 CDS product chemotaxis response regulator protein-glutamate methylesterase of group 1 operon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9J7 protein_id gnl|my_center|LOCUS_40050 7817 9814 gene locus_tag LOCUS_40060 7817 9814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40060 10309 9884 gene locus_tag LOCUS_40070 10309 9884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 13030 10427 gene locus_tag LOCUS_40080 gene acnB 13030 10427 CDS product aconitate hydratase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9K0 protein_id gnl|my_center|LOCUS_40080 13476 13075 gene locus_tag LOCUS_40090 gene vapC 13476 13075 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9K1 protein_id gnl|my_center|LOCUS_40090 13704 13480 gene locus_tag LOCUS_40100 13704 13480 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037031.1 protein_id gnl|my_center|LOCUS_40100 14006 16759 gene locus_tag LOCUS_40110 gene rpfA 14006 16759 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9K3 protein_id gnl|my_center|LOCUS_40110 18461 16911 gene locus_tag LOCUS_40120 gene betT 18461 16911 CDS product choline transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206021.1 protein_id gnl|my_center|LOCUS_40120 18632 19222 gene locus_tag LOCUS_40130 gene betI 18632 19222 CDS product HTH-type transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTJ0 protein_id gnl|my_center|LOCUS_40130 19262 20734 gene locus_tag LOCUS_40140 gene betB 19262 20734 CDS product NAD/NADP-dependent betaine aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG77 protein_id gnl|my_center|LOCUS_40140 20836 22518 gene locus_tag LOCUS_40150 gene betA 20836 22518 CDS product oxygen-dependent choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTJ2 protein_id gnl|my_center|LOCUS_40150 22777 24453 gene locus_tag LOCUS_40160 gene rpfB 22777 24453 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037028.1 protein_id gnl|my_center|LOCUS_40160 24653 25522 gene locus_tag LOCUS_40170 gene rpfF 24653 25522 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037027.1 protein_id gnl|my_center|LOCUS_40170 28258 25535 gene locus_tag LOCUS_40180 gene rpfC 28258 25535 CDS product sensory/regulatory protein RpfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C0F6 protein_id gnl|my_center|LOCUS_40180 29273 28260 gene locus_tag LOCUS_40190 gene rpfG 29273 28260 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037024.1 protein_id gnl|my_center|LOCUS_40190 31128 29617 gene locus_tag LOCUS_40200 gene lysS 31128 29617 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L3G6 protein_id gnl|my_center|LOCUS_40200 >Feature sequence47 122 1870 gene locus_tag LOCUS_40210 gene glnS 122 1870 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCB3 protein_id gnl|my_center|LOCUS_40210 1914 2576 gene locus_tag LOCUS_40220 1914 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 2626 3348 gene locus_tag LOCUS_40230 2626 3348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 3446 4006 gene locus_tag LOCUS_40240 3446 4006 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036053.1 protein_id gnl|my_center|LOCUS_40240 3990 5057 gene locus_tag LOCUS_40250 gene rlmM 3990 5057 CDS product ribosomal RNA large subunit methyltransferase M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCB8 protein_id gnl|my_center|LOCUS_40250 5107 5502 gene locus_tag LOCUS_40260 5107 5502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 6800 5619 gene locus_tag LOCUS_40270 gene visC 6800 5619 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036035.1 protein_id gnl|my_center|LOCUS_40270 8005 6797 gene locus_tag LOCUS_40280 gene ubiH 8005 6797 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036034.1 protein_id gnl|my_center|LOCUS_40280 8113 8697 gene locus_tag LOCUS_40290 8113 8697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036033.1 protein_id gnl|my_center|LOCUS_40290 8706 9260 gene locus_tag LOCUS_40300 8706 9260 CDS product ATP--cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036032.1 protein_id gnl|my_center|LOCUS_40300 9270 10208 gene locus_tag LOCUS_40310 9270 10208 CDS product acetoin utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036031.1 protein_id gnl|my_center|LOCUS_40310 10256 12796 gene locus_tag LOCUS_40320 gene lptD 10256 12796 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCE0 protein_id gnl|my_center|LOCUS_40320 12793 14136 gene locus_tag LOCUS_40330 gene surA 12793 14136 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCE1 protein_id gnl|my_center|LOCUS_40330 14140 15120 gene locus_tag LOCUS_40340 gene pdxA 14140 15120 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCE2 protein_id gnl|my_center|LOCUS_40340 15117 15920 gene locus_tag LOCUS_40350 gene rsmA 15117 15920 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCE3 protein_id gnl|my_center|LOCUS_40350 15934 16317 gene locus_tag LOCUS_40360 gene apaG 15934 16317 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCE4 protein_id gnl|my_center|LOCUS_40360 16333 17352 gene locus_tag LOCUS_40370 gene apaH 16333 17352 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCE5 protein_id gnl|my_center|LOCUS_40370 17352 17996 gene locus_tag LOCUS_40380 17352 17996 CDS product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104401.1 protein_id gnl|my_center|LOCUS_40380 18565 18074 gene locus_tag LOCUS_40390 gene folA 18565 18074 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCE6 protein_id gnl|my_center|LOCUS_40390 19365 18571 gene locus_tag LOCUS_40400 gene thyA 19365 18571 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCE7 protein_id gnl|my_center|LOCUS_40400 20249 19362 gene locus_tag LOCUS_40410 gene lgt 20249 19362 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCE8 protein_id gnl|my_center|LOCUS_40410 20795 20301 gene locus_tag LOCUS_40420 20795 20301 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036021.1 protein_id gnl|my_center|LOCUS_40420 21475 20795 gene locus_tag LOCUS_40430 21475 20795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 22099 21479 gene locus_tag LOCUS_40440 22099 21479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036019.1 protein_id gnl|my_center|LOCUS_40440 23815 22655 gene locus_tag LOCUS_40450 23815 22655 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811192.1 protein_id gnl|my_center|LOCUS_40450 24761 24012 gene locus_tag