>Feature sequence0001 2162 756 gene locus_tag LOCUS_00010 2162 756 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767922.1 protein_id gnl|my_center|LOCUS_00010 4767 2224 gene locus_tag LOCUS_00020 4767 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 6235 4802 gene locus_tag LOCUS_00030 6235 4802 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 protein_id gnl|my_center|LOCUS_00030 9486 6247 gene locus_tag LOCUS_00040 9486 6247 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_00040 10992 9496 gene locus_tag LOCUS_00050 10992 9496 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92U88 protein_id gnl|my_center|LOCUS_00050 12324 11071 gene locus_tag LOCUS_00060 gene exuT 12324 11071 CDS product hexuronate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039188.1 protein_id gnl|my_center|LOCUS_00060 12739 12494 gene locus_tag LOCUS_00070 12739 12494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 14392 13025 gene locus_tag LOCUS_00080 14392 13025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 16697 15690 gene locus_tag LOCUS_00090 16697 15690 CDS product conjugative transposon protein TraN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202372.1 protein_id gnl|my_center|LOCUS_00090 18114 16690 gene locus_tag LOCUS_00100 18114 16690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 18971 18354 gene locus_tag LOCUS_00110 18971 18354 CDS product conjugative transposon protein TraK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108381.1 protein_id gnl|my_center|LOCUS_00110 19180 18968 gene locus_tag LOCUS_00120 19180 18968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 20368 19202 gene locus_tag LOCUS_00130 20368 19202 CDS product conjugative transposon protein TraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291518.1 protein_id gnl|my_center|LOCUS_00130 21552 20365 gene locus_tag LOCUS_00140 21552 20365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 24177 21643 gene locus_tag LOCUS_00150 24177 21643 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107104.1 protein_id gnl|my_center|LOCUS_00150 24512 24174 gene locus_tag LOCUS_00160 24512 24174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291514.1 protein_id gnl|my_center|LOCUS_00160 24959 24522 gene locus_tag LOCUS_00170 24959 24522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 25336 24971 gene locus_tag LOCUS_00180 25336 24971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 25668 25345 gene locus_tag LOCUS_00190 25668 25345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 26441 25728 gene locus_tag LOCUS_00200 26441 25728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 27011 26451 gene locus_tag LOCUS_00210 27011 26451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 27742 27008 gene locus_tag LOCUS_00220 27742 27008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 >Feature sequence0002 <1 2228 gene locus_tag LOCUS_00230 <1 2228 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767197.1:glycosyl hydrolase family 43 2275 5220 gene locus_tag LOCUS_00240 2275 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 5217 5936 gene locus_tag LOCUS_00250 5217 5936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118034.1 protein_id gnl|my_center|LOCUS_00250 6707 5943 gene locus_tag LOCUS_00260 6707 5943 CDS product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002194085.1 protein_id gnl|my_center|LOCUS_00260 6796 6978 gene locus_tag LOCUS_00270 6796 6978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 7249 8046 gene locus_tag LOCUS_00280 7249 8046 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362994.1 protein_id gnl|my_center|LOCUS_00280 8030 9319 gene locus_tag LOCUS_00290 8030 9319 CDS product hexuronate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918872.1 protein_id gnl|my_center|LOCUS_00290 9331 10203 gene locus_tag LOCUS_00300 9331 10203 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117794.1 protein_id gnl|my_center|LOCUS_00300 10238 10747 gene locus_tag LOCUS_00310 gene rpiB 10238 10747 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880713.1 protein_id gnl|my_center|LOCUS_00310 10992 14003 gene locus_tag LOCUS_00320 10992 14003 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_00320 14025 15551 gene locus_tag LOCUS_00330 14025 15551 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_00330 15564 16553 gene locus_tag LOCUS_00340 15564 16553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 16572 17444 gene locus_tag LOCUS_00350 16572 17444 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767385.1 protein_id gnl|my_center|LOCUS_00350 17481 17690 gene locus_tag LOCUS_00360 17481 17690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 19769 18366 gene locus_tag LOCUS_00370 19769 18366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 20581 19781 gene locus_tag LOCUS_00380 20581 19781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 21576 20578 gene locus_tag LOCUS_00390 21576 20578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 21930 22724 gene locus_tag LOCUS_00400 21930 22724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 22728 22973 gene locus_tag LOCUS_00410 22728 22973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 23423 23878 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggtccatccccacctgtgtagggaaaac >Feature sequence0003 <1 1282 gene locus_tag LOCUS_00420 <1 1282 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941985.1:RND transporter 1287 2486 gene locus_tag LOCUS_00430 1287 2486 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941985.1 protein_id gnl|my_center|LOCUS_00430 2528 3124 gene locus_tag LOCUS_00440 2528 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 3254 4738 gene locus_tag LOCUS_00450 3254 4738 CDS product bilirubin oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256867.1 protein_id gnl|my_center|LOCUS_00450 4768 5838 gene locus_tag LOCUS_00460 4768 5838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 6260 6018 gene locus_tag LOCUS_00470 6260 6018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 6726 9092 gene locus_tag LOCUS_00480 6726 9092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 9181 9453 gene locus_tag LOCUS_00490 9181 9453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 9549 10163 gene locus_tag LOCUS_00500 9549 10163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 10173 10724 gene locus_tag LOCUS_00510 10173 10724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 10839 12902 gene locus_tag LOCUS_00520 10839 12902 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877664.1 protein_id gnl|my_center|LOCUS_00520 12908 13465 gene locus_tag LOCUS_00530 12908 13465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 protein_id gnl|my_center|LOCUS_00530 13643 14062 gene locus_tag LOCUS_00540 13643 14062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296181.1 protein_id gnl|my_center|LOCUS_00540 14204 14851 gene locus_tag LOCUS_00550 14204 14851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 16238 14892 gene locus_tag LOCUS_00560 16238 14892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082551.1 protein_id gnl|my_center|LOCUS_00560 16646 16314 gene locus_tag LOCUS_00570 16646 16314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 17284 16661 gene locus_tag LOCUS_00580 17284 16661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 17884 17519 gene locus_tag LOCUS_00590 17884 17519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 19158 18565 gene locus_tag LOCUS_00600 19158 18565 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783481.1 protein_id gnl|my_center|LOCUS_00600 19363 19776 gene locus_tag LOCUS_00610 19363 19776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 20295 19906 gene locus_tag LOCUS_00620 20295 19906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 20770 21501 gene locus_tag LOCUS_00630 20770 21501 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948152.1 protein_id gnl|my_center|LOCUS_00630 >Feature sequence0004 <1 1073 gene locus_tag LOCUS_00640 <1 1073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089203.1:esterase 1226 3370 gene locus_tag LOCUS_00650 1226 3370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 3761 4216 gene locus_tag LOCUS_00660 3761 4216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 4216 4689 gene locus_tag LOCUS_00670 4216 4689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 4770 5756 gene locus_tag LOCUS_00680 4770 5756 CDS product aldehyde oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088295.1 protein_id gnl|my_center|LOCUS_00680 5778 6395 gene locus_tag LOCUS_00690 5778 6395 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582689.1 protein_id gnl|my_center|LOCUS_00690 6587 7702 gene locus_tag LOCUS_00700 6587 7702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211252.1 protein_id gnl|my_center|LOCUS_00700 7692 8786 gene locus_tag LOCUS_00710 7692 8786 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975037.1 protein_id gnl|my_center|LOCUS_00710 8967 10088 gene locus_tag LOCUS_00720 8967 10088 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859695.1 protein_id gnl|my_center|LOCUS_00720 10165 10848 gene locus_tag LOCUS_00730 10165 10848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366897.1 protein_id gnl|my_center|LOCUS_00730 10888 11367 gene locus_tag LOCUS_00740 10888 11367 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930808.1 protein_id gnl|my_center|LOCUS_00740 13114 11681 gene locus_tag LOCUS_00750 13114 11681 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963081.1 protein_id gnl|my_center|LOCUS_00750 16310 13107 gene locus_tag LOCUS_00760 16310 13107 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963080.1 protein_id gnl|my_center|LOCUS_00760 17424 16339 gene locus_tag LOCUS_00770 17424 16339 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963079.1 protein_id gnl|my_center|LOCUS_00770 17823 17527 gene locus_tag LOCUS_00780 17823 17527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 18138 18470 gene locus_tag LOCUS_00790 18138 18470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 18467 18931 gene locus_tag LOCUS_00800 18467 18931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 20552 19188 gene locus_tag LOCUS_00810 20552 19188 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765778.1 protein_id gnl|my_center|LOCUS_00810 21290 20619 gene locus_tag LOCUS_00820 21290 20619 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783816.1 protein_id gnl|my_center|LOCUS_00820 <22570 21740 gene locus_tag LOCUS_00830 <22570 21740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005822162.1:IS110 family transposase >Feature sequence0005 1494 2699 gene locus_tag LOCUS_00840 gene rbsR 1494 2699 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860719.1 protein_id gnl|my_center|LOCUS_00840 3326 2709 gene locus_tag LOCUS_00850 3326 2709 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392680.1 protein_id gnl|my_center|LOCUS_00850 3547 4938 gene locus_tag LOCUS_00860 gene pepA 3547 4938 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD74 protein_id gnl|my_center|LOCUS_00860 5186 4947 gene locus_tag LOCUS_00870 5186 4947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 5103 6260 gene locus_tag LOCUS_00880 5103 6260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 6397 6852 gene locus_tag LOCUS_00890 6397 6852 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065697.1 protein_id gnl|my_center|LOCUS_00890 7557 7084 gene locus_tag LOCUS_00900 7557 7084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 8148 7657 gene locus_tag LOCUS_00910 8148 7657 CDS product damage-inducible protein CinA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206459.1 protein_id gnl|my_center|LOCUS_00910 8341 9108 gene locus_tag LOCUS_00920 8341 9108 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069704.1 protein_id gnl|my_center|LOCUS_00920 10016 9189 gene locus_tag LOCUS_00930 10016 9189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 13033 10064 gene locus_tag LOCUS_00940 13033 10064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 13344 13520 gene locus_tag LOCUS_00950 13344 13520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 15592 13526 gene locus_tag LOCUS_00960 15592 13526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405130.1 protein_id gnl|my_center|LOCUS_00960 15924 16472 gene locus_tag LOCUS_00970 15924 16472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 16575 18863 gene locus_tag LOCUS_00980 gene pepX1 16575 18863 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_00980 19005 19919 gene locus_tag LOCUS_00990 19005 19919 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257720.1 protein_id gnl|my_center|LOCUS_00990 19998 20519 gene locus_tag LOCUS_01000 19998 20519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391482.1 protein_id gnl|my_center|LOCUS_01000 20521 20982 gene locus_tag LOCUS_01010 20521 20982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266690.1 protein_id gnl|my_center|LOCUS_01010 >Feature sequence0006 <1 1181 gene locus_tag LOCUS_01020 <1 1181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947368.1:acylaminoacyl-peptidase 1309 1752 gene locus_tag LOCUS_01030 1309 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 2033 2842 gene locus_tag LOCUS_01040 2033 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 2862 4364 gene locus_tag LOCUS_01050 2862 4364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 4568 4389 gene locus_tag LOCUS_01060 4568 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 6611 4608 gene locus_tag LOCUS_01070 6611 4608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 8966 6726 gene locus_tag LOCUS_01080 8966 6726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 9410 10903 gene locus_tag LOCUS_01090 9410 10903 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964214.1 protein_id gnl|my_center|LOCUS_01090 11014 12375 