>Feature sequence0001 4734 3322 gene locus_tag LOCUS_00010 gene glnA 4734 3322 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C40 protein_id gnl|my_center|LOCUS_00010 5233 6003 gene locus_tag LOCUS_00020 gene flgG-1 5233 6003 CDS product flagellar basal body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671871.1 protein_id gnl|my_center|LOCUS_00020 6061 6849 gene locus_tag LOCUS_00030 gene flgG 6061 6849 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748F1 protein_id gnl|my_center|LOCUS_00030 6958 7971 gene locus_tag LOCUS_00040 6958 7971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 8293 8928 gene locus_tag LOCUS_00050 8293 8928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 9269 13141 gene locus_tag LOCUS_00060 9269 13141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 13261 14511 gene locus_tag LOCUS_00070 13261 14511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 14474 15547 gene locus_tag LOCUS_00080 14474 15547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 15638 16528 gene locus_tag LOCUS_00090 gene yajF 15638 16528 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_402048.2 protein_id gnl|my_center|LOCUS_00090 17290 16529 gene locus_tag LOCUS_00100 17290 16529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 17599 18177 gene locus_tag LOCUS_00110 17599 18177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 18349 18795 gene locus_tag LOCUS_00120 18349 18795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 18774 19232 gene locus_tag LOCUS_00130 18774 19232 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392135.1 protein_id gnl|my_center|LOCUS_00130 20366 19452 gene locus_tag LOCUS_00140 20366 19452 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426922.1 protein_id gnl|my_center|LOCUS_00140 20656 20462 gene locus_tag LOCUS_00150 gene cspA 20656 20462 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812516.1 protein_id gnl|my_center|LOCUS_00150 >Feature sequence0002 <1 1159 gene locus_tag LOCUS_00160 <1 1159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005417487.1:metalloprotease PmbA 1543 1163 gene locus_tag LOCUS_00170 1543 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 1637 2707 gene locus_tag LOCUS_00180 gene rfaF 1637 2707 CDS product ADP-heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001967602.1 protein_id gnl|my_center|LOCUS_00180 4681 2741 gene locus_tag LOCUS_00190 4681 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 5862 4684 gene locus_tag LOCUS_00200 5862 4684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 7113 5866 gene locus_tag LOCUS_00210 7113 5866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 8226 7222 gene locus_tag LOCUS_00220 8226 7222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 8336 9712 gene locus_tag LOCUS_00230 8336 9712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 10365 9739 gene locus_tag LOCUS_00240 gene udk 10365 9739 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCC8 protein_id gnl|my_center|LOCUS_00240 11207 10380 gene locus_tag LOCUS_00250 11207 10380 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MDI9 protein_id gnl|my_center|LOCUS_00250 13723 11219 gene locus_tag LOCUS_00260 gene lon 13723 11219 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5F9 protein_id gnl|my_center|LOCUS_00260 14191 13919 gene locus_tag LOCUS_00270 gene fliQ 14191 13919 CDS product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35535 protein_id gnl|my_center|LOCUS_00270 14976 14224 gene locus_tag LOCUS_00280 gene fliP 14976 14224 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3V8D2 protein_id gnl|my_center|LOCUS_00280 16306 15080 gene locus_tag LOCUS_00290 16306 15080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 16779 16318 gene locus_tag LOCUS_00300 gene fliN 16779 16318 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51466 protein_id gnl|my_center|LOCUS_00300 17544 16921 gene locus_tag LOCUS_00310 17544 16921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 18032 17541 gene locus_tag LOCUS_00320 18032 17541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 18515 18162 gene locus_tag LOCUS_00330 18515 18162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 19720 18860 gene locus_tag LOCUS_00340 gene ispE 19720 18860 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG57 protein_id gnl|my_center|LOCUS_00340 >Feature sequence0003 1706 57 gene locus_tag LOCUS_00350 gene pyrG 1706 57 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BY3 protein_id gnl|my_center|LOCUS_00350 2223 1804 gene locus_tag LOCUS_00360 2223 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140630.1 protein_id gnl|my_center|LOCUS_00360 4468 2240 gene locus_tag LOCUS_00370 4468 2240 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941478.1 protein_id gnl|my_center|LOCUS_00370 4987 4550 gene locus_tag LOCUS_00380 gene ccmE 4987 4550 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SIG4 protein_id gnl|my_center|LOCUS_00380 5158 4991 gene locus_tag LOCUS_00390 5158 4991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 5857 5159 gene locus_tag LOCUS_00400 5857 5159 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228656.1 protein_id gnl|my_center|LOCUS_00400 7283 5850 gene locus_tag LOCUS_00410 gene gatB 7283 5850 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61343 protein_id gnl|my_center|LOCUS_00410 7959 7297 gene locus_tag LOCUS_00420 7959 7297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 8630 8085 gene locus_tag LOCUS_00430 8630 8085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 9102 8698 gene locus_tag LOCUS_00440 gene msrB 9102 8698 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MS5 protein_id gnl|my_center|LOCUS_00440 9275 11017 gene locus_tag LOCUS_00450 9275 11017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 11129 12115 gene locus_tag LOCUS_00460 11129 12115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 13194 12121 gene locus_tag LOCUS_00470 gene hemH 13194 12121 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83FA4 protein_id gnl|my_center|LOCUS_00470 14466 13276 gene locus_tag LOCUS_00480 gene argJ 14466 13276 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYV8 protein_id gnl|my_center|LOCUS_00480 14570 15847 gene locus_tag LOCUS_00490 14570 15847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 15853 17100 gene locus_tag LOCUS_00500 15853 17100 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546785.1 protein_id gnl|my_center|LOCUS_00500 17119 18477 gene locus_tag LOCUS_00510 17119 18477 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119251.1 protein_id gnl|my_center|LOCUS_00510 >Feature sequence0004 691 1728 gene locus_tag LOCUS_00520 691 1728 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021661.1 protein_id gnl|my_center|LOCUS_00520 1889 3040 gene locus_tag LOCUS_00530 1889 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 3165 4385 gene locus_tag LOCUS_00540 3165 4385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 4609 5226 gene locus_tag LOCUS_00550 gene yrdC 4609 5226 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942241.1 protein_id gnl|my_center|LOCUS_00550 5999 5268 gene locus_tag LOCUS_00560 5999 5268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 6561 6040 gene locus_tag LOCUS_00570 6561 6040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 7028 6558 gene locus_tag LOCUS_00580 7028 6558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 7563 7090 gene locus_tag LOCUS_00590 gene xcpT 7563 7090 CDS product type II secretion system protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00514 protein_id gnl|my_center|LOCUS_00590 8095 7931 gene locus_tag LOCUS_00600 8095 7931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 8909 8097 gene locus_tag LOCUS_00610 8909 8097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 9850 8906 gene locus_tag LOCUS_00620 9850 8906 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557312.1 protein_id gnl|my_center|LOCUS_00620 10286 10549 gene locus_tag LOCUS_00630 10286 10549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 12276 10666 gene locus_tag LOCUS_00640 12276 10666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 13302 12343 gene locus_tag LOCUS_00650 gene era 13302 12343 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HDM1 protein_id gnl|my_center|LOCUS_00650 14330 13299 gene locus_tag LOCUS_00660 14330 13299 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292463.1 protein_id gnl|my_center|LOCUS_00660 14769 14365 gene locus_tag LOCUS_00670 14769 14365 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190733.1 protein_id gnl|my_center|LOCUS_00670 >Feature sequence0005 478 35 gene locus_tag LOCUS_00680 478 35 CDS product UPF0336 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L0M4 protein_id gnl|my_center|LOCUS_00680 1430 618 gene locus_tag LOCUS_00690 1430 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 1576 1502 gene locus_tag LOCUS_t00010 1576 1502 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2328 1651 gene locus_tag LOCUS_00700 2328 1651 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065118.1 protein_id gnl|my_center|LOCUS_00700 2711 2367 gene locus_tag LOCUS_00710 2711 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 2811 3539 gene locus_tag LOCUS_00720 2811 3539 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933559.1 protein_id gnl|my_center|LOCUS_00720 3656 5350 gene locus_tag LOCUS_00730 3656 5350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 5372 6079 gene locus_tag LOCUS_00740 gene pspA 5372 6079 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140900.1 protein_id gnl|my_center|LOCUS_00740 6171 6389 gene locus_tag LOCUS_00750 6171 6389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 6734 6573 gene locus_tag LOCUS_00760 6734 6573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 7603 6947 gene locus_tag LOCUS_00770 7603 6947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 8120 7623 gene locus_tag LOCUS_00780 gene coaD 8120 7623 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8I0 protein_id gnl|my_center|LOCUS_00780 10944 8167 gene locus_tag LOCUS_00790 gene mutS 10944 8167 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E279 protein_id gnl|my_center|LOCUS_00790 11148 10972 gene locus_tag LOCUS_00800 11148 10972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 11954 11145 gene locus_tag LOCUS_00810 gene trpA 11954 11145 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFI5 protein_id gnl|my_center|LOCUS_00810 12333 11992 gene locus_tag LOCUS_00820 12333 11992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00820 13233 12367 gene locus_tag LOCUS_00830 13233 12367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00830 13323 14735 gene locus_tag LOCUS_00840 13323 14735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108767.1 protein_id gnl|my_center|LOCUS_00840 14744 16042 gene locus_tag LOCUS_00850 14744 16042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 >Feature sequence0006 243 88 gene locus_tag LOCUS_00860 243 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 879 367 gene locus_tag LOCUS_00870 879 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255959.1 protein_id gnl|my_center|LOCUS_00870 904 1596 gene locus_tag LOCUS_00880 904 1596 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215609.1 protein_id gnl|my_center|LOCUS_00880 2920 1838 gene locus_tag LOCUS_00890 gene ispG 2920 1838 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VBS7 protein_id gnl|my_center|LOCUS_00890 4393 3074 gene locus_tag LOCUS_00900 4393 3074 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87R73 protein_id gnl|my_center|LOCUS_00900 4671 4892 gene locus_tag LOCUS_00910 gene infA 4671 4892 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61688 protein_id gnl|my_center|LOCUS_00910 4992 6746 gene locus_tag LOCUS_00920 gene argS 4992 6746 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I0R5 protein_id gnl|my_center|LOCUS_00920 6851 7258 gene locus_tag LOCUS_00930 6851 7258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 7962 7267 gene locus_tag LOCUS_00940 gene mtnN 7962 7267 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QT87 protein_id gnl|my_center|LOCUS_00940 9299 8178 gene locus_tag LOCUS_00950 gene murG3 9299 8178 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q812Y1 protein_id gnl|my_center|LOCUS_00950 10135 9296 gene locus_tag LOCUS_00960 10135 9296 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948655.1 protein_id gnl|my_center|LOCUS_00960 12407 10194 gene locus_tag LOCUS_00970 gene relA 12407 10194 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_00970 13084 12428 gene locus_tag LOCUS_00980 13084 12428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 14874 13084 gene locus_tag LOCUS_00990 14874 13084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 >Feature sequence0007 2467 1073 gene locus_tag LOCUS_01000 2467 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458967.1 protein_id gnl|my_center|LOCUS_01000 2855 3904 gene locus_tag LOCUS_01010 2855 3904 CDS product exported protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812342.1 protein_id gnl|my_center|LOCUS_01010 4004 4567 gene locus_tag LOCUS_01020 4004 4567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 4575 6062 gene locus_tag LOCUS_01030 4575 6062 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000463030.1 protein_id gnl|my_center|LOCUS_01030 6184 7314 gene locus_tag LOCUS_01040 6184 7314 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085877.1 protein_id gnl|my_center|LOCUS_01040 7423 8652 gene locus_tag LOCUS_01050 gene bcr 7423 8652 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123170.1 protein_id gnl|my_center|LOCUS_01050 9015 9890 gene locus_tag LOCUS_01060 gene sucD 9015 9890 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKI2 protein_id gnl|my_center|LOCUS_01060 10531 10049 gene locus_tag LOCUS_01070 10531 10049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 11025 10801 gene locus_tag LOCUS_01080 11025 10801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 11878 11027 gene locus_tag LOCUS_01090 11878 11027 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203978.1 protein_id gnl|my_center|LOCUS_01090 13477 11885 gene locus_tag LOCUS_01100 13477 11885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 13917 13486 gene locus_tag LOCUS_01110 13917 13486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 14473 13967 gene locus_tag LOCUS_01120 14473 13967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 >Feature sequence0008 1152 481 gene locus_tag LOCUS_01130 1152 481 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407919.1 protein_id gnl|my_center|LOCUS_01130 1960 1223 gene locus_tag LOCUS_01140 1960 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 2329 4287 gene locus_tag LOCUS_01150 gene selB 2329 4287 CDS product selenocysteine-specific translation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940778.1 protein_id gnl|my_center|LOCUS_01150 4350 6743 gene locus_tag LOCUS_01160 4350 6743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 7270 6803 gene locus_tag LOCUS_01170 7270 6803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 7794 8135 gene locus_tag LOCUS_01180 7794 8135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 8149 9195 gene locus_tag LOCUS_01190 8149 9195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 9299 10147 gene locus_tag LOCUS_01200 9299 10147 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YK15 protein_id gnl|my_center|LOCUS_01200 10167 10586 gene locus_tag LOCUS_01210 10167 10586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879059.1 protein_id gnl|my_center|LOCUS_01210 12488 10632 gene locus_tag LOCUS_01220 12488 10632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 12767 12528 gene locus_tag LOCUS_01230 12767 12528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 14038 13337 gene locus_tag LOCUS_01240 gene ygaJ 14038 13337 CDS product putative peptidase YgaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71089 protein_id gnl|my_center|LOCUS_01240 14495 14076 gene locus_tag LOCUS_01250 14495 14076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 >Feature sequence0009 <1 1193 gene locus_tag LOCUS_01260 <1 1193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002853992.1:CDP-diacylglycerol--serine O-phosphatidyltransferase 1200 2264 gene locus_tag LOCUS_01270 gene ruvB 1200 2264 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61532 protein_id gnl|my_center|LOCUS_01270 2377 5835 gene locus_tag LOCUS_01280 2377 5835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 6309 7241 gene locus_tag LOCUS_01290 gene metA 6309 7241 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124953.1 protein_id gnl|my_center|LOCUS_01290 7352 8452 gene locus_tag LOCUS_01300 7352 8452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 8917 8501 gene locus_tag LOCUS_01310 8917 8501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 9048 9458 gene locus_tag LOCUS_01320 9048 9458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 9878 9657 gene locus_tag LOCUS_01330 9878 9657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 10435 10118 gene locus_tag LOCUS_01340 10435 10118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 11798 10503 gene locus_tag LOCUS_01350 11798 10503 CDS product EF-P lysine aminoacylase GenX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388833.1 protein_id gnl|my_center|LOCUS_01350 12505 11987 gene locus_tag LOCUS_01360 gene efp 12505 11987 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RI92 protein_id gnl|my_center|LOCUS_01360 13071 12826 gene locus_tag LOCUS_01370 13071 12826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 <14539 13064 gene locus_tag LOCUS_01380 <14539 13064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941578.1:aldehyde ferredoxin oxidoreductase >Feature sequence0010 1115 396 gene locus_tag LOCUS_01390 1115 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 2267 1134 gene locus_tag LOCUS_01400 gene rpoA 2267 1134 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749B3 protein_id gnl|my_center|LOCUS_01400 2743 2360 gene locus_tag LOCUS_01410 gene rpsK 2743 2360 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749B1 protein_id gnl|my_center|LOCUS_01410 3144 2776 gene locus_tag LOCUS_01420 gene rpsM 3144 2776 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CI0 protein_id gnl|my_center|LOCUS_01420 4620 3289 gene locus_tag LOCUS_01430 gene secY 4620 3289 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749A7 protein_id gnl|my_center|LOCUS_01430 5078 4620 gene locus_tag LOCUS_01440 gene rplO 5078 4620 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NM7 protein_id gnl|my_center|LOCUS_01440 5281 5096 gene locus_tag LOCUS_01450 gene rpmD 5281 5096 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MCD0 protein_id gnl|my_center|LOCUS_01450 5787 5284 gene locus_tag LOCUS_01460 gene rpsE 5787 5284 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFR4 protein_id gnl|my_center|LOCUS_01460 6076 5819 gene locus_tag LOCUS_01470 6076 5819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 6747 6208 gene locus_tag LOCUS_01480 gene rplF 6747 6208 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF0 protein_id gnl|my_center|LOCUS_01480 7166 6771 gene locus_tag LOCUS_01490 gene rpsH 7166 6771 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749A1 protein_id gnl|my_center|LOCUS_01490 7935 7390 gene locus_tag LOCUS_01500 gene rplE 7935 7390 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z9 protein_id gnl|my_center|LOCUS_01500 8276 7935 gene locus_tag LOCUS_01510 gene rplX 8276 7935 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CG6 protein_id gnl|my_center|LOCUS_01510 8654 8286 gene locus_tag LOCUS_01520 gene rplN 8654 8286 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z8 protein_id gnl|my_center|LOCUS_01520 8890 8654 gene locus_tag LOCUS_01530 8890 8654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 9101 8892 gene locus_tag LOCUS_01540 9101 8892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 9514 9098 gene locus_tag LOCUS_01550 gene rplP 9514 9098 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE2 protein_id gnl|my_center|LOCUS_01550 10180 9527 gene locus_tag LOCUS_01560 gene rpsC 10180 9527 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW6 protein_id gnl|my_center|LOCUS_01560 10572 10240 gene locus_tag LOCUS_01570 gene rplV 10572 10240 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42060 protein_id gnl|my_center|LOCUS_01570 10853 10572 gene locus_tag LOCUS_01580 gene rpsS 10853 10572 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CH6 protein_id gnl|my_center|LOCUS_01580 11675 10857 gene locus_tag LOCUS_01590 gene rplB 11675 10857 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60401 protein_id gnl|my_center|LOCUS_01590 11980 11693 gene locus_tag LOCUS_01600 gene rplW 11980 11693 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z1 protein_id gnl|my_center|LOCUS_01600 12603 11980 gene locus_tag LOCUS_01610 gene rplD 12603 11980 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFP8 protein_id gnl|my_center|LOCUS_01610 12939 12628 gene locus_tag LOCUS_01620 gene rpsJ 12939 12628 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z0 protein_id gnl|my_center|LOCUS_01620 14157 12958 gene locus_tag LOCUS_01630 gene tuf 14157 12958 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69303 protein_id gnl|my_center|LOCUS_01630 >Feature sequence0011 <1 536 gene locus_tag LOCUS_01640 <1 536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RU43:Lon protease 656 1102 gene locus_tag LOCUS_01650 656 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 1099 1551 gene locus_tag LOCUS_01660 gene mrnC 1099 1551 CDS product mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EF7 protein_id gnl|my_center|LOCUS_01660 1712 1981 gene locus_tag LOCUS_01670 1712 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 5218 1991 gene locus_tag LOCUS_01680 gene carB 5218 1991 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DP0 protein_id gnl|my_center|LOCUS_01680 5992 5243 gene locus_tag LOCUS_01690 5992 5243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 6379 6140 gene locus_tag LOCUS_01700 6379 6140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 6594 7109 gene locus_tag LOCUS_01710 6594 7109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 7210 9591 gene locus_tag LOCUS_01720 gene mrcA 7210 9591 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943755.1 protein_id gnl|my_center|LOCUS_01720 9950 9672 gene locus_tag LOCUS_01730 gene hupB 9950 9672 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947582.1 protein_id gnl|my_center|LOCUS_01730 10146 11408 gene locus_tag LOCUS_01740 10146 11408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 11512 12774 gene locus_tag LOCUS_01750 11512 12774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 13294 13602 gene locus_tag LOCUS_01760 13294 13602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 >Feature sequence0012 838 1869 gene locus_tag LOCUS_01770 838 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 1960 3123 gene locus_tag LOCUS_01780 1960 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390211.1 protein_id gnl|my_center|LOCUS_01780 3791 3078 gene locus_tag LOCUS_01790 3791 3078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 4660 3953 gene locus_tag LOCUS_01800 4660 3953 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918870.1 protein_id gnl|my_center|LOCUS_01800 4991 6472 gene locus_tag LOCUS_01810 gene glcD 4991 6472 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143062.1 protein_id gnl|my_center|LOCUS_01810 6469 7677 gene locus_tag LOCUS_01820 6469 7677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 7674 9083 gene locus_tag LOCUS_01830 gene glcF 7674 9083 CDS product putative glycolate oxidase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94534 protein_id gnl|my_center|LOCUS_01830 9534 9223 gene locus_tag LOCUS_01840 9534 9223 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141461.1 protein_id gnl|my_center|LOCUS_01840 10734 9541 gene locus_tag LOCUS_01850 10734 9541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 10886 10811 gene locus_tag LOCUS_t00020 10886 10811 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 11118 13157 gene locus_tag LOCUS_01860 11118 13157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 >Feature sequence0013 1135 956 gene locus_tag LOCUS_01870 1135 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 1833 1201 gene locus_tag LOCUS_01880 1833 1201 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483431.1 protein_id gnl|my_center|LOCUS_01880 2253 1873 gene locus_tag LOCUS_01890 2253 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 2687 2268 gene locus_tag LOCUS_01900 2687 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104529.1 protein_id gnl|my_center|LOCUS_01900 2817 4697 gene locus_tag LOCUS_01910 gene rep 2817 4697 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I7FK74 protein_id gnl|my_center|LOCUS_01910 4847 5482 gene locus_tag LOCUS_01920 4847 5482 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943052.1 protein_id gnl|my_center|LOCUS_01920 6809 5559 gene locus_tag LOCUS_01930 6809 5559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 7499 8638 gene locus_tag LOCUS_01940 gene carA 7499 8638 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DP3 protein_id gnl|my_center|LOCUS_01940 8723 9733 gene locus_tag LOCUS_01950 gene fliG 8723 9733 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8FA11 protein_id gnl|my_center|LOCUS_01950 10019 11413 gene locus_tag LOCUS_01960 gene leuC 10019 11413 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4E6 protein_id gnl|my_center|LOCUS_01960 11437 12060 gene locus_tag LOCUS_01970 gene leuD 11437 12060 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4E5 protein_id gnl|my_center|LOCUS_01970 12082 12348 gene locus_tag LOCUS_01980 12082 12348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 12376 12759 gene locus_tag LOCUS_01990 12376 12759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 12781 13392 gene locus_tag LOCUS_02000 12781 13392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 >Feature sequence0014 274 1500 gene locus_tag LOCUS_02010 gene nuoD 274 1500 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GA5 protein_id gnl|my_center|LOCUS_02010 1537 2610 gene locus_tag LOCUS_02020 gene nuoH 1537 2610 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ61 protein_id gnl|my_center|LOCUS_02020 2645 3277 gene locus_tag LOCUS_02030 gene pdxH 2645 3277 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED71 protein_id gnl|my_center|LOCUS_02030 3332 3916 gene locus_tag LOCUS_02040 3332 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 3925 5562 gene locus_tag LOCUS_02050 3925 5562 CDS product UPF0159 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z7F9 protein_id gnl|my_center|LOCUS_02050 5662 6294 gene locus_tag LOCUS_02060 gene upp 5662 6294 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBH2 protein_id gnl|my_center|LOCUS_02060 6297 6875 gene locus_tag LOCUS_02070 6297 6875 CDS product carbon monoxide dehydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728352.1 protein_id gnl|my_center|LOCUS_02070 6910 7500 gene locus_tag LOCUS_02080 6910 7500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 7627 8424 gene locus_tag LOCUS_02090 7627 8424 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940877.1 protein_id gnl|my_center|LOCUS_02090 8516 9787 gene locus_tag LOCUS_02100 8516 9787 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WKN9 protein_id gnl|my_center|LOCUS_02100 9789 10217 gene locus_tag LOCUS_02110 gene iscU 9789 10217 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058819.1 protein_id gnl|my_center|LOCUS_02110 10232 11134 gene locus_tag LOCUS_02120 10232 11134 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256872.1 protein_id gnl|my_center|LOCUS_02120 11196 11684 gene locus_tag LOCUS_02130 11196 11684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 12013 11765 gene locus_tag LOCUS_02140 12013 11765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 >Feature sequence0015 1308 3146 gene locus_tag LOCUS_02150 gene ftsH-2 1308 3146 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C66 protein_id gnl|my_center|LOCUS_02150 3146 4018 gene locus_tag LOCUS_02160 3146 4018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 4094 4876 gene locus_tag LOCUS_02170 4094 4876 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NDP5 protein_id gnl|my_center|LOCUS_02170 4935 6221 gene locus_tag LOCUS_02180 4935 6221 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932090.1 protein_id gnl|my_center|LOCUS_02180 6351 6426 gene locus_tag LOCUS_t00030 6351 6426 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6431 6515 gene locus_tag LOCUS_t00040 6431 6515 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 6550 6624 gene locus_tag LOCUS_t00050 6550 6624 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6835 6910 gene locus_tag LOCUS_t00060 6835 6910 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 7011 7199 gene locus_tag LOCUS_02190 7011 7199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 7189 8019 gene locus_tag LOCUS_02200 7189 8019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 8032 8223 gene locus_tag LOCUS_02210 8032 8223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02210 8257 8457 gene locus_tag LOCUS_02220 8257 8457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02220 8454 9143 gene locus_tag LOCUS_02230 gene rplA 8454 9143 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y3 protein_id gnl|my_center|LOCUS_02230 9405 9929 gene locus_tag LOCUS_02240 gene rplJ 9405 9929 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P659 protein_id gnl|my_center|LOCUS_02240 10000 10380 gene locus_tag LOCUS_02250 gene rplL 10000 10380 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PI32 protein_id gnl|my_center|LOCUS_02250 10604 11659 gene locus_tag LOCUS_02260 gene pyrB 10604 11659 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024378.1 protein_id gnl|my_center|LOCUS_02260 >Feature sequence0016 1754 651 gene locus_tag LOCUS_02270 gene rodA 1754 651 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_02270 3644 1791 gene locus_tag LOCUS_02280 gene guaA 3644 1791 CDS product putative GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4F4 protein_id gnl|my_center|LOCUS_02280 3691 4233 gene locus_tag LOCUS_02290 3691 4233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 4428 4682 gene locus_tag LOCUS_02300 4428 4682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 5498 4743 gene locus_tag LOCUS_02310 gene kdsB 5498 4743 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EL27 protein_id gnl|my_center|LOCUS_02310 6171 5527 gene locus_tag LOCUS_02320 gene tpm 6171 5527 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I011 protein_id gnl|my_center|LOCUS_02320 6904 6200 gene locus_tag LOCUS_02330 6904 6200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 7301 8167 gene locus_tag LOCUS_02340 gene prfB 7301 8167 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P28367 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02340 8207 8692 gene locus_tag LOCUS_02350 8207 8692 CDS product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HM20 protein_id gnl|my_center|LOCUS_02350 11467 8720 gene locus_tag LOCUS_02360 11467 8720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 >Feature sequence0017 1264 2520 gene locus_tag LOCUS_02370 1264 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256669.1 protein_id gnl|my_center|LOCUS_02370 2581 3108 gene locus_tag LOCUS_02380 2581 3108 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776788.1 protein_id gnl|my_center|LOCUS_02380 3506 3132 gene locus_tag LOCUS_02390 3506 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 3787 4989 gene locus_tag LOCUS_02400 gene flgI 3787 4989 CDS product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72EQ3 protein_id gnl|my_center|LOCUS_02400 4986 5309 gene locus_tag LOCUS_02410 4986 5309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 5635 5931 gene locus_tag LOCUS_02420 5635 5931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 5993 6475 gene locus_tag LOCUS_02430 5993 6475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 6527 8215 gene locus_tag LOCUS_02440 gene flgK 6527 8215 CDS product flagellar hook protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535890.1 protein_id gnl|my_center|LOCUS_02440 8580 9794 gene locus_tag LOCUS_02450 8580 9794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 9864 10094 gene locus_tag LOCUS_02460 gene csrA 9864 10094 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748G1 protein_id gnl|my_center|LOCUS_02460 10111 10608 gene locus_tag LOCUS_02470 gene fliW 10111 10608 CDS product flagellar assembly factor FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73K68 protein_id gnl|my_center|LOCUS_02470 10694 11380 gene locus_tag LOCUS_02480 gene rsmG 10694 11380 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAK0 protein_id gnl|my_center|LOCUS_02480 >Feature sequence0018 826 224 gene locus_tag LOCUS_02490 gene hisH 826 224 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KF56 protein_id gnl|my_center|LOCUS_02490 1425 832 gene locus_tag LOCUS_02500 gene hisB 1425 832 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97KI1 protein_id gnl|my_center|LOCUS_02500 2927 1458 gene locus_tag LOCUS_02510 2927 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 3653 3159 gene locus_tag LOCUS_02520 3653 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 5159 3819 gene locus_tag LOCUS_02530 gene proA 5159 3819 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKU1 protein_id gnl|my_center|LOCUS_02530 7566 5197 gene locus_tag LOCUS_02540 7566 5197 CDS product OMP85 family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_011586.2 protein_id gnl|my_center|LOCUS_02540 8418 7735 gene locus_tag LOCUS_02550 gene lolD 8418 7735 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8V9 protein_id gnl|my_center|LOCUS_02550 10285 8495 gene locus_tag LOCUS_02560 10285 8495 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405097.1 protein_id gnl|my_center|LOCUS_02560 <11192 10402 gene locus_tag LOCUS_02570 <11192 10402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DL33:dihydroorotase >Feature sequence0019 <1 515 gene locus_tag LOCUS_02580 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083887.1:ABC transporter ATP-binding protein 2173 566 gene locus_tag LOCUS_02590 2173 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 3417 2317 gene locus_tag LOCUS_02600 gene hemN 3417 2317 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964591.1 protein_id gnl|my_center|LOCUS_02600 4039 7737 gene locus_tag LOCUS_02610 gene nrdJ 4039 7737 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3P1 protein_id gnl|my_center|LOCUS_02610 7934 9187 gene locus_tag LOCUS_02620 7934 9187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 9192 10043 gene locus_tag LOCUS_02630 9192 10043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 10043 10834 gene locus_tag LOCUS_02640 gene coaX 10043 10834 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EB4 protein_id gnl|my_center|LOCUS_02640 >Feature sequence0020 <1 528 gene locus_tag LOCUS_02650 <1 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q72B11:tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG 540 1430 gene locus_tag LOCUS_02660 540 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064131.1 protein_id gnl|my_center|LOCUS_02660 1477 3138 gene locus_tag LOCUS_02670 1477 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 3962 3147 gene locus_tag LOCUS_02680 3962 3147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 5209 4211 gene locus_tag LOCUS_02690 gene asd 5209 4211 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHE3 protein_id gnl|my_center|LOCUS_02690 5904 5311 gene locus_tag LOCUS_02700 gene tdk 5904 5311 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECK0 protein_id gnl|my_center|LOCUS_02700 6633 9155 gene locus_tag LOCUS_02710 gene clpB 6633 9155 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5L8 protein_id gnl|my_center|LOCUS_02710 9363 9836 gene locus_tag LOCUS_02720 9363 9836 CDS product heat-shock protein IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920119.1 protein_id gnl|my_center|LOCUS_02720 10374 10033 gene locus_tag LOCUS_02730 10374 10033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 10613 10377 gene locus_tag LOCUS_02740 10613 10377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 >Feature sequence0021 464 1588 gene locus_tag LOCUS_02750 gene splB 464 1588 CDS product spore photoproduct lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802116.1 protein_id gnl|my_center|LOCUS_02750 1588 2226 gene locus_tag LOCUS_02760 1588 2226 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083424.1 protein_id gnl|my_center|LOCUS_02760 2239 3270 gene locus_tag LOCUS_02770 gene dsbG 2239 3270 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651714.1 protein_id gnl|my_center|LOCUS_02770 3276 4670 gene locus_tag LOCUS_02780 gene hldE 3276 4670 CDS product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BF6 protein_id gnl|my_center|LOCUS_02780 4763 6058 gene locus_tag LOCUS_02790 4763 6058 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762837.1 protein_id gnl|my_center|LOCUS_02790 7493 6108 gene locus_tag LOCUS_02800 gene der 7493 6108 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AX4 protein_id gnl|my_center|LOCUS_02800 9914 7512 gene locus_tag LOCUS_02810 gene gyrB 9914 7512 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H89 protein_id gnl|my_center|LOCUS_02810 <10912 9963 gene locus_tag LOCUS_02820 <10912 9963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q6HQ00:DNA replication and repair protein RecF >Feature sequence0022 820 1911 gene locus_tag LOCUS_02830 820 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 1908 2432 gene locus_tag LOCUS_02840 1908 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 2444 5125 gene locus_tag LOCUS_02850 2444 5125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 5532 6761 gene locus_tag LOCUS_02860 5532 6761 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546283.1 protein_id gnl|my_center|LOCUS_02860 6834 7727 gene locus_tag LOCUS_02870 6834 7727 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039248.1 protein_id gnl|my_center|LOCUS_02870 7724 8779 gene locus_tag LOCUS_02880 7724 8779 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546311.1 protein_id gnl|my_center|LOCUS_02880 8779 9522 gene locus_tag LOCUS_02890 8779 9522 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888330.1 protein_id gnl|my_center|LOCUS_02890 9523 10311 gene locus_tag LOCUS_02900 gene livF 9523 10311 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894681.1 protein_id gnl|my_center|LOCUS_02900 10586 10413 gene locus_tag LOCUS_02910 10586 10413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 >Feature sequence0023 <1 812 gene locus_tag LOCUS_02920 <1 812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071756.1:2-nitropropane dioxygenase 963 1748 gene locus_tag LOCUS_02930 963 1748 CDS product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546810.1 protein_id gnl|my_center|LOCUS_02930 1783 2562 gene locus_tag LOCUS_02940 1783 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 3575 2565 gene locus_tag LOCUS_02950 3575 2565 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882918.1 protein_id gnl|my_center|LOCUS_02950 3994 3596 gene locus_tag LOCUS_02960 3994 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 4742 4317 gene locus_tag LOCUS_02970 gene atpC 4742 4317 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GX9 protein_id gnl|my_center|LOCUS_02970 6133 4742 gene locus_tag LOCUS_02980 gene atpD 6133 4742 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GY0 protein_id gnl|my_center|LOCUS_02980 7044 6178 gene locus_tag LOCUS_02990 gene atpG 7044 6178 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GY1 protein_id gnl|my_center|LOCUS_02990 8574 7066 gene locus_tag LOCUS_03000 gene atpA 8574 7066 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GY2 protein_id gnl|my_center|LOCUS_03000 9123 8581 gene locus_tag LOCUS_03010 gene atpH 9123 8581 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GY3 protein_id gnl|my_center|LOCUS_03010 9707 9120 gene locus_tag LOCUS_03020 9707 9120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 10296 9817 gene locus_tag LOCUS_03030 10296 9817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 >Feature sequence0024 157 774 gene locus_tag LOCUS_03040 157 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122508.1 protein_id gnl|my_center|LOCUS_03040 787 960 gene locus_tag LOCUS_03050 787 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 984 1133 gene locus_tag LOCUS_03060 984 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 1356 1156 gene locus_tag LOCUS_03070 1356 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 1838 3418 gene locus_tag LOCUS_03080 gene serA 1838 3418 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67741 protein_id gnl|my_center|LOCUS_03080 3489 5552 gene locus_tag LOCUS_03090 3489 5552 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679930.1 protein_id gnl|my_center|LOCUS_03090 5876 6742 gene locus_tag LOCUS_03100 5876 6742 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177828.1 protein_id gnl|my_center|LOCUS_03100 6875 8041 gene locus_tag LOCUS_03110 6875 8041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 >Feature sequence0025 1114 476 gene locus_tag LOCUS_03120 1114 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 2084 