LOCUS_40460 24761 24012 CDS product UPF0053 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43932 protein_id gnl|my_center|LOCUS_40460 25241 24795 gene locus_tag LOCUS_40470 gene dgkA 25241 24795 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036018.1 protein_id gnl|my_center|LOCUS_40470 25370 26104 gene locus_tag LOCUS_40480 25370 26104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036017.1 protein_id gnl|my_center|LOCUS_40480 27510 26239 gene locus_tag LOCUS_40490 gene colS 27510 26239 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036016.1 protein_id gnl|my_center|LOCUS_40490 28380 27667 gene locus_tag LOCUS_40500 gene colR 28380 27667 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036015.1 protein_id gnl|my_center|LOCUS_40500 29112 28468 gene locus_tag LOCUS_40510 gene tesA 29112 28468 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036014.1 protein_id gnl|my_center|LOCUS_40510 29105 29836 gene locus_tag LOCUS_40520 gene ftsE 29105 29836 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036013.1 protein_id gnl|my_center|LOCUS_40520 >Feature sequence48 <1 1889 gene locus_tag LOCUS_40530 <1 1889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001883956.1:hydrolase 1909 3054 gene locus_tag LOCUS_40540 1909 3054 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816230.1 protein_id gnl|my_center|LOCUS_40540 3047 3904 gene locus_tag LOCUS_40550 3047 3904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813227.1 protein_id gnl|my_center|LOCUS_40550 5318 3867 gene locus_tag LOCUS_40560 5318 3867 CDS product outer membrane efflux lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204730.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40560 8527 5315 gene locus_tag LOCUS_40570 gene acrD 8527 5315 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038869.1 protein_id gnl|my_center|LOCUS_40570 11649 8524 gene locus_tag LOCUS_40580 11649 8524 CDS product transport system membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204974.1 protein_id gnl|my_center|LOCUS_40580 12797 11649 gene locus_tag LOCUS_40590 12797 11649 CDS product transport system membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534674.1 protein_id gnl|my_center|LOCUS_40590 13483 13001 gene locus_tag LOCUS_40600 13483 13001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 15129 13768 gene locus_tag LOCUS_40610 gene glmM 15129 13768 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7S2 protein_id gnl|my_center|LOCUS_40610 16004 15129 gene locus_tag LOCUS_40620 gene accD 16004 15129 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7S1 protein_id gnl|my_center|LOCUS_40620 17027 16218 gene locus_tag LOCUS_40630 gene trpA 17027 16218 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7S0 protein_id gnl|my_center|LOCUS_40630 17709 17029 gene locus_tag LOCUS_40640 17709 17029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 18932 17715 gene locus_tag LOCUS_40650 gene trpB 18932 17715 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7R8 protein_id gnl|my_center|LOCUS_40650 19030 19917 gene locus_tag LOCUS_40660 19030 19917 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266143.1 protein_id gnl|my_center|LOCUS_40660 20601 19945 gene locus_tag LOCUS_40670 gene trpF 20601 19945 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7R6 protein_id gnl|my_center|LOCUS_40670 21368 20598 gene locus_tag LOCUS_40680 gene truA 21368 20598 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7R5 protein_id gnl|my_center|LOCUS_40680 21793 21401 gene locus_tag LOCUS_40690 21793 21401 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037677.1 protein_id gnl|my_center|LOCUS_40690 23781 21790 gene locus_tag LOCUS_40700 gene fimV 23781 21790 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037678.1 protein_id gnl|my_center|LOCUS_40700 24960 23932 gene locus_tag LOCUS_40710 gene asd 24960 23932 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7R2 protein_id gnl|my_center|LOCUS_40710 26089 25052 gene locus_tag LOCUS_40720 26089 25052 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037680.1 protein_id gnl|my_center|LOCUS_40720 27185 26082 gene locus_tag LOCUS_40730 gene aroC 27185 26082 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7R0 protein_id gnl|my_center|LOCUS_40730 28111 27182 gene locus_tag LOCUS_40740 gene prmB 28111 27182 CDS product 50S ribosomal protein L3 glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7Q8 protein_id gnl|my_center|LOCUS_40740 28234 28884 gene locus_tag LOCUS_40750 28234 28884 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037684.1 protein_id gnl|my_center|LOCUS_40750 28881 29723 gene locus_tag LOCUS_40760 gene psd 28881 29723 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7Q6 protein_id gnl|my_center|LOCUS_40760 >Feature sequence49 168 596 gene locus_tag LOCUS_40770 gene rplM 168 596 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CLV7 protein_id gnl|my_center|LOCUS_40770 599 991 gene locus_tag LOCUS_40780 gene rpsI 599 991 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD66 protein_id gnl|my_center|LOCUS_40780 1348 1274 gene locus_tag LOCUS_t00530 1348 1274 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1480 1404 gene locus_tag LOCUS_t00540 1480 1404 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1602 2222 gene locus_tag LOCUS_40790 gene rppH 1602 2222 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD65 protein_id gnl|my_center|LOCUS_40790 2331 2540 gene locus_tag LOCUS_40800 2331 2540 CDS product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035730.1 protein_id gnl|my_center|LOCUS_40800 2684 3154 gene locus_tag LOCUS_40810 gene bfr 2684 3154 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD63 protein_id gnl|my_center|LOCUS_40810 5379 3178 gene locus_tag LOCUS_40820 5379 3178 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035732.1 protein_id gnl|my_center|LOCUS_40820 7267 5381 gene locus_tag LOCUS_40830 7267 5381 CDS product two-component system regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635876.2 protein_id gnl|my_center|LOCUS_40830 7929 7312 gene locus_tag LOCUS_40840 7929 7312 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035734.1 protein_id gnl|my_center|LOCUS_40840 8109 8852 gene locus_tag LOCUS_40850 8109 8852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635878.2 protein_id