gene locus_tag LOCUS_01100 11014 12375 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_01100 12850 12512 gene locus_tag LOCUS_01110 12850 12512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538054.1 protein_id gnl|my_center|LOCUS_01110 13085 14092 gene locus_tag LOCUS_01120 gene gpsA 13085 14092 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY6 protein_id gnl|my_center|LOCUS_01120 14161 15762 gene locus_tag LOCUS_01130 gene pckA2 14161 15762 CDS product phosphoenolpyruvate carboxykinase [ATP] 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S008 protein_id gnl|my_center|LOCUS_01130 18165 15880 gene locus_tag LOCUS_01140 18165 15880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 20280 18259 gene locus_tag LOCUS_01150 20280 18259 CDS product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080425.1 protein_id gnl|my_center|LOCUS_01150 >Feature sequence0007 2259 1282 gene locus_tag LOCUS_01160 2259 1282 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230695.1 protein_id gnl|my_center|LOCUS_01160 2924 2436 gene locus_tag LOCUS_01170 gene folK 2924 2436 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545434.1 protein_id gnl|my_center|LOCUS_01170 3141 5285 gene locus_tag LOCUS_01180 3141 5285 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108019.1 protein_id gnl|my_center|LOCUS_01180 5352 5567 gene locus_tag LOCUS_01190 5352 5567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 5570 5989 gene locus_tag LOCUS_01200 5570 5989 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392184.1 protein_id gnl|my_center|LOCUS_01200 6106 6306 gene locus_tag LOCUS_01210 6106 6306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 6303 6575 gene locus_tag LOCUS_01220 6303 6575 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870423.1 protein_id gnl|my_center|LOCUS_01220 6686 8434 gene locus_tag LOCUS_01230 gene egl2 6686 8434 CDS product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H9L4N3 protein_id gnl|my_center|LOCUS_01230 8507 8746 gene locus_tag LOCUS_01240 8507 8746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 8852 9838 gene locus_tag LOCUS_01250 8852 9838 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968596.1 protein_id gnl|my_center|LOCUS_01250 10258 9965 gene locus_tag LOCUS_01260 10258 9965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 10491 10255 gene locus_tag LOCUS_01270 10491 10255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 10651 11742 gene locus_tag LOCUS_01280 10651 11742 CDS product glucose-fructose oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640182.1 protein_id gnl|my_center|LOCUS_01280 12185 11784 gene locus_tag LOCUS_01290 12185 11784 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249840.1 protein_id gnl|my_center|LOCUS_01290 12388 12182 gene locus_tag LOCUS_01300 12388 12182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 13986 12559 gene locus_tag LOCUS_01310 13986 12559 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865120.1 protein_id gnl|my_center|LOCUS_01310 14772 14077 gene locus_tag LOCUS_01320 14772 14077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 15208 14900 gene locus_tag LOCUS_01330 15208 14900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 16182 15310 gene locus_tag LOCUS_01340 16182 15310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 16389 17759 gene locus_tag LOCUS_01350 16389 17759 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730651.1 protein_id gnl|my_center|LOCUS_01350 17763 18779 gene locus_tag LOCUS_01360 17763 18779 CDS product cytochrome D ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897013.1 protein_id gnl|my_center|LOCUS_01360 >Feature sequence0008 3172 29 gene locus_tag LOCUS_01370 3172 29 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_01370 3697 4875 gene locus_tag LOCUS_01380 3697 4875 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963526.1 protein_id gnl|my_center|LOCUS_01380 5057 5746 gene locus_tag LOCUS_01390 5057 5746 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963527.1 protein_id gnl|my_center|LOCUS_01390 6347 5802 gene locus_tag LOCUS_01400 6347 5802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 7404 6508 gene locus_tag LOCUS_01410 7404 6508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 8331 7453 gene locus_tag LOCUS_01420 8331 7453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 8620 9477 gene locus_tag LOCUS_01430 8620 9477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 10293 11687 gene locus_tag LOCUS_01440 10293 11687 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879805.1 protein_id gnl|my_center|LOCUS_01440 11724 13040 gene locus_tag LOCUS_01450 11724 13040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 12997 13155 gene locus_tag LOCUS_01460 12997 13155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 13174 13302 gene locus_tag LOCUS_01470 13174 13302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 13569 13811 gene locus_tag LOCUS_01480 13569 13811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 13820 14176 gene locus_tag LOCUS_01490 13820 14176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 17282 14235 gene locus_tag LOCUS_01500 gene sbcC 17282 14235 CDS product nuclease SbcCD subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FSI6 protein_id gnl|my_center|LOCUS_01500 18509 17307 gene locus_tag LOCUS_01510 gene sbcD 18509 17307 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MA98 protein_id gnl|my_center|LOCUS_01510 >Feature sequence0009 1800 3848 gene locus_tag LOCUS_01520 1800 3848 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640121.1 protein_id gnl|my_center|LOCUS_01520 3862 4245 gene locus_tag LOCUS_01530 gene ywkD 3862 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45871 protein_id gnl|my_center|LOCUS_01530 5768 4248 gene locus_tag LOCUS_01540 5768 4248 CDS product glycosyl transferase family 39 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729148.1 protein_id gnl|my_center|LOCUS_01540 6121 7308 gene locus_tag LOCUS_01550 6121 7308 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123368.1 protein_id gnl|my_center|LOCUS_01550 8767 7367 gene locus_tag LOCUS_01560 8767 7367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108194.1 protein_id gnl|my_center|LOCUS_01560 12001 8795 gene locus_tag LOCUS_01570 12001 8795 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108195.1 protein_id gnl|my_center|LOCUS_01570 13066 12272 gene locus_tag LOCUS_01580 13066 12272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 13318 13130 gene locus_tag LOCUS_01590 13318 13130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 14991 13609 gene locus_tag LOCUS_01600 14991 13609 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765778.1 protein_id gnl|my_center|LOCUS_01600 15674 14988 gene locus_tag LOCUS_01610 15674 14988 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783816.1 protein_id gnl|my_center|LOCUS_01610 15979 17628 gene locus_tag LOCUS_01620 gene pgi 15979 17628 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JRV9 protein_id gnl|my_center|LOCUS_01620 17851 18048 gene locus_tag LOCUS_01630 17851 18048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 18080 18601 gene locus_tag LOCUS_01640 18080 18601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 >Feature sequence0010 1401 2123 gene locus_tag LOCUS_01650 1401 2123 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768051.1 protein_id gnl|my_center|LOCUS_01650 2737 4008 gene locus_tag LOCUS_01660 2737 4008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 4319 6382 gene locus_tag LOCUS_01670 4319 6382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 6419 6916 gene locus_tag LOCUS_01680 6419 6916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 7031 7894 gene locus_tag LOCUS_01690 7031 7894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 7927 8970 gene locus_tag LOCUS_01700 7927 8970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 9040 9351 gene locus_tag LOCUS_01710 9040 9351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 9373 11064 gene locus_tag LOCUS_01720 9373 11064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 11186 11407 gene locus_tag LOCUS_01730 11186 11407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 12181 11567 gene locus_tag LOCUS_01740 12181 11567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 12963 12259 gene locus_tag LOCUS_01750 12963 12259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 13366 14778 gene locus_tag LOCUS_01760 13366 14778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 14822 15271 gene locus_tag LOCUS_01770 14822 15271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 15531 15298 gene locus_tag LOCUS_01780 15531 15298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 15606 16223 gene locus_tag LOCUS_01790 15606 16223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 16350 16838 gene locus_tag LOCUS_01800 16350 16838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 17397 16945 gene locus_tag LOCUS_01810 17397 16945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 18388 17513 gene locus_tag LOCUS_01820 18388 17513 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442783.1 protein_id gnl|my_center|LOCUS_01820 >Feature sequence0011 814 662 gene locus_tag LOCUS_01830 814 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 1096 914 gene locus_tag LOCUS_01840 gene rpmG 1096 914 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI5 protein_id gnl|my_center|LOCUS_01840 1415 1963 gene locus_tag LOCUS_01850 1415 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 3303 2026 gene locus_tag LOCUS_01860 gene fucP 3303 2026 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120628.1 protein_id gnl|my_center|LOCUS_01860 3454 4707 gene locus_tag LOCUS_01870 gene nuoD 3454 4707 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEC0 protein_id gnl|my_center|LOCUS_01870 5787 4777 gene locus_tag LOCUS_01880 gene asd 5787 4777 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX07 protein_id gnl|my_center|LOCUS_01880 6474 5884 gene locus_tag LOCUS_01890 6474 5884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 8158 6611 gene locus_tag LOCUS_01900 gene bshC 8158 6611 CDS product putative cysteine ligase BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG1 protein_id gnl|my_center|LOCUS_01900 10258 8444 gene locus_tag LOCUS_01910 10258 8444 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963836.1 protein_id gnl|my_center|LOCUS_01910 11218 10400 gene locus_tag LOCUS_01920 11218 10400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 14633 11760 gene locus_tag LOCUS_01930 14633 11760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 15936 14803 gene locus_tag LOCUS_01940 15936 14803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 16937 15933 gene locus_tag LOCUS_01950 16937 15933 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259594.1 protein_id gnl|my_center|LOCUS_01950 18218 17040 gene locus_tag LOCUS_01960 18218 17040 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 protein_id gnl|my_center|LOCUS_01960 >Feature sequence0012 <1 622 gene locus_tag LOCUS_01970 <1 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962550.1:cytochrome-c oxidase 795 1619 gene locus_tag LOCUS_01980 795 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 2134 2547 gene locus_tag LOCUS_01990 2134 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 2659 3144 gene locus_tag LOCUS_02000 gene ctaE 2659 3144 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964206.1 protein_id gnl|my_center|LOCUS_02000 3160 3930 gene locus_tag LOCUS_02010 3160 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 3954 4277 gene locus_tag LOCUS_02020 3954 4277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 4282 4935 gene locus_tag LOCUS_02030 4282 4935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 4939 5478 gene locus_tag LOCUS_02040 4939 5478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 5505 5759 gene locus_tag LOCUS_02050 5505 5759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 6626 5817 gene locus_tag LOCUS_02060 gene murI 6626 5817 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFY7 protein_id gnl|my_center|LOCUS_02060 6812 7402 gene locus_tag LOCUS_02070 6812 7402 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_02070 7383 8198 gene locus_tag LOCUS_02080 7383 8198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 8210 9361 gene locus_tag LOCUS_02090 8210 9361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 9526 9611 gene locus_tag LOCUS_t00010 9526 9611 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 9620 9693 gene locus_tag LOCUS_t00020 9620 9693 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 9846 9918 gene locus_tag LOCUS_t00030 9846 9918 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 10170 11357 gene locus_tag LOCUS_02100 gene tuf 10170 11357 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A463 protein_id gnl|my_center|LOCUS_02100 11472 11543 gene locus_tag LOCUS_t00040 11472 11543 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 11561 11752 gene locus_tag LOCUS_02110 11561 11752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 11790 12344 gene locus_tag LOCUS_02120 gene nusG 11790 12344 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A464 protein_id gnl|my_center|LOCUS_02120 12421 12870 gene locus_tag LOCUS_02130 gene rplK 12421 12870 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A465 protein_id gnl|my_center|LOCUS_02130 12903 13601 gene locus_tag LOCUS_02140 gene rplA 12903 13601 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A466 protein_id gnl|my_center|LOCUS_02140 13604 14137 gene locus_tag LOCUS_02150 13604 14137 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791518.1 protein_id gnl|my_center|LOCUS_02150 14238 14621 gene locus_tag LOCUS_02160 gene rplL 14238 14621 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU1 