1116 gene locus_tag LOCUS_03130 2084 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 2386 3777 gene locus_tag LOCUS_03140 2386 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 3774 4355 gene locus_tag LOCUS_03150 gene rlmE 3774 4355 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q729T9 protein_id gnl|my_center|LOCUS_03150 4772 6316 gene locus_tag LOCUS_03160 gene fliC 4772 6316 CDS product B-type flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72151 protein_id gnl|my_center|LOCUS_03160 6545 8173 gene locus_tag LOCUS_03170 6545 8173 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456939.1 protein_id gnl|my_center|LOCUS_03170 8166 9647 gene locus_tag LOCUS_03180 gene xdhA 8166 9647 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972218.1 protein_id gnl|my_center|LOCUS_03180 >Feature sequence0026 1268 114 gene locus_tag LOCUS_03190 1268 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 2329 1760 gene locus_tag LOCUS_03200 2329 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 4479 2842 gene locus_tag LOCUS_03210 4479 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 4958 4554 gene locus_tag LOCUS_03220 4958 4554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 7155 5218 gene locus_tag LOCUS_03230 gene dxs 7155 5218 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL74 protein_id gnl|my_center|LOCUS_03230 7321 9723 gene locus_tag LOCUS_03240 7321 9723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 >Feature sequence0027 32 2107 gene locus_tag LOCUS_03250 32 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 2121 2879 gene locus_tag LOCUS_03260 2121 2879 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810950.1 protein_id gnl|my_center|LOCUS_03260 2876 3751 gene locus_tag LOCUS_03270 2876 3751 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940783.1 protein_id gnl|my_center|LOCUS_03270 3898 4581 gene locus_tag LOCUS_03280 3898 4581 CDS product BAX inhibitor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494926.1 protein_id gnl|my_center|LOCUS_03280 5140 9426 gene locus_tag LOCUS_03290 gene rpoB 5140 9426 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y6 protein_id gnl|my_center|LOCUS_03290 >Feature sequence0028 421 1728 gene locus_tag LOCUS_03300 gene hflX 421 1728 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCN0 protein_id gnl|my_center|LOCUS_03300 1877 3163 gene locus_tag LOCUS_03310 gene murA 1877 3163 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89W71 protein_id gnl|my_center|LOCUS_03310 3172 5616 gene locus_tag LOCUS_03320 3172 5616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 5800 7065 gene locus_tag LOCUS_03330 5800 7065 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RWP3 protein_id gnl|my_center|LOCUS_03330 7139 7471 gene locus_tag LOCUS_03340 7139 7471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 8138 7509 gene locus_tag LOCUS_03350 8138 7509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 8351 9070 gene locus_tag LOCUS_03360 gene hisA 8351 9070 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGW1 protein_id gnl|my_center|LOCUS_03360 >Feature sequence0029 <1 794 gene locus_tag LOCUS_03370 <1 794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525044.1:cyanophycin synthetase 2168 885 gene locus_tag LOCUS_03380 2168 885 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584110.1 protein_id gnl|my_center|LOCUS_03380 3202 2369 gene locus_tag LOCUS_03390 3202 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 4311 3304 gene locus_tag LOCUS_03400 gene gapA 4311 3304 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F5H7 protein_id gnl|my_center|LOCUS_03400 5097 4420 gene locus_tag LOCUS_03410 gene rpiA 5097 4420 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NPM5 protein_id gnl|my_center|LOCUS_03410 5546 5094 gene locus_tag LOCUS_03420 5546 5094 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933794.1 protein_id gnl|my_center|LOCUS_03420 <9654 5575 gene locus_tag LOCUS_03430 <9654 5575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to I7EPD8:DNA-directed RNA polymerase subunit beta' >Feature sequence0030 2771 981 gene locus_tag LOCUS_03440 2771 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 4073 2832 gene locus_tag LOCUS_03450 gene ftsA 4073 2832 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748E0 protein_id gnl|my_center|LOCUS_03450 4473 4291 gene locus_tag LOCUS_03460 4473 4291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 6101 4713 gene locus_tag LOCUS_03470 6101 4713 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545959.1 protein_id gnl|my_center|LOCUS_03470 7333 6104 gene locus_tag LOCUS_03480 7333 6104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 8816 7380 gene locus_tag LOCUS_03490 gene proS 8816 7380 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B8E7 protein_id gnl|my_center|LOCUS_03490 >Feature sequence0031 657 151 gene locus_tag LOCUS_03500 657 151 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030740.1 protein_id gnl|my_center|LOCUS_03500 1692 715 gene locus_tag LOCUS_03510 1692 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 2264 1689 gene locus_tag LOCUS_03520 gene yhdE 2264 1689 CDS product Maf-like protein YceF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NDM5 protein_id gnl|my_center|LOCUS_03520 4292 2406 gene locus_tag LOCUS_03530 4292 2406 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545126.1 protein_id gnl|my_center|LOCUS_03530 4786 4289 gene locus_tag LOCUS_03540 4786 4289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 5622 4786 gene locus_tag LOCUS_03550 gene mreC 5622 4786 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BG0 protein_id gnl|my_center|LOCUS_03550 6971 5682 gene locus_tag LOCUS_03560 6971 5682 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876856.1 protein_id gnl|my_center|LOCUS_03560 7394 7002 gene locus_tag LOCUS_03570 7394 7002 CDS product endoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_03570 8450 7416 gene locus_tag LOCUS_03580 8450 7416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 8807 8478 gene locus_tag LOCUS_03590 gene hisE 8807 8478 CDS product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60536 protein_id gnl|my_center|LOCUS_03590 >Feature sequence0032 365 862 gene locus_tag LOCUS_03600 gene aroK 365 862 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GA9 protein_id gnl|my_center|LOCUS_03600 837 1067 gene locus_tag LOCUS_03610 837 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 1346 3853 gene locus_tag LOCUS_03620 1346 3853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 3881 5275 gene locus_tag LOCUS_03630 gene selA 3881 5275 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61736 protein_id gnl|my_center|LOCUS_03630 5496 6752 gene locus_tag LOCUS_03640 5496 6752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 >Feature sequence0033 227 673 gene locus_tag LOCUS_03650 gene dut 227 673 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0B2 protein_id gnl|my_center|LOCUS_03650 1504 689 gene locus_tag LOCUS_03660 1504 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 2403 1501 gene locus_tag LOCUS_03670 2403 1501 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097867.1 protein_id gnl|my_center|LOCUS_03670 3227 2400 gene locus_tag LOCUS_03680 3227 2400 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721008.1 protein_id gnl|my_center|LOCUS_03680 3554 4123 gene locus_tag LOCUS_03690 3554 4123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880223.1 protein_id gnl|my_center|LOCUS_03690 4349 5269 gene locus_tag LOCUS_03700 gene miaA 4349 5269 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BP1 protein_id gnl|my_center|LOCUS_03700 5339 5731 gene locus_tag LOCUS_03710 5339 5731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 5887 7188 gene locus_tag LOCUS_03720 gene miaB 5887 7188 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKW2 protein_id gnl|my_center|LOCUS_03720 7687 8862 gene locus_tag LOCUS_03730 7687 8862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140828.1 protein_id gnl|my_center|LOCUS_03730 >Feature sequence0034 1063 50 gene locus_tag LOCUS_03740 gene fliM 1063 50 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938209.1 protein_id gnl|my_center|LOCUS_03740 2485 1193 gene locus_tag LOCUS_03750 gene gltA 2485 1193 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F801 protein_id gnl|my_center|LOCUS_03750 3440 2517 gene locus_tag LOCUS_03760 gene argF 3440 2517 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG66 protein_id gnl|my_center|LOCUS_03760 3641 4381 gene locus_tag LOCUS_03770 3641 4381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 5218 4424 gene locus_tag LOCUS_03780 5218 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 5386 6186 gene locus_tag LOCUS_03790 gene proC 5386 6186 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UKQ4 protein_id gnl|my_center|LOCUS_03790 6223 7515 gene locus_tag LOCUS_03800 gene purA 6223 7515 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747F9 protein_id gnl|my_center|LOCUS_03800 7543 7767 gene locus_tag LOCUS_03810 7543 7767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 <8866 7785 gene locus_tag LOCUS_03820 <8866 7785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000611464.1:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase >Feature sequence0035 209 832 gene locus_tag LOCUS_03830 209 832 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729685.1 protein_id gnl|my_center|LOCUS_03830 892 1095 gene locus_tag LOCUS_03840 892 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 1117 2100 gene locus_tag LOCUS_03850 1117 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 2744 2211 gene locus_tag LOCUS_03860 gene yozB 2744 2211 CDS product putative membrane protein YozB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31845 protein_id gnl|my_center|LOCUS_03860 3733 2741 gene locus_tag LOCUS_03870 gene ctaA 3733 2741 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074209.1 protein_id gnl|my_center|LOCUS_03870 3970 4269 gene locus_tag LOCUS_03880 3970 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 5971 4325 gene locus_tag LOCUS_03890 5971 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 6544 7872 gene locus_tag LOCUS_03900 gene ahcY 6544 7872 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTY7 protein_id gnl|my_center|LOCUS_03900 7989 8789 gene locus_tag LOCUS_03910 7989 8789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 >Feature sequence0036 1477 308 gene locus_tag LOCUS_03920 1477 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 2233 1481 gene locus_tag LOCUS_03930 2233 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 3020 4378 gene locus_tag LOCUS_03940 3020 4378 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771604.1 protein_id gnl|my_center|LOCUS_03940 4375 5055 gene locus_tag LOCUS_03950 4375 5055 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VU73 protein_id gnl|my_center|LOCUS_03950 5065 6051 gene locus_tag LOCUS_03960 5065 6051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 6094 6852 gene locus_tag LOCUS_03970 6094 6852 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947453.1 protein_id gnl|my_center|LOCUS_03970 7048 7133 gene locus_tag LOCUS_t00070 7048 7133 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7303 8190 gene locus_tag LOCUS_03980 7303 8190 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546572.1 protein_id gnl|my_center|LOCUS_03980 >Feature sequence0037 146 1330 gene locus_tag LOCUS_03990 146 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 2142 1375 gene locus_tag LOCUS_04000 2142 1375 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173391.1 protein_id gnl|my_center|LOCUS_04000 2897 2139 gene locus_tag LOCUS_04010 2897 2139 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944003.1 protein_id gnl|my_center|LOCUS_04010 4027 2894 gene locus_tag LOCUS_04020 4027 2894 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205316.1 protein_id gnl|my_center|LOCUS_04020 5044 4028 gene locus_tag LOCUS_04030 5044 4028 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088975.1 protein_id gnl|my_center|LOCUS_04030 6498 5140 gene locus_tag LOCUS_04040 6498 5140 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085050.1 protein_id gnl|my_center|LOCUS_04040 7949 6948 gene locus_tag LOCUS_04050 7949 6948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 <8573 7956 gene locus_tag LOCUS_04060 <8573 7956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875999.1:sensor histidine kinase >Feature sequence0038 972 289 gene locus_tag LOCUS_04070 972 289 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731358.1 protein_id gnl|my_center|LOCUS_04070 2023 1085 gene locus_tag LOCUS_04080 2023 1085 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815364.1 protein_id gnl|my_center|LOCUS_04080 4649 2136 gene locus_tag LOCUS_04090 4649 2136 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858465.1 protein_id gnl|my_center|LOCUS_04090 5266 4649 gene locus_tag LOCUS_04100 5266 4649 CDS product toluene tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852394.1 protein_id gnl|my_center|LOCUS_04100 6123 5269 gene locus_tag LOCUS_04110 6123 5269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853724.1 protein_id gnl|my_center|LOCUS_04110 6834 7040 gene locus_tag LOCUS_04120 6834 7040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 7964 8410 gene locus_tag LOCUS_04130 7964 8410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 >Feature sequence0039 902 477 gene locus_tag LOCUS_04140 gene exbD1 902 477 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851714.1 protein_id gnl|my_center|LOCUS_04140 1579 899 gene locus_tag LOCUS_04150 1579 899 CDS product Tol-Pal system subunit TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_04150 2826 1588 gene locus_tag LOCUS_04160 2826 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 3254 4879 gene locus_tag LOCUS_04170 3254 4879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 4876 5742 gene locus_tag LOCUS_04180 gene motA-1 4876 5742 CDS product chemotaxis protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937361.1 protein_id gnl|my_center|LOCUS_04180 5832 7400 gene locus_tag LOCUS_04190 5832 7400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 >Feature sequence0040 <1 1512 gene locus_tag LOCUS_04200 <1 1512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005478649.1:cytochrome c 1798 2427 gene locus_tag LOCUS_04210 1798 2427 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478649.1 protein_id gnl|my_center|LOCUS_04210 2547 3614 gene locus_tag LOCUS_04220 2547 3614 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_04220 3684 4613 gene locus_tag LOCUS_04230 3684 4613 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_04230 4698 5750 gene locus_tag LOCUS_04240 4698 5750 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938366.1 protein_id gnl|my_center|LOCUS_04240 5897 6106 gene locus_tag LOCUS_04250 5897 6106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 6096 7535 gene locus_tag LOCUS_04260 6096 7535 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090641.1 protein_id gnl|my_center|LOCUS_04260 >Feature sequence0041 289 2460 gene locus_tag LOCUS_04270 289 2460 CDS product ABC export transporter fused inner membrane and ATPases inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836187.1 protein_id gnl|my_center|LOCUS_04270 2474 4219 gene locus_tag LOCUS_04280 2474 4219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 4867 4244 gene locus_tag LOCUS_04290 4867 4244 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809123.1 protein_id gnl|my_center|LOCUS_04290 5079 4990 gene locus_tag LOCUS_t00080 5079 4990 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5420 5995 gene locus_tag LOCUS_04300 gene folE 5420 5995 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D580 protein_id gnl|my_center|LOCUS_04300 7301 6108 gene locus_tag LOCUS_04310 7301 6108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 >Feature sequence0042 1508 3115 gene locus_tag LOCUS_04320 1508 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 3368 4825 gene locus_tag LOCUS_04330 3368 4825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 5142 6608 gene locus_tag LOCUS_04340 gene fliC 5142 6608 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1U0 protein_id gnl|my_center|LOCUS_04340 >Feature sequence0043 1780 1472 gene locus_tag LOCUS_04350 1780 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 2301 1822 gene locus_tag LOCUS_04360 gene mutX 2301 1822 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59659 protein_id gnl|my_center|LOCUS_04360 2322 3347 gene locus_tag LOCUS_04370 gene fliM 2322 3347 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938209.1 protein_id gnl|my_center|LOCUS_04370 3635 3360 gene locus_tag LOCUS_04380 3635 3360 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940232.1 protein_id gnl|my_center|LOCUS_04380 5429 3786 gene locus_tag LOCUS_04390 5429 3786 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791032.1 protein_id gnl|my_center|LOCUS_04390 6201 5515 gene locus_tag LOCUS_04400 6201 5515 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941396.1 protein_id gnl|my_center|LOCUS_04400 >Feature sequence0044 701 216 gene locus_tag LOCUS_04410 701 216 CDS product inosine-5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174003.1 protein_id gnl|my_center|LOCUS_04410 958 1599 gene locus_tag LOCUS_04420 gene coaE 958 1599 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FU2 protein_id gnl|my_center|LOCUS_04420 1621 2598 gene locus_tag LOCUS_04430 1621 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 3106 2615 gene locus_tag LOCUS_04440 3106 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 3394 3900 gene locus_tag LOCUS_04450 3394 3900 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228652.1 protein_id gnl|my_center|LOCUS_04450 4958 3903 gene locus_tag LOCUS_04460 4958 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 5039 6442 gene locus_tag LOCUS_04470 5039 6442 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_04470 6432 6872 gene locus_tag LOCUS_04480 6432 6872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 7054 6806 gene locus_tag LOCUS_04490 7054 6806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 7119 8051 gene locus_tag LOCUS_04500 7119 8051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 >Feature sequence0045 339 725 gene locus_tag LOCUS_04510 gene dksA 339 725 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72A47 protein_id gnl|my_center|LOCUS_04510 889 1677 gene locus_tag LOCUS_04520 889 1677 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3V886 protein_id gnl|my_center|LOCUS_04520 1783 2847 gene locus_tag LOCUS_04530 gene flhB 1783 2847 CDS product flagellar biosynthetic protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35538 protein_id gnl|my_center|LOCUS_04530 3006 5096 gene locus_tag LOCUS_04540 gene flhA 3006 5096 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943681.1 protein_id gnl|my_center|LOCUS_04540 5174 6469 gene locus_tag LOCUS_04550 gene flhF 5174 6469 CDS product flagellar biosynthesis regulator FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965445.1 protein_id gnl|my_center|LOCUS_04550 6486 7247 gene locus_tag LOCUS_04560 gene fliA 6486 7247 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667112.1 protein_id gnl|my_center|LOCUS_04560 7266 7499 gene locus_tag LOCUS_04570 7266 7499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 >Feature sequence0046 1685 195 gene locus_tag LOCUS_04580 1685 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 1851 2444 gene locus_tag LOCUS_04590 1851 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 2730 3845 gene locus_tag LOCUS_04600 2730 3845 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267701.1 protein_id gnl|my_center|LOCUS_04600 3981 5249 gene locus_tag LOCUS_04610 3981 5249 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387853.1 protein_id gnl|my_center|LOCUS_04610 5443 6198 gene locus_tag LOCUS_04620 5443 6198 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387854.1 protein_id gnl|my_center|LOCUS_04620 6185 6427 gene locus_tag LOCUS_04630 6185 6427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04630 6479 7087 gene locus_tag LOCUS_04640 6479 7087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04640 >Feature sequence0047 626 913 gene locus_tag LOCUS_04650 626 913 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958388.1 protein_id gnl|my_center|LOCUS_04650 1558 1235 gene locus_tag LOCUS_04660 1558 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 2721 1726 gene locus_tag LOCUS_04670 2721 1726 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815232.1 protein_id gnl|my_center|LOCUS_04670 3533 2742 gene locus_tag LOCUS_04680 3533 2742 CDS product histidinol phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336750.1 protein_id gnl|my_center|LOCUS_04680 5030 3726 gene locus_tag LOCUS_04690 5030 3726 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227848.1 protein_id gnl|my_center|LOCUS_04690 6775 5123 gene locus_tag LOCUS_04700 6775 5123 CDS product acetyl-CoA carboxylase carboxyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678775.1 protein_id gnl|my_center|LOCUS_04700 6928 7851 gene locus_tag LOCUS_04710 gene fmt 6928 7851 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIL6 protein_id gnl|my_center|LOCUS_04710 >Feature sequence0048 1794 655 gene locus_tag LOCUS_04720 1794 655 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_04720 2903 2064 gene locus_tag LOCUS_04730 2903 2064 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853568.1 protein_id gnl|my_center|LOCUS_04730 4358 2922 gene locus_tag LOCUS_04740 4358 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04740 5058 4351 gene locus_tag LOCUS_04750 5058 4351 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277074.1 protein_id gnl|my_center|LOCUS_04750 5369 5115 gene locus_tag LOCUS_04760 5369 5115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 5765 5403 gene locus_tag LOCUS_04770 5765 5403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 6283 6032 gene locus_tag LOCUS_04780 6283 6032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 6989 6384 gene locus_tag LOCUS_04790 6989 6384 CDS product putative RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45215 protein_id gnl|my_center|LOCUS_04790 <7867 6989 gene locus_tag LOCUS_04800 <7867 6989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74E53:dual-specificity RNA methyltransferase RlmN >Feature sequence0049 782 288 gene locus_tag LOCUS_04810 782 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 1455 790 gene locus_tag LOCUS_04820 1455 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 3133 1883 gene locus_tag LOCUS_04830 3133 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 4487 3243 gene locus_tag LOCUS_04840 4487 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 4941 4552 gene locus_tag LOCUS_04850 4941 4552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 6562 5105 gene locus_tag LOCUS_04860 gene nuoN-1 6562 5105 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G95 protein_id gnl|my_center|LOCUS_04860 <7773 6658 gene locus_tag LOCUS_04870 <7773 6658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009565364.1:methylmalonate-semialdehyde dehydrogenase (acylating) >Feature sequence0050 1369 557 gene locus_tag LOCUS_04880 1369 557 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087972.1 protein_id gnl|my_center|LOCUS_04880 2324 1371 gene locus_tag LOCUS_04890 2324 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 3220 2384 gene locus_tag LOCUS_04900 3220 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 4727 3438 gene locus_tag LOCUS_04910 4727 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 5712 4717 gene locus_tag LOCUS_04920 5712 4717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 7301 5886 gene locus_tag LOCUS_04930 7301 5886 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815191.1 protein_id gnl|my_center|LOCUS_04930 >Feature sequence0051 <1 677 gene locus_tag LOCUS_04940 <1 677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337052.1:polyamine ABC transporter substrate-binding protein 682 1536 gene locus_tag LOCUS_04950 682 1536 CDS product polyamine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722803.1 protein_id gnl|my_center|LOCUS_04950 1797 2972 gene locus_tag LOCUS_04960 1797 2972 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249918.1 protein_id gnl|my_center|LOCUS_04960 3124 4113 gene locus_tag LOCUS_04970 3124 4113 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975258.1 protein_id gnl|my_center|LOCUS_04970 4119 5831 gene locus_tag LOCUS_04980 4119 5831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 5828 6571 gene locus_tag LOCUS_04990 5828 6571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 6731 7192 gene locus_tag LOCUS_05000 6731 7192 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867224.1 protein_id gnl|my_center|LOCUS_05000 >Feature sequence0052 2068 1289 gene locus_tag LOCUS_05010 2068 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 3844 2081 gene locus_tag LOCUS_05020 3844 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 4451 3852 gene locus_tag LOCUS_05030 4451 3852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 4957 4517 gene locus_tag LOCUS_05040 4957 4517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 6071 5142 gene locus_tag LOCUS_05050 gene yacO 6071 5142 CDS product putative TrmH family tRNA/rRNA methyltransferase YacO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q06753 protein_id gnl|my_center|LOCUS_05050 6691 6071 gene locus_tag LOCUS_05060 gene thrH 6691 6071 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267421.1 protein_id gnl|my_center|LOCUS_05060 7544 6798 gene locus_tag LOCUS_05070 7544 6798 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815983.1 protein_id gnl|my_center|LOCUS_05070 >Feature sequence0053 1210 470 gene locus_tag LOCUS_05080 gene rnc 1210 470 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51833 protein_id gnl|my_center|LOCUS_05080 1547 1212 gene locus_tag LOCUS_05090 1547 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 1691 2479 gene locus_tag LOCUS_05100 1691 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 2800 3633 gene locus_tag LOCUS_05110 gene pomA 2800 3633 CDS product flagellar motor protein MotP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937943.1 protein_id gnl|my_center|LOCUS_05110 3665 4321 gene locus_tag LOCUS_05120 3665 4321 CDS product chemotaxis protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860943.1 protein_id gnl|my_center|LOCUS_05120 4431 5072 gene locus_tag LOCUS_05130 gene motB 4431 5072 CDS product chemotaxis protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986952.1 protein_id gnl|my_center|LOCUS_05130 6386 5082 gene locus_tag LOCUS_05140 gene argA 6386 5082 CDS product amino-acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22567 protein_id gnl|my_center|LOCUS_05140 6385 7452 gene locus_tag LOCUS_05150 6385 7452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 >Feature sequence0054 2363 195 gene locus_tag LOCUS_05160 2363 195 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947460.1 protein_id gnl|my_center|LOCUS_05160 3191 2553 gene locus_tag LOCUS_05170 gene trpF 3191 2553 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AH7 protein_id gnl|my_center|LOCUS_05170 3299 3610 gene locus_tag LOCUS_05180 3299 3610 CDS product UPF0235 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPB6 protein_id gnl|my_center|LOCUS_05180 3683 7606 gene locus_tag LOCUS_05190 3683 7606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 >Feature sequence0055 1231 281 gene locus_tag LOCUS_05200 1231 281 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLS4 protein_id gnl|my_center|LOCUS_05200 1395 3581 gene locus_tag LOCUS_05210 gene recD 1395 3581 CDS product RecBCD enzyme subunit RecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CH01 protein_id gnl|my_center|LOCUS_05210 3718 5025 gene locus_tag LOCUS_05220 3718 5025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 5127 6824 gene locus_tag LOCUS_05230 5127 6824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 >Feature sequence0056 24 689 gene locus_tag LOCUS_05240 gene ccoO 24 689 CDS product cytochrome c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851187.1 protein_id gnl|my_center|LOCUS_05240 720 887 gene locus_tag LOCUS_05250 720 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 951 1850 gene locus_tag LOCUS_05260 gene ccoP 951 1850 CDS product cbb3-type cytochrome c oxidase subunit CcoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O24958 protein_id gnl|my_center|LOCUS_05260 1877 2011 gene locus_tag LOCUS_05270 1877 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 2169 3593 gene locus_tag LOCUS_05280 2169 3593 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858753.1 protein_id gnl|my_center|LOCUS_05280 3599 4189 gene locus_tag LOCUS_05290 3599 4189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 4224 6545 gene locus_tag LOCUS_05300 4224 6545 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891913.1 protein_id gnl|my_center|LOCUS_05300 6580 6825 gene locus_tag LOCUS_05310 6580 6825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 >Feature sequence0057 2171 3736 gene locus_tag LOCUS_05320 gene pntA 2171 3736 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CII9 protein_id gnl|my_center|LOCUS_05320 3805 5199 gene locus_tag LOCUS_05330 3805 5199 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KM25 protein_id gnl|my_center|LOCUS_05330 6467 5361 gene locus_tag LOCUS_05340 6467 5361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 >Feature sequence0058 1233 2834 gene locus_tag LOCUS_05350 gene argD 1233 2834 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5Q4 protein_id gnl|my_center|LOCUS_05350 2956 4047 gene locus_tag LOCUS_05360 gene gmd 2956 4047 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5Y5 protein_id gnl|my_center|LOCUS_05360 4088 4762 gene locus_tag LOCUS_05370 4088 4762 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114053.1 protein_id gnl|my_center|LOCUS_05370 4809 6068 gene locus_tag LOCUS_05380 4809 6068 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTY3 protein_id gnl|my_center|LOCUS_05380 7341 6088 gene locus_tag LOCUS_05390 7341 6088 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015855.1 protein_id gnl|my_center|LOCUS_05390 >Feature sequence0059 1409 474 gene locus_tag LOCUS_05400 gene hldD 1409 474 CDS product ADP-L-glycero-D-manno-heptose-6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67911 protein_id gnl|my_center|LOCUS_05400 1903 1406 gene locus_tag LOCUS_05410 1903 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 2127 4025 gene locus_tag LOCUS_05420 2127 4025 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72D64 protein_id gnl|my_center|LOCUS_05420 >Feature sequence0060 2065 1001 gene locus_tag LOCUS_05430 2065 1001 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404137.1 protein_id gnl|my_center|LOCUS_05430 2154 3044 gene locus_tag LOCUS_05440 gene folD 2154 3044 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73RS2 protein_id gnl|my_center|LOCUS_05440 3334 4335 gene locus_tag LOCUS_05450 3334 4335 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704227.1 protein_id gnl|my_center|LOCUS_05450 4457 5398 gene locus_tag LOCUS_05460 4457 5398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706641.1 protein_id gnl|my_center|LOCUS_05460 5471 7000 gene locus_tag LOCUS_05470 5471 7000 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709921.1 protein_id gnl|my_center|LOCUS_05470 >Feature sequence0061 721 419 gene locus_tag LOCUS_05480 gene nuoK 721 419 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7Q7 protein_id gnl|my_center|LOCUS_05480 1243 731 gene locus_tag LOCUS_05490 gene nuoJ-1 1243 731 CDS product NADH dehydrogenase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941015.1 protein_id gnl|my_center|LOCUS_05490 2911 1280 gene locus_tag LOCUS_05500 2911 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 4181 2922 gene locus_tag LOCUS_05510 gene nuoF 4181 2922 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893427.1 protein_id gnl|my_center|LOCUS_05510 4544 4185 gene locus_tag LOCUS_05520 4544 4185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05520 5034 6743 gene locus_tag LOCUS_05530 5034 6743 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81F28 protein_id gnl|my_center|LOCUS_05530 >Feature sequence0062 1363 563 gene locus_tag LOCUS_05540 1363 563 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191253.1 protein_id gnl|my_center|LOCUS_05540 2162 1353 gene locus_tag LOCUS_05550 2162 1353 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535853.1 protein_id gnl|my_center|LOCUS_05550 2179 2787 gene locus_tag LOCUS_05560 2179 2787 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941355.1 protein_id gnl|my_center|LOCUS_05560 3854 3030 gene locus_tag LOCUS_05570 gene tatC 3854 3030 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72D88 protein_id gnl|my_center|LOCUS_05570 4028 6997 gene locus_tag LOCUS_05580 4028 6997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 >Feature sequence0063 442 113 gene locus_tag LOCUS_05590 442 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 555 1013 gene locus_tag LOCUS_05600 gene rnhA 555 1013 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKU0 protein_id gnl|my_center|LOCUS_05600 1566 1042 gene locus_tag LOCUS_05610 1566 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 2914 1646 gene locus_tag LOCUS_05620 gene serS 2914 1646 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73KB2 protein_id gnl|my_center|LOCUS_05620 3395 3144 gene locus_tag LOCUS_05630 3395 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 3704 3399 gene locus_tag LOCUS_05640 3704 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393078.1 protein_id gnl|my_center|LOCUS_05640 5288 3825 gene locus_tag LOCUS_05650 gene gatA 5288 3825 CDS product aspartyl/glutamyl-tRNA amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812377.1 protein_id gnl|my_center|LOCUS_05650 5562 5305 gene locus_tag LOCUS_05660 5562 5305 CDS product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886812.1 protein_id gnl|my_center|LOCUS_05660 >Feature sequence0064 645 85 gene locus_tag LOCUS_05670 gene nuoC 645 85 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKI4 protein_id gnl|my_center|LOCUS_05670 1376 684 gene locus_tag LOCUS_05680 1376 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 1640 1443 gene locus_tag LOCUS_05690 1640 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 1992 1702 gene locus_tag LOCUS_05700 1992 1702 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930852.1 protein_id gnl|my_center|LOCUS_05700 2357 1995 gene locus_tag LOCUS_05710 gene nuoA 2357 1995 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BQ5 protein_id gnl|my_center|LOCUS_05710 4388 2463 gene locus_tag LOCUS_05720 gene metG 4388 2463 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AE2 protein_id gnl|my_center|LOCUS_05720 4778 4485 gene locus_tag LOCUS_05730 gene yhbY 4778 4485 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417663.1 protein_id gnl|my_center|LOCUS_05730 5074 4781 gene locus_tag LOCUS_05740 5074 4781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 5505 5071 gene locus_tag LOCUS_05750 gene fabZ 5505 5071 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CH00 protein_id gnl|my_center|LOCUS_05750 6029 5505 gene locus_tag LOCUS_05760 6029 5505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 <7042 6089 gene locus_tag LOCUS_05770 <7042 6089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941017.1:NADH-quinone oxidoreductase subunit L >Feature sequence0065 423 1208 gene locus_tag LOCUS_05780 423 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 1245 2156 gene locus_tag LOCUS_05790 1245 2156 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778163.1 protein_id gnl|my_center|LOCUS_05790 2183 2821 gene locus_tag LOCUS_05800 gene plsY 2183 2821 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66905 protein_id gnl|my_center|LOCUS_05800 2846 3976 gene locus_tag LOCUS_05810 gene nce 2846 3976 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404555.1 protein_id gnl|my_center|LOCUS_05810 4671 3973 gene locus_tag LOCUS_05820 4671 3973 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 protein_id gnl|my_center|LOCUS_05820 5381 4719 gene locus_tag LOCUS_05830 gene cobS 5381 4719 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZK9 protein_id gnl|my_center|LOCUS_05830 6543 5497 gene locus_tag LOCUS_05840 gene cobT 6543 5497 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYK9 protein_id gnl|my_center|LOCUS_05840 6967 6614 gene locus_tag LOCUS_05850 gene arsC 6967 6614 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VYL3 protein_id gnl|my_center|LOCUS_05850 >Feature sequence0066 <1 1156 gene locus_tag LOCUS_05860 <1 1156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390531.1:2-oxoglutarate synthase 1267 2004 gene locus_tag LOCUS_05870 1267 2004 CDS product 2-oxoglutarate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390532.1 protein_id gnl|my_center|LOCUS_05870 2179 2574 gene locus_tag LOCUS_05880 2179 2574 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527982.1 protein_id gnl|my_center|LOCUS_05880 2707 3882 gene locus_tag LOCUS_05890 2707 3882 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083872.1 protein_id gnl|my_center|LOCUS_05890 4118 5041 gene locus_tag LOCUS_05900 4118 5041 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083884.1 protein_id gnl|my_center|LOCUS_05900 5042 6043 gene locus_tag LOCUS_05910 5042 6043 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083885.1 protein_id gnl|my_center|LOCUS_05910 6045 6791 gene locus_tag LOCUS_05920 6045 6791 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083886.1 protein_id gnl|my_center|LOCUS_05920 >Feature sequence0067 818 36 gene locus_tag LOCUS_05930 818 36 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807268.1 protein_id gnl|my_center|LOCUS_05930 2815 845 gene locus_tag LOCUS_05940 2815 845 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038733.1 protein_id gnl|my_center|LOCUS_05940 3308 4309 gene locus_tag LOCUS_05950 3308 4309 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538257.1 protein_id gnl|my_center|LOCUS_05950 4394 5227 gene locus_tag LOCUS_05960 gene phnC 4394 5227 CDS product phosphonates import ATP-binding protein PhnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YB24 protein_id gnl|my_center|LOCUS_05960 5230 6054 gene locus_tag LOCUS_05970 5230 6054 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368504.1 protein_id gnl|my_center|LOCUS_05970 6054 6869 gene locus_tag LOCUS_05980 6054 6869 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538258.1 protein_id gnl|my_center|LOCUS_05980 >Feature sequence0068 876 1367 gene locus_tag LOCUS_05990 876 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393113.1 protein_id gnl|my_center|LOCUS_05990 1364 2371 gene locus_tag LOCUS_06000 gene dsrM 1364 2371 CDS product menaquinol oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933897.1 protein_id gnl|my_center|LOCUS_06000 2374 4032 gene locus_tag LOCUS_06010 gene dsrK 2374 4032 CDS product Hdr menaquinol oxidoreductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933896.1 protein_id gnl|my_center|LOCUS_06010 4025 4522 gene locus_tag LOCUS_06020 4025 4522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 4515 5285 gene locus_tag LOCUS_06030 4515 5285 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933894.1 protein_id gnl|my_center|LOCUS_06030 5293 6444 gene locus_tag LOCUS_06040 5293 6444 CDS product Hdr menaquinol oxidoreductase integral membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933893.1 protein_id gnl|my_center|LOCUS_06040 >Feature sequence0069 2179 1676 gene locus_tag LOCUS_06050 2179 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 2466 2284 gene locus_tag LOCUS_06060 2466 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 2773 3846 gene locus_tag LOCUS_06070 2773 3846 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 protein_id gnl|my_center|LOCUS_06070 4016 4672 gene locus_tag LOCUS_06080 4016 4672 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483276.1 protein_id gnl|my_center|LOCUS_06080 4674 6056 gene locus_tag LOCUS_06090 4674 6056 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403751.1 protein_id gnl|my_center|LOCUS_06090 <6930 6143 gene locus_tag LOCUS_06100 <6930 6143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q748B2:release factor glutamine methyltransferase >Feature sequence0070 497 2038 gene locus_tag LOCUS_06110 gene pilB2 497 2038 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546881.1 protein_id gnl|my_center|LOCUS_06110 2263 3597 gene locus_tag LOCUS_06120 2263 3597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 3619 3996 gene locus_tag LOCUS_06130 3619 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 4060 4515 gene locus_tag LOCUS_06140 4060 4515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 4983 4549 gene locus_tag LOCUS_06150 4983 4549 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444695.1 protein_id gnl|my_center|LOCUS_06150 4996 5673 gene locus_tag LOCUS_06160 4996 5673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 6615 5683 gene locus_tag LOCUS_06170 6615 5683 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258190.1 protein_id gnl|my_center|LOCUS_06170 6922 6662 gene locus_tag LOCUS_06180 6922 6662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 >Feature sequence0071 80 415 gene locus_tag LOCUS_06190 gene csaA 80 415 CDS product molecular chaperone CsaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109191.1 protein_id gnl|my_center|LOCUS_06190 1323 343 gene locus_tag LOCUS_06200 1323 343 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113270.1 protein_id gnl|my_center|LOCUS_06200 2961 1465 gene locus_tag LOCUS_06210 2961 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 3754 2948 gene locus_tag LOCUS_06220 gene rsmA 3754 2948 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FMG3 protein_id gnl|my_center|LOCUS_06220 4104 5051 gene locus_tag LOCUS_06230 gene moaA 4104 5051 CDS product cyclic pyranopterin phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ65 protein_id gnl|my_center|LOCUS_06230 5181 6764 gene locus_tag LOCUS_06240 5181 6764 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945835.1 protein_id gnl|my_center|LOCUS_06240 >Feature sequence0072 906 391 gene locus_tag LOCUS_06250 gene shp 906 391 CDS product cytochrome C nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074112.1 protein_id gnl|my_center|LOCUS_06250 1141 899 gene locus_tag LOCUS_06260 1141 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 1747 1160 gene locus_tag LOCUS_06270 1747 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 3519 2113 gene locus_tag LOCUS_06280 3519 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 4474 3674 gene locus_tag LOCUS_06290 4474 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 5332 4766 gene locus_tag LOCUS_06300 5332 4766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 6109 6414 gene locus_tag LOCUS_06310 6109 6414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 >Feature sequence0073 1859 888 gene locus_tag LOCUS_06320 1859 888 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888319.1 protein_id gnl|my_center|LOCUS_06320 2939 1890 gene locus_tag LOCUS_06330 2939 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 3220 5898 gene locus_tag LOCUS_06340 gene acn 3220 5898 CDS product aconitate hydratase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RTN7 protein_id gnl|my_center|LOCUS_06340 5934 6485 gene locus_tag LOCUS_06350 5934 6485 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709188.1 protein_id gnl|my_center|LOCUS_06350 >Feature sequence0074 385 1674 gene locus_tag LOCUS_06360 385 1674 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939648.1 protein_id gnl|my_center|LOCUS_06360 1818 2129 gene locus_tag LOCUS_06370 1818 2129 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333249.1 protein_id gnl|my_center|LOCUS_06370 2274 2456 gene locus_tag LOCUS_06380 gene rpmF 2274 2456 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6MT20 protein_id gnl|my_center|LOCUS_06380 2505 3545 gene locus_tag LOCUS_06390 gene plsX 2505 3545 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CS2 protein_id gnl|my_center|LOCUS_06390 3970 3548 gene locus_tag LOCUS_06400 3970 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 4956 4051 gene locus_tag LOCUS_06410 4956 4051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 5071 5874 gene locus_tag LOCUS_06420 gene glpQ 5071 5874 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_06420 <6781 5902 gene locus_tag LOCUS_06430 <6781 5902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WCH7:anthranilate phosphoribosyltransferase >Feature sequence0075 690 295 gene locus_tag LOCUS_06440 690 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 2098 1949 gene locus_tag LOCUS_06450 2098 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 2846 2133 gene locus_tag LOCUS_06460 2846 2133 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004419147.1 protein_id gnl|my_center|LOCUS_06460 4637 3069 gene locus_tag LOCUS_06470 4637 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 5836 4634 gene locus_tag LOCUS_06480 5836 4634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 <6776 5996 gene locus_tag LOCUS_06490 <6776 5996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943252.1:single-stranded-DNA-specific exonuclease RecJ >Feature sequence0076 674 147 gene locus_tag LOCUS_06500 674 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 1544 780 gene locus_tag LOCUS_06510 gene aapP 1544 780 CDS product arginine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262110.1 protein_id gnl|my_center|LOCUS_06510 2696 1572 gene locus_tag LOCUS_06520 2696 1572 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105885.1 protein_id gnl|my_center|LOCUS_06520 3906 2710 gene locus_tag LOCUS_06530 3906 2710 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481996.1 protein_id gnl|my_center|LOCUS_06530 5038 4022 gene locus_tag LOCUS_06540 gene bztA 5038 4022 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722552.1 protein_id gnl|my_center|LOCUS_06540 6374 5199 gene locus_tag LOCUS_06550 6374 5199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 >Feature sequence0077 2038 1214 gene locus_tag LOCUS_06560 2038 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 2765 2115 gene locus_tag LOCUS_06570 2765 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 2956 2765 gene locus_tag LOCUS_06580 2956 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 3658 2960 gene locus_tag LOCUS_06590 3658 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 5944 3776 gene locus_tag LOCUS_06600 5944 3776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 6276 5941 gene locus_tag LOCUS_06610 6276 5941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 >Feature sequence0078 <1 703 gene locus_tag LOCUS_06620 <1 703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74H61:heat-inducible transcription repressor HrcA 724 1338 gene locus_tag LOCUS_06630 gene grpE 724 1338 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P15874 protein_id gnl|my_center|LOCUS_06630 1440 3362 gene locus_tag LOCUS_06640 gene dnaK 1440 3362 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H59 protein_id gnl|my_center|LOCUS_06640 3441 4556 gene locus_tag LOCUS_06650 gene dnaJ 3441 4556 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RX2 protein_id gnl|my_center|LOCUS_06650 4672 5856 gene locus_tag LOCUS_06660 4672 5856 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941722.1 protein_id gnl|my_center|LOCUS_06660 5878 6378 gene locus_tag LOCUS_06670 gene purE 5878 6378 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y6B6 protein_id gnl|my_center|LOCUS_06670 >Feature sequence0079 501 295 gene locus_tag LOCUS_06680 501 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 1865 696 gene locus_tag LOCUS_06690 1865 696 CDS product antibiotic ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082555.1 protein_id gnl|my_center|LOCUS_06690 2590 1868 gene locus_tag LOCUS_06700 2590 1868 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966543.1 protein_id gnl|my_center|LOCUS_06700 3445 2840 gene locus_tag LOCUS_06710 3445 2840 CDS product TorD family cytoplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261957.1 protein_id gnl|my_center|LOCUS_06710 5548 3503 gene locus_tag LOCUS_06720 5548 3503 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396174.1 protein_id gnl|my_center|LOCUS_06720 6048 5545 gene locus_tag LOCUS_06730 6048 5545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 6580 6218 gene locus_tag LOCUS_06740 6580 6218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 >Feature sequence0080 517 359 gene locus_tag LOCUS_06750 517 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 827 609 gene locus_tag LOCUS_06760 827 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 1865 1068 gene locus_tag LOCUS_06770 1865 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529691.1 protein_id gnl|my_center|LOCUS_06770 2051 2908 gene locus_tag LOCUS_06780 gene trpC 2051 2908 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIT7 protein_id gnl|my_center|LOCUS_06780 2919 3353 gene locus_tag LOCUS_06790 2919 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 4119 3493 gene locus_tag LOCUS_06800 4119 3493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06800 4533 4153 gene locus_tag LOCUS_06810 4533 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06810 <6572 4526 gene locus_tag LOCUS_06820 <6572 4526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071130.1:carbamoyl phosphate synthase large subunit >Feature sequence0081 64 1464 gene locus_tag LOCUS_06830 64 1464 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529293.1 protein_id gnl|my_center|LOCUS_06830 1622 2107 gene locus_tag LOCUS_06840 gene moaE 1622 2107 CDS product molybdopterin-converting factor chain 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036203.1 protein_id gnl|my_center|LOCUS_06840 2098 3264 gene locus_tag LOCUS_06850 2098 3264 CDS product 2-phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227976.1 protein_id gnl|my_center|LOCUS_06850 3272 4495 gene locus_tag LOCUS_06860 3272 4495 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879247.1 protein_id gnl|my_center|LOCUS_06860 >Feature sequence0082 738 562 gene locus_tag LOCUS_06870 738 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 2567 762 gene locus_tag LOCUS_06880 2567 762 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103343.1 protein_id gnl|my_center|LOCUS_06880 3898 2663 gene locus_tag LOCUS_06890 3898 2663 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHD3 protein_id gnl|my_center|LOCUS_06890 4222 3986 gene locus_tag LOCUS_06900 gene acpP 4222 3986 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQH8 protein_id gnl|my_center|LOCUS_06900 5055 4321 gene locus_tag LOCUS_06910 gene fabG 5055 4321 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQH7 protein_id gnl|my_center|LOCUS_06910 6399 5143 gene locus_tag LOCUS_06920 gene mraY 6399 5143 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UDM5 protein_id gnl|my_center|LOCUS_06920 >Feature sequence0083 2128 1169 gene locus_tag LOCUS_06930 gene hemC 2128 1169 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KI9 protein_id gnl|my_center|LOCUS_06930 3445 2132 gene locus_tag LOCUS_06940 gene hemA 3445 2132 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747I2 protein_id gnl|my_center|LOCUS_06940 3600 4166 gene locus_tag LOCUS_06950 3600 4166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 4279 4800 gene locus_tag LOCUS_06960 gene hslV 4279 4800 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3Q4 protein_id gnl|my_center|LOCUS_06960 4805 6160 gene locus_tag LOCUS_06970 gene hslU 4805 6160 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG00 protein_id gnl|my_center|LOCUS_06970 >Feature sequence0084 2813 450 gene locus_tag LOCUS_06980 2813 450 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403114.1 protein_id gnl|my_center|LOCUS_06980 4342 2834 gene locus_tag LOCUS_06990 4342 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 5019 4462 gene locus_tag LOCUS_07000 5019 4462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 5537 6214 gene locus_tag LOCUS_07010 5537 6214 CDS product cytochrome biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268429.1 protein_id gnl|my_center|LOCUS_07010 >Feature sequence0085 2150 1116 gene locus_tag LOCUS_07020 2150 1116 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FY41 protein_id gnl|my_center|LOCUS_07020 2493 5081 gene locus_tag LOCUS_07030 2493 5081 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082976.1 protein_id gnl|my_center|LOCUS_07030 5221 5592 gene locus_tag LOCUS_07040 gene trxA 5221 5592 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51088 protein_id gnl|my_center|LOCUS_07040 >Feature sequence0086 1079 312 gene locus_tag LOCUS_07050 1079 312 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SC0 protein_id gnl|my_center|LOCUS_07050 1749 1237 gene locus_tag LOCUS_07060 gene rppH 1749 1237 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25826 protein_id gnl|my_center|LOCUS_07060 2778 1750 gene locus_tag LOCUS_07070 2778 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 3219 2803 gene locus_tag LOCUS_07080 3219 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 4582 3209 gene locus_tag LOCUS_07090 gene mnmE 4582 3209 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YLC5 protein_id gnl|my_center|LOCUS_07090 6347 4884 gene locus_tag LOCUS_07100 gene fliC 6347 4884 CDS product B-type flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72151 protein_id gnl|my_center|LOCUS_07100 >Feature sequence0087 1130 1816 gene locus_tag LOCUS_07110 1130 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 2328 3293 gene locus_tag LOCUS_07120 2328 3293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 4816 3380 gene locus_tag LOCUS_07130 4816 3380 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948598.1 protein_id gnl|my_center|LOCUS_07130 5332 5000 gene locus_tag LOCUS_07140 5332 5000 CDS product mRNA interferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73KH1 protein_id gnl|my_center|LOCUS_07140 5583 5317 gene locus_tag LOCUS_07150 5583 5317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 >Feature sequence0088 1914 3473 gene locus_tag LOCUS_07160 1914 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 3500 3913 gene locus_tag LOCUS_07170 3500 3913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 4279 3980 gene locus_tag LOCUS_07180 4279 3980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 5090 4314 gene locus_tag LOCUS_07190 gene atpB 5090 4314 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GB2 protein_id gnl|my_center|LOCUS_07190 5631 5113 gene locus_tag LOCUS_07200 5631 5113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 5893 5639 gene locus_tag LOCUS_07210 5893 5639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 >Feature sequence0089 1847 717 gene locus_tag LOCUS_07220 1847 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 3338 2160 gene locus_tag LOCUS_07230 3338 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 3565 3356 gene locus_tag LOCUS_07240 3565 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 3990 3559 gene locus_tag LOCUS_07250 3990 3559 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880901.1 protein_id gnl|my_center|LOCUS_07250 4514 3987 gene locus_tag LOCUS_07260 4514 3987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022440.1 protein_id gnl|my_center|LOCUS_07260 5835 4729 gene locus_tag LOCUS_07270 5835 4729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 >Feature sequence0090 1682 819 gene locus_tag LOCUS_07280 1682 819 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228419.1 protein_id gnl|my_center|LOCUS_07280 1959 2864 gene locus_tag LOCUS_07290 gene ctaB 1959 2864 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S012 protein_id gnl|my_center|LOCUS_07290 3076 3855 gene locus_tag LOCUS_07300 gene coxM 3076 3855 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709066.1 protein_id gnl|my_center|LOCUS_07300 3882 5597 gene locus_tag LOCUS_07310 gene ctaD 3882 5597 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_07310 5666 6247 gene locus_tag LOCUS_07320 5666 6247 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404826.1 protein_id gnl|my_center|LOCUS_07320 >Feature sequence0091 853 458 gene locus_tag LOCUS_07330 853 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 3546 862 gene locus_tag LOCUS_07340 gene infB 3546 862 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNE3 protein_id gnl|my_center|LOCUS_07340 5067 3613 gene locus_tag LOCUS_07350 gene nusA 5067 3613 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CT5 protein_id gnl|my_center|LOCUS_07350 5584 5117 gene locus_tag LOCUS_07360 gene rimP 5584 5117 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJM9 protein_id gnl|my_center|LOCUS_07360 6384 5689 gene locus_tag LOCUS_07370 6384 5689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 >Feature sequence0092 1518 1294 gene locus_tag LOCUS_07380 1518 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 1966 2325 gene locus_tag LOCUS_07390 1966 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 2313 3395 gene locus_tag LOCUS_07400 2313 3395 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104133.1 protein_id gnl|my_center|LOCUS_07400 3493 3732 gene locus_tag LOCUS_07410 3493 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 3793 4068 gene locus_tag LOCUS_07420 3793 4068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 5222 4095 gene locus_tag LOCUS_07430 5222 4095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 >Feature sequence0093 294 2090 gene locus_tag LOCUS_07440 gene aspS 294 2090 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D56 protein_id gnl|my_center|LOCUS_07440 2093 3157 gene locus_tag LOCUS_07450 gene ddl 2093 3157 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FPI5 protein_id gnl|my_center|LOCUS_07450 3519 3175 gene locus_tag LOCUS_07460 3519 3175 CDS product mRNA-degrading endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392535.1 protein_id gnl|my_center|LOCUS_07460 3773 3516 gene locus_tag LOCUS_07470 3773 3516 CDS product multidrug transporter MatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392534.1 protein_id gnl|my_center|LOCUS_07470 3925 3677 gene locus_tag LOCUS_07480 3925 3677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 4339 4815 gene locus_tag LOCUS_07490 4339 4815 CDS product putative tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DYT8 protein_id gnl|my_center|LOCUS_07490 4977 6056 gene locus_tag LOCUS_07500 4977 6056 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124958.1 protein_id gnl|my_center|LOCUS_07500 >Feature sequence0094 2556 1183 gene locus_tag LOCUS_07510 gene ftsY 2556 1183 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E32 protein_id gnl|my_center|LOCUS_07510 2655 4676 gene locus_tag LOCUS_07520 2655 4676 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZU4 protein_id gnl|my_center|LOCUS_07520 5233 4715 gene locus_tag LOCUS_07530 gene msrA 5233 4715 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F024 protein_id gnl|my_center|LOCUS_07530 6012 5221 gene locus_tag LOCUS_07540 gene recO 6012 5221 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q831U0 protein_id gnl|my_center|LOCUS_07540 >Feature sequence0095 1075 494 gene locus_tag LOCUS_07550 1075 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44014 protein_id gnl|my_center|LOCUS_07550 3131 1044 gene locus_tag LOCUS_07560 3131 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 4544 3213 gene locus_tag LOCUS_07570 4544 3213 CDS product chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393455.1 protein_id gnl|my_center|LOCUS_07570 5687 4614 gene locus_tag LOCUS_07580 gene lpxK 5687 4614 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AU2 protein_id gnl|my_center|LOCUS_07580 <6316 5684 gene locus_tag LOCUS_07590 <6316 5684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_002345337.1:type III secretion protein >Feature sequence0096 155 433 gene locus_tag LOCUS_07600 155 433 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878321.1 protein_id gnl|my_center|LOCUS_07600 850 470 gene locus_tag LOCUS_07610 850 470 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881779.1 protein_id gnl|my_center|LOCUS_07610 4646 984 gene locus_tag LOCUS_07620 4646 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 >Feature sequence0097 1296 823 gene locus_tag LOCUS_07630 1296 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07630 1323 2363 gene locus_tag LOCUS_07640 gene pdxA 1323 2363 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3V808 protein_id gnl|my_center|LOCUS_07640 4271 2487 gene locus_tag LOCUS_07650 gene ftsI 4271 2487 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_07650 4662 4279 gene locus_tag LOCUS_07660 4662 4279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 >Feature sequence0098 609 965 gene locus_tag LOCUS_07670 609 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 2040 976 gene locus_tag LOCUS_07680 2040 976 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057332.1 protein_id gnl|my_center|LOCUS_07680 3697 2033 gene locus_tag LOCUS_07690 3697 2033 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388526.1 protein_id gnl|my_center|LOCUS_07690 4405 3737 gene locus_tag LOCUS_07700 4405 3737 CDS product DtxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974588.1 protein_id gnl|my_center|LOCUS_07700 5016 4537 gene locus_tag LOCUS_07710 5016 4537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 <6120 5072 gene locus_tag LOCUS_07720 <6120 5072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704616.1:iron ABC transporter substrate-binding protein >Feature sequence0099 625 900 gene locus_tag LOCUS_07730 625 900 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404970.1 protein_id gnl|my_center|LOCUS_07730 908 1984 gene locus_tag LOCUS_07740 908 1984 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461462.1 protein_id gnl|my_center|LOCUS_07740 5733 2194 gene locus_tag LOCUS_07750 gene mfd 5733 2194 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H75 protein_id gnl|my_center|LOCUS_07750 5981 5766 gene locus_tag LOCUS_07760 5981 5766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 >Feature sequence0100 661 263 gene locus_tag LOCUS_07770 661 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 1841 705 gene locus_tag LOCUS_07780 1841 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 1804 2013 gene locus_tag LOCUS_07790 1804 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 3088 2219 gene locus_tag LOCUS_07800 gene scpA 3088 2219 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C43 protein_id gnl|my_center|LOCUS_07800 5797 3113 gene locus_tag LOCUS_07810 5797 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 >Feature sequence0101 2197 1043 gene locus_tag LOCUS_07820 2197 1043 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 protein_id gnl|my_center|LOCUS_07820 3744 2590 gene locus_tag LOCUS_07830 3744 2590 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_07830 5614 4334 gene locus_tag LOCUS_07840 5614 4334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 5839 5627 gene locus_tag LOCUS_07850 5839 5627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 >Feature sequence0102 876 181 gene locus_tag LOCUS_07860 876 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 886 1404 gene locus_tag LOCUS_07870 886 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 1401 2066 gene locus_tag LOCUS_07880 1401 2066 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476225.1 protein_id gnl|my_center|LOCUS_07880 2178 3041 gene locus_tag LOCUS_07890 2178 3041 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815017.1 protein_id gnl|my_center|LOCUS_07890 3149 4420 gene locus_tag LOCUS_07900 3149 4420 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224310.1 protein_id gnl|my_center|LOCUS_07900 >Feature sequence0103 1111 1836 gene locus_tag LOCUS_07910 1111 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 1858 2271 gene locus_tag LOCUS_07920 1858 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856623.1 protein_id gnl|my_center|LOCUS_07920 2255 2881 gene locus_tag LOCUS_07930 2255 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 2886 3044 gene locus_tag LOCUS_07940 2886 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 4343 3066 gene locus_tag LOCUS_07950 gene hisD 4343 3066 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0P8 protein_id gnl|my_center|LOCUS_07950 <6056 4462 gene locus_tag LOCUS_07960 <6056 4462 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to G5EBD4:chromosome partition protein Smc >Feature sequence0104 <1 663 gene locus_tag LOCUS_07970 <1 663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074121.1:DNA-binding protein 745 1434 gene locus_tag LOCUS_07980 745 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 2938 1502 gene locus_tag LOCUS_07990 2938 1502 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706865.1 protein_id gnl|my_center|LOCUS_07990 3520 2993 gene locus_tag LOCUS_08000 3520 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 4249 3596 gene locus_tag LOCUS_08010 4249 3596 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152997.1 protein_id gnl|my_center|LOCUS_08010 4947 4246 gene locus_tag LOCUS_08020 gene modB2 4947 4246 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419416.1 protein_id gnl|my_center|LOCUS_08020 5749 4949 gene locus_tag LOCUS_08030 5749 4949 CDS product tungsten ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881313.1 protein_id gnl|my_center|LOCUS_08030 >Feature sequence0105 1909 1028 gene locus_tag LOCUS_08040 1909 1028 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066594.1 protein_id gnl|my_center|LOCUS_08040 2436 1912 gene locus_tag LOCUS_08050 2436 1912 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958442.1 protein_id gnl|my_center|LOCUS_08050 2838 2479 gene locus_tag LOCUS_08060 2838 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 3671 2886 gene locus_tag LOCUS_08070 3671 2886 CDS product sulfonate ABC transporter ATP-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972284.1 protein_id gnl|my_center|LOCUS_08070 5116 3671 gene locus_tag LOCUS_08080 gene dht 5116 3671 CDS product D-hydantoinase/dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I676 protein_id gnl|my_center|LOCUS_08080 <5979 5154 gene locus_tag LOCUS_08090 <5979 5154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530894.1:dihydropyrimidine dehydrogenase subunit B >Feature sequence0106 <1 1923 gene locus_tag LOCUS_08100 <1 1923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208107.1:RND transporter 1947 2957 gene locus_tag LOCUS_08110 1947 2957 CDS product MoxR-like ATPase in aerotolerance operon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072987.1 protein_id gnl|my_center|LOCUS_08110 3052 3969 gene locus_tag LOCUS_08120 3052 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948544.1 protein_id gnl|my_center|LOCUS_08120 4064 4546 gene locus_tag LOCUS_08130 4064 4546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038328.1 protein_id gnl|my_center|LOCUS_08130 4560 5582 gene locus_tag LOCUS_08140 gene batA 4560 5582 CDS product VWR domain protein in aerotolerance operon BatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072990.1 protein_id gnl|my_center|LOCUS_08140 >Feature sequence0107 608 2347 gene locus_tag LOCUS_08150 gene recN 608 2347 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BH7 protein_id gnl|my_center|LOCUS_08150 2604 3185 gene locus_tag LOCUS_08160 gene clpP1 2604 3185 CDS product ATP-dependent Clp protease proteolytic subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B0B803 protein_id gnl|my_center|LOCUS_08160 3347 5644 gene locus_tag LOCUS_08170 gene topA 3347 5644 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3X7 protein_id gnl|my_center|LOCUS_08170 >Feature sequence0108 390 653 gene locus_tag LOCUS_08180 390 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 656 1057 gene locus_tag LOCUS_08190 656 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 1196 2020 gene locus_tag LOCUS_08200 1196 2020 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943419.1 protein_id gnl|my_center|LOCUS_08200 2423 2677 gene locus_tag LOCUS_08210 2423 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 2678 3706 gene locus_tag LOCUS_08220 gene argC 2678 3706 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59307 protein_id gnl|my_center|LOCUS_08220 4492 3707 gene locus_tag LOCUS_08230 gene dnaC 4492 3707 CDS product DNA replication protein DnaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601184.1 protein_id gnl|my_center|LOCUS_08230 >Feature sequence0109 1908 385 gene locus_tag LOCUS_08240 1908 385 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021945.1 protein_id gnl|my_center|LOCUS_08240 3238 1970 gene locus_tag LOCUS_08250 3238 1970 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528423.1 protein_id gnl|my_center|LOCUS_08250 3926 3510 gene locus_tag LOCUS_08260 3926 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08260 4874 3942 gene locus_tag LOCUS_08270 4874 3942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08270 <5777 4871 gene locus_tag LOCUS_08280 <5777 4871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337851.1:branched-chain amino acid ABC transporter permease >Feature sequence0110 474 899 gene locus_tag LOCUS_08290 474 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 996 1772 gene locus_tag LOCUS_08300 996 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 1809 2636 gene locus_tag LOCUS_08310 1809 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 2642 3964 gene locus_tag LOCUS_08320 gene nosD 2642 3964 CDS product copper-binding periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYL1 protein_id gnl|my_center|LOCUS_08320 4065 4919 gene locus_tag LOCUS_08330 4065 4919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 >Feature sequence0111 635 2050 gene locus_tag LOCUS_08340 gene pykF 635 2050 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EX62 protein_id gnl|my_center|LOCUS_08340 3264 2101 gene locus_tag LOCUS_08350 gene fadA 3264 2101 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRA1 protein_id gnl|my_center|LOCUS_08350 5603 3447 gene locus_tag LOCUS_08360 gene fadB 5603 3447 CDS product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRA0 protein_id gnl|my_center|LOCUS_08360 >Feature sequence0112 4365 2593 gene locus_tag LOCUS_08370 4365 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 5589 4504 gene locus_tag LOCUS_08380 5589 4504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 >Feature sequence0113 1213 533 gene locus_tag LOCUS_08390 1213 533 CDS product protein glxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731166.1 protein_id gnl|my_center|LOCUS_08390 2114 1215 gene locus_tag LOCUS_08400 2114 1215 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762867.1 protein_id gnl|my_center|LOCUS_08400 3480 2173 gene locus_tag LOCUS_08410 3480 2173 CDS product type III glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532906.1 protein_id gnl|my_center|LOCUS_08410 >Feature sequence0114 240 812 gene locus_tag LOCUS_08420 240 812 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143033.1 protein_id gnl|my_center|LOCUS_08420 763 1488 gene locus_tag LOCUS_08430 763 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 2302 1559 gene locus_tag LOCUS_08440 gene prsW 2302 1559 CDS product protease PrsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50738 protein_id gnl|my_center|LOCUS_08440 2429 3850 gene locus_tag LOCUS_08450 2429 3850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 4142 4585 gene locus_tag LOCUS_08460 gene rplM 4142 4585 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY2 protein_id gnl|my_center|LOCUS_08460 4589 4990 gene locus_tag LOCUS_08470 gene rpsI 4589 4990 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748X5 protein_id gnl|my_center|LOCUS_08470 >Feature sequence0115 <1 881 gene locus_tag LOCUS_08480 <1 881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939506.1:GTP-binding protein 1888 920 gene locus_tag LOCUS_08490 gene rbgA 1888 920 CDS product ribosome biogenesis GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31743 protein_id gnl|my_center|LOCUS_08490 2747 1854 gene locus_tag LOCUS_08500 2747 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 3073 3423 gene locus_tag LOCUS_08510 3073 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 3846 4766 gene locus_tag LOCUS_08520 gene xerD 3846 4766 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q818Z7 protein_id gnl|my_center|LOCUS_08520 5556 4789 gene locus_tag LOCUS_08530 gene dapB 5556 4789 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZ80 protein_id gnl|my_center|LOCUS_08530 >Feature sequence0116 <1 722 gene locus_tag LOCUS_08540 <1 722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P46894:chorismate synthase 1037 1987 gene locus_tag LOCUS_08550 1037 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330175.1 protein_id gnl|my_center|LOCUS_08550 2764 2012 gene locus_tag LOCUS_08560 2764 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392265.1 protein_id gnl|my_center|LOCUS_08560 2863 3390 gene locus_tag LOCUS_08570 2863 3390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 3432 4889 gene locus_tag LOCUS_08580 3432 4889 CDS product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870209.1 protein_id gnl|my_center|LOCUS_08580 <5711 4942 gene locus_tag LOCUS_08590 <5711 4942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939360.1:GTP pyrophosphokinase >Feature sequence0117 <1 1319 gene locus_tag LOCUS_08600 <1 1319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967138.1:methylamine 2773 1403 gene locus_tag LOCUS_08610 2773 1403 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707798.1 protein_id gnl|my_center|LOCUS_08610 3658 2816 gene locus_tag LOCUS_08620 3658 2816 CDS product putrescine ABC transporter permease PotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388770.1 protein_id gnl|my_center|LOCUS_08620 5406 3814 gene locus_tag LOCUS_08630 gene nnr 5406 3814 CDS product bifunctional NAD(P)H-hydrate repair enzyme Nnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIM0 protein_id gnl|my_center|LOCUS_08630 >Feature sequence0118 2340 1246 gene locus_tag LOCUS_08640 2340 1246 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453863.1 protein_id gnl|my_center|LOCUS_08640 2939 2352 gene locus_tag LOCUS_08650 gene fdhB 2939 2352 CDS product formate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812668.1 protein_id gnl|my_center|LOCUS_08650 <5657 2958 gene locus_tag LOCUS_08660 <5657 2958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005453899.1:formate dehydrogenase >Feature sequence0119 <1 535 gene locus_tag LOCUS_08670 <1 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P60344:tRNA pseudouridine synthase B 554 823 gene locus_tag LOCUS_08680 gene rpsO 554 823 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PA13 protein_id gnl|my_center|LOCUS_08680 1152 3224 gene locus_tag LOCUS_08690 gene pnp 1152 3224 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CS9 protein_id gnl|my_center|LOCUS_08690 3466 4386 gene locus_tag LOCUS_08700 gene murI 3466 4386 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NFN6 protein_id gnl|my_center|LOCUS_08700 >Feature sequence0120 173 562 gene locus_tag LOCUS_08710 173 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 559 1938 gene locus_tag LOCUS_08720 559 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 3667 2297 gene locus_tag LOCUS_08730 gene ugdH 3667 2297 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118525.1 protein_id gnl|my_center|LOCUS_08730 5346 3697 gene locus_tag LOCUS_08740 gene gpmI 5346 3697 CDS product putative 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59173 protein_id gnl|my_center|LOCUS_08740 >Feature sequence0121 1111 713 gene locus_tag LOCUS_08750 1111 713 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258116.1 protein_id gnl|my_center|LOCUS_08750 1341 1108 gene locus_tag LOCUS_08760 1341 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 2382 1978 gene locus_tag LOCUS_08770 2382 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064295.1 protein_id gnl|my_center|LOCUS_08770 2744 2379 gene locus_tag LOCUS_08780 2744 2379 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071514.1 protein_id gnl|my_center|LOCUS_08780 3300 2866 gene locus_tag LOCUS_08790 3300 2866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 3835 3464 gene locus_tag LOCUS_08800 3835 3464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258318.1 protein_id gnl|my_center|LOCUS_08800 4245 3973 gene locus_tag LOCUS_08810 4245 3973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 4513 4247 gene locus_tag LOCUS_08820 4513 4247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957044.1 protein_id gnl|my_center|LOCUS_08820 4802 4587 gene locus_tag LOCUS_08830 4802 4587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 5052 4792 gene locus_tag LOCUS_08840 5052 4792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 >Feature sequence0122 1539 4 gene locus_tag LOCUS_08850 1539 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 3991 1841 gene locus_tag LOCUS_08860 gene glyS 3991 1841 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88VS3 protein_id gnl|my_center|LOCUS_08860 4919 3993 gene locus_tag LOCUS_08870 gene glyQ 4919 3993 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I3U3K9 protein_id gnl|my_center|LOCUS_08870 >Feature sequence0123 <1 770 gene locus_tag LOCUS_08880 <1 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RKL6:putative 6-oxopurine nucleoside phosphorylase 3029 792 gene locus_tag LOCUS_08890 3029 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 3320 3075 gene locus_tag LOCUS_08900 gene moaD 3320 3075 CDS product molybdopterin converting factor small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_213755.1 protein_id gnl|my_center|LOCUS_08900 3690 3325 gene locus_tag LOCUS_08910 gene dgkA 3690 3325 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF02 protein_id gnl|my_center|LOCUS_08910 <5595 3702 gene locus_tag LOCUS_08920 <5595 3702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RHN8:phenylalanine--tRNA ligase beta subunit >Feature sequence0124 1347 337 gene locus_tag LOCUS_08930 1347 337 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969505.1 protein_id gnl|my_center|LOCUS_08930 2312 1377 gene locus_tag LOCUS_08940 gene htrB 2312 1377 CDS product lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069787.1 protein_id gnl|my_center|LOCUS_08940 2644 4458 gene locus_tag LOCUS_08950 gene lepA 2644 4458 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60789 protein_id gnl|my_center|LOCUS_08950 >Feature sequence0125 177 1403 gene locus_tag LOCUS_08960 177 1403 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392515.1 protein_id gnl|my_center|LOCUS_08960 1387 1632 gene locus_tag LOCUS_08970 1387 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 2098 1748 gene locus_tag LOCUS_08980 2098 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974541.1 protein_id gnl|my_center|LOCUS_08980 4381 2627 gene locus_tag LOCUS_08990 4381 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 4975 4900 gene locus_tag LOCUS_t00090 4975 4900 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 5125 5040 gene locus_tag LOCUS_t00100 5125 5040 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5272 5478 gene locus_tag LOCUS_09000 5272 5478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 >Feature sequence0126 543 124 gene locus_tag LOCUS_09010 gene gloA 543 124 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947599.1 protein_id gnl|my_center|LOCUS_09010 1096 569 gene locus_tag LOCUS_09020 1096 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 1443 1093 gene locus_tag LOCUS_09030 1443 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 1693 4362 gene locus_tag LOCUS_09040 1693 4362 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108345.1 protein_id gnl|my_center|LOCUS_09040 4807 5349 gene locus_tag LOCUS_09050 4807 5349 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112472.1 protein_id gnl|my_center|LOCUS_09050 >Feature sequence0127 <1 601 gene locus_tag LOCUS_09060 <1 601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938362.1:sigma-54-dependent Fis family transcriptional regulator 624 1520 gene locus_tag LOCUS_09070 gene rsgA 624 1520 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KC52 protein_id gnl|my_center|LOCUS_09070 2578 1529 gene locus_tag LOCUS_09080 2578 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 2611 3162 gene locus_tag LOCUS_09090 2611 3162 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P765 protein_id gnl|my_center|LOCUS_09090 4272 3166 gene locus_tag LOCUS_09100 gene aroB 4272 3166 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q57 protein_id gnl|my_center|LOCUS_09100 4782 4285 gene locus_tag LOCUS_09110 gene cobP 4782 4285 CDS product adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086040.1 protein_id gnl|my_center|LOCUS_09110 <5528 4779 gene locus_tag LOCUS_09120 <5528 4779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RNW9:cobalamin biosynthesis protein CobD >Feature sequence0128 <1 570 gene locus_tag LOCUS_09130 <1 570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940363.1:peptidoglycan-associated lipoprotein 614 1342 gene locus_tag LOCUS_09140 614 1342 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546754.1 protein_id gnl|my_center|LOCUS_09140 1317 1754 gene locus_tag LOCUS_09150 gene exbD 1317 1754 CDS product biopolymer transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A0R9 protein_id gnl|my_center|LOCUS_09150 1982 1764 gene locus_tag LOCUS_09160 gene tatA 1982 1764 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIM8 protein_id gnl|my_center|LOCUS_09160 2126 2422 gene locus_tag LOCUS_09170 2126 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 3766 2483 gene locus_tag LOCUS_09180 gene hemL 3766 2483 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GA9 protein_id gnl|my_center|LOCUS_09180 3903 4223 gene locus_tag LOCUS_09190 3903 4223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 >Feature sequence0129 473 1972 gene locus_tag LOCUS_09200 473 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098866.1 protein_id gnl|my_center|LOCUS_09200 3558 2008 gene locus_tag LOCUS_09210 3558 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 5122 3566 gene locus_tag LOCUS_09220 5122 3566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 >Feature sequence0130 326 1684 gene locus_tag LOCUS_09230 326 1684 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940912.1 protein_id gnl|my_center|LOCUS_09230 1744 2301 gene locus_tag LOCUS_09240 1744 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 2298 3506 gene locus_tag LOCUS_09250 2298 3506 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266391.1 protein_id gnl|my_center|LOCUS_09250 3512 3976 gene locus_tag LOCUS_09260 3512 3976 CDS product 