gnl|my_center|LOCUS_40850 8857 9321 gene locus_tag LOCUS_40860 8857 9321 CDS product cell shape determination protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035736.1 protein_id gnl|my_center|LOCUS_40860 9353 9745 gene locus_tag LOCUS_40870 gene erpA 9353 9745 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD57 protein_id gnl|my_center|LOCUS_40870 9883 10788 gene locus_tag LOCUS_40880 gene nudC 9883 10788 CDS product NADH pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035738.1 protein_id gnl|my_center|LOCUS_40880 10922 11809 gene locus_tag LOCUS_40890 10922 11809 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035739.1 protein_id gnl|my_center|LOCUS_40890 12826 12401 gene locus_tag LOCUS_40900 12826 12401 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035740.1 protein_id gnl|my_center|LOCUS_40900 13148 12870 gene locus_tag LOCUS_40910 13148 12870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 13470 13183 gene locus_tag LOCUS_40920 13470 13183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 15541 13652 gene locus_tag LOCUS_40930 gene aas 15541 13652 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035742.1 protein_id gnl|my_center|LOCUS_40930 16489 15695 gene locus_tag LOCUS_40940 16489 15695 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703218.1 protein_id gnl|my_center|LOCUS_40940 18810 16633 gene locus_tag LOCUS_40950 18810 16633 CDS product TIGR01666 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035745.1 protein_id gnl|my_center|LOCUS_40950 22072 18950 gene locus_tag LOCUS_40960 gene acrA 22072 18950 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038870.1 protein_id gnl|my_center|LOCUS_40960 25337 22104 gene locus_tag LOCUS_40970 gene acrD 25337 22104 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038869.1 protein_id gnl|my_center|LOCUS_40970 26656 25412 gene locus_tag LOCUS_40980 gene mtrC 26656 25412 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038868.1 protein_id gnl|my_center|LOCUS_40980 26789 28162 gene locus_tag LOCUS_40990 gene amaA 26789 28162 CDS product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 protein_id gnl|my_center|LOCUS_40990 >Feature sequence50 <1 727 gene locus_tag LOCUS_41000 <1 727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037883.1:membrane protein 1343 801 gene locus_tag LOCUS_41010 gene tag 1343 801 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037880.1 protein_id gnl|my_center|LOCUS_41010 1433 1999 gene locus_tag LOCUS_41020 1433 1999 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P765 protein_id gnl|my_center|LOCUS_41020 1992 2486 gene locus_tag LOCUS_41030 1992 2486 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P766 protein_id gnl|my_center|LOCUS_41030 2503 3453 gene locus_tag LOCUS_41040 gene pyrB 2503 3453 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P767 protein_id gnl|my_center|LOCUS_41040 3791 4282 gene locus_tag LOCUS_41050 3791 4282 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269020.1 protein_id gnl|my_center|LOCUS_41050 5181 4384 gene locus_tag LOCUS_41060 5181 4384 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037937.1 protein_id gnl|my_center|LOCUS_41060 5518 5252 gene locus_tag LOCUS_41070 5518 5252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 6940 5579 gene locus_tag LOCUS_41080 gene mgtE 6940 5579 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P704 protein_id gnl|my_center|LOCUS_41080 8836 7067 gene locus_tag LOCUS_41090 gene ptsI 8836 7067 CDS product phosphoenolpyruvate-protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P705 protein_id gnl|my_center|LOCUS_41090 9108 8839 gene locus_tag LOCUS_41100 gene ptsH 9108 8839 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037934.1 protein_id gnl|my_center|LOCUS_41100 9493 9101 gene locus_tag LOCUS_41110 9493 9101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037933.1 protein_id gnl|my_center|LOCUS_41110 10787 9903 gene locus_tag LOCUS_41120 10787 9903 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P708 protein_id gnl|my_center|LOCUS_41120 11763 10813 gene locus_tag LOCUS_41130 gene hprK 11763 10813 CDS product HPr kinase/phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P709 protein_id gnl|my_center|LOCUS_41130 12212 11760 gene locus_tag LOCUS_41140 gene ptsN 12212 11760 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037931.1 protein_id gnl|my_center|LOCUS_41140 12551 12234 gene locus_tag LOCUS_41150 12551 12234 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037930.1 protein_id gnl|my_center|LOCUS_41150 14007 12610 gene locus_tag LOCUS_41160 gene rpoN 14007 12610 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P712 protein_id gnl|my_center|LOCUS_41160 14791 14072 gene locus_tag LOCUS_41170 gene yhbG 14791 14072 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037928.1 protein_id gnl|my_center|LOCUS_41170 15318 14791 gene locus_tag LOCUS_41180 gene lptA 15318 14791 CDS product lipopolysaccharide export system protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P714 protein_id gnl|my_center|LOCUS_41180 15993 15418 gene locus_tag LOCUS_41190 gene lptC 15993 15418 CDS product lipopolysaccharide export system protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P715 protein_id gnl|my_center|LOCUS_41190 16538 15990 gene locus_tag LOCUS_41200 16538 15990 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037925.1 protein_id gnl|my_center|LOCUS_41200 17605 16604 gene locus_tag LOCUS_41210 gene kpsF 17605 16604 CDS product arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P717 protein_id gnl|my_center|LOCUS_41210 17660 17890 gene locus_tag LOCUS_41220 17660 17890 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037923.1 protein_id gnl|my_center|LOCUS_41220 17912 19183 gene locus_tag LOCUS_41230 gene murA 17912 19183 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P719 protein_id gnl|my_center|LOCUS_41230 19180 19506 gene locus_tag LOCUS_41240 19180 19506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037921.1 protein_id gnl|my_center|LOCUS_41240 20312 19629 gene locus_tag LOCUS_41250 20312 19629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638141.2 protein_id gnl|my_center|LOCUS_41250 21103 20315 gene locus_tag LOCUS_41260 21103 20315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638140.2 protein_id gnl|my_center|LOCUS_41260 