protein_id gnl|my_center|LOCUS_02160 >Feature sequence0013 1075 374 gene locus_tag LOCUS_02170 1075 374 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933740.1 protein_id gnl|my_center|LOCUS_02170 2805 1087 gene locus_tag LOCUS_02180 2805 1087 CDS product sodium-coupled permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227769.1 protein_id gnl|my_center|LOCUS_02180 3559 2843 gene locus_tag LOCUS_02190 3559 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 5240 3582 gene locus_tag LOCUS_02200 5240 3582 CDS product exo-poly-alpha-D-galacturonosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226064.1 protein_id gnl|my_center|LOCUS_02200 6789 5287 gene locus_tag LOCUS_02210 6789 5287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 7969 6806 gene locus_tag LOCUS_02220 7969 6806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 9428 7977 gene locus_tag LOCUS_02230 9428 7977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 11582 9444 gene locus_tag LOCUS_02240 11582 9444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 13149 11596 gene locus_tag LOCUS_02250 13149 11596 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865120.1 protein_id gnl|my_center|LOCUS_02250 14381 13146 gene locus_tag LOCUS_02260 14381 13146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 16352 14889 gene locus_tag LOCUS_02270 gene phoD 16352 14889 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117733.1 protein_id gnl|my_center|LOCUS_02270 18228 16573 gene locus_tag LOCUS_02280 18228 16573 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108167.1 protein_id gnl|my_center|LOCUS_02280 >Feature sequence0014 1369 506 gene locus_tag LOCUS_02290 1369 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963647.1 protein_id gnl|my_center|LOCUS_02290 2172 1372 gene locus_tag LOCUS_02300 2172 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963648.1 protein_id gnl|my_center|LOCUS_02300 2552 3457 gene locus_tag LOCUS_02310 2552 3457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 3883 4353 gene locus_tag LOCUS_02320 3883 4353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 4364 5938 gene locus_tag LOCUS_02330 4364 5938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 6125 9409 gene locus_tag LOCUS_02340 6125 9409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02340 9563 10135 gene locus_tag LOCUS_02350 9563 10135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 10142 11119 gene locus_tag LOCUS_02360 10142 11119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 11305 11586 gene locus_tag LOCUS_02370 11305 11586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 12034 13035 gene locus_tag LOCUS_02380 12034 13035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02380 14679 13273 gene locus_tag LOCUS_02390 14679 13273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140647.1 protein_id gnl|my_center|LOCUS_02390 15105 14881 gene locus_tag LOCUS_02400 15105 14881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 15396 15109 gene locus_tag LOCUS_02410 15396 15109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 15770 15420 gene locus_tag LOCUS_02420 15770 15420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 16764 16027 gene locus_tag LOCUS_02430 16764 16027 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941733.1 protein_id gnl|my_center|LOCUS_02430 17623 16853 gene locus_tag LOCUS_02440 gene kduD1 17623 16853 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210830.1 protein_id gnl|my_center|LOCUS_02440 >Feature sequence0015 813 1763 gene locus_tag LOCUS_02450 813 1763 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525333.1 protein_id gnl|my_center|LOCUS_02450 2113 2736 gene locus_tag LOCUS_02460 2113 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 3635 3432 gene locus_tag LOCUS_02470 3635 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 4453 5181 gene locus_tag LOCUS_02480 4453 5181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 5253 5786 gene locus_tag LOCUS_02490 5253 5786 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085781.1 protein_id gnl|my_center|LOCUS_02490 6377 7603 gene locus_tag LOCUS_02500 6377 7603 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919382.1 protein_id gnl|my_center|LOCUS_02500 8491 7619 gene locus_tag LOCUS_02510 8491 7619 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767385.1 protein_id gnl|my_center|LOCUS_02510 10264 8609 gene locus_tag LOCUS_02520 10264 8609 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108167.1 protein_id gnl|my_center|LOCUS_02520 13294 10274 gene locus_tag LOCUS_02530 13294 10274 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_02530 14753 13365 gene locus_tag LOCUS_02540 14753 13365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 15628 15152 gene locus_tag LOCUS_02550 gene rpiB 15628 15152 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880713.1 protein_id gnl|my_center|LOCUS_02550 16492 15632 gene locus_tag LOCUS_02560 16492 15632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYP7 protein_id gnl|my_center|LOCUS_02560 17285 16497 gene locus_tag LOCUS_02570 17285 16497 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362994.1 protein_id gnl|my_center|LOCUS_02570 <18198 17685 gene locus_tag LOCUS_02580 <18198 17685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108889.1:membrane protein >Feature sequence0016 2222 1089 gene locus_tag LOCUS_02590 gene tgt 2222 1089 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX92 protein_id gnl|my_center|LOCUS_02590 2333 3466 gene locus_tag LOCUS_02600 2333 3466 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963583.1 protein_id gnl|my_center|LOCUS_02600 3485 4123 gene locus_tag LOCUS_02610 gene rsmG 3485 4123 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ2 protein_id gnl|my_center|LOCUS_02610 4172 4453 gene locus_tag LOCUS_02620 4172 4453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 4584 4658 gene locus_tag LOCUS_t00050 4584 4658 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 4820 6136 gene locus_tag LOCUS_02630 4820 6136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 6454 7428 gene locus_tag LOCUS_02640 6454 7428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 7488 9749 gene locus_tag LOCUS_02650 7488 9749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 12286 9836 gene locus_tag LOCUS_02660 gene nrdA 12286 9836 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU5 protein_id gnl|my_center|LOCUS_02660 12917 13162 gene locus_tag LOCUS_02670 gene rpmE2 12917 13162 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5U9 protein_id gnl|my_center|LOCUS_02670 13277 14467 gene locus_tag LOCUS_02680 13277 14467 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_02680 14534 15661 gene locus_tag LOCUS_02690 14534 15661 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108989.1 protein_id gnl|my_center|LOCUS_02690 15658 16086 gene locus_tag LOCUS_02700 gene rimK2 15658 16086 CDS product ribosomal protein S6 modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261389.1 protein_id gnl|my_center|LOCUS_02700 16225 17127 gene locus_tag LOCUS_02710 gene rimK 16225 17127 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ2 protein_id gnl|my_center|LOCUS_02710 17219 18154 gene locus_tag LOCUS_02720 17219 18154 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460181.1 protein_id gnl|my_center|LOCUS_02720 >Feature sequence0017 2332 737 gene locus_tag LOCUS_02730 2332 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785422.1 protein_id gnl|my_center|LOCUS_02730 5567 2379 gene locus_tag LOCUS_02740 5567 2379 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203176.1 protein_id gnl|my_center|LOCUS_02740 5874 6086 gene locus_tag LOCUS_02750 5874 6086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 6228 7358 gene locus_tag LOCUS_02760 gene purK 6228 7358 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC2 protein_id gnl|my_center|LOCUS_02760 7489 7974 gene locus_tag LOCUS_02770 gene purE 7489 7974 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC3 protein_id gnl|my_center|LOCUS_02770 8042 8713 gene locus_tag LOCUS_02780 8042 8713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 8886 9299 gene locus_tag LOCUS_02790 8886 9299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 10179 9343 gene locus_tag LOCUS_02800 10179 9343 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 protein_id gnl|my_center|LOCUS_02800 11129 10359 gene locus_tag LOCUS_02810 11129 10359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 11203 11742 gene locus_tag LOCUS_02820 11203 11742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 11747 12274 gene locus_tag LOCUS_02830 11747 12274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 12380 12820 gene locus_tag LOCUS_02840 12380 12820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 15007 12827 gene locus_tag LOCUS_02850 15007 12827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 15326 15589 gene locus_tag LOCUS_02860 15326 15589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 16171 15677 gene locus_tag LOCUS_02870 16171 15677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 >Feature sequence0018 <1 1032 gene locus_tag LOCUS_02880 <1 1032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964071.1:FAD-dependent oxidoreductase 1118 4270 gene locus_tag LOCUS_02890 1118 4270 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405100.1 protein_id gnl|my_center|LOCUS_02890 5216 12955 gene locus_tag LOCUS_02900 5216 12955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 12960 13976 gene locus_tag LOCUS_02910 12960 13976 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_02910 14072 16483 gene locus_tag LOCUS_02920 14072 16483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 >Feature sequence0019 <1 661 gene locus_tag LOCUS_02930 <1 661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KJI2:ribulokinase 839 2326 gene locus_tag LOCUS_02940 gene araA 839 2326 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJI0 protein_id gnl|my_center|LOCUS_02940 2474 3172 gene locus_tag LOCUS_02950 2474 3172 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262722.1 protein_id gnl|my_center|LOCUS_02950 3197 3457 gene locus_tag LOCUS_02960 3197 3457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 4052 3699 gene locus_tag LOCUS_02970 4052 3699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 5803 4067 gene locus_tag LOCUS_02980 5803 4067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142469.1 protein_id gnl|my_center|LOCUS_02980 6275 6003 gene locus_tag LOCUS_02990 6275 6003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 7287 6361 gene locus_tag LOCUS_03000 7287 6361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 8946 7384 gene locus_tag LOCUS_03010 8946 7384 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037766.1 protein_id gnl|my_center|LOCUS_03010 9970 10179 gene locus_tag LOCUS_03020 9970 10179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 10295 11446 gene locus_tag LOCUS_03030 10295 11446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 12279 11458 gene locus_tag LOCUS_03040 12279 11458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 12492 15008 gene locus_tag LOCUS_03050 12492 15008 CDS product glycosyl hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109131.1 protein_id gnl|my_center|LOCUS_03050 15085 15630 gene locus_tag LOCUS_03060 15085 15630 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118797.1 protein_id gnl|my_center|LOCUS_03060 >Feature sequence0020 1328 804 gene locus_tag LOCUS_03070 1328 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 4128 1534 gene locus_tag LOCUS_03080 gene mutS 4128 1534 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MG7 protein_id gnl|my_center|LOCUS_03080 4615 5196 gene locus_tag LOCUS_03090 4615 5196 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785427.1 protein_id gnl|my_center|LOCUS_03090 5376 6422 gene locus_tag LOCUS_03100 5376 6422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 6721 10059 gene locus_tag LOCUS_03110 6721 10059 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_03110 10073 11569 gene locus_tag LOCUS_03120 10073 11569 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_03120 11851 14127 gene locus_tag LOCUS_03130 11851 14127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 >Feature sequence0021 <1 653 gene locus_tag LOCUS_03140 <1 653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460338.1:DNA mismatch repair protein 772 1323 gene locus_tag LOCUS_03150 772 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 1451 3556 gene locus_tag LOCUS_03160 1451 3556 CDS product glycosyl hydrolase family 31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767349.1 protein_id gnl|my_center|LOCUS_03160 3707 4978 gene locus_tag LOCUS_03170 3707 4978 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941411.1 protein_id gnl|my_center|LOCUS_03170 5762 8899 gene locus_tag LOCUS_03180 5762 8899 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766148.1 protein_id gnl|my_center|LOCUS_03180 8927 10462 gene locus_tag LOCUS_03190 8927 10462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403146.1 protein_id gnl|my_center|LOCUS_03190 10596 11951 gene locus_tag LOCUS_03200 gene RspA 10596 11951 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770856.1 protein_id gnl|my_center|LOCUS_03200 12066 13091 gene locus_tag LOCUS_03210 12066 13091 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976198.1 protein_id gnl|my_center|LOCUS_03210 13173 14414 gene locus_tag LOCUS_03220 13173 14414 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969235.1 protein_id gnl|my_center|LOCUS_03220 >Feature sequence0022 2205 997 gene locus_tag LOCUS_03230 2205 997 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_03230 2421 3614 gene locus_tag LOCUS_03240 2421 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 3659 4930 gene locus_tag LOCUS_03250 3659 