3-hydroxydecanoyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460561.1 protein_id gnl|my_center|LOCUS_09260 3973 4698 gene locus_tag LOCUS_09270 gene fabG 3973 4698 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074036.1 protein_id gnl|my_center|LOCUS_09270 4695 5444 gene locus_tag LOCUS_09280 4695 5444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 >Feature sequence0131 543 1820 gene locus_tag LOCUS_09290 543 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 2015 2851 gene locus_tag LOCUS_09300 2015 2851 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116998.1 protein_id gnl|my_center|LOCUS_09300 2878 3756 gene locus_tag LOCUS_09310 2878 3756 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068302.1 protein_id gnl|my_center|LOCUS_09310 3766 4497 gene locus_tag LOCUS_09320 gene glnQ 3766 4497 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 protein_id gnl|my_center|LOCUS_09320 >Feature sequence0132 1034 2203 gene locus_tag LOCUS_09330 1034 2203 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389599.1 protein_id gnl|my_center|LOCUS_09330 2539 3411 gene locus_tag LOCUS_09340 2539 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 >Feature sequence0133 149 1141 gene locus_tag LOCUS_09350 149 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 1233 1832 gene locus_tag LOCUS_09360 1233 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 1832 2353 gene locus_tag LOCUS_09370 1832 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 2599 3369 gene locus_tag LOCUS_09380 2599 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09380 3382 4311 gene locus_tag LOCUS_09390 3382 4311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09390 >Feature sequence0134 1282 2646 gene locus_tag LOCUS_09400 1282 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 2716 3423 gene locus_tag LOCUS_09410 2716 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 4032 3604 gene locus_tag LOCUS_09420 4032 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 4016 4492 gene locus_tag LOCUS_09430 4016 4492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 >Feature sequence0135 610 816 gene locus_tag LOCUS_09440 610 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 915 1841 gene locus_tag LOCUS_09450 915 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 1933 2532 gene locus_tag LOCUS_09460 1933 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 3760 2576 gene locus_tag LOCUS_09470 3760 2576 CDS product phosphoribosylglycinamide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257876.1 protein_id gnl|my_center|LOCUS_09470 4734 4426 gene locus_tag LOCUS_09480 4734 4426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 >Feature sequence0136 430 759 gene locus_tag LOCUS_09490 430 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 768 1730 gene locus_tag LOCUS_09500 768 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 1911 2864 gene locus_tag LOCUS_09510 gene yhcC-1 1911 2864 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941035.1 protein_id gnl|my_center|LOCUS_09510 3098 3547 gene locus_tag LOCUS_09520 3098 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 3557 4516 gene locus_tag LOCUS_09530 3557 4516 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460695.1 protein_id gnl|my_center|LOCUS_09530 >Feature sequence0137 <1 894 gene locus_tag LOCUS_09540 <1 894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763610.1:phosphoenolpyruvate synthase 1085 2899 gene locus_tag LOCUS_09550 1085 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_599789.1 protein_id gnl|my_center|LOCUS_09550 2931 3548 gene locus_tag LOCUS_09560 2931 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 3568 4143 gene locus_tag LOCUS_09570 gene ubiX 3568 4143 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3G3X8 protein_id gnl|my_center|LOCUS_09570 4145 4600 gene locus_tag LOCUS_09580 4145 4600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 >Feature sequence0138 2588 1359 gene locus_tag LOCUS_09590 gene glgC 2588 1359 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5DZC0 protein_id gnl|my_center|LOCUS_09590 2711 4039 gene locus_tag LOCUS_09600 gene pfkA 2711 4039 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EXU6 protein_id gnl|my_center|LOCUS_09600 >Feature sequence0139 <1 970 gene locus_tag LOCUS_09610 <1 970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339249.1:glutamyl-tRNA amidotransferase subunit A 1358 2092 gene locus_tag LOCUS_09620 1358 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 2085 2423 gene locus_tag LOCUS_09630 2085 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 2497 2943 gene locus_tag LOCUS_09640 2497 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 2959 3888 gene locus_tag LOCUS_09650 2959 3888 CDS product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404955.1 protein_id gnl|my_center|LOCUS_09650 3875 4792 gene locus_tag LOCUS_09660 3875 4792 CDS product stomatin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073827.1 protein_id gnl|my_center|LOCUS_09660 4837 5097 gene locus_tag LOCUS_09670 4837 5097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 >Feature sequence0140 205 2667 gene locus_tag LOCUS_09680 gene priA 205 2667 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94461 protein_id gnl|my_center|LOCUS_09680 2762 3397 gene locus_tag LOCUS_09690 2762 3397 CDS product amino acid transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704971.1 protein_id gnl|my_center|LOCUS_09690 4724 3924 gene locus_tag LOCUS_09700 gene lipM 4724 3924 CDS product octanoyltransferase LipM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q818P0 protein_id gnl|my_center|LOCUS_09700 5077 4742 gene locus_tag LOCUS_09710 5077 4742 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CA3 protein_id gnl|my_center|LOCUS_09710 >Feature sequence0141 477 2042 gene locus_tag LOCUS_09720 477 2042 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420148.1 protein_id gnl|my_center|LOCUS_09720 2320 3120 gene locus_tag LOCUS_09730 gene cpdA 2320 3120 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MQ1 protein_id gnl|my_center|LOCUS_09730 3188 4045 gene locus_tag LOCUS_09740 3188 4045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 4103 4939 gene locus_tag LOCUS_09750 4103 4939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 >Feature sequence0142 2304 1324 gene locus_tag LOCUS_09760 2304 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 3003 3701 gene locus_tag LOCUS_09770 3003 3701 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482754.1 protein_id gnl|my_center|LOCUS_09770 3694 4950 gene locus_tag LOCUS_09780 3694 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 >Feature sequence0143 72 581 gene locus_tag LOCUS_09790 72 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 699 1367 gene locus_tag LOCUS_09800 gene rpe 699 1367 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Z3 protein_id gnl|my_center|LOCUS_09800 1570 2115 gene locus_tag LOCUS_09810 1570 2115 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709135.1 protein_id gnl|my_center|LOCUS_09810 2112 3017 gene locus_tag LOCUS_09820 2112 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 4225 3074 gene locus_tag LOCUS_09830 4225 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122598.1 protein_id gnl|my_center|LOCUS_09830 4526 4227 gene locus_tag LOCUS_09840 4526 4227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 >Feature sequence0144 562 350 gene locus_tag LOCUS_09850 562 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 1601 2284 gene locus_tag LOCUS_09860 1601 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 2474 3550 gene locus_tag LOCUS_09870 2474 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 3724 3903 gene locus_tag LOCUS_09880 3724 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 4639 4043 gene locus_tag LOCUS_09890 4639 4043 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478031.1 protein_id gnl|my_center|LOCUS_09890 >Feature sequence0145 <1 713 gene locus_tag LOCUS_09900 <1 713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086663.1:dihydrodipicolinate synthase family protein 892 1569 gene locus_tag LOCUS_09910 892 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 1890 3770 gene locus_tag LOCUS_09920 gene rpsA 1890 3770 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_09920 <5178 3994 gene locus_tag LOCUS_09930 <5178 3994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0C6NZT1:microcystinase C >Feature sequence0146 <1 1250 gene locus_tag LOCUS_09940 <1 1250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933893.1:Hdr menaquinol oxidoreductase integral membrane subunit 1453 1824 gene locus_tag LOCUS_09950 1453 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 1978 3591 gene locus_tag LOCUS_09960 gene nirS 1978 3591 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24474 protein_id gnl|my_center|LOCUS_09960 3688 4089 gene locus_tag LOCUS_09970 3688 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 4086 4523 gene locus_tag LOCUS_09980 4086 4523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 >Feature sequence0147 442 4245 gene locus_tag LOCUS_09990 442 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 >Feature sequence0148 178 930 gene locus_tag LOCUS_10000 178 930 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P62036 protein_id gnl|my_center|LOCUS_10000 923 1420 gene locus_tag LOCUS_10010 gene ruvC 923 1420 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E88 protein_id gnl|my_center|LOCUS_10010 1465 2082 gene locus_tag LOCUS_10020 gene ruvA 1465 2082 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZW00 protein_id gnl|my_center|LOCUS_10020 2123 2590 gene locus_tag LOCUS_10030 gene ssb1 2123 2590 CDS product single-stranded DNA-binding protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KB47 protein_id gnl|my_center|LOCUS_10030 2781 3596 gene locus_tag LOCUS_10040 2781 3596 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946141.1 protein_id gnl|my_center|LOCUS_10040 >Feature sequence0149 1167 325 gene locus_tag LOCUS_10050 1167 325 CDS product phage antirepressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_10050 2906 1371 gene locus_tag LOCUS_10060 2906 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 4028 2949 gene locus_tag LOCUS_10070 4028 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 4483 4025 gene locus_tag LOCUS_10080 gene aroQ 4483 4025 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43878 protein_id gnl|my_center|LOCUS_10080 >Feature sequence0150 1709 858 gene locus_tag LOCUS_10090 1709 858 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72E95 protein_id gnl|my_center|LOCUS_10090 1873 2136 gene locus_tag LOCUS_10100 1873 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 2133 3038 gene locus_tag LOCUS_10110 gene prmA 2133 3038 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G05 protein_id gnl|my_center|LOCUS_10110 3204 3713 gene locus_tag LOCUS_10120 3204 3713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460030.1 protein_id gnl|my_center|LOCUS_10120 3723 4097 gene locus_tag LOCUS_10130 3723 4097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 >Feature sequence0151 1846 3351 gene locus_tag LOCUS_10140 gene pepA 1846 3351 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHC6 protein_id gnl|my_center|LOCUS_10140 3392 4768 gene locus_tag LOCUS_10150 3392 4768 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SMG8 protein_id gnl|my_center|LOCUS_10150 >Feature sequence0152 1297 176 gene locus_tag LOCUS_10160 1297 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 2451 1357 gene locus_tag LOCUS_10170 2451 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 3053 4072 gene locus_tag LOCUS_10180 3053 4072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 4087 4437 gene locus_tag LOCUS_10190 4087 4437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 >Feature sequence0153 433 1764 gene locus_tag LOCUS_10200 433 1764 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067496.1 protein_id gnl|my_center|LOCUS_10200 1860 2237 gene locus_tag LOCUS_10210 1860 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 2273 2635 gene locus_tag LOCUS_10220 2273 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 3264 2668 gene locus_tag LOCUS_10230 3264 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 4683 3352 gene locus_tag LOCUS_10240 4683 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 >Feature sequence0154 1870 2568 gene locus_tag LOCUS_10250 gene cmk 1870 2568 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHA7 protein_id gnl|my_center|LOCUS_10250 2606 3796 gene locus_tag LOCUS_10260 2606 3796 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877197.1 protein_id gnl|my_center|LOCUS_10260 >Feature sequence0155 653 1171 gene locus_tag LOCUS_10270 653 1171 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXS2 protein_id gnl|my_center|LOCUS_10270 2357 1257 gene locus_tag LOCUS_10280 2357 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143093.1 protein_id gnl|my_center|LOCUS_10280 2901 2425 gene locus_tag LOCUS_10290 2901 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 3114 4187 gene locus_tag LOCUS_10300 3114 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 >Feature sequence0156 922 188 gene locus_tag LOCUS_10310 922 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 3864 919 gene locus_tag LOCUS_10320 gene gcvP1 3864 919 CDS product glycine dehydrogenase (decarboxylating) 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I137 protein_id gnl|my_center|LOCUS_10320 4589 4179 gene locus_tag LOCUS_10330 4589 4179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 >Feature sequence0157 2049 208 gene locus_tag LOCUS_10340 gene dnaK 2049 208 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YH59 protein_id gnl|my_center|LOCUS_10340 2594 2091 gene locus_tag LOCUS_10350 gene hscB 2594 2091 CDS product co-chaperone protein HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62IZ4 protein_id gnl|my_center|LOCUS_10350 3125 2739 gene locus_tag LOCUS_10360 gene iscU 3125 2739 CDS product iron-sulfur cluster assembly scaffold protein IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0ACD6 protein_id gnl|my_center|LOCUS_10360 4376 3162 gene locus_tag LOCUS_10370 gene iscS 4376 3162 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A6B7 protein_id gnl|my_center|LOCUS_10370 4809 4354 gene locus_tag LOCUS_10380 4809 4354 CDS product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390324.1 protein_id gnl|my_center|LOCUS_10380 >Feature sequence0158 252 1223 gene locus_tag LOCUS_10390 gene selD 252 1223 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q9L4E1 protein_id gnl|my_center|LOCUS_10390 1367 3475 gene locus_tag LOCUS_10400 gene fusA 1367 3475 CDS product elongation factor G 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O30913 protein_id gnl|my_center|LOCUS_10400 4632 3472 gene locus_tag LOCUS_10410 gene degT 4632 3472 CDS product pleiotropic regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118241.1 protein_id gnl|my_center|LOCUS_10410 >Feature sequence0159 491 2356 gene locus_tag LOCUS_10420 gene msbA 491 2356 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036606.1 protein_id gnl|my_center|LOCUS_10420 3750 2386 gene locus_tag LOCUS_10430 3750 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 >Feature sequence0160 251 1333 gene locus_tag LOCUS_10440 gene yceG 251 1333 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941176.1 protein_id gnl|my_center|LOCUS_10440 1338 3191 gene locus_tag LOCUS_10450 1338 3191 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143661.1 protein_id gnl|my_center|LOCUS_10450 3247 4752 gene locus_tag LOCUS_10460 gene modF 3247 4752 CDS product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096900.1 protein_id gnl|my_center|LOCUS_10460 >Feature sequence0161 1959 703 gene locus_tag LOCUS_10470 1959 703 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868271.1 protein_id gnl|my_center|LOCUS_10470 3618 2062 gene locus_tag LOCUS_10480 gene leuA 3618 2062 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BX2 protein_id gnl|my_center|LOCUS_10480 4248 3727 gene locus_tag LOCUS_10490 gene dcd 4248 3727 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67539 protein_id gnl|my_center|LOCUS_10490 >Feature sequence0162 1431 259 gene locus_tag LOCUS_10500 1431 259 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887074.1 protein_id gnl|my_center|LOCUS_10500 1723 2820 gene locus_tag LOCUS_10510 1723 2820 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267680.1 protein_id gnl|my_center|LOCUS_10510 3665 2829 gene locus_tag LOCUS_10520 3665 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267474.1 protein_id gnl|my_center|LOCUS_10520 4804 3665 gene locus_tag LOCUS_10530 4804 3665 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533412.1 protein_id gnl|my_center|LOCUS_10530 >Feature sequence0163 2613 1729 gene locus_tag LOCUS_10540 gene metF 2613 1729 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNJ7 protein_id gnl|my_center|LOCUS_10540 <4904 2912 gene locus_tag LOCUS_10550 <4904 2912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000262613.1:methionine synthase >Feature sequence0164 2604 1810 gene locus_tag LOCUS_10560 2604 1810 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703373.1 protein_id gnl|my_center|LOCUS_10560 3038 3475 gene locus_tag LOCUS_10570 3038 3475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880563.1 protein_id gnl|my_center|LOCUS_10570 3481 3732 gene locus_tag LOCUS_10580 3481 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 >Feature sequence0165 980 792 gene locus_tag LOCUS_10590 980 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 1555 1085 gene locus_tag LOCUS_10600 gene ribH 1555 1085 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61723 protein_id gnl|my_center|LOCUS_10600 1912 1604 gene locus_tag LOCUS_10610 1912 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 2086 2487 gene locus_tag LOCUS_10620 2086 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 2521 3159 gene locus_tag LOCUS_10630 gene tmk 2521 3159 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37537 protein_id gnl|my_center|LOCUS_10630 3198 3956 gene locus_tag LOCUS_10640 3198 3956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 4803 3988 gene locus_tag LOCUS_10650 4803 3988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 >Feature sequence0166 1385 9 gene locus_tag LOCUS_10660 gene glnA 1385 9 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972090.1 protein_id gnl|my_center|LOCUS_10660 2691 1603 gene locus_tag LOCUS_10670 2691 1603 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719483.1 protein_id gnl|my_center|LOCUS_10670 4109 2787 gene locus_tag LOCUS_10680 4109 2787 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719484.1 protein_id gnl|my_center|LOCUS_10680 4618 4106 gene locus_tag LOCUS_10690 4618 4106 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719485.1 protein_id gnl|my_center|LOCUS_10690 >Feature sequence0167 1732 623 gene locus_tag LOCUS_10700 gene frmA 1732 623 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFC7 protein_id gnl|my_center|LOCUS_10700 1894 2826 gene locus_tag LOCUS_10710 gene gluQ 1894 2826 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY80 protein_id gnl|my_center|LOCUS_10710 3308 2829 gene locus_tag LOCUS_10720 gene greA 3308 2829 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZS95 protein_id gnl|my_center|LOCUS_10720 3747 3424 gene locus_tag LOCUS_10730 3747 3424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 4689 4003 gene locus_tag LOCUS_10740 4689 4003 CDS product fumarylpyruvate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199325.1 protein_id gnl|my_center|LOCUS_10740 >Feature sequence0168 349 750 gene locus_tag LOCUS_10750 349 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088906.1 protein_id gnl|my_center|LOCUS_10750 1203 1469 gene locus_tag LOCUS_10760 1203 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958642.1 protein_id gnl|my_center|LOCUS_10760 1731 1964 gene locus_tag LOCUS_10770 1731 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 2451 2882 gene locus_tag LOCUS_10780 2451 2882 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020097.1 protein_id gnl|my_center|LOCUS_10780 2965 3417 gene locus_tag LOCUS_10790 2965 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 3481 4701 gene locus_tag LOCUS_10800 3481 4701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206376.1 protein_id gnl|my_center|LOCUS_10800 >Feature sequence0169 <1 1507 gene locus_tag LOCUS_10810 <1 1507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8TE98:transketolase 1606 2670 gene locus_tag LOCUS_10820 1606 2670 CDS product fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388354.1 protein_id gnl|my_center|LOCUS_10820 2709 4130 gene locus_tag LOCUS_10830 gene cbbL 2709 4130 CDS product ribulose bisphosphate carboxylase large chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VD33 protein_id gnl|my_center|LOCUS_10830 4221 4574 gene locus_tag LOCUS_10840 gene rbcS 4221 4574 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124705.1 protein_id gnl|my_center|LOCUS_10840 >Feature sequence0170 885 181 gene locus_tag LOCUS_10850 885 181 CDS product tributyrin esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875831.1 protein_id gnl|my_center|LOCUS_10850 1790 873 gene locus_tag LOCUS_10860 gene purF 1790 873 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973660.1 protein_id gnl|my_center|LOCUS_10860 3249 1921 gene locus_tag LOCUS_10870 3249 1921 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJW4 protein_id gnl|my_center|LOCUS_10870 3611 4246 gene locus_tag LOCUS_10880 3611 4246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 >Feature sequence0171 121 810 gene locus_tag LOCUS_10890 121 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 2036 813 gene locus_tag LOCUS_10900 2036 813 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532243.1 protein_id gnl|my_center|LOCUS_10900 2139 3275 gene locus_tag LOCUS_10910 2139 3275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 4614 3304 gene locus_tag LOCUS_10920 4614 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 >Feature sequence0172 1417 71 gene locus_tag LOCUS_10930 gene pykF 1417 71 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EX62 protein_id gnl|my_center|LOCUS_10930 2988 1516 gene locus_tag LOCUS_10940 2988 1516 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZ75 protein_id gnl|my_center|LOCUS_10940 4655 3012 gene locus_tag LOCUS_10950 4655 3012 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101357.1 protein_id gnl|my_center|LOCUS_10950 >Feature sequence0173 403 1488 gene locus_tag LOCUS_10960 403 1488 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966194.1 protein_id gnl|my_center|LOCUS_10960 2063 1605 gene locus_tag LOCUS_10970 2063 1605 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932524.1 protein_id gnl|my_center|LOCUS_10970 2299 4002 gene locus_tag LOCUS_10980 2299 4002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 >Feature sequence0174 1456 1091 gene locus_tag LOCUS_10990 1456 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 3533 1563 gene locus_tag LOCUS_11000 3533 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 >Feature sequence0175 1865 1632 gene locus_tag LOCUS_11010 1865 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 3402 1912 gene locus_tag LOCUS_11020 gene gabD 3402 1912 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187560.1 protein_id gnl|my_center|LOCUS_11020 >Feature sequence0176 510 1082 gene locus_tag LOCUS_11030 510 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11030 1147 3432 gene locus_tag LOCUS_11040 1147 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 3725 3438 gene locus_tag LOCUS_11050 3725 3438 CDS product stress responsive protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986755.1 protein_id gnl|my_center|LOCUS_11050 <4758 3734 gene locus_tag LOCUS_11060 <4758 3734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A5I748:tyrosine--tRNA ligase >Feature sequence0177 856 515 gene locus_tag LOCUS_11070 856 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 1610 876 gene locus_tag LOCUS_11080 1610 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656707.1 protein_id gnl|my_center|LOCUS_11080 <4751 1748 gene locus_tag LOCUS_11090 <4751 1748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9RDE2:tricorn protease >Feature sequence0178 1396 2433 gene locus_tag LOCUS_11100 gene recA 1396 2433 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P16971 protein_id gnl|my_center|LOCUS_11100 2430 3542 gene locus_tag LOCUS_11110 2430 3542 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861175.1 protein_id gnl|my_center|LOCUS_11110 >Feature sequence0179 776 555 gene locus_tag LOCUS_11120 776 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 1283 996 gene locus_tag LOCUS_11130 gene higA 1283 996 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403401.1 protein_id gnl|my_center|LOCUS_11130 1571 1293 gene locus_tag LOCUS_11140 1571 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605676.1 protein_id gnl|my_center|LOCUS_11140 2202 2005 gene locus_tag LOCUS_11150 2202 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 2795 2463 gene locus_tag LOCUS_11160 2795 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 3304 2957 gene locus_tag LOCUS_11170 gene tfoX 3304 2957 CDS product competence protein TfoX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135500.1 protein_id gnl|my_center|LOCUS_11170 4380 3445 gene locus_tag LOCUS_11180 4380 3445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554540.1 protein_id gnl|my_center|LOCUS_11180 >Feature sequence0180 1924 302 gene locus_tag LOCUS_11190 1924 302 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389348.1 protein_id gnl|my_center|LOCUS_11190 2182 3231 gene locus_tag LOCUS_11200 2182 3231 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096710.1 protein_id gnl|my_center|LOCUS_11200 3240 4088 gene locus_tag LOCUS_11210 gene kdsA 3240 4088 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZFK4 protein_id gnl|my_center|LOCUS_11210 4118 4477 gene locus_tag LOCUS_11220 4118 4477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 >Feature sequence0181 3293 174 gene locus_tag LOCUS_11230 gene ileS 3293 174 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73JB2 protein_id gnl|my_center|LOCUS_11230 4372 3371 gene locus_tag LOCUS_11240 4372 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 >Feature sequence0182 <1 601 gene locus_tag LOCUS_11250 <1 601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000888997.1:cell division protein FtsZ 653 1360 gene locus_tag LOCUS_11260 gene ate 653 1360 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PCI0 protein_id gnl|my_center|LOCUS_11260 1385 1873 gene locus_tag LOCUS_11270 gene moaC 1385 1873 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q48260 protein_id gnl|my_center|LOCUS_11270 2333 1908 gene locus_tag LOCUS_11280 2333 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 >Feature sequence0183 5 724 gene locus_tag LOCUS_11290 5 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 749 1894 gene locus_tag LOCUS_11300 749 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 1929 3152 gene locus_tag LOCUS_11310 1929 3152 CDS product ectoine hydrolase DoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530333.1 protein_id gnl|my_center|LOCUS_11310 3780 3178 gene locus_tag LOCUS_11320 3780 3178 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097039.1 protein_id gnl|my_center|LOCUS_11320 <4643 3912 gene locus_tag LOCUS_11330 <4643 3912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940609.1:phosphopantothenoylcysteine decarboxylase >Feature sequence0184 <1 1348 gene locus_tag LOCUS_11340 <1 1348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005168762.1:chemotaxis protein CheA 1369 1920 gene locus_tag LOCUS_11350 gene cheW 1369 1920 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037040.1 protein_id gnl|my_center|LOCUS_11350 1917 2993 gene locus_tag LOCUS_11360 gene cheB2 1917 2993 CDS product chemotaxis response regulator protein-glutamate methylesterase of group 2 operon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P62639 protein_id gnl|my_center|LOCUS_11360 3193 3633 gene locus_tag LOCUS_11370 3193 3633 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767059.1 protein_id gnl|my_center|LOCUS_11370 >Feature sequence0185 1768 863 gene locus_tag LOCUS_11380 1768 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 2569 1793 gene locus_tag LOCUS_11390 gene lpxA 2569 1793 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FS50 protein_id gnl|my_center|LOCUS_11390 2758 3405 gene locus_tag LOCUS_11400 2758 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 3418 3867 gene locus_tag LOCUS_11410 3418 3867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 4258 3875 gene locus_tag LOCUS_11420 gene apaG 4258 3875 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CGX7 protein_id gnl|my_center|LOCUS_11420 >Feature sequence0186 2423 300 gene locus_tag LOCUS_11430 2423 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 3583 2657 gene locus_tag LOCUS_11440 gene fcl 3583 2657 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FI1 protein_id gnl|my_center|LOCUS_11440 >Feature sequence0187 230 487 gene locus_tag LOCUS_11450 230 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 503 1447 gene locus_tag LOCUS_11460 503 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 1523 2212 gene locus_tag LOCUS_11470 1523 2212 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532669.1 protein_id gnl|my_center|LOCUS_11470 2337 2588 gene locus_tag LOCUS_11480 2337 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 2591 2917 gene locus_tag LOCUS_11490 2591 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 2985 3206 gene locus_tag LOCUS_11500 2985 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 3372 3911 gene locus_tag LOCUS_11510 3372 3911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 >Feature sequence0188 <1 2118 gene locus_tag LOCUS_11520 <1 2118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114679.1:xanthine dehydrogenase molybdopterin binding subunit 2269 3312 gene locus_tag LOCUS_11530 2269 3312 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108126.1 protein_id gnl|my_center|LOCUS_11530 3331 3657 gene locus_tag LOCUS_11540 3331 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 >Feature sequence0189 1209 448 gene locus_tag LOCUS_11550 1209 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 3253 1196 gene locus_tag LOCUS_11560 gene cat5 3253 1196 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404999.1 protein_id gnl|my_center|LOCUS_11560 3979 3320 gene locus_tag LOCUS_11570 gene lolA 3979 3320 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZGC6 protein_id gnl|my_center|LOCUS_11570 >Feature sequence0190 1352 432 gene locus_tag LOCUS_11580 1352 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 1901 1707 gene locus_tag LOCUS_11590 1901 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 4299 1849 gene locus_tag LOCUS_11600 4299 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 >Feature sequence0191 1872 1033 gene locus_tag LOCUS_11610 1872 1033 CDS product non-ribosomal peptide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525107.1 protein_id gnl|my_center|LOCUS_11610 2426 1869 gene locus_tag LOCUS_11620 2426 1869 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528294.1 protein_id gnl|my_center|LOCUS_11620 3185 2460 gene locus_tag LOCUS_11630 3185 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528408.1 protein_id gnl|my_center|LOCUS_11630 4122 3244 gene locus_tag LOCUS_11640 4122 3244 CDS product 3-keto-5-aminohexanoate cleavage enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186835.1 protein_id gnl|my_center|LOCUS_11640 >Feature sequence0192 3 1001 gene locus_tag LOCUS_11650 3 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 1007 1855 gene locus_tag LOCUS_11660 gene ans 1007 1855 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020718.1 protein_id gnl|my_center|LOCUS_11660 2410 1862 gene locus_tag LOCUS_11670 2410 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 >Feature sequence0193 243 2012 gene locus_tag LOCUS_11680 243 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 2030 3820 gene locus_tag LOCUS_11690 gene rpoD 2030 3820 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748B8 protein_id gnl|my_center|LOCUS_11690 >Feature sequence0194 1764 298 gene locus_tag LOCUS_11700 gene ccoN 1764 298 CDS product cytochrome c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851405.1 protein_id gnl|my_center|LOCUS_11700 2044 4326 gene locus_tag LOCUS_11710 2044 4326 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461874.1 protein_id gnl|my_center|LOCUS_11710 >Feature sequence0195 970 38 gene locus_tag LOCUS_11720 gene secF 970 38 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTY6 protein_id gnl|my_center|LOCUS_11720 2575 1007 gene locus_tag LOCUS_11730 gene secD 2575 1007 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749X5 protein_id gnl|my_center|LOCUS_11730 3143 2712 gene locus_tag LOCUS_11740 3143 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 4347 3517 gene locus_tag LOCUS_11750 4347 3517 CDS product cobalt transporter subunit CbtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531118.1 protein_id gnl|my_center|LOCUS_11750 >Feature sequence0196 1609 851 gene locus_tag LOCUS_11760 1609 851 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389167.1 protein_id gnl|my_center|LOCUS_11760 2337 1639 gene locus_tag LOCUS_11770 2337 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196743.1 protein_id gnl|my_center|LOCUS_11770 2937 2614 gene locus_tag LOCUS_11780 2937 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 3361 3543 gene locus_tag LOCUS_11790 3361 3543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 >Feature sequence0197 <1 515 gene locus_tag LOCUS_11800 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004525503.1:agmatinase 1808 555 gene locus_tag LOCUS_11810 1808 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 3525 1822 gene locus_tag LOCUS_11820 gene glnS 3525 1822 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVP0 protein_id gnl|my_center|LOCUS_11820 4259 3576 gene locus_tag LOCUS_11830 gene ligE 4259 3576 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090161.1 protein_id gnl|my_center|LOCUS_11830 >Feature sequence0198 <1 1132 gene locus_tag LOCUS_11840 <1 1132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918807.1:MBL fold metallo-hydrolase 1129 3399 gene locus_tag LOCUS_11850 gene rnr 1129 3399 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21499 protein_id gnl|my_center|LOCUS_11850 >Feature sequence0199 3035 843 gene locus_tag LOCUS_11860 gene icd 3035 843 CDS product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942111.1 protein_id gnl|my_center|LOCUS_11860 <4367 3284 gene locus_tag LOCUS_11870 <4367 3284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030822.1:chloride channel protein >Feature sequence0200 68 1075 gene locus_tag LOCUS_11880 68 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 1325 2335 gene locus_tag LOCUS_11890 1325 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11890 2354 3235 gene locus_tag LOCUS_11900 2354 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11900 3271 4299 gene locus_tag LOCUS_11910 gene korB 3271 4299 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121170.1 protein_id gnl|my_center|LOCUS_11910 >Feature sequence0201 346 1701 gene locus_tag LOCUS_11920 346 1701 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530341.1 protein_id gnl|my_center|LOCUS_11920 2636 1695 gene locus_tag LOCUS_11930 gene fliM 2636 1695 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938209.1 protein_id gnl|my_center|LOCUS_11930 3970 2645 gene locus_tag LOCUS_11940 3970 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 >Feature sequence0202 1198 200 gene locus_tag LOCUS_11950 1198 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 2245 1610 gene locus_tag LOCUS_11960 2245 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 3408 2263 gene locus_tag LOCUS_11970 3408 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 >Feature sequence0203 2819 1437 gene locus_tag LOCUS_11980 2819 1437 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404102.1 protein_id gnl|my_center|LOCUS_11980 3556 2834 gene locus_tag LOCUS_11990 gene menG 3556 2834 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EXJ3 protein_id gnl|my_center|LOCUS_11990 >Feature sequence0204 647 1567 gene locus_tag LOCUS_12000 647 1567 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249843.1 protein_id gnl|my_center|LOCUS_12000 1769 2665 gene locus_tag LOCUS_12010 1769 2665 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533022.1 protein_id gnl|my_center|LOCUS_12010 2769 3230 gene locus_tag LOCUS_12020 2769 3230 CDS product RbsD or FucU transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532181.1 protein_id gnl|my_center|LOCUS_12020 3264 4052 gene locus_tag LOCUS_12030 3264 4052 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200881.1 protein_id gnl|my_center|LOCUS_12030 >Feature sequence0205 2465 3691 gene locus_tag LOCUS_12040 2465 3691 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176674.1 protein_id gnl|my_center|LOCUS_12040 >Feature sequence0206 2150 258 gene locus_tag LOCUS_12050 2150 258 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532890.1 protein_id gnl|my_center|LOCUS_12050 3399 2335 gene locus_tag LOCUS_12060 3399 2335 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532889.1 protein_id gnl|my_center|LOCUS_12060 <4260 3543 gene locus_tag LOCUS_12070 <4260 3543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532888.1:ABC transporter >Feature sequence0207 1519 395 gene locus_tag LOCUS_12080 gene clpX 1519 395 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C83 protein_id gnl|my_center|LOCUS_12080 2258 1662 gene locus_tag LOCUS_12090 gene clpP 2258 1662 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YI38 protein_id gnl|my_center|LOCUS_12090 3698 2307 gene locus_tag LOCUS_12100 gene tig 3698 2307 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YI37 protein_id gnl|my_center|LOCUS_12100 >Feature sequence0208 557 165 gene locus_tag LOCUS_12110 gene gcvH 557 165 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CPW8 protein_id gnl|my_center|LOCUS_12110 808 2283 gene locus_tag LOCUS_12120 gene htrA 808 2283 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873435.1 protein_id gnl|my_center|LOCUS_12120 2317 2496 gene locus_tag LOCUS_12130 2317 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 2627 3352 gene locus_tag LOCUS_12140 2627 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 >Feature sequence0209 2240 498 gene locus_tag LOCUS_12150 2240 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 2818 2519 gene locus_tag LOCUS_12160 2818 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 3169 2870 gene locus_tag LOCUS_12170 3169 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 3686 3246 gene locus_tag LOCUS_12180 3686 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 >Feature sequence0210 217 98 gene locus_tag LOCUS_12190 217 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 359 508 gene locus_tag LOCUS_12200 359 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 605 826 gene locus_tag LOCUS_12210 605 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 1382 1783 gene locus_tag LOCUS_12220 1382 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023843.1 protein_id gnl|my_center|LOCUS_12220 1911 2702 gene locus_tag LOCUS_12230 1911 2702 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067407.1 protein_id gnl|my_center|LOCUS_12230 2811 3686 gene locus_tag LOCUS_12240 2811 3686 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072236.1 protein_id gnl|my_center|LOCUS_12240 >Feature sequence0211 777 1739 gene locus_tag LOCUS_12250 777 1739 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528641.1 protein_id gnl|my_center|LOCUS_12250 1769 3526 gene locus_tag LOCUS_12260 1769 3526 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869125.1 protein_id gnl|my_center|LOCUS_12260 4127 3543 gene locus_tag LOCUS_12270 4127 3543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530297.1 protein_id gnl|my_center|LOCUS_12270 >Feature sequence0212 2104 821 gene locus_tag LOCUS_12280 gene aroA 2104 821 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QX9 protein_id gnl|my_center|LOCUS_12280 3000 2101 gene locus_tag LOCUS_12290 3000 2101 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903644.1 protein_id gnl|my_center|LOCUS_12290 3116 3277 gene locus_tag LOCUS_12300 3116 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 3452 3982 gene locus_tag LOCUS_12310 3452 3982 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958442.1 protein_id gnl|my_center|LOCUS_12310 >Feature sequence0213 2890 1817 gene locus_tag LOCUS_12320 2890 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 4110 2902 gene locus_tag LOCUS_12330 4110 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 >Feature sequence0214 1356 64 gene locus_tag LOCUS_12340 gene kdtA 1356 64 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962573.1 protein_id gnl|my_center|LOCUS_12340 2721 1366 gene locus_tag LOCUS_12350 2721 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 >Feature sequence0215 535 2382 gene locus_tag LOCUS_12360 535 2382 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267221.1 protein_id gnl|my_center|LOCUS_12360 2426 3523 gene locus_tag LOCUS_12370 2426 3523 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954183.1 protein_id gnl|my_center|LOCUS_12370 >Feature sequence0216 1998 181 gene locus_tag LOCUS_12380 gene oadA 1998 181 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932515.1 protein_id gnl|my_center|LOCUS_12380 2296 2045 gene locus_tag LOCUS_12390 2296 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 2431 3273 gene locus_tag LOCUS_12400 gene legD1 2431 3273 CDS product phytanoyl-CoA dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948394.1 protein_id gnl|my_center|LOCUS_12400 <4162 3270 gene locus_tag LOCUS_12410 <4162 3270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085362.1:N-carbamoyl-D-amino-acid hydrolase >Feature sequence0217 >Feature sequence0218 1095 166 gene locus_tag LOCUS_12420 1095 166 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089449.1 protein_id gnl|my_center|LOCUS_12420 1631 1143 gene locus_tag LOCUS_12430 1631 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 1872 2495 gene locus_tag LOCUS_12440 1872 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 2794 2492 gene locus_tag LOCUS_12450 2794 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 <4146 2995 gene locus_tag LOCUS_12460 <4146 2995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005457669.1:peptidase M16 >Feature sequence0219 643 1752 gene locus_tag LOCUS_12470 gene proB 643 1752 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCG4 protein_id gnl|my_center|LOCUS_12470 1756 3177 gene locus_tag LOCUS_12480 1756 3177 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404528.1 protein_id gnl|my_center|LOCUS_12480 >Feature sequence0220 <4124 2757 gene locus_tag LOCUS_12490 <4124 2757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000626143.1:ABC-F family ATPase >Feature sequence0221 <1 1071 gene locus_tag LOCUS_12500 <1 1071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583298.1:branched-chain amino acid ABC transporter permease 1068 2294 gene locus_tag LOCUS_12510 1068 2294 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674209.1 protein_id gnl|my_center|LOCUS_12510 2291 3058 gene locus_tag LOCUS_12520 2291 3058 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727509.1 protein_id gnl|my_center|LOCUS_12520 3084 3818 gene locus_tag LOCUS_12530 3084 3818 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819071.1 protein_id gnl|my_center|LOCUS_12530 >Feature sequence0222 51 185 gene locus_tag LOCUS_12540 51 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 200 1120 gene locus_tag LOCUS_12550 200 1120 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582519.1 protein_id gnl|my_center|LOCUS_12550 1113 2222 gene locus_tag LOCUS_12560 1113 2222 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809384.1 protein_id gnl|my_center|LOCUS_12560 2748 2341 gene locus_tag LOCUS_12570 2748 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 3810 3190 gene locus_tag LOCUS_12580 gene rplC 3810 3190 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38515 protein_id gnl|my_center|LOCUS_12580 >Feature sequence0223 362 619 gene locus_tag LOCUS_12590 362 619 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941530.1 protein_id gnl|my_center|LOCUS_12590 1805 621 gene locus_tag LOCUS_12600 1805 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 2590 1802 gene locus_tag LOCUS_12610 gene bamD 2590 1802 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83DH4 protein_id gnl|my_center|LOCUS_12610 3652 2765 gene locus_tag LOCUS_12620 gene cheY 3652 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328012.1 protein_id gnl|my_center|LOCUS_12620 >Feature sequence0224 312 1199 gene locus_tag LOCUS_12630 gene cheR 312 1199 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51069 protein_id gnl|my_center|LOCUS_12630 1230 1529 gene locus_tag LOCUS_12640 1230 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 1536 2945 gene locus_tag LOCUS_12650 1536 2945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 >Feature sequence0225 494 1165 gene locus_tag LOCUS_12660 gene rplY 494 1165 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMC2 protein_id gnl|my_center|LOCUS_12660 1200 1760 gene locus_tag LOCUS_12670 gene pth 1200 1760 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E2I1 protein_id gnl|my_center|LOCUS_12670 1818 2909 gene locus_tag LOCUS_12680 gene ychF 1818 2909 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FE5 protein_id gnl|my_center|LOCUS_12680 3017 3565 gene locus_tag LOCUS_12690 gene rpsF 3017 3565 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9F9 protein_id gnl|my_center|LOCUS_12690 3625 3960 gene locus_tag LOCUS_12700 3625 3960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 >Feature sequence0226 2263 839 gene locus_tag LOCUS_12710 2263 839 CDS product phosphonoacetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533038.1 protein_id gnl|my_center|LOCUS_12710 3518 2277 gene locus_tag LOCUS_12720 gene phnA 3518 2277 CDS product phosphonoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808715.1 protein_id gnl|my_center|LOCUS_12720 >Feature sequence0227 <1 500 gene locus_tag LOCUS_12730 <1 500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010865121.1:short-chain dehydrogenase 511 1509 gene locus_tag LOCUS_12740 gene adh 511 1509 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324237.1 protein_id gnl|my_center|LOCUS_12740 2015 1929 gene locus_tag LOCUS_t00110 2015 1929 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2106 2033 gene locus_tag LOCUS_t00120 2106 2033 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2136 3539 gene locus_tag LOCUS_12750 2136 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 >Feature sequence0228 555 479 gene locus_tag LOCUS_t00130 555 479 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1152 604 gene locus_tag LOCUS_12760 1152 604 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762154.1 protein_id gnl|my_center|LOCUS_12760 2089 1160 gene locus_tag LOCUS_12770 gene yicC 2089 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942879.1 protein_id gnl|my_center|LOCUS_12770 2145 2627 gene locus_tag LOCUS_12780 2145 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 <4057 2682 gene locus_tag LOCUS_12790 <4057 2682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KE61:chaperone protein HtpG >Feature sequence0229 1678 209 gene locus_tag LOCUS_12800 1678 209 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433374.1 protein_id gnl|my_center|LOCUS_12800 2305 1856 gene locus_tag LOCUS_12810 2305 1856 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903120.1 protein_id gnl|my_center|LOCUS_12810 3183 2962 gene locus_tag LOCUS_12820 3183 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_12820 3568 3407 gene locus_tag LOCUS_12830 3568 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 >Feature sequence0230 2605 3792 gene locus_tag LOCUS_12840 2605 3792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 >Feature sequence0231 1026 334 gene locus_tag LOCUS_12850 1026 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348683.1 protein_id gnl|my_center|LOCUS_12850 1928 1293 gene locus_tag LOCUS_12860 1928 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 2432 2025 gene locus_tag LOCUS_12870 2432 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 <4040 2547 gene locus_tag LOCUS_12880 <4040 2547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249114.1:ABC transporter >Feature sequence0232 1815 862 gene locus_tag LOCUS_12890 1815 862 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083176.1 protein_id gnl|my_center|LOCUS_12890 2072 1875 gene locus_tag LOCUS_12900 2072 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085116.1 protein_id gnl|my_center|LOCUS_12900 3735 2086 gene locus_tag LOCUS_12910 3735 2086 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808489.1 protein_id gnl|my_center|LOCUS_12910 >Feature sequence0233 1359 2258 gene locus_tag LOCUS_12920 1359 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 2389 3636 gene locus_tag LOCUS_12930 2389 3636 CDS product D-amino-acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531949.1 protein_id gnl|my_center|LOCUS_12930 >Feature sequence0234 565 131 gene locus_tag LOCUS_12940 565 131 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200916.1 protein_id gnl|my_center|LOCUS_12940 837 2372 gene locus_tag LOCUS_12950 837 2372 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943740.1 protein_id gnl|my_center|LOCUS_12950 2375 3070 gene locus_tag LOCUS_12960 2375 3070 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137847.1 protein_id gnl|my_center|LOCUS_12960 <3992 3361 gene locus_tag LOCUS_12970 <3992 3361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084524.1:IS256 family transposase >Feature sequence0235 286 1587 gene locus_tag LOCUS_12980 286 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 1802 2962 gene locus_tag LOCUS_12990 1802 2962 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256286.1 protein_id gnl|my_center|LOCUS_12990 3132 3668 gene locus_tag LOCUS_13000 3132 3668 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64N93 protein_id gnl|my_center|LOCUS_13000 >Feature sequence0236 1039 434 gene locus_tag LOCUS_13010 1039 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 1071 1781 gene locus_tag LOCUS_13020 1071 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 1805 2737 gene locus_tag LOCUS_13030 1805 2737 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289860.1 protein_id gnl|my_center|LOCUS_13030 3456 2803 gene locus_tag LOCUS_13040 3456 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 >Feature sequence0237 1228 647 gene locus_tag LOCUS_13050 gene rsxA 1228 647 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83KY7 protein_id gnl|my_center|LOCUS_13050 1931 1230 gene locus_tag LOCUS_13060 gene rnfE 1931 1230 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18AZ8 protein_id gnl|my_center|LOCUS_13060 2581 1928 gene locus_tag LOCUS_13070 2581 1928 CDS product Na+-transporting NADH:ubiquinone oxidoreductase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020708.1 protein_id gnl|my_center|LOCUS_13070 3581 2574 gene locus_tag LOCUS_13080 3581 2574 CDS product electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T33 protein_id gnl|my_center|LOCUS_13080 >Feature sequence0238 <1 3702 gene locus_tag LOCUS_13090 <1 3702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071757.1:beta-hydroxyacyl-ACP dehydratase >Feature sequence0239 455 1216 gene locus_tag LOCUS_13100 455 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 1570 1325 gene locus_tag LOCUS_13110 1570 1325 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055463.1 protein_id gnl|my_center|LOCUS_13110 2523 1681 gene locus_tag LOCUS_13120 gene yjiL 2523 1681 CDS product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943157.1 protein_id gnl|my_center|LOCUS_13120 <3935 2952 gene locus_tag LOCUS_13130 <3935 2952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879451.1:2-hydroxyglutaryl-CoA dehydratase >Feature sequence0240 1888 821 gene locus_tag LOCUS_13140 gene prfA 1888 821 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180Y2 protein_id gnl|my_center|LOCUS_13140 2101 1895 gene locus_tag LOCUS_13150 gene rpmE 2101 1895 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KC50 protein_id gnl|my_center|LOCUS_13150 3468 2143 gene locus_tag LOCUS_13160 gene rho 3468 2143 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748A7 protein_id gnl|my_center|LOCUS_13160 >Feature sequence0241 791 1885 gene locus_tag LOCUS_13170 791 1885 CDS product putrescine-binding periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVM6 protein_id gnl|my_center|LOCUS_13170 1979 3064 gene locus_tag LOCUS_13180 gene potG 1979 3064 CDS product polyamine-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63UP0 protein_id gnl|my_center|LOCUS_13180 >Feature sequence0242 40 1041 gene locus_tag LOCUS_13190 40 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 2208 1153 gene locus_tag LOCUS_13200 2208 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 2902 2198 gene locus_tag LOCUS_13210 2902 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 >Feature sequence0243 2394 187 gene locus_tag LOCUS_13220 gene recD2 2394 187 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DN4 protein_id gnl|my_center|LOCUS_13220 2938 2426 gene locus_tag LOCUS_13230 2938 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 3867 2935 gene locus_tag LOCUS_13240 3867 2935 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545713.1 protein_id gnl|my_center|LOCUS_13240 >Feature sequence0244 1359 757 gene locus_tag LOCUS_13250 1359 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 1494 1847 gene locus_tag LOCUS_13260 1494 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 2485 1940 gene locus_tag LOCUS_13270 gene hpt 2485 1940 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359412.1 protein_id gnl|my_center|LOCUS_13270 <3887 2488 gene locus_tag LOCUS_13280 <3887 2488 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038548.1:tail-specific protease >Feature sequence0245 1853 669 gene locus_tag LOCUS_13290 1853 669 CDS product DNA protecting protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813280.1 protein_id gnl|my_center|LOCUS_13290 2320 1865 gene locus_tag LOCUS_13300 gene smpB 2320 1865 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHM0 protein_id gnl|my_center|LOCUS_13300 3777 2401 gene locus_tag LOCUS_13310 gene cca 3777 2401 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5D4 protein_id gnl|my_center|LOCUS_13310 >Feature sequence0246 1038 283 gene locus_tag LOCUS_13320 gene rsmE 1038 283 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G06 protein_id gnl|my_center|LOCUS_13320 3291 1048 gene locus_tag LOCUS_13330 3291 1048 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317954.1 protein_id gnl|my_center|LOCUS_13330 3609 3301 gene locus_tag LOCUS_13340 gene clpS 3609 3301 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZM8 protein_id gnl|my_center|LOCUS_13340 3871 3743 gene locus_tag LOCUS_13350 3871 3743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 >Feature sequence0247 508 1260 gene locus_tag LOCUS_13360 508 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703714.1 protein_id gnl|my_center|LOCUS_13360 1275 2033 gene locus_tag LOCUS_13370 1275 2033 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074021.1 protein_id gnl|my_center|LOCUS_13370 2014 2289 gene locus_tag LOCUS_13380 2014 2289 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261516.1 protein_id gnl|my_center|LOCUS_13380 2289 2567 gene locus_tag LOCUS_13390 gene acpP 2289 2567 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHS3 protein_id gnl|my_center|LOCUS_13390 2586 3083 gene locus_tag LOCUS_13400 2586 3083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 >Feature sequence0248 355 1818 gene locus_tag LOCUS_13410 gene fliC 355 1818 CDS product B-type flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72151 protein_id gnl|my_center|LOCUS_13410 <3845 1884 gene locus_tag LOCUS_13420 <3845 1884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023607.1:cell surface protein >Feature sequence0249 600 217 gene locus_tag LOCUS_13430 600 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 2109 613 gene locus_tag LOCUS_13440 gene lysS 2109 613 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCM7 protein_id gnl|my_center|LOCUS_13440 2360 2641 gene locus_tag LOCUS_13450 gene groES1 2360 2641 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6W1D4 protein_id gnl|my_center|LOCUS_13450 >Feature sequence0250 302 544 gene locus_tag LOCUS_13460 302 544 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NI03 protein_id gnl|my_center|LOCUS_13460 1021 1278 gene locus_tag LOCUS_13470 1021 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 1300 2505 gene locus_tag LOCUS_13480 1300 2505 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546576.1 protein_id gnl|my_center|LOCUS_13480 2832 3089 gene locus_tag LOCUS_13490 2832 3089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 3095 3358 gene locus_tag LOCUS_13500 3095 3358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665928.1 protein_id gnl|my_center|LOCUS_13500 3411 3587 gene locus_tag LOCUS_13510 3411 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 >Feature sequence0251 473 2197 gene locus_tag LOCUS_13520 473 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 2699 2274 gene locus_tag LOCUS_13530 2699 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 >Feature sequence0252 960 79 gene locus_tag LOCUS_13540 960 79 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583458.1 protein_id gnl|my_center|LOCUS_13540 1300 992 gene locus_tag LOCUS_13550 1300 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 1937 1347 gene locus_tag LOCUS_13560 1937 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023903.1 protein_id gnl|my_center|LOCUS_13560 >Feature sequence0253 <1 2484 gene locus_tag LOCUS_13570 <1 2484 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74H88:DNA gyrase subunit A 2566 3504 gene locus_tag LOCUS_13580 2566 3504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 >Feature sequence0254 2064 1465 gene locus_tag LOCUS_13590 2064 1465 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948229.1 protein_id gnl|my_center|LOCUS_13590 2286 2744 gene locus_tag LOCUS_13600 gene rlmH 2286 2744 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Q2 protein_id gnl|my_center|LOCUS_13600 >Feature sequence0255 605 78 gene locus_tag LOCUS_13610 605 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 1148 612 gene locus_tag LOCUS_13620 1148 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 1644 1120 gene locus_tag LOCUS_13630 gene lspA 1644 1120 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182T8 protein_id gnl|my_center|LOCUS_13630 2924 1641 gene locus_tag LOCUS_13640 gene hisS 2924 1641 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CWM3 protein_id gnl|my_center|LOCUS_13640 <3733 2980 gene locus_tag LOCUS_13650 <3733 2980 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869683.1:uracil-DNA glycosylase >Feature sequence0256 410 213 gene locus_tag LOCUS_13660 410 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 2723 417 gene locus_tag LOCUS_13670 2723 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 >Feature sequence0257 1444 167 gene locus_tag LOCUS_13680 1444 167 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453372.1 protein_id gnl|my_center|LOCUS_13680 2127 1441 gene locus_tag LOCUS_13690 2127 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 2632 2111 gene locus_tag LOCUS_13700 2632 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404832.1 protein_id gnl|my_center|LOCUS_13700 <3712 2632 gene locus_tag LOCUS_13710 <3712 2632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000063680.1:Fe-S-cluster-containing hydrogenase >Feature sequence0258 1901 249 gene locus_tag LOCUS_13720 1901 249 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943835.1 protein_id gnl|my_center|LOCUS_13720 3368 2205 gene locus_tag LOCUS_13730 3368 2205 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337165.1 protein_id gnl|my_center|LOCUS_13730 >Feature sequence0259 <1 504 gene locus_tag LOCUS_13740 <1 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932534.1:sulfite reductase, dissimilatory-type beta subunit 520 2259 gene locus_tag LOCUS_13750 520 2259 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933900.1 protein_id gnl|my_center|LOCUS_13750 2279 2650 gene locus_tag LOCUS_13760 2279 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933899.1 protein_id gnl|my_center|LOCUS_13760 2676 3557 gene locus_tag LOCUS_13770 2676 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 >Feature sequence0260 973 1827 gene locus_tag LOCUS_13780 973 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 2134 3288 gene locus_tag LOCUS_13790 2134 3288 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 protein_id gnl|my_center|LOCUS_13790 >Feature sequence0261 <1 2588 gene locus_tag LOCUS_13800 <1 2588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q180A1:valine--tRNA ligase 2733 2987 gene locus_tag LOCUS_13810 2733 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887102.1 protein_id gnl|my_center|LOCUS_13810 2984 3322 gene locus_tag LOCUS_13820 2984 3322 CDS product antitoxin HicB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530441.1 protein_id gnl|my_center|LOCUS_13820 >Feature sequence0262 728 1279 gene locus_tag LOCUS_13830 728 1279 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525883.1 protein_id gnl|my_center|LOCUS_13830 1434 2843 gene locus_tag LOCUS_13840 1434 2843 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969340.1 protein_id gnl|my_center|LOCUS_13840 >Feature sequence0263 1916 822 gene locus_tag LOCUS_13850 1916 822 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720305.1 protein_id gnl|my_center|LOCUS_13850 3153 2056 gene locus_tag LOCUS_13860 3153 2056 CDS product polyamine-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5T5 protein_id gnl|my_center|LOCUS_13860 >Feature sequence0264 >Feature sequence0265 1589 189 gene locus_tag LOCUS_13870 gene ubiD 1589 189 CDS product 3-octaprenyl-4-hydroxybenzoate carboxy-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEH3 protein_id gnl|my_center|LOCUS_13870 <3618 2317 gene locus_tag LOCUS_13880 <3618 2317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001024552.1:Zn-dependent protease >Feature sequence0266 1115 444 gene locus_tag LOCUS_13890 1115 444 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705602.1 protein_id gnl|my_center|LOCUS_13890 1725 1108 gene locus_tag LOCUS_13900 gene mobA 1725 1108 CDS product putative molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WI17 protein_id gnl|my_center|LOCUS_13900 2597 1821 gene locus_tag LOCUS_13910 2597 1821 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061780.1 protein_id gnl|my_center|LOCUS_13910 >Feature sequence0267 604 1200 gene locus_tag LOCUS_13920 gene gmhB 604 1200 CDS product D,D-heptose 1,7-bisphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BF7 protein_id gnl|my_center|LOCUS_13920 1526 2902 gene locus_tag LOCUS_13930 1526 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 >Feature sequence0268 247 1032 gene locus_tag LOCUS_13940 gene etfB 247 1032 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029033.1 protein_id gnl|my_center|LOCUS_13940 1139 2101 gene locus_tag LOCUS_13950 gene etfA 1139 2101 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072965.1 protein_id gnl|my_center|LOCUS_13950 2309 2689 gene locus_tag LOCUS_13960 2309 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 >Feature sequence0269 1288 794 gene locus_tag LOCUS_13970 1288 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 2319 1372 gene locus_tag LOCUS_13980 gene trxB 2319 1372 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE48 protein_id gnl|my_center|LOCUS_13980 <3580 2478 gene locus_tag LOCUS_13990 <3580 2478 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020571.1:DNA mismatch repair protein >Feature sequence0270 110 928 gene locus_tag LOCUS_14000 gene fpg 110 928 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MUD7 protein_id gnl|my_center|LOCUS_14000 1122 1838 gene locus_tag LOCUS_14010 1122 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 1835 2785 gene locus_tag LOCUS_14020 gene rsmH 1835 2785 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I1T3 protein_id gnl|my_center|LOCUS_14020 2782 3255 gene locus_tag LOCUS_14030 gene ybeY 2782 3255 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67367 protein_id gnl|my_center|LOCUS_14030 >Feature sequence0271 1464 586 gene locus_tag LOCUS_14040 1464 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 2299 1523 gene locus_tag LOCUS_14050 2299 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 3388 2324 gene locus_tag LOCUS_14060 3388 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 >Feature sequence0272 1337 186 gene locus_tag LOCUS_14070 1337 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 2511 1477 gene locus_tag LOCUS_14080 2511 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 3437 2721 gene locus_tag LOCUS_14090 3437 2721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 >Feature sequence0273 1349 870 gene locus_tag LOCUS_14100 1349 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526466.1 protein_id gnl|my_center|LOCUS_14100 1928 1374 gene locus_tag LOCUS_14110 1928 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 2094 3428 gene locus_tag LOCUS_14120 gene thrC 2094 3428 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942338.1 protein_id gnl|my_center|LOCUS_14120 >Feature sequence0274 665 1066 gene locus_tag LOCUS_14130 665 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 1300 2640 gene locus_tag LOCUS_14140 gene ffh 1300 2640 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FG7 protein_id gnl|my_center|LOCUS_14140 2717 2959 gene locus_tag LOCUS_14150 2717 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 >Feature sequence0275 967 542 gene locus_tag LOCUS_14160 967 542 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011840937.1 protein_id gnl|my_center|LOCUS_14160 1407 1736 gene locus_tag LOCUS_14170 1407 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 2001 1925 gene locus_tag LOCUS_t00140 2001 1925 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2109 2034 gene locus_tag LOCUS_t00150 2109 2034 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3054 2524 gene locus_tag LOCUS_14180 3054 2524 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391119.1 protein_id gnl|my_center|LOCUS_14180 >Feature sequence0276 1119 148 gene locus_tag LOCUS_14190 gene trpS 1119 148 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964337.1 protein_id gnl|my_center|LOCUS_14190 1410 1129 gene locus_tag LOCUS_14200 gene rpmA 1410 1129 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUS9 protein_id gnl|my_center|LOCUS_14200 1838 1431 gene locus_tag LOCUS_14210 gene rplU 1838 1431 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P9D7 protein_id gnl|my_center|LOCUS_14210 2035 2862 gene locus_tag LOCUS_14220 gene menB 2035 2862 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CPN2 protein_id gnl|my_center|LOCUS_14220 >Feature sequence0277 326 748 gene locus_tag LOCUS_14230 326 748 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082961.1 protein_id gnl|my_center|LOCUS_14230 766 1095 gene locus_tag LOCUS_14240 766 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 1182 1871 gene locus_tag LOCUS_14250 1182 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 1911 2333 gene locus_tag LOCUS_14260 1911 2333 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072758.1 protein_id gnl|my_center|LOCUS_14260 2417 2968 gene locus_tag LOCUS_14270 2417 2968 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947704.1 protein_id gnl|my_center|LOCUS_14270 >Feature sequence0278 980 255 gene locus_tag LOCUS_14280 gene cobI 980 255 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526969.1 protein_id gnl|my_center|LOCUS_14280 1375 1004 gene locus_tag LOCUS_14290 1375 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_14290 2677 1418 gene locus_tag LOCUS_14300 2677 1418 CDS product precorrin-6Y C5,15-methyltransferase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269017.1 protein_id gnl|my_center|LOCUS_14300 >Feature sequence0279 <1 2100 gene locus_tag LOCUS_14310 <1 2100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393495.1:selenium-dependent xanthine dehydrogenase 2189 3421 gene locus_tag LOCUS_14320 2189 3421 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532461.1 protein_id gnl|my_center|LOCUS_14320 >Feature sequence0280 245 1285 gene locus_tag LOCUS_14330 245 1285 CDS product FAD-binding molybdopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105102.1 protein_id gnl|my_center|LOCUS_14330 1996 1343 gene locus_tag LOCUS_14340 gene gph 1996 1343 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932569.1 protein_id gnl|my_center|LOCUS_14340 2293 2012 gene locus_tag LOCUS_14350 gene ihfA 2293 2012 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKP3 protein_id gnl|my_center|LOCUS_14350 2663 3094 gene locus_tag LOCUS_14360 2663 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 >Feature sequence0281 154 1068 gene locus_tag LOCUS_14370 154 1068 CDS product choline/ethanolamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528033.1 protein_id gnl|my_center|LOCUS_14370 1091 1846 gene locus_tag LOCUS_14380 1091 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 1863 2795 gene locus_tag LOCUS_14390 1863 2795 CDS product choline kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528030.1 protein_id gnl|my_center|LOCUS_14390 >Feature sequence0282 1817 1077 gene locus_tag LOCUS_14400 1817 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 2792 1926 gene locus_tag LOCUS_14410 2792 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 >Feature sequence0283 <1 1321 gene locus_tag LOCUS_14420 <1 1321 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947377.1:3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) 1570 2592 gene locus_tag LOCUS_14430 1570 2592 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969388.1 protein_id gnl|my_center|LOCUS_14430 >Feature sequence0284 390 1757 gene locus_tag LOCUS_14440 gene trpB 390 1757 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WA80 protein_id gnl|my_center|LOCUS_14440 1828 2070 gene locus_tag LOCUS_14450 1828 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 2149 3198 gene locus_tag LOCUS_14460 2149 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 >Feature sequence0285 332 1825 gene locus_tag LOCUS_14470 332 1825 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531218.1 protein_id gnl|my_center|LOCUS_14470 1879 2829 gene locus_tag LOCUS_14480 1879 2829 CDS product peptide ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531217.1 protein_id gnl|my_center|LOCUS_14480 >Feature sequence0286 1920 697 gene locus_tag LOCUS_14490 1920 697 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061574.1 protein_id gnl|my_center|LOCUS_14490 2984 2145 gene locus_tag LOCUS_14500 2984 2145 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975672.1 protein_id gnl|my_center|LOCUS_14500 >Feature sequence0287 526 335 gene locus_tag LOCUS_14510 526 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 804 526 gene locus_tag LOCUS_14520 804 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 1107 814 gene locus_tag LOCUS_14530 1107 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 2075 1104 gene locus_tag LOCUS_14540 2075 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 2345 2079 gene locus_tag LOCUS_14550 2345 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 2700 2494 gene locus_tag LOCUS_14560 2700 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 3030 2719 gene locus_tag LOCUS_14570 3030 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 >Feature sequence0288 2360 897 gene locus_tag LOCUS_14580 gene fliC 2360 897 CDS product B-type flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72151 protein_id gnl|my_center|LOCUS_14580 <3420 2841 gene locus_tag LOCUS_14590 <3420 2841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P02968:flagellin >Feature sequence0289 1370 708 gene locus_tag LOCUS_14600 gene purQ 1370 708 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y6C0 protein_id gnl|my_center|LOCUS_14600 1618 1370 gene locus_tag LOCUS_14610 gene purS 1618 1370 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P12049 protein_id gnl|my_center|LOCUS_14610 2350 1640 gene locus_tag LOCUS_14620 gene purC 2350 1640 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y6B9 protein_id gnl|my_center|LOCUS_14620 <3416 2523 gene locus_tag LOCUS_14630 <3416 2523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q6HPA9:N5-carboxyaminoimidazole ribonucleotide synthase >Feature sequence0290 1887 103 gene locus_tag LOCUS_14640 gene iorA-1 1887 103 CDS product indolepyruvate oxidoreductase subunit IorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CD5 protein_id gnl|my_center|LOCUS_14640 3298 1991 gene locus_tag LOCUS_14650 gene paaA 3298 1991 CDS product phenylacetate-coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QH8 protein_id gnl|my_center|LOCUS_14650 >Feature sequence0291 1886 1152 gene locus_tag LOCUS_14660 1886 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228741.1 protein_id gnl|my_center|LOCUS_14660 2309 2055 gene locus_tag LOCUS_14670 2309 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 >Feature sequence0292 485 1207 gene locus_tag LOCUS_14680 485 1207 CDS product acetyl-CoA--acetoacetyl-CoA transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389137.1 protein_id gnl|my_center|LOCUS_14680 1194 1862 gene locus_tag LOCUS_14690 1194 1862 CDS product acyl CoA:acetate/3-ketoacid CoA transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525293.1 protein_id gnl|my_center|LOCUS_14690 2021 3352 gene locus_tag LOCUS_14700 2021 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112975.1 protein_id gnl|my_center|LOCUS_14700 >Feature sequence0293 <3409 2801 gene locus_tag LOCUS_14710 <3409 2801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681145.1:toxin Fic >Feature sequence0294 <1 509 gene locus_tag LOCUS_14720 <1 509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879704.1:methylmalonyl-CoA mutase 766 1875 gene locus_tag LOCUS_14730 gene nirK 766 1875 CDS product nitrite reductase, copper-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089826.1 protein_id gnl|my_center|LOCUS_14730 2013 2603 gene locus_tag LOCUS_14740 2013 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 >Feature sequence0295 536 234 gene locus_tag LOCUS_14750 536 234 CDS product phenylacetate-CoA oxygenase subunit PaaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857353.1 protein_id gnl|my_center|LOCUS_14750 1519 545 gene locus_tag LOCUS_14760 gene paaA 1519 545 CDS product phenylacetate-CoA oxygenase subunit PaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085675.1 protein_id gnl|my_center|LOCUS_14760 >Feature sequence0296 724 236 gene locus_tag LOCUS_14770 gene ppiB 724 236 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP01 protein_id gnl|my_center|LOCUS_14770 1059 760 gene locus_tag LOCUS_14780 1059 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 1421 1167 gene locus_tag LOCUS_14790 1421 1167 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815785.1 protein_id gnl|my_center|LOCUS_14790 1809 1441 gene locus_tag LOCUS_14800 1809 1441 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326964.1 protein_id gnl|my_center|LOCUS_14800 2230 1823 gene locus_tag LOCUS_14810 2230 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 2950 2477 gene locus_tag LOCUS_14820 gene resA 2950 2477 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941975.1 protein_id gnl|my_center|LOCUS_14820 >Feature sequence0297 2778 1630 gene locus_tag LOCUS_14830 gene ftsW 2778 1630 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748D5 protein_id gnl|my_center|LOCUS_14830 >Feature sequence0298 1185 529 gene locus_tag LOCUS_14840 1185 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 2446 1436 gene locus_tag LOCUS_14850 2446 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 >Feature sequence0299 1604 1969 gene locus_tag LOCUS_14860 1604 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 2098 3087 gene locus_tag LOCUS_14870 gene hemB 2098 3087 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCJ0 protein_id gnl|my_center|LOCUS_14870 >Feature sequence0300 407 1102 gene locus_tag LOCUS_14880 407 1102 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_14880 1102 2259 gene locus_tag LOCUS_14890 1102 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 2395 3336 gene locus_tag LOCUS_14900 gene ribF 2395 3336 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D32 protein_id gnl|my_center|LOCUS_14900 >Feature sequence0301 564 115 gene locus_tag LOCUS_14910 gene flgC 564 115 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G41 protein_id gnl|my_center|LOCUS_14910 980 564 gene locus_tag LOCUS_14920 gene flgB 980 564 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G42 protein_id gnl|my_center|LOCUS_14920 1209 2702 gene locus_tag LOCUS_14930 gene argH 1209 2702 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CBQ4 protein_id gnl|my_center|LOCUS_14930 >Feature sequence0302 1070 165 gene locus_tag LOCUS_14940 1070 165 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331282.1 protein_id gnl|my_center|LOCUS_14940 1529 2335 gene locus_tag LOCUS_14950 gene uppP 1529 2335 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFJ7 protein_id gnl|my_center|LOCUS_14950 >Feature sequence0303 501 1220 gene locus_tag LOCUS_14960 501 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 1535 1227 gene locus_tag LOCUS_14970 1535 1227 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722172.1 protein_id gnl|my_center|LOCUS_14970 1866 1624 gene locus_tag LOCUS_14980 1866 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 2069 1863 gene locus_tag LOCUS_14990 2069 1863 CDS product 2-oxoisovalerate dehydrogenase E1 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227795.1 protein_id gnl|my_center|LOCUS_14990 2752 2228 gene locus_tag LOCUS_15000 2752 2228 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969365.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15000 >Feature sequence0304 1408 470 gene locus_tag LOCUS_15010 1408 470 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_15010 1585 2394 gene locus_tag LOCUS_15020 1585 2394 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080508.1 protein_id gnl|my_center|LOCUS_15020 >Feature sequence0305 <1 1677 gene locus_tag LOCUS_15030 <1 1677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140524.1:transglycosylase 1825 2832 gene locus_tag LOCUS_15040 1825 2832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 >Feature sequence0306 2934 1321 gene locus_tag LOCUS_15050 gene fliF 2934 1321 CDS product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G39 protein_id gnl|my_center|LOCUS_15050 3324 3109 gene locus_tag LOCUS_15060 3324 3109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 >Feature sequence0307 <3283 1873 gene locus_tag LOCUS_15070 <3283 1873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085400.1:membrane protein >Feature sequence0308 1383 295 gene locus_tag LOCUS_15080 1383 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 1587 2663 gene locus_tag LOCUS_15090 gene leuB 1587 2663 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUZ4 protein_id gnl|my_center|LOCUS_15090 3062 2685 gene locus_tag LOCUS_15100 3062 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 >Feature sequence0309 <1 1680 gene locus_tag LOCUS_15110 <1 1680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257094.1:arsenite oxidase large subunit 1754 2527 gene locus_tag LOCUS_15120 1754 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 >Feature sequence0310 1821 721 gene locus_tag LOCUS_15130 1821 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 2061 2981 gene locus_tag LOCUS_15140 gene psuG 2061 2981 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y4U2 protein_id gnl|my_center|LOCUS_15140 >Feature sequence0311 1603 656 gene locus_tag LOCUS_15150 1603 656 CDS product hemolytic protein HlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058218.1 protein_id gnl|my_center|LOCUS_15150 2257 1874 gene locus_tag LOCUS_15160 2257 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 3108 2254 gene locus_tag LOCUS_15170 3108 2254 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980041.1 protein_id gnl|my_center|LOCUS_15170 >Feature sequence0312 657 1091 gene locus_tag LOCUS_15180 657 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 1099 2145 gene locus_tag LOCUS_15190 gene rmlB 1099 2145 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ54 protein_id gnl|my_center|LOCUS_15190 >Feature sequence0313 3235 1340 gene locus_tag LOCUS_15200 3235 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 >Feature sequence0314 188 1903 gene locus_tag LOCUS_15210 188 1903 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256685.1 protein_id gnl|my_center|LOCUS_15210 1983 2996 gene locus_tag LOCUS_15220 1983 2996 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256681.