21824 21171 gene locus_tag LOCUS_41270 gene purN 21824 21171 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P723 protein_id gnl|my_center|LOCUS_41270 22258 21821 gene locus_tag LOCUS_41280 22258 21821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 22751 22266 gene locus_tag LOCUS_41290 22751 22266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037917.1 protein_id gnl|my_center|LOCUS_41290 23830 22772 gene locus_tag LOCUS_41300 gene purM 23830 22772 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P725 protein_id gnl|my_center|LOCUS_41300 23943 25070 gene locus_tag LOCUS_41310 23943 25070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037915.1 protein_id gnl|my_center|LOCUS_41310 25067 26236 gene locus_tag LOCUS_41320 gene perM 25067 26236 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037914.1 protein_id gnl|my_center|LOCUS_41320 26236 26943 gene locus_tag LOCUS_41330 26236 26943 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037913.1 protein_id gnl|my_center|LOCUS_41330 >Feature sequence51 768 208 gene locus_tag LOCUS_41340 768 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41340 895 1518 gene locus_tag LOCUS_41350 895 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41350 1592 2551 gene locus_tag LOCUS_41360 1592 2551 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730062.1 protein_id gnl|my_center|LOCUS_41360 3012 2623 gene locus_tag LOCUS_41370 3012 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 3293 3009 gene locus_tag LOCUS_41380 gene phaF 3293 3009 CDS product K+/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035695.1 protein_id gnl|my_center|LOCUS_41380 3796 3290 gene locus_tag LOCUS_41390 gene phaE 3796 3290 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035696.1 protein_id gnl|my_center|LOCUS_41390 5328 3793 gene locus_tag LOCUS_41400 gene phaD 5328 3793 CDS product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035697.1 protein_id gnl|my_center|LOCUS_41400 5717 5325 gene locus_tag LOCUS_41410 gene phaC 5717 5325 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035698.1 protein_id gnl|my_center|LOCUS_41410 8545 5717 gene locus_tag LOCUS_41420 gene ndhF 8545 5717 CDS product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035699.1 protein_id gnl|my_center|LOCUS_41420 9364 8879 gene locus_tag LOCUS_41430 9364 8879 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035701.1 protein_id gnl|my_center|LOCUS_41430 10510 9584 gene locus_tag LOCUS_41440 gene purC 10510 9584 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD87 protein_id gnl|my_center|LOCUS_41440 10652 10981 gene locus_tag LOCUS_41450 10652 10981 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035707.1 protein_id gnl|my_center|LOCUS_41450 11012 11686 gene locus_tag LOCUS_41460 gene rpe 11012 11686 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD84 protein_id gnl|my_center|LOCUS_41460 11747 12229 gene locus_tag LOCUS_41470 11747 12229 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537307.1 protein_id gnl|my_center|LOCUS_41470 12478 13431 gene locus_tag LOCUS_41480 12478 13431 CDS product putative lipid kinase YegS-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD82 protein_id gnl|my_center|LOCUS_41480 13629 15104 gene locus_tag LOCUS_41490 gene trpE 13629 15104 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035712.1 protein_id gnl|my_center|LOCUS_41490 15171 15950 gene locus_tag LOCUS_41500 15171 15950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 15953 16540 gene locus_tag LOCUS_41510 gene trpG 15953 16540 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035720.1 protein_id gnl|my_center|LOCUS_41510 16557 17588 gene locus_tag LOCUS_41520 gene trpD 16557 17588 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD71 protein_id gnl|my_center|LOCUS_41520 17666 18460 gene locus_tag LOCUS_41530 gene trpC 17666 18460 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD70 protein_id gnl|my_center|LOCUS_41530 18457 19173 gene locus_tag LOCUS_41540 18457 19173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035724.1 protein_id gnl|my_center|LOCUS_41540 19976 19215 gene locus_tag LOCUS_41550 19976 19215 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UKF4 protein_id gnl|my_center|LOCUS_41550 20704 20039 gene locus_tag LOCUS_41560 gene clp 20704 20039 CDS product CRP-like protein Clp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22260 protein_id gnl|my_center|LOCUS_41560 20878 21672 gene locus_tag LOCUS_41570 gene speD 20878 21672 CDS product S-adenosylmethionine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X4I6 protein_id gnl|my_center|LOCUS_41570 21840 22160 gene locus_tag LOCUS_41580 gene sugE 21840 22160 CDS product QacE family quaternary ammonium compound efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035726.1 protein_id gnl|my_center|LOCUS_41580 22892 22248 gene locus_tag LOCUS_41590 gene coq7 22892 22248 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD67 protein_id gnl|my_center|LOCUS_41590 >Feature sequence52 158 4078 gene locus_tag LOCUS_41600 gene purL 158 4078 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCQ7 protein_id gnl|my_center|LOCUS_41600 4520 11698 gene locus_tag LOCUS_41610 gene xadA 4520 11698 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035898.1 protein_id gnl|my_center|LOCUS_41610 12339 11950 gene locus_tag LOCUS_41620 12339 11950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 13566 12772 gene locus_tag LOCUS_41630 13566 12772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 14148 13576 gene locus_tag LOCUS_41640 14148 13576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 14717 14220 gene locus_tag LOCUS_41650 14717 14220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 14667 14942 gene locus_tag LOCUS_41660 14667 14942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 18402 14899 gene locus_tag LOCUS_41670 18402 14899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 18982 18623 gene locus_tag LOCUS_41680 18982 18623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 19813 19268 gene locus_tag LOCUS_41690 19813 19268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 >Feature sequence53 1196 102 gene locus_tag LOCUS_41700 gene tcbD 1196 102 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038888.1 protein_id gnl|my_center|LOCUS_41700 2633 1197 gene locus_tag