4930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 4927 6174 gene locus_tag LOCUS_03260 4927 6174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 7551 6277 gene locus_tag LOCUS_03270 gene serS 7551 6277 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962253.1 protein_id gnl|my_center|LOCUS_03270 7910 7560 gene locus_tag LOCUS_03280 7910 7560 CDS product mRNA interferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NI95 protein_id gnl|my_center|LOCUS_03280 8100 7888 gene locus_tag LOCUS_03290 8100 7888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 9540 8173 gene locus_tag LOCUS_03300 9540 8173 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z9 protein_id gnl|my_center|LOCUS_03300 9853 9599 gene locus_tag LOCUS_03310 9853 9599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 10348 9869 gene locus_tag LOCUS_03320 gene ribH 10348 9869 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H143 protein_id gnl|my_center|LOCUS_03320 11161 10460 gene locus_tag LOCUS_03330 11161 10460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759931.1 protein_id gnl|my_center|LOCUS_03330 12392 11364 gene locus_tag LOCUS_03340 gene pdhA 12392 11364 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE5 protein_id gnl|my_center|LOCUS_03340 12584 13669 gene locus_tag LOCUS_03350 gene recF 12584 13669 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H141 protein_id gnl|my_center|LOCUS_03350 13897 14283 gene locus_tag LOCUS_03360 13897 14283 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729215.1 protein_id gnl|my_center|LOCUS_03360 >Feature sequence0023 123 911 gene locus_tag LOCUS_03370 123 911 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002082133.1 protein_id gnl|my_center|LOCUS_03370 986 1519 gene locus_tag LOCUS_03380 986 1519 CDS product putative metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HI24 protein_id gnl|my_center|LOCUS_03380 1738 4185 gene locus_tag LOCUS_03390 1738 4185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 4787 4179 gene locus_tag LOCUS_03400 4787 4179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 5314 6081 gene locus_tag LOCUS_03410 5314 6081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 6092 7507 gene locus_tag LOCUS_03420 6092 7507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 7849 8172 gene locus_tag LOCUS_03430 7849 8172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 8181 9779 gene locus_tag LOCUS_03440 8181 9779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 9855 10586 gene locus_tag LOCUS_03450 9855 10586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 11488 10583 gene locus_tag LOCUS_03460 11488 10583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 13141 11642 gene locus_tag LOCUS_03470 13141 11642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 13984 13166 gene locus_tag LOCUS_03480 13984 13166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 14358 13981 gene locus_tag LOCUS_03490 14358 13981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 14526 14813 gene locus_tag LOCUS_03500 14526 14813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 >Feature sequence0024 3059 1068 gene locus_tag LOCUS_03510 3059 1068 CDS product alpha-L-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107222.1 protein_id gnl|my_center|LOCUS_03510 4638 3154 gene locus_tag LOCUS_03520 4638 3154 CDS product endo-arabinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107221.1 protein_id gnl|my_center|LOCUS_03520 6266 4701 gene locus_tag LOCUS_03530 6266 4701 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767302.1 protein_id gnl|my_center|LOCUS_03530 9375 6313 gene locus_tag LOCUS_03540 9375 6313 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405543.1 protein_id gnl|my_center|LOCUS_03540 10329 9589 gene locus_tag LOCUS_03550 10329 9589 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_03550 10637 11749 gene locus_tag LOCUS_03560 10637 11749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 12295 11750 gene locus_tag LOCUS_03570 12295 11750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 12630 13946 gene locus_tag LOCUS_03580 12630 13946 CDS product organophopsphate acid anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729793.1 protein_id gnl|my_center|LOCUS_03580 >Feature sequence0025 <1 742 gene locus_tag LOCUS_03590 <1 742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203723.1:glycosyl transferase 1349 4453 gene locus_tag LOCUS_03600 1349 4453 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404908.1 protein_id gnl|my_center|LOCUS_03600 4491 5843 gene locus_tag LOCUS_03610 4491 5843 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_03610 6180 9149 gene locus_tag LOCUS_03620 6180 9149 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108758.1 protein_id gnl|my_center|LOCUS_03620 9190 10620 gene locus_tag LOCUS_03630 9190 10620 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107166.1 protein_id gnl|my_center|LOCUS_03630 10644 11459 gene locus_tag LOCUS_03640 10644 11459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 11473 12000 gene locus_tag LOCUS_03650 11473 12000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 12074 14443 gene locus_tag LOCUS_03660 12074 14443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 >Feature sequence0026 <1 870 gene locus_tag LOCUS_03670 <1 870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142597.1:sorbosone dehydrogenase 1034 1864 gene locus_tag LOCUS_03680 1034 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 2049 3134 gene locus_tag LOCUS_03690 gene corA-1 2049 3134 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DB7 protein_id gnl|my_center|LOCUS_03690 3181 5667 gene locus_tag LOCUS_03700 gene mur/alr 3181 5667 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963209.1 protein_id gnl|my_center|LOCUS_03700 7259 5769 gene locus_tag LOCUS_03710 gene glyS 7259 5769 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2A9 protein_id gnl|my_center|LOCUS_03710 7591 8565 gene locus_tag LOCUS_03720 7591 8565 CDS product competence protein ComEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108917.1 protein_id gnl|my_center|LOCUS_03720 9362 8586 gene locus_tag LOCUS_03730 9362 8586 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX2 protein_id gnl|my_center|LOCUS_03730 9494 9925 gene locus_tag LOCUS_03740 9494 9925 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786501.1 protein_id gnl|my_center|LOCUS_03740 11331 9922 gene locus_tag LOCUS_03750 11331 9922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 11506 11889 gene locus_tag LOCUS_03760 11506 11889 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791944.1 protein_id gnl|my_center|LOCUS_03760 11908 13137 gene locus_tag LOCUS_03770 11908 13137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402810.1 protein_id gnl|my_center|LOCUS_03770 >Feature sequence0027 623 204 gene locus_tag LOCUS_03780 623 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 1016 636 gene locus_tag LOCUS_03790 gene groES-2 1016 636 CDS product chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932256.1 protein_id gnl|my_center|LOCUS_03790 2741 1272 gene locus_tag LOCUS_03800 2741 1272 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_03800 3693 2731 gene locus_tag LOCUS_03810 3693 2731 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170714.1 protein_id gnl|my_center|LOCUS_03810 5477 3762 gene locus_tag LOCUS_03820 5477 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 6900 5461 gene locus_tag LOCUS_03830 6900 5461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 7828 6893 gene locus_tag LOCUS_03840 gene ykcG 7828 6893 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905676.1 protein_id gnl|my_center|LOCUS_03840 8852 7956 gene locus_tag LOCUS_03850 8852 7956 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962773.1 protein_id gnl|my_center|LOCUS_03850 9931 8849 gene locus_tag LOCUS_03860 9931 8849 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761518.1 protein_id gnl|my_center|LOCUS_03860 10651 9947 gene locus_tag LOCUS_03870 gene sirR 10651 9947 CDS product iron-dependent repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_03870 10915 12855 gene locus_tag LOCUS_03880 gene kup 10915 12855 CDS product putative potassium transport system protein kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXA1 protein_id gnl|my_center|LOCUS_03880 13881 12928 gene locus_tag LOCUS_03890 13881 12928 CDS product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404019.1 protein_id gnl|my_center|LOCUS_03890 >Feature sequence0028 <1 572 gene locus_tag LOCUS_03900 <1 572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932241.1:RND transporter 682 1797 gene locus_tag LOCUS_03910 682 1797 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969385.1 protein_id gnl|my_center|LOCUS_03910 1854 2225 gene locus_tag LOCUS_03920 1854 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_03920 2290 3540 gene locus_tag LOCUS_03930 gene lolC 2290 3540 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963073.1 protein_id gnl|my_center|LOCUS_03930 3588 4322 gene locus_tag LOCUS_03940 gene lolD 3588 4322 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY43 protein_id gnl|my_center|LOCUS_03940 4303 5352 gene locus_tag LOCUS_03950 4303 5352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03950 6816 5401 gene locus_tag LOCUS_03960 6816 5401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 9251 6987 gene locus_tag LOCUS_03970 9251 6987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 10351 9809 gene locus_tag LOCUS_03980 10351 9809 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403872.1 protein_id gnl|my_center|LOCUS_03980 10504 11274 gene locus_tag LOCUS_03990 10504 11274 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582685.1 protein_id gnl|my_center|LOCUS_03990 11884 11366 gene locus_tag LOCUS_04000 11884 11366 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963793.1 protein_id gnl|my_center|LOCUS_04000 12482 11910 gene locus_tag LOCUS_04010 12482 11910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889422.1 protein_id gnl|my_center|LOCUS_04010 13997 12591 gene locus_tag LOCUS_04020 13997 12591 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_04020 >Feature sequence0029 543 268 gene locus_tag LOCUS_04030 543 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 653 2101 gene locus_tag LOCUS_04040 653 2101 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963433.1 protein_id gnl|my_center|LOCUS_04040 2667 2338 gene locus_tag LOCUS_04050 gene ogt2 2667 2338 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_04050 3241 2654 gene locus_tag LOCUS_04060 3241 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_04060 5349 3265 gene locus_tag LOCUS_04070 5349 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 6079 5435 gene locus_tag LOCUS_04080 6079 5435 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_04080 7060 6197 gene locus_tag LOCUS_04090 gene rfbA 7060 6197 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C714 protein_id gnl|my_center|LOCUS_04090 8206 7151 gene locus_tag LOCUS_04100 gene rfbB 8206 7151 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFL8 protein_id gnl|my_center|LOCUS_04100 9230 8214 gene locus_tag LOCUS_04110 9230 8214 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788150.1 protein_id gnl|my_center|LOCUS_04110 9433 10284 gene locus_tag LOCUS_04120 9433 10284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 10871 10287 gene locus_tag LOCUS_04130 10871 10287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 10985 11887 gene locus_tag LOCUS_04140 10985 11887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 12037 13029 gene locus_tag LOCUS_04150 12037 13029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 13080 13430 gene locus_tag LOCUS_04160 gene folB 13080 13430 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H1 protein_id gnl|my_center|LOCUS_04160 >Feature sequence0030 1477 428 gene locus_tag LOCUS_04170 gene queA 1477 428 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650L7 protein_id gnl|my_center|LOCUS_04170 3203 1704 gene locus_tag LOCUS_04180 gene accC 3203 1704 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 protein_id gnl|my_center|LOCUS_04180 3474 4742 gene locus_tag LOCUS_04190 3474 4742 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_04190 5001 5180 gene locus_tag LOCUS_04200 5001 5180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 5678 5265 gene locus_tag LOCUS_04210 5678 5265 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706256.1 protein_id gnl|my_center|LOCUS_04210 5927 8311 gene locus_tag LOCUS_04220 5927 8311 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_04220 10122 8671 gene locus_tag LOCUS_04230 10122 8671 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816066.1 protein_id gnl|my_center|LOCUS_04230 10318 10995 gene locus_tag LOCUS_04240 10318 10995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 11072 12319 gene locus_tag LOCUS_04250 11072 12319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 12410 12805 gene locus_tag LOCUS_04260 12410 12805 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962274.1 protein_id gnl|my_center|LOCUS_04260 13909 12869 gene locus_tag LOCUS_04270 13909 12869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 >Feature sequence0031 806 973 gene locus_tag LOCUS_04280 806 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 1099 1947 gene locus_tag LOCUS_04290 1099 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948253.1 protein_id gnl|my_center|LOCUS_04290 2010 2486 gene locus_tag LOCUS_04300 2010 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 4349 2574 gene locus_tag LOCUS_04310 4349 2574 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031762.1 protein_id gnl|my_center|LOCUS_04310 4797 4985 gene locus_tag LOCUS_04320 4797 4985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 5188 8700 gene locus_tag