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence0315 1246 2235 gene locus_tag LOCUS_15230 1246 2235 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776928.1 protein_id gnl|my_center|LOCUS_15230 2317 2823 gene locus_tag LOCUS_15240 2317 2823 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813563.1 protein_id gnl|my_center|LOCUS_15240 >Feature sequence0316 980 132 gene locus_tag LOCUS_15250 980 132 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 protein_id gnl|my_center|LOCUS_15250 1618 1385 gene locus_tag LOCUS_15260 1618 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 3112 1763 gene locus_tag LOCUS_15270 gene hemN 3112 1763 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67886 protein_id gnl|my_center|LOCUS_15270 >Feature sequence0317 1279 947 gene locus_tag LOCUS_15280 1279 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 1540 1839 gene locus_tag LOCUS_15290 1540 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 1887 2405 gene locus_tag LOCUS_15300 1887 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 2412 3014 gene locus_tag LOCUS_15310 gene recR 2412 3014 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CA2 protein_id gnl|my_center|LOCUS_15310 >Feature sequence0318 1875 547 gene locus_tag LOCUS_15320 1875 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 2658 2350 gene locus_tag LOCUS_15330 2658 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 2726 3121 gene locus_tag LOCUS_15340 2726 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 >Feature sequence0319 <1 1117 gene locus_tag LOCUS_15350 <1 1117 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104013.1:aminomethyltransferase 1166 2293 gene locus_tag LOCUS_15360 1166 2293 CDS product class V aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889090.1 protein_id gnl|my_center|LOCUS_15360 2303 3016 gene locus_tag LOCUS_15370 2303 3016 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204423.1 protein_id gnl|my_center|LOCUS_15370 >Feature sequence0320 1027 131 gene locus_tag LOCUS_15380 1027 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 1518 1033 gene locus_tag LOCUS_15390 1518 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 2830 1547 gene locus_tag LOCUS_15400 gene gltA 2830 1547 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPW5 protein_id gnl|my_center|LOCUS_15400 >Feature sequence0321 <1 798 gene locus_tag LOCUS_15410 <1 798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080645.1:anion permease 795 1451 gene locus_tag LOCUS_15420 795 1451 CDS product UPF0111 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X016 protein_id gnl|my_center|LOCUS_15420 1594 2988 gene locus_tag LOCUS_15430 1594 2988 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529649.1 protein_id gnl|my_center|LOCUS_15430 >Feature sequence0322 1016 486 gene locus_tag LOCUS_15440 1016 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 2104 1115 gene locus_tag LOCUS_15450 2104 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 2938 2450 gene locus_tag LOCUS_15460 2938 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096939.1 protein_id gnl|my_center|LOCUS_15460 >Feature sequence0323 <1 1140 gene locus_tag LOCUS_15470 <1 1140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267220.1:ABC transporter ATP-binding protein 1659 1153 gene locus_tag LOCUS_15480 1659 1153 CDS product heme utilization protein HutZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372763.1 protein_id gnl|my_center|LOCUS_15480 >Feature sequence0324 364 1470 gene locus_tag LOCUS_15490 364 1470 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974502.1 protein_id gnl|my_center|LOCUS_15490 1523 2593 gene locus_tag LOCUS_15500 1523 2593 CDS product acetylpolyamine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710075.1 protein_id gnl|my_center|LOCUS_15500 >Feature sequence0325 1025 345 gene locus_tag LOCUS_15510 1025 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 1192 2115 gene locus_tag LOCUS_15520 1192 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 >Feature sequence0326 631 1659 gene locus_tag LOCUS_15530 gene proX 631 1659 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973330.1 protein_id gnl|my_center|LOCUS_15530 1736 2758 gene locus_tag LOCUS_15540 1736 2758 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380009.1 protein_id gnl|my_center|LOCUS_15540 >Feature sequence0327 909 268 gene locus_tag LOCUS_15550 909 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 >Feature sequence0328 >Feature sequence0329 426 1721 gene locus_tag LOCUS_15560 426 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 1743 2717 gene locus_tag LOCUS_15570 1743 2717 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708857.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence0330 34 693 gene locus_tag LOCUS_15580 34 693 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89NM1 protein_id gnl|my_center|LOCUS_15580 803 1879 gene locus_tag LOCUS_15590 803 1879 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106295.1 protein_id gnl|my_center|LOCUS_15590 2036 3016 gene locus_tag LOCUS_15600 2036 3016 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530364.1 protein_id gnl|my_center|LOCUS_15600 >Feature sequence0331 261 2426 gene locus_tag LOCUS_15610 261 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 2696 2866 gene locus_tag LOCUS_15620 2696 2866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15620 >Feature sequence0332 335 925 gene locus_tag LOCUS_15630 335 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 2153 1101 gene locus_tag LOCUS_15640 gene queA 2153 1101 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32054 protein_id gnl|my_center|LOCUS_15640 2772 2233 gene locus_tag LOCUS_15650 2772 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 >Feature sequence0333 <1 1061 gene locus_tag LOCUS_15660 <1 1061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KAK2:cysteine--tRNA ligase 1105 2877 gene locus_tag LOCUS_15670 gene msbA 1105 2877 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_15670 >Feature sequence0334 <1 599 gene locus_tag LOCUS_15680 <1 599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXW3:aminomethyltransferase 648 2300 gene locus_tag LOCUS_15690 648 2300 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706041.1 protein_id gnl|my_center|LOCUS_15690 2582 3040 gene locus_tag LOCUS_15700 2582 3040 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_15700 >Feature sequence0335 >Feature sequence0336 1855 1388 gene locus_tag LOCUS_15710 gene aspB 1855 1388 CDS product adenylylsulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932545.1 protein_id gnl|my_center|LOCUS_15710 2661 2278 gene locus_tag LOCUS_15720 2661 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 2864 2658 gene locus_tag LOCUS_15730 2864 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 >Feature sequence0337 >Feature sequence0338 916 1590 gene locus_tag LOCUS_15740 gene pyrE 916 1590 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97N11 protein_id gnl|my_center|LOCUS_15740 1719 2153 gene locus_tag LOCUS_15750 1719 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 2159 2842 gene locus_tag LOCUS_15760 2159 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 >Feature sequence0339 >Feature sequence0340 891 1781 gene locus_tag LOCUS_15770 891 1781 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708258.1 protein_id gnl|my_center|LOCUS_15770 >Feature sequence0341 <1 809 gene locus_tag LOCUS_15780 <1 809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004548886.1:ferredoxin 858 1406 gene locus_tag LOCUS_15790 858 1406 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980453.1 protein_id gnl|my_center|LOCUS_15790 1722 1486 gene locus_tag LOCUS_15800 1722 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 2103 1807 gene locus_tag LOCUS_15810 2103 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15810 2265 2131 gene locus_tag LOCUS_15820 2265 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 <3104 2389 gene locus_tag LOCUS_15830 <3104 2389 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937987.1:HflK protein >Feature sequence0342 779 690 gene locus_tag LOCUS_t00160 779 690 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2050 914 gene locus_tag LOCUS_15840 2050 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 <3101 2050 gene locus_tag LOCUS_15850 <3101 2050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DG51:asparagine--tRNA ligase >Feature sequence0343 1712 1068 gene locus_tag LOCUS_15860 gene adk 1712 1068 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFF5 protein_id gnl|my_center|LOCUS_15860 2571 1885 gene locus_tag LOCUS_15870 gene mas1 2571 1885 CDS product agropine synthesis reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086406.1 protein_id gnl|my_center|LOCUS_15870 >Feature sequence0344 844 62 gene locus_tag LOCUS_15880 844 62 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262121.1 protein_id gnl|my_center|LOCUS_15880 1834 1043 gene locus_tag LOCUS_15890 1834 1043 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807257.1 protein_id gnl|my_center|LOCUS_15890 3060 1948 gene locus_tag LOCUS_15900 3060 1948 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337371.1 protein_id gnl|my_center|LOCUS_15900 >Feature sequence0345 <3057 931 gene locus_tag LOCUS_15910 <3057 931 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003530667.1:drug:proton antiporter >Feature sequence0346 <1 2032 gene locus_tag LOCUS_15920 <1 2032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085105.1:formate dehydrogenase subunit alpha >Feature sequence0347 1593 541 gene locus_tag LOCUS_15930 1593 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 <3047 1683 gene locus_tag LOCUS_15940 <3047 1683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707716.1:trimethylamine N-oxide reductase I catalytic subunit >Feature sequence0348 709 1893 gene locus_tag LOCUS_15950 709 1893 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887074.1 protein_id gnl|my_center|LOCUS_15950 2912 1926 gene locus_tag LOCUS_15960 2912 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 >Feature sequence0349 2830 1409 gene locus_tag LOCUS_15970 gene mpl 2830 1409 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933145.1 protein_id gnl|my_center|LOCUS_15970 >Feature sequence0350 601 1038 gene locus_tag LOCUS_15980 601 1038 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096732.1 protein_id gnl|my_center|LOCUS_15980 1035 1724 gene locus_tag LOCUS_15990 1035 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106037.1 protein_id gnl|my_center|LOCUS_15990 1769 1960 gene locus_tag LOCUS_16000 1769 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 >Feature sequence0351 <1 813 gene locus_tag LOCUS_16010 <1 813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012067242.1:carbohydrate kinase 979 1752 gene locus_tag LOCUS_16020 979 1752 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391560.1 protein_id gnl|my_center|LOCUS_16020 1788 2588 gene locus_tag LOCUS_16030 1788 2588 CDS product sgc region protein SgcQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530267.1 protein_id gnl|my_center|LOCUS_16030 >Feature sequence0352 402 4 gene locus_tag LOCUS_16040 402 4 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527982.1 protein_id gnl|my_center|LOCUS_16040 1238 819 gene locus_tag LOCUS_16050 1238 819 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088818.1 protein_id gnl|my_center|LOCUS_16050 2089 1322 gene locus_tag LOCUS_16060 2089 1322 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927121.1 protein_id gnl|my_center|LOCUS_16060 3027 2089 gene locus_tag LOCUS_16070 3027 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 >Feature sequence0353 1018 716 gene locus_tag LOCUS_16080 1018 716 CDS product addiction module antidote protein, HigA family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739893.1 protein_id gnl|my_center|LOCUS_16080 1307 1029 gene locus_tag LOCUS_16090 1307 1029 CDS product killer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939017.1 protein_id gnl|my_center|LOCUS_16090 <3019 1619 gene locus_tag LOCUS_16100 <3019 1619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071225.1:acriflavin resistance protein >Feature sequence0354 1210 359 gene locus_tag LOCUS_16110 1210 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 1439 2917 gene locus_tag LOCUS_16120 gene guaB 1439 2917 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74B47 protein_id gnl|my_center|LOCUS_16120 >Feature sequence0355 1115 186 gene locus_tag LOCUS_16130 1115 186 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767011.1 protein_id gnl|my_center|LOCUS_16130 2095 1121 gene locus_tag LOCUS_16140 2095 1121 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709923.1 protein_id gnl|my_center|LOCUS_16140 <3003 2173 gene locus_tag LOCUS_16150 <3003 2173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005307647.1:ABC transporter permease >Feature sequence0356 <1 592 gene locus_tag LOCUS_16160 <1 592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933433.1:aldolase 859 2769 gene locus_tag LOCUS_16170 859 2769 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791976.1 protein_id gnl|my_center|LOCUS_16170 >Feature sequence0357 1978 1061 gene locus_tag LOCUS_16180 gene map 1978 1061 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY1 protein_id gnl|my_center|LOCUS_16180 2864 2010 gene locus_tag LOCUS_16190 2864 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 >Feature sequence0358 1968 289 gene locus_tag LOCUS_16200 1968 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 <2998 2259 gene locus_tag LOCUS_16210 <2998 2259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P54535:arginine-binding extracellular protein ArtP >Feature sequence0359 <1 2389 gene locus_tag LOCUS_16220 <1 2389 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003021315.1:cyanophycin synthetase >Feature sequence0360 179 36 gene locus_tag LOCUS_16230 179 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 729 1067 gene locus_tag LOCUS_16240 gene glnB 729 1067 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942480.1 protein_id gnl|my_center|LOCUS_16240 1105 2325 gene locus_tag LOCUS_16250 gene amtB 1105 2325 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262597.1 protein_id gnl|my_center|LOCUS_16250 <2998 2375 gene locus_tag LOCUS_16260 <2998 2375 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8Z3E5:oxaloacetate decarboxylase beta chain 2 >Feature sequence0361 <2993 1452 gene locus_tag LOCUS_16270 <2993 1452 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013368424.1:type I restriction endonuclease subunit R >Feature sequence0362 <1 2235 gene locus_tag LOCUS_16280 <1 2235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RRH5:ferrous iron transport protein B 2295 2516 gene locus_tag LOCUS_16290 2295 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 >Feature sequence0363 149 649 gene locus_tag LOCUS_16300 149 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 1080 2066 gene locus_tag LOCUS_16310 1080 2066 CDS product secreted protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811594.1 protein_id gnl|my_center|LOCUS_16310 2073 2564 gene locus_tag LOCUS_16320 2073 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 >Feature sequence0364 <2970 879 gene locus_tag LOCUS_16330 <2970 879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DKS5:alpha-1,4 glucan phosphorylase >Feature sequence0365 <1 1791 gene locus_tag LOCUS_16340 <1 1791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O69177:Lon protease >Feature sequence0366 161 331 gene locus_tag LOCUS_16350 161 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 566 715 gene locus_tag LOCUS_16360 566 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 815 1078 gene locus_tag LOCUS_16370 815 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16370 1525 2514 gene locus_tag LOCUS_16380 gene galE 1525 2514 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931718.1 protein_id gnl|my_center|LOCUS_16380 >Feature sequence0367 >Feature sequence0368 >Feature sequence0369 2571 2095 gene locus_tag LOCUS_16390 2571 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 >Feature sequence0370 1266 289 gene locus_tag LOCUS_16400 1266 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 2633 1299 gene locus_tag LOCUS_16410 2633 1299 CDS product O-unit flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939580.1 protein_id gnl|my_center|LOCUS_16410 >Feature sequence0371 2920 71 gene locus_tag LOCUS_16420 2920 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 >Feature sequence0372 1439 399 gene locus_tag LOCUS_16430 gene aroF 1439 399 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN07 protein_id gnl|my_center|LOCUS_16430 1643 1567 gene locus_tag LOCUS_t00170 1643 1567 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2191 1736 gene locus_tag LOCUS_16440 gene yigI 2191 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073919.1 protein_id gnl|my_center|LOCUS_16440 >Feature sequence0373 <1 686 gene locus_tag LOCUS_16450 <1 686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000942282.1:ABC transporter ATP-binding protein 673 1095 gene locus_tag LOCUS_16460 673 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 1097 1522 gene locus_tag LOCUS_16470 1097 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 1559 2371 gene locus_tag LOCUS_16480 1559 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 2661 2395 gene locus_tag LOCUS_16490 2661 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112314.1 protein_id gnl|my_center|LOCUS_16490 >Feature sequence0374 1419 796 gene locus_tag LOCUS_16500 1419 796 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921310.1 protein_id gnl|my_center|LOCUS_16500 2199 1444 gene locus_tag LOCUS_16510 2199 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 >Feature sequence0375 891 966 gene locus_tag LOCUS_t00180 891 966 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1239 1931 gene locus_tag LOCUS_16520 1239 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 2231 2806 gene locus_tag LOCUS_16530 2231 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16530 >Feature sequence0376 <1 681 gene locus_tag LOCUS_16540 <1 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011970334.1:N-methylproline demethylase 1647 901 gene locus_tag LOCUS_16550 1647 901 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528029.1 protein_id gnl|my_center|LOCUS_16550 >Feature sequence0377 387 289 gene locus_tag LOCUS_t00190 387 289 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 554 973 gene locus_tag LOCUS_16560 554 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 1117 2655 gene locus_tag LOCUS_16570 gene pcd 1117 2655 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 protein_id gnl|my_center|LOCUS_16570 >Feature sequence0378 61 1092 gene locus_tag LOCUS_16580 61 1092 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532889.1 protein_id gnl|my_center|LOCUS_16580 >Feature sequence0379 <1 531 gene locus_tag LOCUS_16590 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939231.1:2-oxoglutarate ferredoxin oxidoreductase subunit alpha 608 942 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ttttaatcagtgtaaatccgtggc 938 1798 gene locus_tag LOCUS_16600 gene oorB 938 1798 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854895.1 protein_id gnl|my_center|LOCUS_16600 1795 2322 gene locus_tag LOCUS_16610 gene korC 1795 2322 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942116.1 protein_id gnl|my_center|LOCUS_16610 >Feature sequence0380 2092 1418 gene locus_tag LOCUS_16620 2092 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16620 <2860 2234 gene locus_tag LOCUS_16630 <2860 2234 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096832.1:gamma-glutamylputrescine synthetase note possible pseudo, internal stop codon >Feature sequence0381 2182 1847 gene locus_tag LOCUS_16640 2182 1847 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJG4 protein_id gnl|my_center|LOCUS_16640 2801 2301 gene locus_tag LOCUS_16650 2801 2301 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258997.1 protein_id gnl|my_center|LOCUS_16650 >Feature sequence0382 1531 404 gene locus_tag LOCUS_16660 1531 404 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143424.1 protein_id gnl|my_center|LOCUS_16660 1766 2188 gene locus_tag LOCUS_16670 1766 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 >Feature sequence0383 1058 126 gene locus_tag LOCUS_16680 gene xerC 1058 126 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39776 protein_id gnl|my_center|LOCUS_16680 1079 1417 gene locus_tag LOCUS_16690 1079 1417 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205430.1 protein_id gnl|my_center|LOCUS_16690 2013 1615 gene locus_tag LOCUS_16700 gene cheY 2013 1615 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005996243.1 protein_id gnl|my_center|LOCUS_16700 2328 2107 gene locus_tag LOCUS_16710 2328 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16710 2685 2440 gene locus_tag LOCUS_16720 2685 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 >Feature sequence0384 986 717 gene locus_tag LOCUS_16730 gene ptsH 986 717 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVV2 protein_id gnl|my_center|LOCUS_16730 2153 990 gene locus_tag LOCUS_16740 gene metK 2153 990 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61946 protein_id gnl|my_center|LOCUS_16740 >Feature sequence0385 >Feature sequence0386 <2821 1907 gene locus_tag LOCUS_16750 <2821 1907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A5HYC0:phosphoglycerate kinase >Feature sequence0387 <1 920 gene locus_tag LOCUS_16760 <1 920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973457.1:oxidoreductase 1965 958 gene locus_tag LOCUS_16770 gene rfaF 1965 958 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197552.1 protein_id gnl|my_center|LOCUS_16770 >Feature sequence0388 <1 597 gene locus_tag LOCUS_16780 <1 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015063907.1:DUF3604 domain-containing protein <2810 746 gene locus_tag LOCUS_16790 <2810 746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064652.1:serine hydroxymethyltransferase >Feature sequence0389 1333 194 gene locus_tag LOCUS_16800 1333 194 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837658.1 protein_id gnl|my_center|LOCUS_16800 2751 1348 gene locus_tag LOCUS_16810 gene lpdA1 2751 1348 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0C9 protein_id gnl|my_center|LOCUS_16810 >Feature sequence0390 <1 1299 gene locus_tag LOCUS_16820 <1 1299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003807020.1:membrane protein <2804 1403 gene locus_tag LOCUS_16830 <2804 1403 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529192.1:aldehyde dehydrogenase >Feature sequence0391 <1 2581 gene locus_tag LOCUS_16840 <1 2581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858356.1:restriction endonuclease subunit R >Feature sequence0392 2090 570 gene locus_tag LOCUS_16850 2090 570 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532922.1 protein_id gnl|my_center|LOCUS_16850 <2803 2155 gene locus_tag LOCUS_16860 <2803 2155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89KK7:methylthioribose kinase >Feature sequence0393 1935 2678 gene locus_tag LOCUS_16870 1935 2678 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697455.1 protein_id gnl|my_center|LOCUS_16870 >Feature sequence0394 490 633 gene locus_tag LOCUS_16880 490 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 644 1210 gene locus_tag LOCUS_16890 644 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 >Feature sequence0395 1252 953 gene locus_tag LOCUS_16900 1252 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 1581 1493 gene locus_tag LOCUS_t00200 1581 1493 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2047 1634 gene locus_tag LOCUS_16910 2047 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 2245 2436 gene locus_tag LOCUS_16920 2245 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 >Feature sequence0396 2 1099 gene locus_tag LOCUS_16930 2 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 1096 2106 gene locus_tag LOCUS_16940 1096 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938657.1 protein_id gnl|my_center|LOCUS_16940 >Feature sequence0397 333 1391 gene locus_tag LOCUS_16950 gene holA 333 1391 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048008.1 protein_id gnl|my_center|LOCUS_16950 >Feature sequence0398 <1 1289 gene locus_tag LOCUS_16960 <1 1289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338678.1:malonyl-CoA synthase 1544 1690 gene locus_tag LOCUS_16970 1544 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 1707 2141 gene locus_tag LOCUS_16980 1707 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 >Feature sequence0399 1254 466 gene locus_tag LOCUS_16990 1254 466 CDS product spermidine/putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357916.1 protein_id gnl|my_center|LOCUS_16990 2072 1251 gene locus_tag LOCUS_17000 2072 1251 CDS product spermidine/putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382189.1 protein_id gnl|my_center|LOCUS_17000 <2769 2089 gene locus_tag LOCUS_17010 <2769 2089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013384121.1:spermidine/putrescine ABC transporter >Feature sequence0400 1418 165 gene locus_tag LOCUS_17020 1418 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 2636 1440 gene locus_tag LOCUS_17030 2636 1440 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085634.1 protein_id gnl|my_center|LOCUS_17030 >Feature sequence0401 1413 547 gene locus_tag LOCUS_17040 1413 547 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067118.1 protein_id gnl|my_center|LOCUS_17040 2356 1721 gene locus_tag LOCUS_17050 2356 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 >Feature sequence0402 <1 976 gene locus_tag LOCUS_17060 <1 976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8Y6X2:threonine--tRNA ligase 1001 2305 gene locus_tag LOCUS_17070 1001 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 >Feature sequence0403 303 524 gene locus_tag LOCUS_17080 303 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 714 995 gene locus_tag LOCUS_17090 714 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 1035 2573 gene locus_tag LOCUS_17100 1035 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17100 >Feature sequence0404 <1 661 gene locus_tag LOCUS_17110 <1 661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933901.1:cobyrinic acid a,c-diamide synthase 689 1024 gene locus_tag LOCUS_17120 gene dsrC-2 689 1024 CDS product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932532.1 protein_id gnl|my_center|LOCUS_17120 1166 2428 gene locus_tag LOCUS_17130 gene dsrA-2 1166 2428 CDS product sulfite reductase, dissimilatory-type subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932533.1 protein_id gnl|my_center|LOCUS_17130 >Feature sequence0405 802 1770 gene locus_tag LOCUS_17140 802 1770 CDS product bordetella uptake gene family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464323.1 protein_id gnl|my_center|LOCUS_17140 1844 2344 gene locus_tag LOCUS_17150 1844 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 >Feature sequence0406 <1 2706 gene locus_tag LOCUS_17160 <1 2706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000372295.1:Fe-S-cluster-containing hydrogenase >Feature sequence0407 494 255 gene locus_tag LOCUS_17170 494 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 2551 1604 gene locus_tag LOCUS_17180 2551 1604 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405562.1 protein_id gnl|my_center|LOCUS_17180 >Feature sequence0408 1625 255 gene locus_tag LOCUS_17190 gene cbiA 1625 255 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748J6 protein_id gnl|my_center|LOCUS_17190 >Feature sequence0409 >Feature sequence0410 2061 769 gene locus_tag LOCUS_17200 2061 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 2060 2320 gene locus_tag LOCUS_17210 2060 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 >Feature sequence0411 1490 354 gene locus_tag LOCUS_17220 1490 354 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339252.1 protein_id gnl|my_center|LOCUS_17220 <2720 1866 gene locus_tag LOCUS_17230 <2720 1866 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389568.1:D-glycerate dehydrogenase >Feature sequence0412 354 1010 gene locus_tag LOCUS_17240 354 1010 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414149.1 protein_id gnl|my_center|LOCUS_17240 1340 2461 gene locus_tag LOCUS_17250 gene dnaN 1340 2461 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXP6 protein_id gnl|my_center|LOCUS_17250 >Feature sequence0413 <1 1263 gene locus_tag LOCUS_17260 <1 1263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104725.1:aminopeptidase N 1294 2616 gene locus_tag LOCUS_17270 gene cysD 1294 2616 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084053.1 protein_id gnl|my_center|LOCUS_17270 >Feature sequence0414 668 1135 gene locus_tag LOCUS_17280 668 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 2029 1211 gene locus_tag LOCUS_17290 2029 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 >Feature sequence0415 1962 1123 gene locus_tag LOCUS_17300 1962 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 >Feature sequence0416 273 467 gene locus_tag LOCUS_17310 273 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 927 1073 gene locus_tag LOCUS_17320 927 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 1833 2432 gene locus_tag LOCUS_17330 gene can 1833 2432 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEB3 protein_id gnl|my_center|LOCUS_17330 >Feature sequence0417 <1 798 gene locus_tag LOCUS_17340 <1 798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967740.1:oxidoreductase 2210 912 gene locus_tag LOCUS_17350 2210 912 CDS product racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002346580.2 protein_id gnl|my_center|LOCUS_17350 >Feature sequence0418 1581 934 gene locus_tag LOCUS_17360 gene hmgA 1581 934 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207986.1 protein_id gnl|my_center|LOCUS_17360 2589 1609 gene locus_tag LOCUS_17370 gene fahA 2589 1609 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071820.1 protein_id gnl|my_center|LOCUS_17370 >Feature sequence0419 1420 473 gene locus_tag LOCUS_17380 gene acuC2 1420 473 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881382.1 protein_id gnl|my_center|LOCUS_17380 1629 2147 gene locus_tag LOCUS_17390 gene def 1629 2147 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SH6 protein_id gnl|my_center|LOCUS_17390 2144 2611 gene locus_tag LOCUS_17400 2144 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 >Feature sequence0420 711 397 gene locus_tag LOCUS_17410 711 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 2463 868 gene locus_tag LOCUS_17420 2463 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 >Feature sequence0421 273 941 gene locus_tag LOCUS_17430 273 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389165.1 protein_id gnl|my_center|LOCUS_17430 961 2157 gene locus_tag LOCUS_17440 961 2157 CDS product hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405472.1 protein_id gnl|my_center|LOCUS_17440 >Feature sequence0422 >Feature sequence0423 308 778 gene locus_tag LOCUS_17450 308 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 1312 851 gene locus_tag LOCUS_17460 1312 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 1710 1393 gene locus_tag LOCUS_17470 1710 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 2132 2001 gene locus_tag LOCUS_17480 2132 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 >Feature sequence0424 <1 1664 gene locus_tag LOCUS_17490 <1 1664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142107.1:ATPase AAA 1671 1880 gene locus_tag LOCUS_17500 1671 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 <2632 1941 gene locus_tag LOCUS_17510 <2632 1941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257947.1:dihydroorotate dehydrogenase >Feature sequence0425 >Feature sequence0426 1625 2128 gene locus_tag LOCUS_17520 1625 2128 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030654.1 protein_id gnl|my_center|LOCUS_17520 >Feature sequence0427 212 847 gene locus_tag LOCUS_17530 212 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063692.1 protein_id gnl|my_center|LOCUS_17530 939 1739 gene locus_tag LOCUS_17540 939 1739 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072011.1 protein_id gnl|my_center|LOCUS_17540 2382 1765 gene locus_tag LOCUS_17550 2382 1765 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971922.1 protein_id gnl|my_center|LOCUS_17550 >Feature sequence0428 917 339 gene locus_tag LOCUS_17560 917 339 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932674.1 protein_id gnl|my_center|LOCUS_17560 1732 914 gene locus_tag LOCUS_17570 1732 914 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940877.1 protein_id gnl|my_center|LOCUS_17570 >Feature sequence0429 303 2018 gene locus_tag LOCUS_17580 303 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113945.1 protein_id gnl|my_center|LOCUS_17580 >Feature sequence0430 608 15 gene locus_tag LOCUS_17590 608 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938827.1 protein_id gnl|my_center|LOCUS_17590 1333 806 gene locus_tag LOCUS_17600 1333 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 2330 1386 gene locus_tag LOCUS_17610 2330 1386 CDS product NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544981.1 protein_id gnl|my_center|LOCUS_17610 >Feature sequence0431 <1 1288 gene locus_tag LOCUS_17620 <1 1288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083900.1:benzoyl-CoA-dihydrodiol lyase >Feature sequence0432 859 719 gene locus_tag LOCUS_17630 859 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17630 2115 871 gene locus_tag LOCUS_17640 2115 871 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_17640 >Feature sequence0433 640 176 gene locus_tag LOCUS_17650 gene fliS 640 176 CDS product flagellar protein FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3W9 protein_id gnl|my_center|LOCUS_17650 <2569 665 gene locus_tag LOCUS_17660 <2569 665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8ECA8:flagellar hook-associated protein 2 >Feature sequence0434 2272 611 gene locus_tag LOCUS_17670 2272 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 >Feature sequence0435 64 447 gene locus_tag LOCUS_17680 64 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 612 1331 gene locus_tag LOCUS_17690 gene aat 612 1331 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZS4 protein_id gnl|my_center|LOCUS_17690 1333 2052 gene locus_tag LOCUS_17700 1333 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 >Feature sequence0436 >Feature sequence0437 648 1580 gene locus_tag LOCUS_17710 648 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 1596 2066 gene locus_tag LOCUS_17720 1596 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 >Feature sequence0438 1884 1360 gene locus_tag LOCUS_17730 1884 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 2457 1897 gene locus_tag LOCUS_17740 2457 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 >Feature sequence0439 410 1462 gene locus_tag LOCUS_17750 gene ugpC 410 1462 CDS product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRT4 protein_id gnl|my_center|LOCUS_17750 1603 2307 gene locus_tag LOCUS_17760 1603 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970661.1 protein_id gnl|my_center|LOCUS_17760 >Feature sequence0440 2216 1080 gene locus_tag LOCUS_17770 2216 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 >Feature sequence0441 <1 584 gene locus_tag LOCUS_17780 <1 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974270.1:deoxyfructose oxidoreductase 584 1351 gene locus_tag LOCUS_17790 584 1351 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948304.1 protein_id gnl|my_center|LOCUS_17790 1419 1988 gene locus_tag LOCUS_17800 1419 1988 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115035.1 protein_id gnl|my_center|LOCUS_17800 2070 2357 gene locus_tag LOCUS_17810 2070 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729587.1 protein_id gnl|my_center|LOCUS_17810 >Feature sequence0442 1994 1356 gene locus_tag LOCUS_17820 1994 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 >Feature sequence0443 476 1360 gene locus_tag LOCUS_17830 gene thtR 476 1360 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975834.1 protein_id gnl|my_center|LOCUS_17830 1413 2060 gene locus_tag LOCUS_17840 1413 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 >Feature sequence0444 <1 795 gene locus_tag LOCUS_17850 <1 795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005480734.1:glycine radical enzyme activase 1126 1434 gene locus_tag LOCUS_17860 1126 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 1576 1905 gene locus_tag LOCUS_17870 1576 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17870 >Feature sequence0445 <1 796 gene locus_tag LOCUS_17880 <1 796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003102870.1:oxidoreductase 1113 1787 gene locus_tag LOCUS_17890 1113 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 1830 2054 gene locus_tag LOCUS_17900 1830 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 >Feature sequence0446 197 988 gene locus_tag LOCUS_17910 gene znuC 197 988 CDS product zinc import ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UN0 protein_id gnl|my_center|LOCUS_17910 991 1782 gene locus_tag LOCUS_17920 991 1782 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975837.1 protein_id gnl|my_center|LOCUS_17920 <2515 1907 gene locus_tag LOCUS_17930 <2515 1907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014205980.1:class II glutamine amidotransferase >Feature sequence0447 554 348 gene locus_tag LOCUS_17940 554 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 1866 604 gene locus_tag LOCUS_17950 1866 604 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946106.1 protein_id gnl|my_center|LOCUS_17950 >Feature sequence0448 1614 640 gene locus_tag LOCUS_17960 1614 640 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204261.1 protein_id gnl|my_center|LOCUS_17960 <2506 1701 gene locus_tag LOCUS_17970 <2506 1701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704304.1:D-aminoacylase >Feature sequence0449 <1 695 gene locus_tag LOCUS_17980 <1 695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532183.1:sugar ABC transporter substrate-binding protein 823 1914 gene locus_tag LOCUS_17990 823 1914 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532184.1 protein_id gnl|my_center|LOCUS_17990 >Feature sequence0450 >Feature sequence0451 >Feature sequence0452 2376 1354 gene locus_tag LOCUS_18000 2376 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 >Feature sequence0453 506 2080 gene locus_tag LOCUS_18010 gene hutH 506 2080 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U8Z7 protein_id gnl|my_center|LOCUS_18010 >Feature sequence0454 4 684 gene locus_tag LOCUS_18020 4 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 2099 705 gene locus_tag LOCUS_18030 gene fumC 2099 705 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAI9 protein_id gnl|my_center|LOCUS_18030 >Feature sequence0455 2245 701 gene locus_tag LOCUS_18040 2245 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 >Feature sequence0456 1785 691 gene locus_tag LOCUS_18050 gene cbiD 1785 691 CDS product cobalt-precorrin-5B C(1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8GDE1 protein_id gnl|my_center|LOCUS_18050 >Feature sequence0457 1750 659 gene locus_tag LOCUS_18060 1750 659 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240530.1 protein_id gnl|my_center|LOCUS_18060 >Feature sequence0458 2 1033 gene locus_tag LOCUS_18070 2 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 1000 1128 gene locus_tag LOCUS_18080 1000 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 >Feature sequence0459 597 800 gene locus_tag LOCUS_18090 597 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 900 1187 gene locus_tag LOCUS_18100 900 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 1251 1763 gene locus_tag LOCUS_18110 1251 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 1777 2226 gene locus_tag LOCUS_18120 1777 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 >Feature sequence0460 <1 667 gene locus_tag LOCUS_18130 <1 667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012708366.1:5-methyltetrahydrofolate--homocysteine methyltransferase 684 1385 gene locus_tag LOCUS_18140 684 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337251.1 protein_id gnl|my_center|LOCUS_18140 1390 1695 gene locus_tag LOCUS_18150 1390 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975919.1 protein_id gnl|my_center|LOCUS_18150 >Feature sequence0461 1235 87 gene locus_tag LOCUS_18160 1235 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 2135 1395 gene locus_tag LOCUS_18170 2135 1395 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 protein_id gnl|my_center|LOCUS_18170 >Feature sequence0462 944 720 gene locus_tag LOCUS_18180 944 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 1155 1577 gene locus_tag LOCUS_18190 1155 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 >Feature sequence0463 2312 705 gene locus_tag LOCUS_18200 2312 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 >Feature sequence0464 <2461 1255 gene locus_tag LOCUS_18210 <2461 1255 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072114.1:DNA recombination protein RmuC >Feature sequence0465 640 449 gene locus_tag LOCUS_18220 640 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 >Feature sequence0466 1601 660 gene locus_tag LOCUS_18230 1601 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 2254 1685 gene locus_tag LOCUS_18240 2254 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 >Feature sequence0467 <1 1598 gene locus_tag LOCUS_18250 <1 1598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083897.1:acetyl-CoA synthetase >Feature sequence0468 1090 1015 gene locus_tag LOCUS_t00210 1090 1015 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1285 1210 gene locus_tag LOCUS_t00220 1285 1210 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2453 1533 gene locus_tag LOCUS_18260 2453 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 >Feature sequence0469 525 1646 gene locus_tag LOCUS_18270 gene sat 525 1646 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE30 protein_id gnl|my_center|LOCUS_18270 2139 1675 gene locus_tag LOCUS_18280 2139 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 >Feature sequence0470 <1 798 gene locus_tag LOCUS_18290 <1 798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KG43:1-deoxy-D-xylulose 5-phosphate reductoisomerase 821 1207 gene locus_tag LOCUS_18300 821 1207 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022772.1 protein_id gnl|my_center|LOCUS_18300 >Feature sequence0471 1439 108 gene locus_tag LOCUS_18310 gene trmFO 1439 108 CDS product methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J349 protein_id gnl|my_center|LOCUS_18310 >Feature sequence0472 1315 203 gene locus_tag LOCUS_18320 1315 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 1675 1355 gene locus_tag LOCUS_18330 1675 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18330 >Feature sequence0473 2258 252 gene locus_tag LOCUS_18340 2258 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 >Feature sequence0474 1273 