LOCUS_41710 2633 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038887.1 protein_id gnl|my_center|LOCUS_41710 2766 4256 gene locus_tag LOCUS_41720 2766 4256 CDS product cysteine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202992.1 protein_id gnl|my_center|LOCUS_41720 4308 7307 gene locus_tag LOCUS_41730 gene oar 4308 7307 CDS product Oar protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039298.1 protein_id gnl|my_center|LOCUS_41730 7295 8887 gene locus_tag LOCUS_41740 7295 8887 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920922.1 protein_id gnl|my_center|LOCUS_41740 8934 9533 gene locus_tag LOCUS_41750 gene ddpX 8934 9533 CDS product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4A9 protein_id gnl|my_center|LOCUS_41750 9601 9972 gene locus_tag LOCUS_41760 9601 9972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038880.1 protein_id gnl|my_center|LOCUS_41760 10205 10615 gene locus_tag LOCUS_41770 10205 10615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038879.1 protein_id gnl|my_center|LOCUS_41770 10711 11463 gene locus_tag LOCUS_41780 10711 11463 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038877.1 protein_id gnl|my_center|LOCUS_41780 11495 11983 gene locus_tag LOCUS_41790 11495 11983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 12149 13513 gene locus_tag LOCUS_41800 12149 13513 CDS product DUF1338 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038874.1 protein_id gnl|my_center|LOCUS_41800 15099 13585 gene locus_tag LOCUS_41810 15099 13585 CDS product acetyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038672.1 protein_id gnl|my_center|LOCUS_41810 15397 18192 gene locus_tag LOCUS_41820 gene glnE 15397 18192 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4V7 protein_id gnl|my_center|LOCUS_41820 <19162 18539 gene locus_tag LOCUS_41830 <19162 18539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038685.1:membrane protein >Feature sequence54 3321 2998 gene locus_tag LOCUS_41840 3321 2998 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478614.1 protein_id gnl|my_center|LOCUS_41840 3674 3321 gene locus_tag LOCUS_41850 3674 3321 CDS product multidrug transporter subunit MdtJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478736.1 protein_id gnl|my_center|LOCUS_41850 3835 4686 gene locus_tag LOCUS_41860 3835 4686 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211617.1 protein_id gnl|my_center|LOCUS_41860 5680 4760 gene locus_tag LOCUS_41870 5680 4760 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037185.1 protein_id gnl|my_center|LOCUS_41870 5812 7893 gene locus_tag LOCUS_41880 5812 7893 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815510.1 protein_id gnl|my_center|LOCUS_41880 7956 9728 gene locus_tag LOCUS_41890 7956 9728 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038079.1 protein_id gnl|my_center|LOCUS_41890 9831 10547 gene locus_tag LOCUS_41900 9831 10547 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090491.1 protein_id gnl|my_center|LOCUS_41900 11011 10604 gene locus_tag LOCUS_41910 11011 10604 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114472.1 protein_id gnl|my_center|LOCUS_41910 11075 11902 gene locus_tag LOCUS_41920 11075 11902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199880.1 protein_id gnl|my_center|LOCUS_41920 12285 11983 gene locus_tag LOCUS_41930 12285 11983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 13237 12395 gene locus_tag LOCUS_41940 13237 12395 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184872.1 protein_id gnl|my_center|LOCUS_41940 <18136 13299 gene locus_tag LOCUS_41950 <18136 13299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001033221.1:adhesin >Feature sequence55 933 238 gene locus_tag LOCUS_41960 933 238 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036626.1 protein_id gnl|my_center|LOCUS_41960 2495 1074 gene locus_tag LOCUS_41970 gene phr 2495 1074 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036625.1 protein_id gnl|my_center|LOCUS_41970 3192 2578 gene locus_tag LOCUS_41980 3192 2578 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846890.1 protein_id gnl|my_center|LOCUS_41980 4570 3203 gene locus_tag LOCUS_41990 4570 3203 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037525.1 protein_id gnl|my_center|LOCUS_41990 5682 4567 gene locus_tag LOCUS_42000 5682 4567 CDS product phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037526.1 protein_id gnl|my_center|LOCUS_42000 8243 5682 gene locus_tag LOCUS_42010 gene cirA 8243 5682 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037527.1 protein_id gnl|my_center|LOCUS_42010 8367 9032 gene locus_tag LOCUS_42020 gene upp 8367 9032 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RBJ3 protein_id gnl|my_center|LOCUS_42020 9575 9096 gene locus_tag LOCUS_42030 9575 9096 CDS product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367985.1 protein_id gnl|my_center|LOCUS_42030 9981 9556 gene locus_tag LOCUS_42040 9981 9556 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088047.1 protein_id gnl|my_center|LOCUS_42040 10041 10334 gene locus_tag LOCUS_42050 10041 10334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 11254 10418 gene locus_tag LOCUS_42060 11254 10418 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114721.1 protein_id gnl|my_center|LOCUS_42060 13156 11426 gene locus_tag LOCUS_42070 gene ggt 13156 11426 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037530.1 protein_id gnl|my_center|LOCUS_42070 13434 13153 gene locus_tag LOCUS_42080 13434 13153 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037531.1 protein_id gnl|my_center|LOCUS_42080 14057 13566 gene locus_tag LOCUS_42090 14057 13566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037532.1 protein_id gnl|my_center|LOCUS_42090 14627 14118 gene locus_tag LOCUS_42100 gene coaD 14627 14118 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P857 protein_id gnl|my_center|LOCUS_42100 15319 14654 gene locus_tag LOCUS_42110 15319 14654 CDS product ribosomal RNA small subunit methyltransferase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P856 protein_id gnl|my_center|LOCUS_42110 15816 17708 gene locus_tag LOCUS_42120 gene htpG 15816 17708 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3C5 protein_id gnl|my_center|LOCUS_42120 >Feature sequence56 566 111 gene locus_tag LOCUS_42130 