LOCUS_04330 5188 8700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 9155 8712 gene locus_tag LOCUS_04340 9155 8712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 10033 9182 gene locus_tag LOCUS_04350 10033 9182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 11041 10082 gene locus_tag LOCUS_04360 11041 10082 CDS product glycosyl hydrolase family 43 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766598.1 protein_id gnl|my_center|LOCUS_04360 13117 11099 gene locus_tag LOCUS_04370 13117 11099 CDS product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814533.1 protein_id gnl|my_center|LOCUS_04370 >Feature sequence0032 705 127 gene locus_tag LOCUS_04380 705 127 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761748.1 protein_id gnl|my_center|LOCUS_04380 960 1697 gene locus_tag LOCUS_04390 960 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 2476 1700 gene locus_tag LOCUS_04400 2476 1700 CDS product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3E7 protein_id gnl|my_center|LOCUS_04400 2850 3500 gene locus_tag LOCUS_04410 2850 3500 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940928.1 protein_id gnl|my_center|LOCUS_04410 4612 3977 gene locus_tag LOCUS_04420 4612 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 5848 4811 gene locus_tag LOCUS_04430 5848 4811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 6034 5861 gene locus_tag LOCUS_04440 6034 5861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 6799 6080 gene locus_tag LOCUS_04450 6799 6080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 7581 6955 gene locus_tag LOCUS_04460 7581 6955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 7773 8876 gene locus_tag LOCUS_04470 gene mnmA 7773 8876 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZN9 protein_id gnl|my_center|LOCUS_04470 9004 9243 gene locus_tag LOCUS_04480 9004 9243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705505.1 protein_id gnl|my_center|LOCUS_04480 9582 10079 gene locus_tag LOCUS_04490 9582 10079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088607.1 protein_id gnl|my_center|LOCUS_04490 10703 10170 gene locus_tag LOCUS_04500 10703 10170 CDS product DNA damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963000.1 protein_id gnl|my_center|LOCUS_04500 12099 10798 gene locus_tag LOCUS_04510 12099 10798 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817866.1 protein_id gnl|my_center|LOCUS_04510 >Feature sequence0033 834 430 gene locus_tag LOCUS_04520 834 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269296.1 protein_id gnl|my_center|LOCUS_04520 1970 834 gene locus_tag LOCUS_04530 1970 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269295.1 protein_id gnl|my_center|LOCUS_04530 3324 2263 gene locus_tag LOCUS_04540 3324 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679442.1 protein_id gnl|my_center|LOCUS_04540 4502 3324 gene locus_tag LOCUS_04550 4502 3324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 4912 5511 gene locus_tag LOCUS_04560 4912 5511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 6077 5529 gene locus_tag LOCUS_04570 6077 5529 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_04570 11648 6204 gene locus_tag LOCUS_04580 11648 6204 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887375.1 protein_id gnl|my_center|LOCUS_04580 12252 11821 gene locus_tag LOCUS_04590 12252 11821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 12770 12336 gene locus_tag LOCUS_04600 12770 12336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 >Feature sequence0034 3557 2526 gene locus_tag LOCUS_04610 3557 2526 CDS product chalcone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404147.1 protein_id gnl|my_center|LOCUS_04610 3872 4687 gene locus_tag LOCUS_04620 3872 4687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 4801 4876 gene locus_tag LOCUS_t00060 4801 4876 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4952 5038 gene locus_tag LOCUS_t00070 4952 5038 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6686 5157 gene locus_tag LOCUS_04630 6686 5157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109635.1 protein_id gnl|my_center|LOCUS_04630 6940 8232 gene locus_tag LOCUS_04640 6940 8232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 8252 9907 gene locus_tag LOCUS_04650 8252 9907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 10407 11666 gene locus_tag LOCUS_04660 10407 11666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 >Feature sequence0035 2850 4907 gene locus_tag LOCUS_04670 2850 4907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 6324 4951 gene locus_tag LOCUS_04680 6324 4951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 7188 6430 gene locus_tag LOCUS_04690 7188 6430 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_04690 7940 7266 gene locus_tag LOCUS_04700 7940 7266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 8100 8939 gene locus_tag LOCUS_04710 gene lpxH 8100 8939 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_04710 9663 8950 gene locus_tag LOCUS_04720 9663 8950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 10646 9813 gene locus_tag LOCUS_04730 10646 9813 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0L5 protein_id gnl|my_center|LOCUS_04730 10839 10627 gene locus_tag LOCUS_04740 10839 10627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 11936 10986 gene locus_tag LOCUS_04750 11936 10986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 >Feature sequence0036 1896 178 gene locus_tag LOCUS_04760 1896 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 3452 1929 gene locus_tag LOCUS_04770 3452 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 3866 6526 gene locus_tag LOCUS_04780 3866 6526 CDS product beta-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227885.1 protein_id gnl|my_center|LOCUS_04780 7887 6586 gene locus_tag LOCUS_04790 7887 6586 CDS product xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036093.1 protein_id gnl|my_center|LOCUS_04790 9717 8035 gene locus_tag LOCUS_04800 9717 8035 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108167.1 protein_id gnl|my_center|LOCUS_04800 <12048 9739 gene locus_tag LOCUS_04810 <12048 9739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202162.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence0037 952 1863 gene locus_tag LOCUS_04820 952 1863 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_04820 3525 1885 gene locus_tag LOCUS_04830 3525 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 3671 4438 gene locus_tag LOCUS_04840 3671 4438 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KGE2 protein_id gnl|my_center|LOCUS_04840 4933 8181 gene locus_tag LOCUS_04850 4933 8181 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107964.1 protein_id gnl|my_center|LOCUS_04850 8238 9992 gene locus_tag LOCUS_04860 8238 9992 CDS product glycan metabolism protein RagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767780.1 protein_id gnl|my_center|LOCUS_04860 >Feature sequence0038 155 889 gene locus_tag LOCUS_04870 155 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 1374 1916 gene locus_tag LOCUS_04880 1374 1916 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724156.1 protein_id gnl|my_center|LOCUS_04880 2794 2066 gene locus_tag LOCUS_04890 2794 2066 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_04890 4123 2882 gene locus_tag LOCUS_04900 4123 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 4418 5413 gene locus_tag LOCUS_04910 4418 5413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 5538 6401 gene locus_tag LOCUS_04920 gene galU 5538 6401 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EV0 protein_id gnl|my_center|LOCUS_04920 7701 6556 gene locus_tag LOCUS_04930 7701 6556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058124.1 protein_id gnl|my_center|LOCUS_04930 7902 9389 gene locus_tag LOCUS_04940 7902 9389 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403159.1 protein_id gnl|my_center|LOCUS_04940 9610 11127 gene locus_tag LOCUS_04950 9610 11127 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403159.1 protein_id gnl|my_center|LOCUS_04950 11265 11507 gene locus_tag LOCUS_04960 11265 11507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 >Feature sequence0039 2 562 gene locus_tag LOCUS_04970 2 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 679 1476 gene locus_tag LOCUS_04980 679 1476 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NU1 protein_id gnl|my_center|LOCUS_04980 1473 1979 gene locus_tag LOCUS_04990 1473 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 2244 2816 gene locus_tag LOCUS_05000 2244 2816 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932332.1 protein_id gnl|my_center|LOCUS_05000 2902 3192 gene locus_tag LOCUS_05010 2902 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 3194 3769 gene locus_tag LOCUS_05020 gene gmk 3194 3769 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI8 protein_id gnl|my_center|LOCUS_05020 3766 4338 gene locus_tag LOCUS_05030 gene nadD 3766 4338 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY8 protein_id gnl|my_center|LOCUS_05030 4739 4329 gene locus_tag LOCUS_05040 4739 4329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 5762 4743 gene locus_tag LOCUS_05050 5762 4743 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108349.1 protein_id gnl|my_center|LOCUS_05050 5981 6199 gene locus_tag LOCUS_05060 5981 6199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 6724 6203 gene locus_tag LOCUS_05070 6724 6203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 8358 6862 gene locus_tag LOCUS_05080 gene cysS 8358 6862 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX80 protein_id gnl|my_center|LOCUS_05080 8564 9748 gene locus_tag LOCUS_05090 8564 9748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403294.1 protein_id gnl|my_center|LOCUS_05090 9912 10829 gene locus_tag LOCUS_05100 9912 10829 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 protein_id gnl|my_center|LOCUS_05100 11403 10864 gene locus_tag LOCUS_05110 11403 10864 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693800.1 protein_id gnl|my_center|LOCUS_05110 >Feature sequence0040 1097 900 gene locus_tag LOCUS_05120 1097 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 2205 1213 gene locus_tag LOCUS_05130 2205 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 2610 2335 gene locus_tag LOCUS_05140 2610 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 5468 2610 gene locus_tag LOCUS_05150 5468 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 6377 5553 gene locus_tag LOCUS_05160 6377 5553 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119732.1 protein_id gnl|my_center|LOCUS_05160 7071 6505 gene locus_tag LOCUS_05170 7071 6505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258319.1 protein_id gnl|my_center|LOCUS_05170 7326 8651 gene locus_tag LOCUS_05180 7326 8651 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029206.1 protein_id gnl|my_center|LOCUS_05180 8653 9093 gene locus_tag LOCUS_05190 8653 9093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 <11585 9121 gene locus_tag LOCUS_05200 <11585 9121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070731.1:type III restriction-modification system restriction subunit Res >Feature sequence0041 1995 556 gene locus_tag LOCUS_05210 1995 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 2707 2051 gene locus_tag LOCUS_05220 2707 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 2768 3004 gene locus_tag LOCUS_05230 2768 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 3371 3556 gene locus_tag LOCUS_05240 3371 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 3589 3828 gene locus_tag LOCUS_05250 3589 3828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 3982 5457 gene locus_tag LOCUS_05260 gene hsdM 3982 5457 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948400.1 protein_id gnl|my_center|LOCUS_05260 5578 8970 gene locus_tag LOCUS_05270 5578 8970 CDS product restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022389.1 protein_id gnl|my_center|LOCUS_05270 10619 9069 gene locus_tag LOCUS_05280 10619 9069 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108243.1 protein_id gnl|my_center|LOCUS_05280 11040 10693 gene locus_tag LOCUS_05290 11040 10693 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887079.1 protein_id gnl|my_center|LOCUS_05290 11347 11045 gene locus_tag LOCUS_05300 11347 11045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 >Feature sequence0042 1313 87 gene locus_tag LOCUS_05310 1313 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 protein_id gnl|my_center|LOCUS_05310 2733 1327 gene locus_tag LOCUS_05320 2733 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963629.1 protein_id gnl|my_center|LOCUS_05320 3104 3313 gene locus_tag LOCUS_05330 3104 3313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 3431 3886 gene locus_tag LOCUS_05340 3431 3886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 4028 6238 gene locus_tag LOCUS_05350 4028 6238 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787236.1 protein_id gnl|my_center|LOCUS_05350 6245 6817 gene locus_tag LOCUS_05360 6245 6817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 7002 7259 gene locus_tag LOCUS_05370 7002 7259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 7339 7692 gene locus_tag LOCUS_05380 7339 7692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 7803 8570 gene locus_tag LOCUS_05390 7803 8570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 8676 10052 gene locus_tag LOCUS_05400 8676 10052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 >Feature sequence0043 2147 1851 gene locus_tag LOCUS_05410 2147 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 2434 2808 gene locus_tag LOCUS_05420 2434 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 3231 2815 gene locus_tag LOCUS_05430 3231 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 