119 gene locus_tag LOCUS_18350 1273 119 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888021.1 protein_id gnl|my_center|LOCUS_18350 2241 1288 gene locus_tag LOCUS_18360 2241 1288 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888022.1 protein_id gnl|my_center|LOCUS_18360 >Feature sequence0475 <1 857 gene locus_tag LOCUS_18370 <1 857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011731465.1:glutamine synthetase 960 1895 gene locus_tag LOCUS_18380 960 1895 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875830.1 protein_id gnl|my_center|LOCUS_18380 >Feature sequence0476 1083 646 gene locus_tag LOCUS_18390 gene ypeA 1083 646 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804508.1 protein_id gnl|my_center|LOCUS_18390 1727 1083 gene locus_tag LOCUS_18400 1727 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 <2391 1796 gene locus_tag LOCUS_18410 <2391 1796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RGK7:5-formyltetrahydrofolate cyclo-ligase >Feature sequence0477 <1 785 gene locus_tag LOCUS_18420 <1 785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679762.1:membrane protein 800 1627 gene locus_tag LOCUS_18430 800 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_18430 >Feature sequence0478 1592 633 gene locus_tag LOCUS_18440 gene glpX 1592 633 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BU5 protein_id gnl|my_center|LOCUS_18440 <2374 1748 gene locus_tag LOCUS_18450 <2374 1748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005817230.1:phosphoribosylamine--glycine ligase >Feature sequence0479 >Feature sequence0480 1604 603 gene locus_tag LOCUS_18460 1604 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18460 <2365 1650 gene locus_tag LOCUS_18470 <2365 1650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q59637:pyruvate dehydrogenase E1 component note possible pseudo, internal stop codon >Feature sequence0481 >Feature sequence0482 <2345 1650 gene locus_tag LOCUS_18480 <2345 1650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8PD06:acetyltransferase component of pyruvate dehydrogenase complex >Feature sequence0483 3 1358 gene locus_tag LOCUS_18490 3 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 1355 2080 gene locus_tag LOCUS_18500 1355 2080 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088307.1 protein_id gnl|my_center|LOCUS_18500 >Feature sequence0484 >Feature sequence0485 1197 592 gene locus_tag LOCUS_18510 1197 592 CDS product transporter DctQ-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707213.1 protein_id gnl|my_center|LOCUS_18510 2249 1455 gene locus_tag LOCUS_18520 2249 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18520 >Feature sequence0486 20 784 gene locus_tag LOCUS_18530 20 784 CDS product N(G),N(G)-dimethylarginine dimethylaminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4E3 protein_id gnl|my_center|LOCUS_18530 1579 866 gene locus_tag LOCUS_18540 1579 866 CDS product UPF0761 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E985 protein_id gnl|my_center|LOCUS_18540 1829 1966 gene locus_tag LOCUS_18550 1829 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 >Feature sequence0487 >Feature sequence0488 152 469 gene locus_tag LOCUS_18560 152 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 457 1107 gene locus_tag LOCUS_18570 457 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 >Feature sequence0489 1153 248 gene locus_tag LOCUS_18580 gene hag 1153 248 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P02968 protein_id gnl|my_center|LOCUS_18580 1973 1608 gene locus_tag LOCUS_18590 1973 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 >Feature sequence0490 472 221 gene locus_tag LOCUS_18600 472 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 1828 1391 gene locus_tag LOCUS_18610 1828 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 >Feature sequence0491 <1 1139 gene locus_tag LOCUS_18620 <1 1139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528442.1:branched-chain amino acid ABC transporter substrate-binding protein 1203 2096 gene locus_tag LOCUS_18630 1203 2096 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528443.1 protein_id gnl|my_center|LOCUS_18630 >Feature sequence0492 <1 683 gene locus_tag LOCUS_18640 <1 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105893.1:propionyl-CoA synthetase 744 2108 gene locus_tag LOCUS_18650 744 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 >Feature sequence0493 1910 543 gene locus_tag LOCUS_18660 1910 543 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339250.1 protein_id gnl|my_center|LOCUS_18660 >Feature sequence0494 324 248 gene locus_tag LOCUS_t00230 324 248 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 451 376 gene locus_tag LOCUS_t00240 451 376 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1839 649 gene locus_tag LOCUS_18670 gene fadA 1839 649 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190136.1 protein_id gnl|my_center|LOCUS_18670 >Feature sequence0495 1556 666 gene locus_tag LOCUS_18680 1556 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 >Feature sequence0496 1663 62 gene locus_tag LOCUS_18690 1663 62 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390595.1 protein_id gnl|my_center|LOCUS_18690 <2289 1660 gene locus_tag LOCUS_18700 <2289 1660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390594.1:ABC transporter substrate-binding protein >Feature sequence0497 65 388 gene locus_tag LOCUS_18710 gene trxA 65 388 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747I5 protein_id gnl|my_center|LOCUS_18710 407 1207 gene locus_tag LOCUS_18720 gene truA 407 1207 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4AAX9 protein_id gnl|my_center|LOCUS_18720 >Feature sequence0498 <1 1038 gene locus_tag LOCUS_18730 <1 1038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q747R0:ribosomal protein S12 methylthiotransferase RimO >Feature sequence0499 <1 576 gene locus_tag LOCUS_18740 <1 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932548.1:heterodisulfide reductase subunit A 648 1805 gene locus_tag LOCUS_18750 648 1805 CDS product QmoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545389.1 protein_id gnl|my_center|LOCUS_18750 >Feature sequence0500 <2261 1667 gene locus_tag LOCUS_18760 <2261 1667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259049.1:4Fe-4S ferredoxin >Feature sequence0501 426 1439 gene locus_tag LOCUS_18770 gene alc1 426 1439 CDS product putative allantoicase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63T53 protein_id gnl|my_center|LOCUS_18770 >Feature sequence0502 602 526 gene locus_tag LOCUS_t00250 602 526 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 <2259 702 gene locus_tag LOCUS_18780 <2259 702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015040627.1:amidase >Feature sequence0503 802 1413 gene locus_tag LOCUS_18790 gene rpsD 802 1413 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WT66 protein_id gnl|my_center|LOCUS_18790 >Feature sequence0504 578 1099 gene locus_tag LOCUS_18800 578 1099 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975049.1 protein_id gnl|my_center|LOCUS_18800 >Feature sequence0505 <1 1430 gene locus_tag LOCUS_18810 <1 1430 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q72AY0:apolipoprotein N-acyltransferase >Feature sequence0506 708 1025 gene locus_tag LOCUS_18820 708 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 1013 1243 gene locus_tag LOCUS_18830 1013 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 >Feature sequence0507 2 859 gene locus_tag LOCUS_18840 2 859 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104034.1 protein_id gnl|my_center|LOCUS_18840 1430 879 gene locus_tag LOCUS_18850 1430 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 >Feature sequence0508 830 90 gene locus_tag LOCUS_18860 830 90 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090177.1 protein_id gnl|my_center|LOCUS_18860 1919 1020 gene locus_tag LOCUS_18870 1919 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 >Feature sequence0509 1183 890 gene locus_tag LOCUS_18880 1183 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 >Feature sequence0510 1 888 gene locus_tag LOCUS_18890 1 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 972 1283 gene locus_tag LOCUS_18900 972 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 1276 1548 gene locus_tag LOCUS_18910 1276 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 1643 1996 gene locus_tag LOCUS_18920 gene arsC 1643 1996 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED91 protein_id gnl|my_center|LOCUS_18920 >Feature sequence0511 376 999 gene locus_tag LOCUS_18930 376 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 1025 1891 gene locus_tag LOCUS_18940 1025 1891 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404066.1 protein_id gnl|my_center|LOCUS_18940 >Feature sequence0512 189 707 gene locus_tag LOCUS_18950 gene folK 189 707 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262835.1 protein_id gnl|my_center|LOCUS_18950 2194 695 gene locus_tag LOCUS_18960 gene aceB 2194 695 CDS product malate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HM57 protein_id gnl|my_center|LOCUS_18960 >Feature sequence0513 228 614 gene locus_tag LOCUS_18970 228 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 711 1526 gene locus_tag LOCUS_18980 711 1526 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJN7 protein_id gnl|my_center|LOCUS_18980 >Feature sequence0514 459 1706 gene locus_tag LOCUS_18990 459 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 >Feature sequence0515 2074 1199 gene locus_tag LOCUS_19000 2074 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 >Feature sequence0516 312 1733 gene locus_tag LOCUS_19010 312 1733 CDS product MucD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545143.1 protein_id gnl|my_center|LOCUS_19010 2188 1979 gene locus_tag LOCUS_19020 2188 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 >Feature sequence0517 <2187 1014 gene locus_tag LOCUS_19030 <2187 1014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8T9Y5:kynureninase >Feature sequence0518 179 733 gene locus_tag LOCUS_19040 179 733 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249129.1 protein_id gnl|my_center|LOCUS_19040 718 1893 gene locus_tag LOCUS_19050 gene pyrD 718 1893 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NC99 protein_id gnl|my_center|LOCUS_19050 >Feature sequence0519 877 185 gene locus_tag LOCUS_19060 877 185 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709525.1 protein_id gnl|my_center|LOCUS_19060 1545 919 gene locus_tag LOCUS_19070 1545 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 2092 1604 gene locus_tag LOCUS_19080 2092 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060680.1 protein_id gnl|my_center|LOCUS_19080 >Feature sequence0520 >Feature sequence0521 551 733 gene locus_tag LOCUS_19090 551 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 1584 1390 gene locus_tag LOCUS_19100 1584 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 1938 1693 gene locus_tag LOCUS_19110 1938 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 >Feature sequence0522 1142 453 gene locus_tag LOCUS_19120 1142 453 CDS product transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRN2 protein_id gnl|my_center|LOCUS_19120 <2174 1139 gene locus_tag LOCUS_19130 <2174 1139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002025277.1:sensor histidine kinase >Feature sequence0523 <2170 725 gene locus_tag LOCUS_19140 <2170 725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096762.1:bifunctional aldehyde dehydrogenase/enoyl-CoA hydratase >Feature sequence0524 <1 926 gene locus_tag LOCUS_19150 <1 926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005483284.1:C4-dicarboxylate ABC transporter >Feature sequence0525 578 1456 gene locus_tag LOCUS_19160 578 1456 CDS product deoxyribonucleoside regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192701.1 protein_id gnl|my_center|LOCUS_19160 >Feature sequence0526 1426 113 gene locus_tag LOCUS_19170 1426 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 <2157 1511 gene locus_tag LOCUS_19180 <2157 1511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000169689.1:2-isopropylmalate synthase >Feature sequence0527 402 1004 gene locus_tag LOCUS_19190 402 1004 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932570.1 protein_id gnl|my_center|LOCUS_19190 1049 2089 gene locus_tag LOCUS_19200 1049 2089 CDS product acyl-CoA--6-aminopenicillanic acid acyl-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728149.1 protein_id gnl|my_center|LOCUS_19200 >Feature sequence0528 81 1211 gene locus_tag LOCUS_19210 81 1211 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277803.1 protein_id gnl|my_center|LOCUS_19210 1277 1990 gene locus_tag LOCUS_19220 1277 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 >Feature sequence0529 931 560 gene locus_tag LOCUS_19230 931 560 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978039.1 protein_id gnl|my_center|LOCUS_19230 1537 1115 gene locus_tag LOCUS_19240 1537 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 >Feature sequence0530 <1 1530 gene locus_tag LOCUS_19250 <1 1530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016207.1:UNC-44 ankyrin 1809 1576 gene locus_tag LOCUS_19260 1809 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 >Feature sequence0531 1143 1580 gene locus_tag LOCUS_19270 gene rpsL 1143 1580 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I7F9P6 protein_id gnl|my_center|LOCUS_19270 1626 2063 gene locus_tag LOCUS_19280 gene rpsG 1626 2063 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3K3 protein_id gnl|my_center|LOCUS_19280 >Feature sequence0532 1715 759 gene locus_tag LOCUS_19290 1715 759 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230181.1 protein_id gnl|my_center|LOCUS_19290 >Feature sequence0533 575 1033 gene locus_tag LOCUS_19300 575 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 >Feature sequence0534 1213 2007 gene locus_tag LOCUS_19310 1213 2007 CDS product Asp/Glu racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531948.1 protein_id gnl|my_center|LOCUS_19310 >Feature sequence0535 642 1847 gene locus_tag LOCUS_19320 642 1847 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920461.1 protein_id gnl|my_center|LOCUS_19320 >Feature sequence0536 1430 327 gene locus_tag LOCUS_19330 gene aroF2 1430 327 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546648.1 protein_id gnl|my_center|LOCUS_19330 1873 1484 gene locus_tag LOCUS_19340 1873 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 >Feature sequence0537 1121 51 gene locus_tag LOCUS_19350 1121 51 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968776.1 protein_id gnl|my_center|LOCUS_19350 <2124 1159 gene locus_tag LOCUS_19360 <2124 1159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088825.1:BEC protein >Feature sequence0538 1659 694 gene locus_tag LOCUS_19370 1659 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 >Feature sequence0539 1116 1535 gene locus_tag LOCUS_19380 1116 1535 CDS product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_19380 >Feature sequence0540 863 1012 gene locus_tag LOCUS_19390 863 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 1079 1474 gene locus_tag LOCUS_19400 1079 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 2115 1567 gene locus_tag LOCUS_19410 2115 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085806.1 protein_id gnl|my_center|LOCUS_19410 >Feature sequence0541 1067 174 gene locus_tag LOCUS_19420 gene iolE 1067 174 CDS product inosose dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HIK1 protein_id gnl|my_center|LOCUS_19420 <2113 1355 gene locus_tag LOCUS_19430 <2113 1355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q92WJ0:Fe(3+) ions import ATP-binding protein FbpC 1 >Feature sequence0542 289 5 gene locus_tag LOCUS_19440 289 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 1009 401 gene locus_tag LOCUS_19450 1009 401 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186915.1 protein_id gnl|my_center|LOCUS_19450 >Feature sequence0543 >Feature sequence0544 1109 879 gene locus_tag LOCUS_19460 1109 879 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932528.1 protein_id gnl|my_center|LOCUS_19460 <2098 1383 gene locus_tag LOCUS_19470 <2098 1383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932553.1:Fe-S oxidoreductase >Feature sequence0545 621 1097 gene locus_tag LOCUS_19480 621 1097 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035414.1 protein_id gnl|my_center|LOCUS_19480 <2096 1386 gene locus_tag LOCUS_19490 <2096 1386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921167.1:acyl-CoA synthetase >Feature sequence0546 1083 223 gene locus_tag LOCUS_19500 gene dapF 1083 223 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZX7 protein_id gnl|my_center|LOCUS_19500 >Feature sequence0547 2 652 gene locus_tag LOCUS_19510 2 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 649 1023 gene locus_tag LOCUS_19520 649 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 1030 1782 gene locus_tag LOCUS_19530 1030 1782 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208350.1 protein_id gnl|my_center|LOCUS_19530 >Feature sequence0548 95 910 gene locus_tag LOCUS_19540 95 910 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389380.1 protein_id gnl|my_center|LOCUS_19540 916 1473 gene locus_tag LOCUS_19550 916 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 >Feature sequence0549 912 1643 gene locus_tag LOCUS_19560 912 1643 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528821.1 protein_id gnl|my_center|LOCUS_19560 >Feature sequence0550 <1 636 gene locus_tag LOCUS_19570 <1 636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011331273.1:sulfoacetaldehyde acetyltransferase >Feature sequence0551 908 360 gene locus_tag LOCUS_19580 908 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 <2055 997 gene locus_tag LOCUS_19590 <2055 997 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012289252.1:phycocyanobilin lyase >Feature sequence0552 1503 865 gene locus_tag LOCUS_19600 1503 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 >Feature sequence0553 326 102 gene locus_tag LOCUS_19610 326 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 711 541 gene locus_tag LOCUS_19620 711 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 1866 931 gene locus_tag LOCUS_19630 1866 931 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103268.1 protein_id gnl|my_center|LOCUS_19630 >Feature sequence0554 564 184 gene locus_tag LOCUS_19640 564 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 1510 1352 gene locus_tag LOCUS_19650 1510 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 >Feature sequence0555 321 806 gene locus_tag LOCUS_19660 321 806 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258478.1 protein_id gnl|my_center|LOCUS_19660 907 1890 gene locus_tag LOCUS_19670 907 1890 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657813.1 protein_id gnl|my_center|LOCUS_19670 >Feature sequence0556 246 854 gene locus_tag LOCUS_19680 246 854 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZT1 protein_id gnl|my_center|LOCUS_19680 >Feature sequence0557 <1 1187 gene locus_tag LOCUS_19690 <1 1187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000551472.1:2-oxoglutarate dehydrogenase subunit E1 >Feature sequence0558 841 164 gene locus_tag LOCUS_19700 841 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 1150 1929 gene locus_tag LOCUS_19710 1150 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 >Feature sequence0559 >Feature sequence0560 743 369 gene locus_tag LOCUS_19720 743 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 1000 740 gene locus_tag LOCUS_19730 1000 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 1365 1907 gene locus_tag LOCUS_19740 1365 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 >Feature sequence0561 272 1804 gene locus_tag LOCUS_19750 272 1804 CDS product acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088826.1 protein_id gnl|my_center|LOCUS_19750 >Feature sequence0562 1403 354 gene locus_tag LOCUS_19760 gene tdh 1403 354 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFH1 protein_id gnl|my_center|LOCUS_19760 <2008 1400 gene locus_tag LOCUS_19770 <2008 1400 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C3MFH2:2-amino-3-ketobutyrate coenzyme A ligase >Feature sequence0563 236 631 gene locus_tag LOCUS_19780 gene dsrF 236 631 CDS product sulfurtransferase TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932537.1 protein_id gnl|my_center|LOCUS_19780 664 957 gene locus_tag LOCUS_19790 gene dsrH 664 957 CDS product multidrug MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932538.1 protein_id gnl|my_center|LOCUS_19790 1055 1663 gene locus_tag LOCUS_19800 1055 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 >Feature sequence0564 1033 251 gene locus_tag LOCUS_19810 gene nagB 1033 251 CDS product glucosamine-6-phosphate deaminase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O35000 protein_id gnl|my_center|LOCUS_19810 >Feature sequence0565 1199 768 gene locus_tag LOCUS_19820 gene maoC 1199 768 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034360.1 protein_id gnl|my_center|LOCUS_19820 1830 1387 gene locus_tag LOCUS_19830 1830 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222517.1 protein_id gnl|my_center|LOCUS_19830 >Feature sequence0566 <1995 1002 gene locus_tag LOCUS_19840 <1995 1002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121781.1:proline dehydrogenase >Feature sequence0567 1660 464 gene locus_tag LOCUS_19850 1660 464 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082450.1 protein_id gnl|my_center|LOCUS_19850 >Feature sequence0568 750 1529 gene locus_tag LOCUS_19860 750 1529 CDS product cyclohexadienyl dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456015.1 protein_id gnl|my_center|LOCUS_19860 >Feature sequence0569 294 1364 gene locus_tag LOCUS_19870 294 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 <1983 1479 gene locus_tag LOCUS_19880 <1983 1479 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257910.1:AMP-dependent synthetase >Feature sequence0570 702 1493 gene locus_tag LOCUS_19890 702 1493 CDS product methylglutaconyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337545.1 protein_id gnl|my_center|LOCUS_19890 >Feature sequence0571 1922 1617 gene locus_tag LOCUS_19900 1922 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 >Feature sequence0572 214 807 gene locus_tag LOCUS_19910 214 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 882 1307 gene locus_tag LOCUS_19920 882 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 1360 1444 gene locus_tag LOCUS_t00260 1360 1444 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0573 <1 697 gene locus_tag LOCUS_19930 <1 697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947557.1:acetoacetyl-CoA synthetase >Feature sequence0574 <1 752 gene locus_tag LOCUS_19940 <1 752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P39576:branched-chain-amino-acid aminotransferase 2 782 1447 gene locus_tag LOCUS_19950 782 1447 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704333.1 protein_id gnl|my_center|LOCUS_19950 >Feature sequence0575 >Feature sequence0576 >Feature sequence0577 1609 1427 gene locus_tag LOCUS_19960 1609 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 >Feature sequence0578 >Feature sequence0579 <1 1299 gene locus_tag LOCUS_19970 <1 1299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YKK1:UDP-3-O-acyl-N-acetylglucosamine deacetylase >Feature sequence0580 1926 1564 gene locus_tag LOCUS_19980 1926 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 >Feature sequence0581 <1 1269 gene locus_tag LOCUS_19990 <1 1269 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122818.1:succinate dehydrogenase flavoprotein subunit >Feature sequence0582 <1916 477 gene locus_tag LOCUS_20000 <1916 477 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E2W3:histidine kinase >Feature sequence0583 3 1343 gene locus_tag LOCUS_20010 3 1343 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969919.1 protein_id gnl|my_center|LOCUS_20010 >Feature sequence0584 983 441 gene locus_tag LOCUS_20020 983 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 1351 1022 gene locus_tag LOCUS_20030 1351 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 <1914 1381 gene locus_tag LOCUS_20040 <1914 1381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140144.1:exodeoxyribonuclease III >Feature sequence0585 <1 1108 gene locus_tag LOCUS_20050 <1 1108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012709130.1:phenylacetate-CoA oxygenase subunit PaaJ >Feature sequence0586 <1911 483 gene locus_tag LOCUS_20060 <1911 483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974158.1:iron ABC transporter permease >Feature sequence0587 <1 521 gene locus_tag LOCUS_20070 <1 521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q812P6:translation initiation factor IF-3 530 724 gene locus_tag LOCUS_20080 gene rpmI 530 724 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189N0 protein_id gnl|my_center|LOCUS_20080 742 1098 gene locus_tag LOCUS_20090 gene rplT 742 1098 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D01 protein_id gnl|my_center|LOCUS_20090 >Feature sequence0588 1766 774 gene locus_tag LOCUS_20100 1766 774 CDS product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709004.1 protein_id gnl|my_center|LOCUS_20100 >Feature sequence0589 284 757 gene locus_tag LOCUS_20110 284 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 871 1227 gene locus_tag LOCUS_20120 gene dksA 871 1227 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GG2 protein_id gnl|my_center|LOCUS_20120 <1898 1360 gene locus_tag LOCUS_20130 <1898 1360 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P31681:60 kDa chaperonin >Feature sequence0590 >Feature sequence0591 <1 646 gene locus_tag LOCUS_20140 <1 646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090006.1:carbon monoxide dehydrogenase 729 1013 gene locus_tag LOCUS_20150 729 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582865.1 protein_id gnl|my_center|LOCUS_20150 >Feature sequence0592 372 76 gene locus_tag LOCUS_20160 372 76 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143402.1 protein_id gnl|my_center|LOCUS_20160 548 1120 gene locus_tag LOCUS_20170 548 1120 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194572.1 protein_id gnl|my_center|LOCUS_20170 >Feature sequence0593 <1 1846 gene locus_tag LOCUS_20180 <1 1846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005771665.1:membrane protein >Feature sequence0594 >Feature sequence0595 <1882 297 gene locus_tag LOCUS_20190 <1882 297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein >Feature sequence0596 >Feature sequence0597 <1879 147 gene locus_tag LOCUS_20200 <1879 147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q81IQ3:phosphoribosylformylglycinamidine synthase subunit PurL >Feature sequence0598 417 1616 gene locus_tag LOCUS_20210 417 1616 CDS product 5-aminoimidazole-4-carboxamide ribonucleotide transformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965740.1 protein_id gnl|my_center|LOCUS_20210 >Feature sequence0599 671 294 gene locus_tag LOCUS_20220 671 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 <1875 836 gene locus_tag LOCUS_20230 <1875 836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267522.1:sarcosine oxidase subunit beta >Feature sequence0600 1159 455 gene locus_tag LOCUS_20240 1159 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932971.1 protein_id gnl|my_center|LOCUS_20240 <1875 1254 gene locus_tag LOCUS_20250 <1875 1254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003816037.1:taurine dioxygenase >Feature sequence0601 1248 112 gene locus_tag LOCUS_20260 gene yjeS 1248 112 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MN61 protein_id gnl|my_center|LOCUS_20260 <1872 1268 gene locus_tag LOCUS_20270 <1872 1268 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186349.1:aminotransferase >Feature sequence0602 <1 1170 gene locus_tag LOCUS_20280 <1 1170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004530004.1:non-ribosomal peptide synthase <1869 1212 gene locus_tag LOCUS_20290 <1869 1212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385446.1:amidohydrolase >Feature sequence0603 397 1248 gene locus_tag LOCUS_20300 397 1248 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259304.1 protein_id gnl|my_center|LOCUS_20300 >Feature sequence0604 >Feature sequence0605 1713 730 gene locus_tag LOCUS_20310 1713 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 >Feature sequence0606 <1 956 gene locus_tag LOCUS_20320 <1 956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546373.1:cytochrome c551 peroxidase 966 1526 gene locus_tag LOCUS_20330 966 1526 CDS product arsenite oxidase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229170.1 protein_id gnl|my_center|LOCUS_20330 >Feature sequence0607 923 234 gene locus_tag LOCUS_20340 923 234 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261737.1 protein_id gnl|my_center|LOCUS_20340 <1844 937 gene locus_tag LOCUS_20350 <1844 937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261736.1:ABC transporter permease >Feature sequence0608 1762 860 gene locus_tag LOCUS_20360 gene znuA 1762 860 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969557.1 protein_id gnl|my_center|LOCUS_20360 >Feature sequence0609 1654 749 gene locus_tag LOCUS_20370 1654 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 >Feature sequence0610 2 364 gene locus_tag LOCUS_20380 2 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 357 968 gene locus_tag LOCUS_20390 357 968 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105558.1 protein_id gnl|my_center|LOCUS_20390 >Feature sequence0611 <1 590 gene locus_tag LOCUS_20400 <1 590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000097194.1:3-oxoacyl-ACP reductase 885 673 gene locus_tag LOCUS_20410 885 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 >Feature sequence0612 898 125 gene locus_tag LOCUS_20420 898 125 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532969.1 protein_id gnl|my_center|LOCUS_20420 <1806 1019 gene locus_tag LOCUS_20430 <1806 1019 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012709787.1:sugar ABC transporter ATP-binding protein >Feature sequence0613 >Feature sequence0614 626 342 gene locus_tag LOCUS_20440 626 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 809 636 gene locus_tag LOCUS_20450 809 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 1641 1066 gene locus_tag LOCUS_20460 1641 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 >Feature sequence0615 >Feature sequence0616 >Feature sequence0617 <1 1348 gene locus_tag LOCUS_20470 <1 1348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001047260.1:Zn-dependent protease >Feature sequence0618 1096 191 gene locus_tag LOCUS_20480 1096 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 1608 1093 gene locus_tag LOCUS_20490 1608 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 >Feature sequence0619 1166 420 gene locus_tag LOCUS_20500 1166 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212540.1 protein_id gnl|my_center|LOCUS_20500 >Feature sequence0620 <1788 883 gene locus_tag LOCUS_20510 <1788 883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963021.1:aminotransferase >Feature sequence0621 <1783 1233 gene locus_tag LOCUS_20520 <1783 1233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O67240:adenosylhomocysteinase >Feature sequence0622 >Feature sequence0623 <1778 1279 gene locus_tag LOCUS_20530 <1778 1279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974600.1:ABC transporter permease >Feature sequence0624 503 1663 gene locus_tag LOCUS_20540 503 1663 CDS product conjugal transfer protein TraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811492.1 protein_id gnl|my_center|LOCUS_20540 >Feature sequence0625 >Feature sequence0626 >Feature sequence0627 <1766 482 gene locus_tag LOCUS_20550 <1766 482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886991.1:cytochrome c biogenesis protein CcmF >Feature sequence0628 486 1439 gene locus_tag LOCUS_20560 486 1439 CDS product phytanoyl-CoA dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030607.1 protein_id gnl|my_center|LOCUS_20560 >Feature sequence0629 <1 1466 gene locus_tag LOCUS_20570 <1 1466 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887727.1:methylmalonyl-CoA mutase >Feature sequence0630 647 1342 gene locus_tag LOCUS_20580 647 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 >Feature sequence0631 1028 183 gene locus_tag LOCUS_20590 gene yvoA 1028 183 CDS product HTH-type transcriptional repressor YvoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34817 protein_id gnl|my_center|LOCUS_20590 <1764 1145 gene locus_tag LOCUS_20600 <1764 1145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972429.1:sugar ABC transporter ATP-binding protein >Feature sequence0632 812 456 gene locus_tag LOCUS_20610 812 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 1621 809 gene locus_tag LOCUS_20620 1621 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 >Feature sequence0633 >Feature sequence0634 <1 778 gene locus_tag LOCUS_20630 <1 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090538.1:L-proline 4-hydroxylase 873 1151 gene locus_tag LOCUS_20640 873 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 1129 1449 gene locus_tag LOCUS_20650 1129 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 >Feature sequence0635 >Feature sequence0636 191 901 gene locus_tag LOCUS_20660 gene pyrH 191 901 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2Y0 protein_id gnl|my_center|LOCUS_20660 910 1479 gene locus_tag LOCUS_20670 gene frr 910 1479 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61304 protein_id gnl|my_center|LOCUS_20670 >Feature sequence0637 1462 689 gene locus_tag LOCUS_20680 gene cobM 1462 689 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086055.1 protein_id gnl|my_center|LOCUS_20680 >Feature sequence0638 <1745 531 gene locus_tag LOCUS_20690 <1745 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941157.1:ATP-dependent protease >Feature sequence0639 >Feature sequence0640 1314 385 gene locus_tag LOCUS_20700 1314 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 >Feature sequence0641 <1732 489 gene locus_tag LOCUS_20710 <1732 489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KC02:pyruvate-flavodoxin oxidoreductase >Feature sequence0642 876 469 gene locus_tag LOCUS_20720 876 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 984 1184 gene locus_tag LOCUS_20730 984 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 1209 1427 gene locus_tag LOCUS_20740 1209 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 >Feature sequence0643 379 1632 gene locus_tag LOCUS_20750 379 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 >Feature sequence0644 >Feature sequence0645 802 1527 gene locus_tag LOCUS_20760 802 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 >Feature sequence0646 3 341 gene locus_tag LOCUS_20770 3 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 430 1020 gene locus_tag LOCUS_20780 430 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 1027 1557 gene locus_tag LOCUS_20790 1027 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 >Feature sequence0647 1059 373 gene locus_tag LOCUS_20800 1059 373 CDS product histidine/lysine/arginine/ornithine ABC transporter permease HisQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705576.1 protein_id gnl|my_center|LOCUS_20800 <1701 1186 gene locus_tag LOCUS_20810 <1701 1186 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005419848.1:ABC transporter substrate-binding protein >Feature sequence0648 1453 299 gene locus_tag LOCUS_20820 1453 299 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1E6 protein_id gnl|my_center|LOCUS_20820 >Feature sequence0649 526 134 gene locus_tag LOCUS_20830 526 134 CDS product death-on-curing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142729.1 protein_id gnl|my_center|LOCUS_20830 750 526 gene locus_tag LOCUS_20840 750 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 >Feature sequence0650 <1 1224 gene locus_tag LOCUS_20850 <1 1224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071759.1:type I polyketide synthase >Feature sequence0651 <1 830 gene locus_tag LOCUS_20860 <1 830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KET5:ATP-dependent RNA helicase DeaD <1695 902 gene locus_tag LOCUS_20870 <1695 902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010926009.1:(2Fe-2S)-binding protein >Feature sequence0652 1330 26 gene locus_tag LOCUS_20880 1330 26 CDS product 3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048213.1 protein_id gnl|my_center|LOCUS_20880 >Feature sequence0653 1321 620 gene locus_tag LOCUS_20890 1321 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119447.1 protein_id gnl|my_center|LOCUS_20890 >Feature sequence0654 470 1285 gene locus_tag LOCUS_20900 470 1285 CDS product inorganic polyphosphate/ATP-NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876505.1 protein_id gnl|my_center|LOCUS_20900 >Feature sequence0655 >Feature sequence0656 <1 627 gene locus_tag LOCUS_20910 <1 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528445.1:ABC transporter ATP-binding protein 627 1337 gene locus_tag LOCUS_20920 627 1337 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528446.1 protein_id gnl|my_center|LOCUS_20920 >Feature sequence0657 133 57 gene locus_tag LOCUS_t00270 133 57 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0658 1071 613 gene locus_tag LOCUS_20930 1071 613 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928801.1 protein_id gnl|my_center|LOCUS_20930 >Feature sequence0659 1078 212 gene locus_tag LOCUS_20940 gene metF 1078 212 CDS product 5,10-methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971608.1 protein_id gnl|my_center|LOCUS_20940 >Feature sequence0660 396 1037 gene locus_tag LOCUS_20950 396 1037 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634004.1 protein_id gnl|my_center|LOCUS_20950 >Feature sequence0661 193 363 gene locus_tag LOCUS_20960 193 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20960 732 397 gene locus_tag LOCUS_20970 732 397 CDS product antitoxin HicB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530441.1 protein_id gnl|my_center|LOCUS_20970 983 729 gene locus_tag LOCUS_20980 983 729 CDS product hexulose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680062.1 protein_id gnl|my_center|LOCUS_20980 <1667 1122 gene locus_tag LOCUS_20990 <1667 1122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005477167.1:MFS transporter >Feature sequence0662 <1665 1012 gene locus_tag LOCUS_21000 <1665 1012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528247.1:peptidase S15 >Feature sequence0663 <1 753 gene locus_tag LOCUS_21010 <1 753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931500.1:haloacid dehalogenase 1321 1545 gene locus_tag LOCUS_21020 1321 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21020 >Feature sequence0664 <1 558 gene locus_tag LOCUS_21030 <1 558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390231.1:ATPase/protein kinase 867 607 gene locus_tag LOCUS_21040 867 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 1227 877 gene locus_tag LOCUS_21050 1227 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 1541 1338 gene locus_tag LOCUS_21060 1541 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 >Feature sequence0665 820 1476 gene locus_tag LOCUS_21070 820 1476 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056926.1 protein_id gnl|my_center|LOCUS_21070 >Feature sequence0666 <1649 240 gene locus_tag LOCUS_21080 <1649 240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532328.1:N-methylproline demethylase >Feature sequence0667 1451 669 gene locus_tag LOCUS_21090 1451 669 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847037.1 protein_id gnl|my_center|LOCUS_21090 >Feature sequence0668 296 1024 gene locus_tag LOCUS_21100 296 1024 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963513.1 protein_id gnl|my_center|LOCUS_21100 >Feature sequence0669 <1 1411 gene locus_tag LOCUS_21110 <1 1411 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002851467.1:type I restriction endonuclease subunit M >Feature sequence0670 403 1203 gene locus_tag LOCUS_21120 403 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 >Feature sequence0671 1109 222 gene locus_tag LOCUS_21130 1109 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082086.1 protein_id gnl|my_center|LOCUS_21130 >Feature sequence0672 418 125 gene locus_tag LOCUS_21140 418 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 954 559 gene locus_tag LOCUS_21150 954 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 1202 951 gene locus_tag LOCUS_21160 1202 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 >Feature sequence0673 >Feature sequence0674 269 1435 gene locus_tag LOCUS_21170 269 1435 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947750.1 protein_id gnl|my_center|LOCUS_21170 >Feature sequence0675 >Feature sequence0676 923 513 gene locus_tag LOCUS_21180 923 513 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074029.1 protein_id gnl|my_center|LOCUS_21180 <1627 1010 gene locus_tag LOCUS_21190 <1627 1010 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261519.1:acyltransferase >Feature sequence0677 68 460 gene locus_tag LOCUS_21200 68 460 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146517.1 protein_id gnl|my_center|LOCUS_21200 >Feature sequence0678 <1 985 gene locus_tag LOCUS_21210 <1 985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104133.1:tartrate dehydrogenase >Feature sequence0679 1096 179 gene locus_tag LOCUS_21220 1096 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 1440 1135 gene