gene slyA 566 111 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039231.1 protein_id gnl|my_center|LOCUS_42130 1179 1790 gene locus_tag LOCUS_42140 gene folE 1179 1790 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3B0 protein_id gnl|my_center|LOCUS_42140 1903 3372 gene locus_tag LOCUS_42150 1903 3372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039229.1 protein_id gnl|my_center|LOCUS_42150 3401 4060 gene locus_tag LOCUS_42160 3401 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039228.1 protein_id gnl|my_center|LOCUS_42160 4077 7457 gene locus_tag LOCUS_42170 4077 7457 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039227.1 protein_id gnl|my_center|LOCUS_42170 8342 7554 gene locus_tag LOCUS_42180 8342 7554 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3B5 protein_id gnl|my_center|LOCUS_42180 8436 8828 gene locus_tag LOCUS_42190 8436 8828 CDS product UPF0225 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3B7 protein_id gnl|my_center|LOCUS_42190 10112 8832 gene locus_tag LOCUS_42200 10112 8832 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103166.1 protein_id gnl|my_center|LOCUS_42200 10224 11534 gene locus_tag LOCUS_42210 10224 11534 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035424.1 protein_id gnl|my_center|LOCUS_42210 11531 12505 gene locus_tag LOCUS_42220 11531 12505 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035425.1 protein_id gnl|my_center|LOCUS_42220 12589 13854 gene locus_tag LOCUS_42230 12589 13854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_42230 13895 14785 gene locus_tag LOCUS_42240 13895 14785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_42240 14812 15603 gene locus_tag LOCUS_42250 14812 15603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42250 16797 15610 gene locus_tag LOCUS_42260 gene benE 16797 15610 CDS product benzoate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039217.1 protein_id gnl|my_center|LOCUS_42260 >Feature sequence57 3114 2764 gene locus_tag LOCUS_42270 3114 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 5891 3138 gene locus_tag LOCUS_42280 gene clpB 5891 3138 CDS product protease associated ATPase ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549921.1 protein_id gnl|my_center|LOCUS_42280 7049 5958 gene locus_tag LOCUS_42290 7049 5958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200010.1 protein_id gnl|my_center|LOCUS_42290 8848 7013 gene locus_tag LOCUS_42300 8848 7013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205262.1 protein_id gnl|my_center|LOCUS_42300 9336 8848 gene locus_tag LOCUS_42310 9336 8848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205263.1 protein_id gnl|my_center|LOCUS_42310 9960 9463 gene locus_tag LOCUS_42320 9960 9463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318810.1 protein_id gnl|my_center|LOCUS_42320 11597 10107 gene locus_tag LOCUS_42330 11597 10107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521953.1 protein_id gnl|my_center|LOCUS_42330 12101 11601 gene locus_tag LOCUS_42340 12101 11601 CDS product type VI secretion system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521952.1 protein_id gnl|my_center|LOCUS_42340 12755 12132 gene locus_tag LOCUS_42350 12755 12132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42350 13105 13617 gene locus_tag LOCUS_42360 13105 13617 CDS product type VI secretion system-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521950.1 protein_id gnl|my_center|LOCUS_42360 13834 15168 gene locus_tag LOCUS_42370 13834 15168 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521949.1 protein_id gnl|my_center|LOCUS_42370 15165 15959 gene locus_tag LOCUS_42380 15165 15959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521948.1 protein_id gnl|my_center|LOCUS_42380 >Feature sequence58 251 733 gene locus_tag LOCUS_42390 gene slyD 251 733 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7M9 protein_id gnl|my_center|LOCUS_42390 833 2077 gene locus_tag LOCUS_42400 gene yxaH 833 2077 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037711.1 protein_id gnl|my_center|LOCUS_42400 2081 3331 gene locus_tag LOCUS_42410 gene dadA 2081 3331 CDS product D-amino-acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037710.1 protein_id gnl|my_center|LOCUS_42410 3328 4686 gene locus_tag LOCUS_42420 3328 4686 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037709.1 protein_id gnl|my_center|LOCUS_42420 4871 5791 gene locus_tag LOCUS_42430 4871 5791 CDS product multidrug DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813145.1 protein_id gnl|my_center|LOCUS_42430 5824 6126 gene locus_tag LOCUS_42440 5824 6126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 6220 6894 gene locus_tag LOCUS_42450 6220 6894 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037707.1 protein_id gnl|my_center|LOCUS_42450 8615 7029 gene locus_tag LOCUS_42460 8615 7029 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089326.1 protein_id gnl|my_center|LOCUS_42460 9094 8612 gene locus_tag LOCUS_42470 9094 8612 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114391.1 protein_id gnl|my_center|LOCUS_42470 11229 9220 gene locus_tag LOCUS_42480 11229 9220 CDS product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037706.1 protein_id gnl|my_center|LOCUS_42480 <12952 11388 gene locus_tag LOCUS_42490 <12952 11388 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037704.1:peptidase >Feature sequence59 396 1037 gene locus_tag LOCUS_42500 gene mtnB 396 1037 CDS product methylthioribulose-1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9N3 protein_id gnl|my_center|LOCUS_42500 1130 1687 gene locus_tag LOCUS_42510 gene mtnD 1130 1687 CDS product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9N4 protein_id gnl|my_center|LOCUS_42510 1691 2386 gene locus_tag LOCUS_42520 gene mtnC 1691 2386 CDS product enolase-phosphatase E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9N5 protein_id gnl|my_center|LOCUS_42520 5113 2495 gene locus_tag LOCUS_42530 5113 2495 CDS product beta-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038016.1 protein_id gnl|my_center|LOCUS_42530 6401 5175 gene locus_tag LOCUS_42540 6401 5175 CDS product N-acylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036696.1 protein_id gnl|my_center|LOCUS_42540 7393 6398 gene locus_tag LOCUS_42550 gene scrK 7393 6398 