5593 3371 gene locus_tag LOCUS_05440 5593 3371 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485384.1 protein_id gnl|my_center|LOCUS_05440 5800 6105 gene locus_tag LOCUS_05450 5800 6105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 6483 6145 gene locus_tag LOCUS_05460 6483 6145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 7645 6632 gene locus_tag LOCUS_05470 7645 6632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 8605 7649 gene locus_tag LOCUS_05480 gene soj 8605 7649 CDS product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288805.1 protein_id gnl|my_center|LOCUS_05480 10060 8714 gene locus_tag LOCUS_05490 10060 8714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 10619 10050 gene locus_tag LOCUS_05500 10619 10050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 >Feature sequence0044 386 1171 gene locus_tag LOCUS_05510 386 1171 CDS product putative ABC transporter permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZE51 protein_id gnl|my_center|LOCUS_05510 1172 1969 gene locus_tag LOCUS_05520 1172 1969 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_05520 2030 3076 gene locus_tag LOCUS_05530 2030 3076 CDS product mammalian cell entry protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937913.1 protein_id gnl|my_center|LOCUS_05530 4367 3084 gene locus_tag LOCUS_05540 4367 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_05540 4756 7521 gene locus_tag LOCUS_05550 4756 7521 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_05550 7587 8150 gene locus_tag LOCUS_05560 7587 8150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143802.1 protein_id gnl|my_center|LOCUS_05560 8909 8163 gene locus_tag LOCUS_05570 8909 8163 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209109.1 protein_id gnl|my_center|LOCUS_05570 9991 8906 gene locus_tag LOCUS_05580 9991 8906 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_05580 10797 10027 gene locus_tag LOCUS_05590 10797 10027 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084226.1 protein_id gnl|my_center|LOCUS_05590 >Feature sequence0045 <1 676 gene locus_tag LOCUS_05600 <1 676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087771.1:resolvase 2635 1547 gene locus_tag LOCUS_05610 2635 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 3369 4181 gene locus_tag LOCUS_05620 3369 4181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 4295 5674 gene locus_tag LOCUS_05630 4295 5674 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963666.1 protein_id gnl|my_center|LOCUS_05630 5760 7373 gene locus_tag LOCUS_05640 5760 7373 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964265.1 protein_id gnl|my_center|LOCUS_05640 7378 10041 gene locus_tag LOCUS_05650 7378 10041 CDS product type III restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964263.1 protein_id gnl|my_center|LOCUS_05650 10305 11195 gene locus_tag LOCUS_05660 10305 11195 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263960.1 protein_id gnl|my_center|LOCUS_05660 >Feature sequence0046 <1 895 gene locus_tag LOCUS_05670 <1 895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009014330.1:permease 2563 980 gene locus_tag LOCUS_05680 2563 980 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QPP6 protein_id gnl|my_center|LOCUS_05680 3816 2683 gene locus_tag LOCUS_05690 3816 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 4320 5849 gene locus_tag LOCUS_05700 4320 5849 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949063.1 protein_id gnl|my_center|LOCUS_05700 5825 7603 gene locus_tag LOCUS_05710 5825 7603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 protein_id gnl|my_center|LOCUS_05710 7950 10895 gene locus_tag LOCUS_05720 7950 10895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 >Feature sequence0047 1672 200 gene locus_tag LOCUS_05730 1672 200 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122845.1 protein_id gnl|my_center|LOCUS_05730 3415 1775 gene locus_tag LOCUS_05740 3415 1775 CDS product starch-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108254.1 protein_id gnl|my_center|LOCUS_05740 6773 3429 gene locus_tag LOCUS_05750 6773 3429 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_05750 8026 6938 gene locus_tag LOCUS_05760 8026 6938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 8697 8104 gene locus_tag LOCUS_05770 8697 8104 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203445.1 protein_id gnl|my_center|LOCUS_05770 9192 9034 gene locus_tag LOCUS_05780 9192 9034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 9308 10330 gene locus_tag LOCUS_05790 9308 10330 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_05790 >Feature sequence0048 427 86 gene locus_tag LOCUS_05800 427 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 1875 553 gene locus_tag LOCUS_05810 1875 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 3444 2113 gene locus_tag LOCUS_05820 3444 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404247.1 protein_id gnl|my_center|LOCUS_05820 4892 3441 gene locus_tag LOCUS_05830 4892 3441 CDS product glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405140.1 protein_id gnl|my_center|LOCUS_05830 7588 4898 gene locus_tag LOCUS_05840 7588 4898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 8532 7744 gene locus_tag LOCUS_05850 8532 7744 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405039.1 protein_id gnl|my_center|LOCUS_05850 8699 9505 gene locus_tag LOCUS_05860 8699 9505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206199.1 protein_id gnl|my_center|LOCUS_05860 10737 9541 gene locus_tag LOCUS_05870 10737 9541 CDS product N-acylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766061.1 protein_id gnl|my_center|LOCUS_05870 >Feature sequence0049 <1 550 gene locus_tag LOCUS_05880 <1 550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H1D1:NAD kinase 667 1680 gene locus_tag LOCUS_05890 gene ykfB 667 1680 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121963.1 protein_id gnl|my_center|LOCUS_05890 1685 2749 gene locus_tag LOCUS_05900 gene bioF 1685 2749 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8X823 protein_id gnl|my_center|LOCUS_05900 4298 3426 gene locus_tag LOCUS_05910 gene tatC 4298 3426 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ5 protein_id gnl|my_center|LOCUS_05910 5703 4414 gene locus_tag LOCUS_05920 gene glyA 5703 4414 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXG2 protein_id gnl|my_center|LOCUS_05920 6019 8004 gene locus_tag LOCUS_05930 6019 8004 CDS product putative glucosamine-6-phosphate deaminase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AB53 protein_id gnl|my_center|LOCUS_05930 8142 8903 gene locus_tag LOCUS_05940 gene rhgT 8142 8903 CDS product rhamnogalacturonan acetylesterase RhgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31523 protein_id gnl|my_center|LOCUS_05940 9881 9045 gene locus_tag LOCUS_05950 gene hpaG 9881 9045 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122036.1 protein_id gnl|my_center|LOCUS_05950 <11013 9953 gene locus_tag LOCUS_05960 <11013 9953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64R17:UvrABC system protein A >Feature sequence0050 1465 1076 gene locus_tag LOCUS_05970 1465 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 2570 1893 gene locus_tag LOCUS_05980 2570 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 4601 5731 gene locus_tag LOCUS_05990 4601 5731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 6389 5739 gene locus_tag LOCUS_06000 6389 5739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 6955 7146 gene locus_tag LOCUS_06010 6955 7146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 7201 7446 gene locus_tag LOCUS_06020 7201 7446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 7448 7630 gene locus_tag LOCUS_06030 7448 7630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 7688 8335 gene locus_tag LOCUS_06040 7688 8335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 8794 9348 gene locus_tag LOCUS_06050 8794 9348 CDS product DNA invertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100847.1 protein_id gnl|my_center|LOCUS_06050 9632 9369 gene locus_tag LOCUS_06060 9632 9369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 10011 10265 gene locus_tag LOCUS_06070 10011 10265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 >Feature sequence0051 <1 1409 gene locus_tag LOCUS_06080 <1 1409 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963036.1:acriflavine resistance protein B 1458 2633 gene locus_tag LOCUS_06090 1458 2633 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963037.1 protein_id gnl|my_center|LOCUS_06090 2643 3263 gene locus_tag LOCUS_06100 2643 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918209.1 protein_id gnl|my_center|LOCUS_06100 3279 5186 gene locus_tag LOCUS_06110 3279 5186 CDS product cadmium/zinc/cobalt-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962595.1 protein_id gnl|my_center|LOCUS_06110 5211 5381 gene locus_tag LOCUS_06120 5211 5381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 6659 5490 gene locus_tag LOCUS_06130 6659 5490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962254.1 protein_id gnl|my_center|LOCUS_06130 7114 6758 gene locus_tag LOCUS_06140 7114 6758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 8430 7231 gene locus_tag LOCUS_06150 8430 7231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962256.1 protein_id gnl|my_center|LOCUS_06150 9779 8760 gene locus_tag LOCUS_06160 9779 8760 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933484.1 protein_id gnl|my_center|LOCUS_06160 <10972 9834 gene locus_tag LOCUS_06170 <10972 9834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920572.1:cation-transporting ATPase >Feature sequence0052 1294 581 gene locus_tag LOCUS_06180 1294 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 2107 1376 gene locus_tag LOCUS_06190 2107 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 2982 4226 gene locus_tag LOCUS_06200 2982 4226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 4283 4879 gene locus_tag LOCUS_06210 gene citB 4283 4879 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805069.1 protein_id gnl|my_center|LOCUS_06210 5059 7557 gene locus_tag LOCUS_06220 5059 7557 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202662.1 protein_id gnl|my_center|LOCUS_06220 7654 8112 gene locus_tag LOCUS_06230 7654 8112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202663.1 protein_id gnl|my_center|LOCUS_06230 8162 9550 gene locus_tag LOCUS_06240 8162 9550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310152.1 protein_id gnl|my_center|LOCUS_06240 9590 9982 gene locus_tag LOCUS_06250 9590 9982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 10060 10629 gene locus_tag LOCUS_06260 10060 10629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 >Feature sequence0053 2675 756 gene locus_tag LOCUS_06270 gene nuoL 2675 756 CDS product NADH dehydrogenase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964310.1 protein_id gnl|my_center|LOCUS_06270 3087 2749 gene locus_tag LOCUS_06280 gene nuoK 3087 2749 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1Q3 protein_id gnl|my_center|LOCUS_06280 4006 3194 gene locus_tag LOCUS_06290 4006 3194 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 protein_id gnl|my_center|LOCUS_06290 5624 4125 gene locus_tag LOCUS_06300 gene glpK 5624 4125 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJ21 protein_id gnl|my_center|LOCUS_06300 6151 5795 gene locus_tag LOCUS_06310 6151 5795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 7157 6294 gene locus_tag LOCUS_06320 7157 6294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 10202 7191 gene locus_tag LOCUS_06330 10202 7191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 >Feature sequence0054 <1 1122 gene locus_tag LOCUS_06340 <1 1122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYG2:phenylalanine--tRNA ligase beta subunit 1132 1476 gene locus_tag LOCUS_06350 1132 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 1473 1772 gene locus_tag LOCUS_06360 1473 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 1877 3442 gene locus_tag LOCUS_06370 gene rny 1877 3442 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR0 protein_id gnl|my_center|LOCUS_06370 3582 4388 gene locus_tag LOCUS_06380 3582 4388 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963194.1 protein_id gnl|my_center|LOCUS_06380 4389 6017 gene locus_tag LOCUS_06390 4389 6017 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_06390 7152 6097 gene locus_tag LOCUS_06400 gene recA 7152 6097 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S7 protein_id gnl|my_center|LOCUS_06400 7574 8224 gene locus_tag LOCUS_06410 7574 8224 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511395.1 protein_id gnl|my_center|LOCUS_06410 8350 9384 gene locus_tag LOCUS_06420 8350 9384 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892860.1 protein_id gnl|my_center|LOCUS_06420 9476 10222 gene locus_tag LOCUS_06430 9476 10222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_06430 >Feature sequence0055 418 1455 gene locus_tag LOCUS_06440 418 1455 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766068.1 protein_id gnl|my_center|LOCUS_06440 1467 1880 gene locus_tag LOCUS_06450 1467 1880 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_06450 1894 2823 gene locus_tag LOCUS_06460 gene yfkH 1894 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963960.1 protein_id gnl|my_center|LOCUS_06460 3080 4069 gene locus_tag LOCUS_06470 3080 4069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 4128 4754 gene locus_tag LOCUS_06480 4128 4754 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_06480 4862 5548 gene locus_tag LOCUS_06490 4862 5548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108764.1 protein_id gnl|my_center|LOCUS_06490 5641 8133 gene locus_tag LOCUS_06500 gene clpC 5641 8133 CDS product ATP-dependent Clp protease ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931885.1 protein_id gnl|my_center|LOCUS_06500 8319 8987 gene locus_tag LOCUS_06510 8319 8987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 9353 9015 gene locus_tag LOCUS_06520 9353 9015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 9431 10177 gene locus_tag LOCUS_06530 9431 10177 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_06530 >Feature sequence0056 297 1175 gene locus_tag LOCUS_06540 297 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 2098 1184 gene locus_tag LOCUS_06550 2098 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 2530 2156 gene locus_tag LOCUS_06560 2530 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 3065 2778 gene locus_tag LOCUS_06570 3065 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 3309 3890 gene locus_tag LOCUS_06580 3309 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 4915 4403 gene locus_tag LOCUS_06590 4915 4403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 6515 4983 gene locus_tag LOCUS_06600 6515 4983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 7387 6635 gene locus_tag LOCUS_06610 7387 6635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 7386 7571 gene locus_tag LOCUS_06620 7386 7571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 8665 7715 gene locus_tag LOCUS_06630 8665 7715 CDS product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946852.1 protein_id gnl|my_center|LOCUS_06630 10222 8789 gene locus_tag LOCUS_06640 10222 8789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 >Feature sequence0057 <1 895 gene locus_tag LOCUS_06650 <1 895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765356.1:transporter 1060 2196 gene locus_tag LOCUS_06660 1060 2196 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964490.1 protein_id gnl|my_center|LOCUS_06660 2400 5849 gene locus_tag LOCUS_06670 2400 5849 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 protein_id gnl|my_center|LOCUS_06670 5995 6168 gene locus_tag LOCUS_06680 5995 6168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 6125 6535 gene locus_tag LOCUS_06690 6125 6535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 7125 6673 gene locus_tag LOCUS_06700 7125 6673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266690.1 protein_id gnl|my_center|LOCUS_06700 7562 7128 gene locus_tag LOCUS_06710 7562 7128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 8007 8813 gene locus_tag LOCUS_06720 8007 8813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727530.1 protein_id gnl|my_center|LOCUS_06720 >Feature sequence0058 334 1887 gene locus_tag LOCUS_06730 334 1887 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405255.1 protein_id gnl|my_center|LOCUS_06730 2448 1942 gene locus_tag LOCUS_06740 gene aroK 2448 1942 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZU2 protein_id gnl|my_center|LOCUS_06740 3559 2465 gene locus_tag LOCUS_06750 3559 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791116.1 protein_id gnl|my_center|LOCUS_06750 4123 3578 gene locus_tag LOCUS_06760 4123 3578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 protein_id gnl|my_center|LOCUS_06760 4186 5016 gene locus_tag LOCUS_06770 gene folP 4186 5016 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH8 protein_id gnl|my_center|LOCUS_06770 5053 5850 gene locus_tag LOCUS_06780 5053 5850 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108919.1 protein_id gnl|my_center|LOCUS_06780 5958 6218 gene locus_tag LOCUS_06790 gene rpsT 5958 6218 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF2 protein_id gnl|my_center|LOCUS_06790 6421 9102 gene locus_tag LOCUS_06800 6421 9102 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117740.1 protein_id gnl|my_center|LOCUS_06800 9337 10518 gene locus_tag LOCUS_06810 9337 10518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142978.1 protein_id gnl|my_center|LOCUS_06810 >Feature sequence0059 454 224 gene locus_tag LOCUS_06820 454 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 516 1394 gene locus_tag LOCUS_06830 516 1394 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964439.1 protein_id gnl|my_center|LOCUS_06830 1652 1425 gene locus_tag LOCUS_06840 1652 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 1758 2402 gene locus_tag LOCUS_06850 1758 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 2505 3248 gene locus_tag LOCUS_06860 2505 3248 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107771.1 protein_id gnl|my_center|LOCUS_06860 3389 3694 gene locus_tag LOCUS_06870 3389 3694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 4341 3754 gene locus_tag LOCUS_06880 4341 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037689.1 protein_id gnl|my_center|LOCUS_06880 4387 5133 gene locus_tag LOCUS_06890 gene fruR 4387 5133 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321471.1 protein_id gnl|my_center|LOCUS_06890 5177 5869 gene locus_tag LOCUS_06900 5177 5869 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854387.1 protein_id gnl|my_center|LOCUS_06900 7762 5948 gene locus_tag LOCUS_06910 gene ggt 7762 5948 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963831.1 protein_id gnl|my_center|LOCUS_06910 7914 9524 gene locus_tag LOCUS_06920 7914 9524 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767669.1 protein_id gnl|my_center|LOCUS_06920 >Feature sequence0060 686 3670 gene locus_tag LOCUS_06930 686 3670 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107165.1 protein_id gnl|my_center|LOCUS_06930 3671 5125 gene locus_tag LOCUS_06940 3671 5125 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405544.1 protein_id gnl|my_center|LOCUS_06940 6929 5880 gene locus_tag LOCUS_06950 6929 5880 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_06950 7445 7633 gene locus_tag LOCUS_06960 7445 7633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 7662 7865 gene locus_tag LOCUS_06970 7662 7865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 >Feature sequence0061 408 2696 gene locus_tag LOCUS_06980 408 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 3569 2745 gene locus_tag LOCUS_06990 gene modC 3569 2745 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002816233.1 protein_id gnl|my_center|LOCUS_06990 4290 3616 gene locus_tag LOCUS_07000 4290 3616 CDS product molybdenum ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349469.1 protein_id gnl|my_center|LOCUS_07000 5214 4441 gene locus_tag LOCUS_07010 5214 4441 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798928.1 protein_id gnl|my_center|LOCUS_07010 5591 5664 gene locus_tag LOCUS_t00080 5591 5664 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5942 6460 gene locus_tag LOCUS_07020 5942 6460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 8831 6618 gene locus_tag LOCUS_07030 8831 6618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 8994 10295 gene locus_tag LOCUS_07040 gene murF 8994 10295 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF0 protein_id gnl|my_center|LOCUS_07040 >Feature sequence0062 2549 822 gene locus_tag LOCUS_07050 2549 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 3275 2574 gene locus_tag LOCUS_07060 3275 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 4027 4260 gene locus_tag LOCUS_07070 gene acpP 4027 4260 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZD0 protein_id gnl|my_center|LOCUS_07070 4770 4312 gene locus_tag LOCUS_07080 4770 4312 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393004.1 protein_id gnl|my_center|LOCUS_07080 4985 6064 gene locus_tag LOCUS_07090 gene gcvT 4985 6064 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WS3 protein_id gnl|my_center|LOCUS_07090 6077 6787 gene locus_tag LOCUS_07100 gene comB 6077 6787 CDS product putative 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZQ4 protein_id gnl|my_center|LOCUS_07100 6957 8795 gene locus_tag LOCUS_07110 6957 8795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 8861 9427 gene locus_tag LOCUS_07120 8861 9427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 9437 9859 gene locus_tag LOCUS_07130 9437 9859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119621.1 protein_id gnl|my_center|LOCUS_07130 >Feature sequence0063 249 614 gene locus_tag LOCUS_07140 249 614 CDS product penicillinase repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257725.1 protein_id gnl|my_center|LOCUS_07140 639 2558 gene locus_tag LOCUS_07150 639 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 3347 2676 gene locus_tag LOCUS_07160 gene yceI 3347 2676 CDS product lipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962678.1 protein_id gnl|my_center|LOCUS_07160 4375 3503 gene locus_tag LOCUS_07170 4375 3503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402862.1 protein_id gnl|my_center|LOCUS_07170 5158 4409 gene locus_tag LOCUS_07180 5158 4409 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I446 protein_id gnl|my_center|LOCUS_07180 5519 5286 gene locus_tag LOCUS_07190 5519 5286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 5461 6318 gene locus_tag LOCUS_07200 5461 6318 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095324.1 protein_id gnl|my_center|LOCUS_07200 6854 6351 gene locus_tag LOCUS_07210 6854 6351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 7865 6957 gene locus_tag LOCUS_07220 7865 6957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 8062 9177 gene locus_tag LOCUS_07230 8062 9177 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975188.1 protein_id gnl|my_center|LOCUS_07230 9751 9203 gene locus_tag LOCUS_07240 9751 9203 CDS product cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_07240 >Feature sequence0064 437 81 gene locus_tag LOCUS_07250 437 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 protein_id gnl|my_center|LOCUS_07250 787 434 gene locus_tag LOCUS_07260 787 434 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ6 protein_id gnl|my_center|LOCUS_07260 983 1549 gene locus_tag LOCUS_07270 983 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 2850 1600 gene locus_tag LOCUS_07280 2850 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 3974 2949 gene locus_tag LOCUS_07290 3974 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07290 6298 3896 gene locus_tag LOCUS_07300 6298 3896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07300 6547 7167 gene locus_tag LOCUS_07310 6547 7167 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088324.1 protein_id gnl|my_center|LOCUS_07310 7613 7164 gene locus_tag LOCUS_07320 7613 7164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 8174 7692 gene locus_tag LOCUS_07330 8174 7692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 8570 8274 gene locus_tag LOCUS_07340 8570 8274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 9231 8590 gene locus_tag LOCUS_07350 9231 8590 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405446.1 protein_id gnl|my_center|LOCUS_07350 10224 9280 gene locus_tag LOCUS_07360 10224 9280 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086031.1 protein_id gnl|my_center|LOCUS_07360 >Feature sequence0065 434 66 gene locus_tag LOCUS_07370 434 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 1123 446 gene locus_tag LOCUS_07380 1123 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 1749 1156 gene locus_tag LOCUS_07390 1749 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812610.1 protein_id gnl|my_center|LOCUS_07390 2732 1791 gene locus_tag LOCUS_07400 2732 1791 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891853.1 protein_id gnl|my_center|LOCUS_07400 3568 2765 gene locus_tag LOCUS_07410 3568 2765 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817185.1 protein_id gnl|my_center|LOCUS_07410 5240 3636 gene locus_tag LOCUS_07420 5240 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 5818 7656 gene locus_tag LOCUS_07430 5818 7656 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108133.1 protein_id gnl|my_center|LOCUS_07430 7653 8741 gene locus_tag LOCUS_07440 7653 8741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 9541 8801 gene locus_tag LOCUS_07450 9541 8801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 10293 9622 gene locus_tag LOCUS_07460 10293 9622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 >Feature sequence0066 502 1299 gene locus_tag LOCUS_07470 502 1299 CDS product alpha/beta hydrolase fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869263.1 protein_id gnl|my_center|LOCUS_07470 1348 2403 gene locus_tag LOCUS_07480 1348 2403 CDS product DUF4432 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787047.1 protein_id gnl|my_center|LOCUS_07480 2428 3651 gene locus_tag LOCUS_07490 2428 3651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118419.1 protein_id gnl|my_center|LOCUS_07490 3758 4813 gene locus_tag LOCUS_07500 3758 4813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123542.1 protein_id gnl|my_center|LOCUS_07500 4905 6068 gene locus_tag LOCUS_07510 4905 6068 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 protein_id gnl|my_center|LOCUS_07510 6256 7758 gene locus_tag LOCUS_07520 6256 7758 CDS product putative ribose/galactose/methyl galactoside import ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRC6 protein_id gnl|my_center|LOCUS_07520 7879 8793 gene locus_tag LOCUS_07530 7879 8793 CDS product sugar transport system permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002345910.1 protein_id gnl|my_center|LOCUS_07530 8965 9897 gene locus_tag LOCUS_07540 8965 9897 CDS product rhizopine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764495.1 protein_id gnl|my_center|LOCUS_07540 >Feature sequence0067 <1 787 gene locus_tag LOCUS_07550 <1 787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962266.1:endothelin-converting protein 1486 914 gene locus_tag LOCUS_07560 1486 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 2187 1753 gene locus_tag LOCUS_07570 2187 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 2449 4305 gene locus_tag LOCUS_07580 2449 