locus_tag LOCUS_21230 1440 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 >Feature sequence0680 497 1438 gene locus_tag LOCUS_21240 497 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21240 >Feature sequence0681 <1 957 gene locus_tag LOCUS_21250 <1 957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090391.1:adenylate cyclase >Feature sequence0682 <1618 1012 gene locus_tag LOCUS_21260 <1618 1012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532911.1:aminomethyltransferase >Feature sequence0683 <1 776 gene locus_tag LOCUS_21270 <1 776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S2V3:o-succinylbenzoate synthase >Feature sequence0684 1314 376 gene locus_tag LOCUS_21280 1314 376 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530883.1 protein_id gnl|my_center|LOCUS_21280 >Feature sequence0685 >Feature sequence0686 830 1606 gene locus_tag LOCUS_21290 830 1606 CDS product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038826.1 protein_id gnl|my_center|LOCUS_21290 >Feature sequence0687 888 49 gene locus_tag LOCUS_21300 888 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 1376 1062 gene locus_tag LOCUS_21310 1376 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 >Feature sequence0688 <1 614 gene locus_tag LOCUS_21320 <1 614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546592.1:nitrate reductase note possible pseudo, internal stop codon 621 1421 gene locus_tag LOCUS_21330 621 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21330 >Feature sequence0689 <1 928 gene locus_tag LOCUS_21340 <1 928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531219.1:succinyl-diaminopimelate desuccinylase <1612 1055 gene locus_tag LOCUS_21350 <1612 1055 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74DZ3:putative lipid II flippase MurJ >Feature sequence0690 3 1127 gene locus_tag LOCUS_21360 3 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 >Feature sequence0691 919 302 gene locus_tag LOCUS_21370 gene sdhC 919 302 CDS product succinate dehydrogenase cytochrome b558 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P08064 protein_id gnl|my_center|LOCUS_21370 1341 1072 gene locus_tag LOCUS_21380 gene rpsT 1341 1072 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AU4 protein_id gnl|my_center|LOCUS_21380 >Feature sequence0692 73 1023 gene locus_tag LOCUS_21390 73 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 >Feature sequence0693 1253 267 gene locus_tag LOCUS_21400 1253 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 >Feature sequence0694 <1 1027 gene locus_tag LOCUS_21410 <1 1027 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775991.1:glycine cleavage system protein T >Feature sequence0695 476 709 gene locus_tag LOCUS_21420 476 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 1596 796 gene locus_tag LOCUS_21430 1596 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 >Feature sequence0696 352 534 gene locus_tag LOCUS_21440 352 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 684 1184 gene locus_tag LOCUS_21450 684 1184 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532199.1 protein_id gnl|my_center|LOCUS_21450 >Feature sequence0697 1176 499 gene locus_tag LOCUS_21460 1176 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 >Feature sequence0698 893 282 gene locus_tag LOCUS_21470 893 282 CDS product electron transporter SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256468.1 protein_id gnl|my_center|LOCUS_21470 >Feature sequence0699 1386 295 gene locus_tag LOCUS_21480 1386 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143046.1 protein_id gnl|my_center|LOCUS_21480 >Feature sequence0700 453 902 gene locus_tag LOCUS_21490 453 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 >Feature sequence0701 <1 572 gene locus_tag LOCUS_21500 <1 572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404681.1:TIGR00159 family protein 572 1486 gene locus_tag LOCUS_21510 572 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 >Feature sequence0702 823 41 gene locus_tag LOCUS_21520 gene kynA 823 41 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DG95 protein_id gnl|my_center|LOCUS_21520 >Feature sequence0703 <1 846 gene locus_tag LOCUS_21530 <1 846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933893.1:Hdr menaquinol oxidoreductase integral membrane subunit >Feature sequence0704 >Feature sequence0705 783 163 gene locus_tag LOCUS_21540 783 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 1392 790 gene locus_tag LOCUS_21550 1392 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 >Feature sequence0706 484 50 gene locus_tag LOCUS_21560 484 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 760 1257 gene locus_tag LOCUS_21570 760 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 >Feature sequence0707 244 44 gene locus_tag LOCUS_21580 244 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 1503 472 gene locus_tag LOCUS_21590 1503 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 >Feature sequence0708 1281 991 gene locus_tag LOCUS_21600 gene soxD2 1281 991 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707982.1 protein_id gnl|my_center|LOCUS_21600 >Feature sequence0709 <1 1153 gene locus_tag LOCUS_21610 <1 1153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107156.1:thiol:disulfide interchange protein DsbD >Feature sequence0710 <1 604 gene locus_tag LOCUS_21620 <1 604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947377.1:3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) 648 1541 gene locus_tag LOCUS_21630 gene iolE 648 1541 CDS product inosose dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HIK1 protein_id gnl|my_center|LOCUS_21630 >Feature sequence0711 1185 16 gene locus_tag LOCUS_21640 1185 16 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108005.1 protein_id gnl|my_center|LOCUS_21640 >Feature sequence0712 <1 725 gene locus_tag LOCUS_21650 <1 725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P71063:putative acetyltransferase EpsM 815 1063 gene locus_tag LOCUS_21660 815 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392155.1 protein_id gnl|my_center|LOCUS_21660 1074 1346 gene locus_tag LOCUS_21670 1074 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 >Feature sequence0713 <1539 574 gene locus_tag LOCUS_21680 <1539 574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003811061.1:membrane protein >Feature sequence0714 <1 546 gene locus_tag LOCUS_21690 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002666509.1:cob(I)alamin adenosyltransferase/cobinamide ATP-dependent adenosyltransferase >Feature sequence0715 1009 299 gene locus_tag LOCUS_21700 1009 299 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256517.1 protein_id gnl|my_center|LOCUS_21700 >Feature sequence0716 1466 486 gene locus_tag LOCUS_21710 gene rluD 1466 486 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H11 protein_id gnl|my_center|LOCUS_21710 >Feature sequence0717 <1 717 gene locus_tag LOCUS_21720 <1 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010929970.1:membrane protein >Feature sequence0718 >Feature sequence0719 >Feature sequence0720 856 203 gene locus_tag LOCUS_21730 gene rnhB 856 203 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MF1 protein_id gnl|my_center|LOCUS_21730 1172 804 gene locus_tag LOCUS_21740 gene rplS 1172 804 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJV3 protein_id gnl|my_center|LOCUS_21740 >Feature sequence0721 995 483 gene locus_tag LOCUS_21750 995 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 >Feature sequence0722 400 1419 gene locus_tag LOCUS_21760 gene rihB2 400 1419 CDS product ribosylpyrimidine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113476.1 protein_id gnl|my_center|LOCUS_21760 >Feature sequence0723 <1 925 gene locus_tag LOCUS_21770 <1 925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942903.1:UDP-N-acetylglucosamine 3-dehydrogenase >Feature sequence0724 963 142 gene locus_tag LOCUS_21780 963 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142942.1 protein_id gnl|my_center|LOCUS_21780 1485 1255 gene locus_tag LOCUS_21790 1485 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 >Feature sequence0725 >Feature sequence0726 >Feature sequence0727 1142 624 gene locus_tag LOCUS_21800 1142 624 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021795.1 protein_id gnl|my_center|LOCUS_21800 >Feature sequence0728 18 443 gene locus_tag LOCUS_21810 18 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 >Feature sequence0729 764 1156 gene locus_tag LOCUS_21820 764 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 >Feature sequence0730 <1475 846 gene locus_tag LOCUS_21830 <1475 846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256682.1:peptide ABC transporter permease >Feature sequence0731 1139 885 gene locus_tag LOCUS_21840 1139 885 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881572.1 protein_id gnl|my_center|LOCUS_21840 >Feature sequence0732 <1 763 gene locus_tag LOCUS_21850 <1 763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975825.1:putative 2-aminoethylphosphonate ABC transporter substrate-binding protein >Feature sequence0733 >Feature sequence0734 >Feature sequence0735 >Feature sequence0736 1385 198 gene locus_tag LOCUS_21860 gene dacF 1385 198 CDS product D-alanyl-D-alanine carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38422 protein_id gnl|my_center|LOCUS_21860 >Feature sequence0737 <1464 562 gene locus_tag LOCUS_21870 <1464 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000125226.1:serine protease >Feature sequence0738 523 825 gene locus_tag LOCUS_21880 gene yczJ 523 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31484 protein_id gnl|my_center|LOCUS_21880 911 1222 gene locus_tag LOCUS_21890 911 1222 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204343.1 protein_id gnl|my_center|LOCUS_21890 >Feature sequence0739 >Feature sequence0740 155 577 gene locus_tag LOCUS_21900 155 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942956.1 protein_id gnl|my_center|LOCUS_21900 783 580 gene locus_tag LOCUS_21910 783 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 >Feature sequence0741 183 908 gene locus_tag LOCUS_21920 183 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 >Feature sequence0742 >Feature sequence0743 28 888 gene locus_tag LOCUS_21930 28 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 >Feature sequence0744 193 50 gene locus_tag LOCUS_21940 193 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 700 275 gene locus_tag LOCUS_21950 700 275 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404325.1 protein_id gnl|my_center|LOCUS_21950 930 697 gene locus_tag LOCUS_21960 930 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 >Feature sequence0745 916 92 gene locus_tag LOCUS_21970 916 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 >Feature sequence0746 >Feature sequence0747 1104 1274 gene locus_tag LOCUS_21980 1104 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 >Feature sequence0748 <1 706 gene locus_tag LOCUS_21990 <1 706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970355.1:ABC transporter ATP-binding protein >Feature sequence0749 1329 1201 gene locus_tag LOCUS_22000 1329 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 >Feature sequence0750 268 582 gene locus_tag LOCUS_22010 268 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 692 1042 gene locus_tag LOCUS_22020 692 1042 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201974.1 protein_id gnl|my_center|LOCUS_22020 1042 1317 gene locus_tag LOCUS_22030 1042 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 >Feature sequence0751 <1 616 gene locus_tag LOCUS_22040 <1 616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337856.1:GntR family transcriptional regulator <1444 747 gene locus_tag LOCUS_22050 <1444 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KLX6:peptide methionine sulfoxide reductase MsrA/MsrB >Feature sequence0752 <1439 377 gene locus_tag LOCUS_22060 <1439 377 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8RDU4:histidine ammonia-lyase 2 >Feature sequence0753 >Feature sequence0754 467 688 gene locus_tag LOCUS_22070 467 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 716 961 gene locus_tag LOCUS_22080 716 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 >Feature sequence0755 196 1170 gene locus_tag LOCUS_22090 196 1170 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112640.1 protein_id gnl|my_center|LOCUS_22090 >Feature sequence0756 1005 358 gene locus_tag LOCUS_22100 1005 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 >Feature sequence0757 771 463 gene locus_tag LOCUS_22110 771 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 1007 1237 gene locus_tag LOCUS_22120 1007 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 1239 1388 gene locus_tag LOCUS_22130 1239 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 >Feature sequence0758 <1421 80 gene locus_tag LOCUS_22140 <1421 80 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015886700.1:guanylyl cyclase >Feature sequence0759 <1 849 gene locus_tag LOCUS_22150 <1 849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963606.1:type I deoxyribonuclease HsdR 1057 827 gene locus_tag LOCUS_22160 1057 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 >Feature sequence0760 1197 244 gene locus_tag LOCUS_22170 1197 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 >Feature sequence0761 343 1176 gene locus_tag LOCUS_22180 343 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 >Feature sequence0762 <1408 764 gene locus_tag LOCUS_22190 <1408 764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DVX9:glutamate--tRNA ligase >Feature sequence0763 >Feature sequence0764 <1404 609 gene locus_tag LOCUS_22200 <1404 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706889.1:beta-hexosaminidase >Feature sequence0765 1213 605 gene locus_tag LOCUS_22210 1213 605 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269399.1 protein_id gnl|my_center|LOCUS_22210 1400 1263 gene locus_tag LOCUS_22220 1400 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 >Feature sequence0766 >Feature sequence0767 1323 802 gene locus_tag LOCUS_22230 1323 802 CDS product phosphinothricin N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990112.1 protein_id gnl|my_center|LOCUS_22230 >Feature sequence0768 195 485 gene locus_tag LOCUS_22240 195 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 594 1343 gene locus_tag LOCUS_22250 594 1343 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108548.1 protein_id gnl|my_center|LOCUS_22250 >Feature sequence0769 >Feature sequence0770 <1393 808 gene locus_tag LOCUS_22260 <1393 808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003818550.1:isocitrate lyase >Feature sequence0771 <1 825 gene locus_tag LOCUS_22270 <1 825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222287.1:alcohol dehydrogenase >Feature sequence0772 >Feature sequence0773 >Feature sequence0774 715 1209 gene locus_tag LOCUS_22280 715 1209 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461289.1 protein_id gnl|my_center|LOCUS_22280 >Feature sequence0775 >Feature sequence0776 <1384 540 gene locus_tag LOCUS_22290 <1384 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946683.1:2-oxoglutarate ferredoxin oxidoreductase subunit beta >Feature sequence0777 299 1213 gene locus_tag LOCUS_22300 299 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 >Feature sequence0778 <1383 181 gene locus_tag LOCUS_22310 <1383 181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974597.1:peptide ABC transporter substrate-binding protein >Feature sequence0779 >Feature sequence0780 >Feature sequence0781 <1 668 gene locus_tag LOCUS_22320 <1 668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336960.1:creatinase 1231 875 gene locus_tag LOCUS_22330 1231 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 >Feature sequence0782 >Feature sequence0783 <1375 124 gene locus_tag LOCUS_22340 <1375 124 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971781.1:NAD(P)(+) transhydrogenase >Feature sequence0784 >Feature sequence0785 <1 709 gene locus_tag LOCUS_22350 <1 709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012775595.1:CoA-disulfide reductase >Feature sequence0786 <1366 754 gene locus_tag LOCUS_22360 <1366 754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5DYU2:peptidoglycan lytic exotransglycosylase >Feature sequence0787 >Feature sequence0788 >Feature sequence0789 >Feature sequence0790 182 1252 gene locus_tag LOCUS_22370 182 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 >Feature sequence0791 814 1311 gene locus_tag LOCUS_22380 814 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 >Feature sequence0792 >Feature sequence0793 >Feature sequence0794 <1 733 gene locus_tag LOCUS_22390 <1 733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003016692.1:cyanophycinase >Feature sequence0795 322 657 gene locus_tag LOCUS_22400 322 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 >Feature sequence0796 >Feature sequence0797 393 872 gene locus_tag LOCUS_22410 393 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 >Feature sequence0798 82 255 gene locus_tag LOCUS_22420 82 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 230 775 gene locus_tag LOCUS_22430 230 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 >Feature sequence0799 837 406 gene locus_tag LOCUS_22440 837 406 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391721.1 protein_id gnl|my_center|LOCUS_22440 1045 827 gene locus_tag LOCUS_22450 1045 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 >Feature sequence0800 <1325 600 gene locus_tag LOCUS_22460 <1325 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938381.1:3'-exoribonuclease >Feature sequence0801 <1 689 gene locus_tag LOCUS_22470 <1 689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545647.1:indolepyruvate oxidoreductase >Feature sequence0802 >Feature sequence0803 >Feature sequence0804 <1 662 gene locus_tag LOCUS_22480 <1 662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003808671.1:FAD-dependent oxidoreductase 655 951 gene locus_tag LOCUS_22490 655 951 CDS product sarcosine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886767.1 protein_id gnl|my_center|LOCUS_22490 >Feature sequence0805 1198 14 gene locus_tag LOCUS_22500 1198 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 >Feature sequence0806 >Feature sequence0807 <1 941 gene locus_tag LOCUS_22510 <1 941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015886962.1:adenylate class-3/4/guanylyl cyclase >Feature sequence0808 >Feature sequence0809 444 169 gene locus_tag LOCUS_22520 444 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932501.1 protein_id gnl|my_center|LOCUS_22520 <1307 542 gene locus_tag LOCUS_22530 <1307 542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021142.1:cation transporter >Feature sequence0810 550 885 gene locus_tag LOCUS_22540 550 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 882 1181 gene locus_tag LOCUS_22550 882 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 >Feature sequence0811 >Feature sequence0812 556 104 gene locus_tag LOCUS_22560 556 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 >Feature sequence0813 >Feature sequence0814 <1 701 gene locus_tag LOCUS_22570 <1 701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7ND43:prolipoprotein diacylglyceryl transferase >Feature sequence0815 <1300 294 gene locus_tag LOCUS_22580 <1300 294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970271.1:oxidoreductase >Feature sequence0816 <1 595 gene locus_tag LOCUS_22590 <1 595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933651.1:cysteine desulfurase 592 849 gene locus_tag LOCUS_22600 592 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 >Feature sequence0817 466 251 gene locus_tag LOCUS_22610 466 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 >Feature sequence0818 243 1100 gene locus_tag LOCUS_22620 gene ugpE 243 1100 CDS product sn-glycerol-3-phosphate transport system permease protein UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UB30 protein_id gnl|my_center|LOCUS_22620 >Feature sequence0819 >Feature sequence0820 >Feature sequence0821 >Feature sequence0822 <1 640 gene locus_tag LOCUS_22630 <1 640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003436463.1:amidohydrolase >Feature sequence0823 <1290 195 gene locus_tag LOCUS_22640 <1290 195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9WYU5:nicotinate phosphoribosyltransferase >Feature sequence0824 126 998 gene locus_tag LOCUS_22650 126 998 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067123.1 protein_id gnl|my_center|LOCUS_22650 >Feature sequence0825 887 300 gene locus_tag LOCUS_22660 887 300 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943032.1 protein_id gnl|my_center|LOCUS_22660 1206 997 gene locus_tag LOCUS_22670 1206 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 >Feature sequence0826 962 204 gene locus_tag LOCUS_22680 962 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 >Feature sequence0827 >Feature sequence0828 808 461 gene locus_tag LOCUS_22690 808 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 1071 901 gene locus_tag LOCUS_22700 1071 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 >Feature sequence0829 696 328 gene locus_tag LOCUS_22710 696 328 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810206.1 protein_id gnl|my_center|LOCUS_22710 >Feature sequence0830 918 469 gene locus_tag LOCUS_22720 gene osmC 918 469 CDS product redox protein OsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033743.1 protein_id gnl|my_center|LOCUS_22720 >Feature sequence0831 >Feature sequence0832 671 294 gene locus_tag LOCUS_22730 671 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 >Feature sequence0833 >Feature sequence0834 >Feature sequence0835 636 91 gene locus_tag LOCUS_22740 636 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 >Feature sequence0836 >Feature sequence0837 >Feature sequence0838 >Feature sequence0839 >Feature sequence0840 >Feature sequence0841 1266 409 gene locus_tag LOCUS_22750 1266 409 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532920.1 protein_id gnl|my_center|LOCUS_22750 >Feature sequence0842 >Feature sequence0843 383 643 gene locus_tag LOCUS_22760 383 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 634 1029 gene locus_tag LOCUS_22770 634 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 >Feature sequence0844 321 560 gene locus_tag LOCUS_22780 321 560 CDS product iron transporter FeoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390222.1 protein_id gnl|my_center|LOCUS_22780 >Feature sequence0845 <1 884 gene locus_tag LOCUS_22790 <1 884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029259.1:3-hydroxyacyl-CoA dehydrogenase >Feature sequence0846 <1261 302 gene locus_tag LOCUS_22800 <1261 302 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000564921.1:biotin carboxylase >Feature sequence0847 <1258 342 gene locus_tag LOCUS_22810 <1258 342 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YJ65:GTPase Obg >Feature sequence0848 <1254 603 gene locus_tag LOCUS_22820 <1254 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003115022.1:short-chain dehydrogenase >Feature sequence0849 >Feature sequence0850 <1251 495 gene locus_tag LOCUS_22830 <1251 495 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532967.1:GntR family transcriptional regulator >Feature sequence0851 <1 926 gene locus_tag LOCUS_22840 <1 926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875867.1:aspartate aminotransferase family protein >Feature sequence0852 661 14 gene locus_tag LOCUS_22850 661 14 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262921.1 protein_id gnl|my_center|LOCUS_22850 >Feature sequence0853 <1 722 gene locus_tag LOCUS_22860 <1 722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003811151.1:2-methylcitrate dehydratase >Feature sequence0854 >Feature sequence0855 1066 242 gene locus_tag LOCUS_22870 1066 242 CDS product xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528449.1 protein_id gnl|my_center|LOCUS_22870 >Feature sequence0856 >Feature sequence0857 3 353 gene locus_tag LOCUS_22880 3 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 915 619 gene locus_tag LOCUS_22890 915 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 >Feature sequence0858 <1 1155 gene locus_tag LOCUS_22900 <1 1155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013399688.1:ATPase >Feature sequence0859 >Feature sequence0860 <1243 463 gene locus_tag LOCUS_22910 <1243 463 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388811.1:NAD(P)H quinone oxidoreductase >Feature sequence0861 >Feature sequence0862 255 887 gene locus_tag LOCUS_22920 255 887 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707260.1 protein_id gnl|my_center|LOCUS_22920 >Feature sequence0863 905 576 gene locus_tag LOCUS_22930 905 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 >Feature sequence0864 >Feature sequence0865 <1 957 gene locus_tag LOCUS_22940 <1 957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3EJU4:DNA ligase >Feature sequence0866 <1 681 gene locus_tag LOCUS_22950 <1 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787585.1:phosphatidylinositol-4-phosphate 5-kinase >Feature sequence0867 1229 774 gene locus_tag LOCUS_22960 1229 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 >Feature sequence0868 >Feature sequence0869 366 1025 gene locus_tag LOCUS_22970 366 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 >Feature sequence0870 >Feature sequence0871 >Feature sequence0872 867 298 gene locus_tag LOCUS_22980 867 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 >Feature sequence0873 >Feature sequence0874 1220 114 gene locus_tag LOCUS_22990 1220 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 >Feature sequence0875 >Feature sequence0876 1051 677 gene locus_tag LOCUS_tm00010 1051 677 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0877 <1215 305 gene locus_tag LOCUS_23000 <1215 305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532099.1:aspartate aminotransferase family protein >Feature sequence0878 376 1056 gene locus_tag LOCUS_23010 376 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 >Feature sequence0879 <1 766 gene locus_tag LOCUS_23020 <1 766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012707214.1:C4-dicarboxylate ABC transporter permease >Feature sequence0880 77 328 gene locus_tag LOCUS_23030 77 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 318 545 gene locus_tag LOCUS_23040 318 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23040 546 695 gene locus_tag LOCUS_23050 546 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23050 >Feature sequence0881 3 263 gene locus_tag LOCUS_23060 3 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 >Feature sequence0882 <1 800 gene locus_tag LOCUS_23070 <1 800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002720081.1:ABC transporter ATP-binding protein >Feature sequence0883 695 135 gene locus_tag LOCUS_23080 695 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 >Feature sequence0884 >Feature sequence0885 <1 861 gene locus_tag LOCUS_23090 <1 861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121146.1:cytochrome c554 >Feature sequence0886 524 216 gene locus_tag LOCUS_23100 524 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 727 521 gene locus_tag LOCUS_23110 727 521 CDS product addiction module antitoxin RelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932270.1 protein_id gnl|my_center|LOCUS_23110 >Feature sequence0887 56 436 gene locus_tag LOCUS_23120 gene crcB 56 436 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61389 protein_id gnl|my_center|LOCUS_23120 860 462 gene locus_tag LOCUS_23130 860 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 >Feature sequence0888 <1192 404 gene locus_tag LOCUS_23140 <1192 404 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963631.1:permease >Feature sequence0889 >Feature sequence0890 >Feature sequence0891 >Feature sequence0892 >Feature sequence0893 >Feature sequence0894 1128 610 gene locus_tag LOCUS_23150 1128 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 >Feature sequence0895 <1185 375 gene locus_tag LOCUS_23160 <1185 375 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q749X3:queuine tRNA-ribosyltransferase >Feature sequence0896 >Feature sequence0897 <1 781 gene locus_tag LOCUS_23170 <1 781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389828.1:O-acetylhomoserine/O-acetylserine sulfhydrylase >Feature sequence0898 <1181 399 gene locus_tag LOCUS_23180 <1181 399 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546111.1:heterodisulfide reductase subunit A >Feature sequence0899 >Feature sequence0900 >Feature sequence0901 702 836 gene locus_tag LOCUS_23190 702 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 >Feature sequence0902 <1 933 gene locus_tag LOCUS_23200 <1 933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004190656.1:sulfurtransferase >Feature sequence0903 <1 546 gene locus_tag LOCUS_23210 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015888014.1:ABC transporter ATP-binding protein >Feature sequence0904 <1 537 gene locus_tag LOCUS_23220 <1 537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057647.1:phosphotyrosine protein phosphatase >Feature sequence0905 >Feature sequence0906 <1162 137 gene locus_tag LOCUS_23230 <1162 137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003527786.1:5-dehydro-2-deoxygluconokinase >Feature sequence0907 309 31 gene locus_tag LOCUS_23240 309 31 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245507.1 protein_id gnl|my_center|LOCUS_23240 616 302 gene locus_tag LOCUS_23250 616 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811545.1 protein_id gnl|my_center|LOCUS_23250 >Feature sequence0908 >Feature sequence0909 <1 648 gene locus_tag LOCUS_23260 <1 648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971233.1:ABC transporter substrate-binding protein >Feature sequence0910 >Feature sequence0911 490 221 gene locus_tag LOCUS_23270 490 221 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349637.1 protein_id gnl|my_center|LOCUS_23270 >Feature sequence0912 >Feature sequence0913 <1150 192 gene locus_tag LOCUS_23280 <1150 192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706869.1:bifunctional molybdopterin-guanine dinucleotide biosynthesis protein MobB/molybdopterin molybdotransferase MoeA >Feature sequence0914 >Feature sequence0915 975 76 gene locus_tag LOCUS_23290 975 76 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535539.1 protein_id gnl|my_center|LOCUS_23290 >Feature sequence0916 <1 828 gene locus_tag LOCUS_23300 <1 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010438666.1:4-hydroxyphenylpyruvate dioxygenase >Feature sequence0917 <1147 482 gene locus_tag LOCUS_23310 <1147 482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533046.1:calcium-binding protein >Feature sequence0918 >Feature sequence0919 <1146 322 gene locus_tag LOCUS_23320 <1146 322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974599.1:ABC transporter permease >Feature sequence0920 >Feature sequence0921 310 627 gene locus_tag LOCUS_23330 310 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 >Feature sequence0922 287 565 gene locus_tag LOCUS_23340 287 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605676.1 protein_id gnl|my_center|LOCUS_23340 580 894 gene locus_tag LOCUS_23350 580 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 >Feature sequence0923 >Feature sequence0924 >Feature sequence0925 <1 568 gene locus_tag LOCUS_23360 <1 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528563.1:hydantoinase >Feature sequence0926 <1136 417 gene locus_tag LOCUS_23370 <1136 417 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9CFX9:N-acetylglucosamine-6-phosphate deacetylase >Feature sequence0927 1051 227 gene locus_tag LOCUS_23380 1051 227 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527980.1 protein_id gnl|my_center|LOCUS_23380 >Feature sequence0928 >Feature sequence0929 >Feature sequence0930 <1 670 gene locus_tag LOCUS_23390 <1 670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941906.1:lipoprotein >Feature sequence0931 <1 549 gene locus_tag LOCUS_23400 <1 549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q749I1:glycerol kinase 810 1082 gene locus_tag LOCUS_23410 810 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679831.1 protein_id gnl|my_center|LOCUS_23410 >Feature sequence0932 473 742 gene locus_tag LOCUS_23420 473 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 >Feature sequence0933 >Feature sequence0934 >Feature sequence0935 73 318 gene locus_tag LOCUS_23430 73 318 CDS product cell division protein DedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768750.1 protein_id gnl|my_center|LOCUS_23430 >Feature sequence0936 >Feature sequence0937 >Feature sequence0938 >Feature sequence0939 >Feature sequence0940 >Feature sequence0941 <1115 425 gene locus_tag LOCUS_23440 <1115 425 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P00497:amidophosphoribosyltransferase >Feature sequence0942 <1113 506 gene locus_tag LOCUS_23450 <1113 506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012708595.1:ABC transporter ATP-binding protein >Feature sequence0943 293 51 gene locus_tag LOCUS_23460 293 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 800 489 gene locus_tag LOCUS_23470 800 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 >Feature sequence0944 <1112 351 gene locus_tag LOCUS_23480 <1112 351 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533037.1:aspartate aminotransferase family protein >Feature sequence0945 >Feature sequence0946 385 849 gene locus_tag LOCUS_23490 385 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 >Feature sequence0947 <1109 247 gene locus_tag LOCUS_23500 <1109 247 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8TIE1:imidazolonepropionase >Feature sequence0948 126 887 gene locus_tag LOCUS_23510 126 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 >Feature sequence0949 1106 531 gene locus_tag LOCUS_23520 1106 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 >Feature sequence0950 347 111 gene locus_tag LOCUS_23530 347 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 >Feature sequence0951 <1 964 gene locus_tag LOCUS_23540 <1 964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392902.1:dimethyl sulfoxide reductase subunit A >Feature sequence0952 100 357 gene locus_tag LOCUS_23550 100 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 350 742 gene locus_tag LOCUS_23560 350 742 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002684748.1 protein_id gnl|my_center|LOCUS_23560 >Feature sequence0953 >Feature sequence0954 >Feature sequence0955 >Feature sequence0956 >Feature sequence0957 504 232 gene locus_tag LOCUS_23570 504 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 873 1022 gene locus_tag LOCUS_23580 873 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 >Feature sequence0958 <1 580 gene locus_tag LOCUS_23590 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014538174.1:type I restriction endonuclease >Feature sequence0959 <1094 388 gene locus_tag LOCUS_23600 <1094 388 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q746Q2:membrane protein insertase YidC >Feature sequence0960 >Feature sequence0961 >Feature sequence0962 >Feature sequence0963 >Feature sequence0964 360 620 gene locus_tag LOCUS_23610 360 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808730.1 protein_id gnl|my_center|LOCUS_23610 632 874 gene locus_tag LOCUS_23620 632 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 >Feature sequence0965 >Feature sequence0966 345 824 gene locus_tag LOCUS_23630 345 824 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459082.1 protein_id gnl|my_center|LOCUS_23630 >Feature sequence0967 <1083 388 gene locus_tag LOCUS_23640 <1083 388 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262157.1:histidine/lysine/arginine/ornithine ABC transporter ATP-binding protein HisP >Feature sequence0968 711 325 gene locus_tag LOCUS_23650 711 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 >Feature sequence0969 <1 860 gene locus_tag LOCUS_23660 <1 860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267555.1:type III glutamate--ammonia ligase >Feature sequence0970 <1078 192 gene locus_tag LOCUS_23670 <1078 192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971758.1:dimethylglycine dehydrogenase >Feature sequence0971 >Feature sequence0972 811 380 gene locus_tag LOCUS_23680 gene ndk 811 380 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UGB6 protein_id gnl|my_center|LOCUS_23680 >Feature sequence0973 >Feature sequence0974 <1 884 gene locus_tag LOCUS_23690 <1 884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YHC2:UDP-3-O-acylglucosamine N-acyltransferase >Feature sequence0975 <1 801 gene locus_tag LOCUS_23700 <1 801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071136.1:quinol dehydrogenase ferredoxin subunit NapH >Feature sequence0976 >Feature sequence0977 >Feature sequence0978 >Feature sequence0979 >Feature sequence0980 >Feature sequence0981 >Feature sequence0982 646 305 gene locus_tag LOCUS_23710 646 305 CDS product potassium-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140100.1 protein_id gnl|my_center|LOCUS_23710 895 647 gene locus_tag LOCUS_23720 895 647 CDS product multidrug transporter MatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887061.1 protein_id gnl|my_center|LOCUS_23720 >Feature sequence0983 <1061 11 gene locus_tag LOCUS_23730 <1061 11 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0R730:glycerol-3-phosphate dehydrogenase >Feature sequence0984 >Feature sequence0985 2 355 gene locus_tag LOCUS_23740 2 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 >Feature sequence0986 >Feature sequence0987 >Feature sequence0988 <1056 492 gene locus_tag LOCUS_23750 <1056 492 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013527999.1:methyltransferase >Feature sequence0989 930 742 gene locus_tag LOCUS_23760 930 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 >Feature sequence0990 >Feature sequence0991 >Feature sequence0992 7 83 gene locus_tag LOCUS_t00280 7 83 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 171 245 gene locus_tag LOCUS_t00290 171 245 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 <1046 500 gene locus_tag LOCUS_23770 <1046 500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973446.1:oxidoreductase >Feature sequence0993 >Feature sequence0994 >Feature sequence0995 <1 942 gene locus_tag LOCUS_23780 <1 942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760938.1:membrane protein >Feature sequence0996 >Feature sequence0997 <1043 211 gene locus_tag LOCUS_23790 <1043 211 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q818X6:riboflavin biosynthesis protein RibBA >Feature sequence0998 >Feature sequence0999 <1042 308 gene locus_tag LOCUS_23800 <1042 308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086016.1:ABC transporter ATP-binding protein >Feature sequence1000 >Feature sequence1001 250 897 gene locus_tag LOCUS_23810 250 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 >Feature sequence1002 <1 770 gene locus_tag LOCUS_23820 <1 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459459.1:alanine dehydrogenase >Feature sequence1003 <1 672 gene locus_tag LOCUS_23830 <1 672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140793.1:adenosine kinase >Feature sequence1004 >Feature sequence1005 >Feature sequence1006 <1 575 gene locus_tag LOCUS_23840 <1 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085104.1:NADH-quinone oxidoreductase subunit F note possible pseudo, frameshifted 581 793 gene locus_tag LOCUS_23850 581 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23850 >Feature sequence1007 <1033 326 gene locus_tag LOCUS_23860 <1033 326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085758.1:dehydratase >Feature sequence1008 >Feature sequence1009 586 1002 gene locus_tag LOCUS_23870 586 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 >Feature sequence1010 559 203 gene locus_tag LOCUS_23880 559 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 >Feature sequence1011 304 546 gene locus_tag LOCUS_23890 304 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 536 868 gene locus_tag LOCUS_23900 536 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 >Feature sequence1012 >Feature sequence1013 <1 735 gene locus_tag LOCUS_23910 <1 735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DKY2:glucose-6-phosphate isomerase >Feature sequence1014 133 603 gene locus_tag LOCUS_23920 133 603 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_23920 >Feature sequence1015 >Feature sequence1016 >Feature sequence1017 >Feature sequence1018 <1 921 gene locus_tag LOCUS_23930 <1 921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WJ72:GDP-mannose 4,6-dehydratase >Feature sequence1019 >Feature sequence1020 958 800 gene locus_tag LOCUS_23940 958 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 >Feature sequence1021 >Feature sequence1022 >Feature sequence1023 <1021 148 gene locus_tag LOCUS_23950 <1021 148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZNZ8:protein translocase subunit SecA >Feature sequence1024 >Feature sequence1025 >Feature sequence1026 >Feature sequence1027 >Feature sequence1028 >Feature sequence1029 <1 889 gene locus_tag LOCUS_23960 <1 889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943853.1:ribonuclease G >Feature sequence1030 >Feature sequence1031 839 914 gene locus_tag LOCUS_t00300 839 914 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1032 >Feature sequence1033 >Feature sequence1034 <1007 502 gene locus_tag LOCUS_23970 <1007 502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530355.1:DNA-3-methyladenine glycosylase I >Feature sequence1035 >Feature sequence1036 >Feature sequence1037 >Feature sequence1038