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036695.1 protein_id gnl|my_center|LOCUS_42550 8714 7401 gene locus_tag LOCUS_42560 gene fucP 8714 7401 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036694.1 protein_id gnl|my_center|LOCUS_42560 9823 8774 gene locus_tag LOCUS_42570 9823 8774 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036693.1 protein_id gnl|my_center|LOCUS_42570 12385 9920 gene locus_tag LOCUS_42580 12385 9920 CDS product alpha-1 2-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039282.1 protein_id gnl|my_center|LOCUS_42580 >Feature sequence60 <1 1826 gene locus_tag LOCUS_42590 <1 1826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038579.1:aminopeptidase 1951 2682 gene locus_tag LOCUS_42600 1951 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038578.1 protein_id gnl|my_center|LOCUS_42600 2682 3305 gene locus_tag LOCUS_42610 2682 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114316.1 protein_id gnl|my_center|LOCUS_42610 4346 3408 gene locus_tag LOCUS_42620 4346 3408 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038567.1 protein_id gnl|my_center|LOCUS_42620 4630 5676 gene locus_tag LOCUS_42630 gene mreB 4630 5676 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003482734.1 protein_id gnl|my_center|LOCUS_42630 5798 6886 gene locus_tag LOCUS_42640 5798 6886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42640 6883 7368 gene locus_tag LOCUS_42650 gene mreD 6883 7368 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P574 protein_id gnl|my_center|LOCUS_42650 7372 9447 gene locus_tag LOCUS_42660 gene mrdA 7372 9447 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038564.1 protein_id gnl|my_center|LOCUS_42660 9444 10556 gene locus_tag LOCUS_42670 gene mrdB 9444 10556 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038563.1 protein_id gnl|my_center|LOCUS_42670 10683 11831 gene locus_tag LOCUS_42680 gene mrdB 10683 11831 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038563.1 protein_id gnl|my_center|LOCUS_42680 >Feature sequence61 2370 583 gene locus_tag LOCUS_42690 2370 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42690 3651 2524 gene locus_tag LOCUS_42700 3651 2524 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63XP4 protein_id gnl|my_center|LOCUS_42700 4424 3648 gene locus_tag LOCUS_42710 4424 3648 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704761.1 protein_id gnl|my_center|LOCUS_42710 5792 4458 gene locus_tag LOCUS_42720 gene agaZ 5792 4458 CDS product tagatose-6-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209876.1 protein_id gnl|my_center|LOCUS_42720 6747 5809 gene locus_tag LOCUS_42730 6747 5809 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390380.1 protein_id gnl|my_center|LOCUS_42730 7924 6740 gene locus_tag LOCUS_42740 gene agaS 7924 6740 CDS product putative tagatose-6-phosphate ketose/aldose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O50523 protein_id gnl|my_center|LOCUS_42740 8217 11576 gene locus_tag LOCUS_42750 8217 11576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42750 >Feature sequence62 232 157 gene locus_tag LOCUS_t00550 232 157 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 492 417 gene locus_tag LOCUS_t00560 492 417 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 622 547 gene locus_tag LOCUS_t00570 622 547 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1123 725 gene locus_tag LOCUS_42760 1123 725 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429838.1 protein_id gnl|my_center|LOCUS_42760 1310 2377 gene locus_tag LOCUS_42770 1310 2377 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967910.1 protein_id gnl|my_center|LOCUS_42770 2459 3262 gene locus_tag LOCUS_42780 2459 3262 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927928.1 protein_id gnl|my_center|LOCUS_42780 3293 4132 gene locus_tag LOCUS_42790 gene dsbG 3293 4132 CDS product thiol:disulfide interchange protein DsbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I106 protein_id gnl|my_center|LOCUS_42790 4648 6093 gene locus_tag LOCUS_42800 4648 6093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42800 6170 7522 gene locus_tag LOCUS_42810 gene adiC 6170 7522 CDS product arginine/agmatine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZGS9 protein_id gnl|my_center|LOCUS_42810 7543 9831 gene locus_tag LOCUS_42820 gene ldcA 7543 9831 CDS product lysine-specific pyridoxal 5'-phosphate-dependent carboxylase LdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113592.1 protein_id gnl|my_center|LOCUS_42820 9860 10762 gene locus_tag LOCUS_42830 9860 10762 CDS product cation efflux family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947834.1 protein_id gnl|my_center|LOCUS_42830 >Feature sequence63 37 399 gene locus_tag LOCUS_42840 37 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42840 710 453 gene locus_tag LOCUS_42850 710 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 839 1771 gene locus_tag LOCUS_42860 839 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 1975 2478 gene locus_tag LOCUS_42870 1975 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42870 2753 2484 gene locus_tag LOCUS_42880 2753 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42880 2646 2942 gene locus_tag LOCUS_42890 2646 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42890 3222 3497 gene locus_tag LOCUS_42900 3222 3497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42900 3628 4434 gene locus_tag LOCUS_42910 gene exoA 3628 4434 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038921.1 protein_id gnl|my_center|LOCUS_42910 4431 5735 gene locus_tag LOCUS_42920 gene ampG 4431 5735 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038920.1 protein_id gnl|my_center|LOCUS_42920 5813 6043 gene locus_tag LOCUS_42930 5813 6043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038919.1 protein_id gnl|my_center|LOCUS_42930 7237 6110 gene locus_tag LOCUS_42940 gene anmK 7237 6110 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P473 protein_id gnl|my_center|LOCUS_42940 8775 7303 gene locus_tag LOCUS_42950 8775 7303 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038917.1 protein_id gnl|my_center|LOCUS_42950 8942 10153 gene locus_tag LOCUS_42960 gene tyrS 8942 10153 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P475 protein_id gnl|my_center|LOCUS_42960 >Feature sequence64 176 2053 gene locus_tag LOCUS_42970 176 2053 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035899.1 protein_id gnl|my_center|LOCUS_42970 2190 3911 gene locus_tag LOCUS_42980 gene xpsE 2190 3911 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31742 protein_id gnl|my_center|LOCUS_42980 3936 5156 gene locus_tag LOCUS_42990 gene xpsF 3936 5156 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31744 protein_id gnl|my_center|LOCUS_42990 5206 5649 gene locus_tag LOCUS_43000 gene xpsG 5206 5649 CDS product type II secretion system protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31734 protein_id gnl|my_center|LOCUS_43000 5656 6150 gene locus_tag LOCUS_43010 gene xpsH 5656 6150 CDS product type II secretion system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31736 protein_id gnl|my_center|LOCUS_43010 6147 6566 gene locus_tag LOCUS_43020 gene xpsI 6147 6566 CDS product type II secretion system protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31738 protein_id gnl|my_center|LOCUS_43020 6563 7195 gene locus_tag LOCUS_43030 gene xpsJ 6563 7195 CDS product type II secretion system protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31740 protein_id gnl|my_center|LOCUS_43030 7192 8055 gene locus_tag LOCUS_43040 gene pefK 7192 8055 CDS product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P34026 protein_id gnl|my_center|LOCUS_43040 8052 9197 gene locus_tag LOCUS_43050 gene pefL 8052 9197 CDS product type II secretion system protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P34027 protein_id gnl|my_center|LOCUS_43050 9172 9885 gene locus_tag LOCUS_43060 gene xpsM 9172 9885 CDS product protein XpsM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29039 protein_id gnl|my_center|LOCUS_43060 >Feature sequence65 1816 98 gene locus_tag LOCUS_43070 gene ggt 1816 98 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038421.1 protein_id gnl|my_center|LOCUS_43070 2504 3478 gene locus_tag LOCUS_43080 gene ilvC 2504 3478 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5L5 protein_id gnl|my_center|LOCUS_43080 3518 5254 gene locus_tag LOCUS_43090 gene ilvG 3518 5254 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5L4 protein_id gnl|my_center|LOCUS_43090 5238 5489 gene locus_tag LOCUS_43100 gene ilvM 5238 5489 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038424.1 protein_id gnl|my_center|LOCUS_43100 5586 6689 gene locus_tag LOCUS_43110 gene tdcB 5586 6689 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038425.1 protein_id gnl|my_center|LOCUS_43110 >Feature sequence66 1358 372 gene locus_tag LOCUS_43120 gene mdh 1358 372 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC25 protein_id gnl|my_center|LOCUS_43120 1968 1477 gene locus_tag LOCUS_43130 gene ppiB 1968 1477 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC26 protein_id gnl|my_center|LOCUS_43130 2294 2064 gene locus_tag LOCUS_43140 2294 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43140 2244 4091 gene locus_tag LOCUS_43150 gene typA 2244 4091 CDS product GTP-binding elongation factor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636312.2 protein_id gnl|my_center|LOCUS_43150 4103 4570 gene locus_tag LOCUS_43160 4103 4570 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036139.1 protein_id gnl|my_center|LOCUS_43160 4612 6234 gene locus_tag LOCUS_43170 gene gatAX 4612 6234 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036138.1 protein_id gnl|my_center|LOCUS_43170 7437 6298 gene locus_tag LOCUS_43180 7437 6298 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036137.1 protein_id gnl|my_center|LOCUS_43180 >Feature sequence67 238 1611 gene locus_tag LOCUS_43190 gene cycA 238 1611 CDS product D-serine/D-alanine/glycine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038625.1 protein_id gnl|my_center|LOCUS_43190 1964 2716 gene locus_tag LOCUS_43200 1964 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43200 4244 2724 gene locus_tag LOCUS_43210 4244 2724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43210 4446 6491 gene locus_tag LOCUS_43220 4446 6491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43220 6876 6469 gene locus_tag LOCUS_43230 6876 6469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038745.1 protein_id gnl|my_center|LOCUS_43230 >Feature sequence68 1591 425 gene locus_tag LOCUS_43240 gene yliI 1591 425 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038894.1 protein_id gnl|my_center|LOCUS_43240 1772 2212 gene locus_tag LOCUS_43250 gene yiaA 1772 2212 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038893.1 protein_id gnl|my_center|LOCUS_43250 2583 2260 gene locus_tag LOCUS_43260 2583 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038892.1 protein_id gnl|my_center|LOCUS_43260 3993 2692 gene locus_tag LOCUS_43270 3993 2692 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038890.1 protein_id gnl|my_center|LOCUS_43270 4751 3990 gene locus_tag LOCUS_43280 4751 3990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038889.1 protein_id gnl|my_center|LOCUS_43280 5615 4767 gene locus_tag LOCUS_43290 5615 4767 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370295.1 protein_id gnl|my_center|LOCUS_43290 >Feature sequence69 <1 2191 gene locus_tag LOCUS_43300 <1 2191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037788.1:ligand-gated channel 2419 2985 gene locus_tag LOCUS_43310 2419 2985 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035991.1 protein_id gnl|my_center|LOCUS_43310 >Feature sequence70 225 686 gene locus_tag LOCUS_43320 225 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43320 686 1081 gene locus_tag LOCUS_43330 686 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43330 >Feature sequence71 2765 564 gene locus_tag LOCUS_43340 gene xpsD 2765 564 CDS product type II secretion system protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29041 protein_id gnl|my_center|LOCUS_43340 >Feature sequence72 160 1176 gene locus_tag LOCUS_43350 gene ansA 160 1176 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035484.1 protein_id gnl|my_center|LOCUS_43350 1314 1399 gene locus_tag LOCUS_t00580 1314 1399 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1424 1497 gene locus_tag LOCUS_t00590 1424 1497 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1547 1622 gene locus_tag LOCUS_t00600 1547 1622 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38