4305 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784059.1 protein_id gnl|my_center|LOCUS_07580 4761 4438 gene locus_tag LOCUS_07590 4761 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 4867 5154 gene locus_tag LOCUS_07600 4867 5154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 5787 5083 gene locus_tag LOCUS_07610 5787 5083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 6144 7235 gene locus_tag LOCUS_07620 6144 7235 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971709.1 protein_id gnl|my_center|LOCUS_07620 7422 8042 gene locus_tag LOCUS_07630 7422 8042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107703.1 protein_id gnl|my_center|LOCUS_07630 9011 10201 gene locus_tag LOCUS_07640 9011 10201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 >Feature sequence0068 1457 2713 gene locus_tag LOCUS_07650 1457 2713 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887610.1 protein_id gnl|my_center|LOCUS_07650 2890 5418 gene locus_tag LOCUS_07660 2890 5418 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202101.1 protein_id gnl|my_center|LOCUS_07660 5649 5440 gene locus_tag LOCUS_07670 5649 5440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014309.1 protein_id gnl|my_center|LOCUS_07670 6314 5658 gene locus_tag LOCUS_07680 6314 5658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 6895 6425 gene locus_tag LOCUS_07690 6895 6425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057196.1 protein_id gnl|my_center|LOCUS_07690 8386 6920 gene locus_tag LOCUS_07700 8386 6920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 <10193 8722 gene locus_tag LOCUS_07710 <10193 8722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880081.1:nitrite reductase >Feature sequence0069 1 1194 gene locus_tag LOCUS_07720 1 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 1354 3780 gene locus_tag LOCUS_07730 1354 3780 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_07730 4355 3849 gene locus_tag LOCUS_07740 4355 3849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 4354 5853 gene locus_tag LOCUS_07750 4354 5853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07750 5952 6779 gene locus_tag LOCUS_07760 5952 6779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07760 7069 7479 gene locus_tag LOCUS_07770 7069 7479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 7476 7940 gene locus_tag LOCUS_07780 7476 7940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 7999 8580 gene locus_tag LOCUS_07790 7999 8580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 8702 9604 gene locus_tag LOCUS_07800 8702 9604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 <10175 9637 gene locus_tag LOCUS_07810 <10175 9637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920130.1:isoquinoline 1-oxidoreductase subunit beta >Feature sequence0070 <1 4856 gene locus_tag LOCUS_07820 <1 4856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964220.1:cell surface protein SprA 6549 5059 gene locus_tag LOCUS_07830 6549 5059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 7861 6965 gene locus_tag LOCUS_07840 7861 6965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 9578 7977 gene locus_tag LOCUS_07850 9578 7977 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389949.1 protein_id gnl|my_center|LOCUS_07850 >Feature sequence0071 1519 104 gene locus_tag LOCUS_07860 1519 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 1615 1821 gene locus_tag LOCUS_07870 1615 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 3569 1911 gene locus_tag LOCUS_07880 3569 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 4626 3712 gene locus_tag LOCUS_07890 4626 3712 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763547.1 protein_id gnl|my_center|LOCUS_07890 5562 4900 gene locus_tag LOCUS_07900 5562 4900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 6350 5760 gene locus_tag LOCUS_07910 gene exbD2 6350 5760 CDS product biopolymer transport ExbD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964298.1 protein_id gnl|my_center|LOCUS_07910 7009 6389 gene locus_tag LOCUS_07920 gene exbD1 7009 6389 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964299.1 protein_id gnl|my_center|LOCUS_07920 7904 7068 gene locus_tag LOCUS_07930 7904 7068 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792006.1 protein_id gnl|my_center|LOCUS_07930 8630 9265 gene locus_tag LOCUS_07940 8630 9265 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086430.1 protein_id gnl|my_center|LOCUS_07940 9383 9961 gene locus_tag LOCUS_07950 9383 9961 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964470.1 protein_id gnl|my_center|LOCUS_07950 >Feature sequence0072 <1 1388 gene locus_tag LOCUS_07960 <1 1388 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021845.1:sensor histidine kinase 1419 2165 gene locus_tag LOCUS_07970 1419 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 3420 2215 gene locus_tag LOCUS_07980 3420 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 3568 4692 gene locus_tag LOCUS_07990 3568 4692 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974018.1 protein_id gnl|my_center|LOCUS_07990 5516 4671 gene locus_tag LOCUS_08000 5516 4671 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258943.1 protein_id gnl|my_center|LOCUS_08000 5676 8357 gene locus_tag LOCUS_08010 5676 8357 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964117.1 protein_id gnl|my_center|LOCUS_08010 8585 8385 gene locus_tag LOCUS_08020 8585 8385 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023878.1 protein_id gnl|my_center|LOCUS_08020 9100 8582 gene locus_tag LOCUS_08030 9100 8582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 >Feature sequence0073 1909 1190 gene locus_tag LOCUS_08040 1909 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964113.1 protein_id gnl|my_center|LOCUS_08040 2094 3422 gene locus_tag LOCUS_08050 gene norM 2094 3422 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962730.1 protein_id gnl|my_center|LOCUS_08050 4180 3425 gene locus_tag LOCUS_08060 4180 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 6415 4301 gene locus_tag LOCUS_08070 gene prc 6415 4301 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091593.1 protein_id gnl|my_center|LOCUS_08070 7023 6424 gene locus_tag LOCUS_08080 7023 6424 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3H8 protein_id gnl|my_center|LOCUS_08080 7465 9042 gene locus_tag LOCUS_08090 gene atpA 7465 9042 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D7 protein_id gnl|my_center|LOCUS_08090 >Feature sequence0074 754 8 gene locus_tag LOCUS_08100 754 8 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964336.1 protein_id gnl|my_center|LOCUS_08100 2407 872 gene locus_tag LOCUS_08110 gene purH 2407 872 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H296 protein_id gnl|my_center|LOCUS_08110 2577 3974 gene locus_tag LOCUS_08120 2577 3974 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257389.1 protein_id gnl|my_center|LOCUS_08120 5016 3964 gene locus_tag LOCUS_08130 5016 3964 CDS product tRNA 2-selenouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72EL0 protein_id gnl|my_center|LOCUS_08130 5783 5067 gene locus_tag LOCUS_08140 gene pdxJ 5783 5067 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3V814 protein_id gnl|my_center|LOCUS_08140 5948 6463 gene locus_tag LOCUS_08150 5948 6463 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964151.1 protein_id gnl|my_center|LOCUS_08150 6505 7068 gene locus_tag LOCUS_08160 6505 7068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 7122 8171 gene locus_tag LOCUS_08170 gene rlmN 7122 8171 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B8 protein_id gnl|my_center|LOCUS_08170 8265 9686 gene locus_tag LOCUS_08180 8265 9686 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T8G1 protein_id gnl|my_center|LOCUS_08180 >Feature sequence0075 1361 1942 gene locus_tag LOCUS_08190 1361 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 1950 2897 gene locus_tag LOCUS_08200 1950 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 3107 2928 gene locus_tag LOCUS_08210 3107 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 3119 6112 gene locus_tag LOCUS_08220 3119 6112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 6125 7375 gene locus_tag LOCUS_08230 6125 7375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 7491 8693 gene locus_tag LOCUS_08240 7491 8693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 >Feature sequence0076 231 761 gene locus_tag LOCUS_08250 231 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 1857 781 gene locus_tag LOCUS_08260 1857 781 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258073.1 protein_id gnl|my_center|LOCUS_08260 2032 3273 gene locus_tag LOCUS_08270 2032 3273 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964503.1 protein_id gnl|my_center|LOCUS_08270 3340 3810 gene locus_tag LOCUS_08280 3340 3810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 4204 3869 gene locus_tag LOCUS_08290 4204 3869 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 protein_id gnl|my_center|LOCUS_08290 5113 4235 gene locus_tag LOCUS_08300 5113 4235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107505.1 protein_id gnl|my_center|LOCUS_08300 5327 5743 gene locus_tag LOCUS_08310 5327 5743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 5740 6981 gene locus_tag LOCUS_08320 gene nhaA 5740 6981 CDS product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAZ2 protein_id gnl|my_center|LOCUS_08320 7554 7057 gene locus_tag LOCUS_08330 7554 7057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 8248 7748 gene locus_tag LOCUS_08340 8248 7748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 9379 8393 gene locus_tag LOCUS_08350 9379 8393 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390231.1 protein_id gnl|my_center|LOCUS_08350 >Feature sequence0077 <1 1253 gene locus_tag LOCUS_08360 <1 1253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962560.1:SOS mutagenesis and repair protein UmuC 1850 1302 gene locus_tag LOCUS_08370 1850 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 3175 2168 gene locus_tag LOCUS_08380 3175 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 4365 3229 gene locus_tag LOCUS_08390 4365 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946040.1 protein_id gnl|my_center|LOCUS_08390 6027 4369 gene locus_tag LOCUS_08400 6027 4369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 7828 6080 gene locus_tag LOCUS_08410 7828 6080 CDS product pyruvate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970775.1 protein_id gnl|my_center|LOCUS_08410 8347 7871 gene locus_tag LOCUS_08420 8347 7871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332434.1 protein_id gnl|my_center|LOCUS_08420 8812 8642 gene locus_tag LOCUS_08430 8812 8642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 9290 8970 gene locus_tag LOCUS_08440 9290 8970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 >Feature sequence0078 <1 1919 gene locus_tag LOCUS_08450 <1 1919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122517.1:endo-inulinase 1924 3432 gene locus_tag LOCUS_08460 1924 3432 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122518.1 protein_id gnl|my_center|LOCUS_08460 3930 3457 gene locus_tag LOCUS_08470 3930 3457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 4969 6006 gene locus_tag LOCUS_08480 4969 6006 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_08480 6070 6381 gene locus_tag LOCUS_08490 6070 6381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 6473 8401 gene locus_tag LOCUS_08500 6473 8401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 8448 9518 gene locus_tag LOCUS_08510 8448 9518 CDS product beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E346 protein_id gnl|my_center|LOCUS_08510 >Feature sequence0079 964 2820 gene locus_tag LOCUS_08520 964 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 3182 5062 gene locus_tag LOCUS_08530 3182 5062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 5617 5420 gene locus_tag LOCUS_08540 5617 5420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 5564 7546 gene locus_tag LOCUS_08550 5564 7546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 9437 7566 gene locus_tag LOCUS_08560 9437 7566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 >Feature sequence0080 2720 933 gene locus_tag LOCUS_08570 gene lepA 2720 933 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S4 protein_id gnl|my_center|LOCUS_08570 4070 2838 gene locus_tag LOCUS_08580 4070 2838 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 protein_id gnl|my_center|LOCUS_08580 4600 5079 gene locus_tag LOCUS_08590 4600 5079 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359806.1 protein_id gnl|my_center|LOCUS_08590 5266 5637 gene locus_tag LOCUS_08600 gene ywzG 5266 5637 CDS product putative DNA-binding protein YwzG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C0H3S6 protein_id gnl|my_center|LOCUS_08600 5658 6680 gene locus_tag LOCUS_08610 5658 6680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 6810 7328 gene locus_tag LOCUS_08620 6810 7328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 8479 7337 gene locus_tag LOCUS_08630 8479 7337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 8666 8848 gene locus_tag LOCUS_08640 8666 8848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 <9562 8857 gene locus_tag LOCUS_08650 <9562 8857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962582.1:fatty acid desaturase >Feature sequence0081 <1 1752 gene locus_tag LOCUS_08660 <1 1752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760893.1:collagen-binding protein 2278 1841 gene locus_tag LOCUS_08670 2278 1841 CDS product NH2-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890794.1 protein_id gnl|my_center|LOCUS_08670 2874 2443 gene locus_tag LOCUS_08680 2874 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068355.1 protein_id gnl|my_center|LOCUS_08680 4339 2972 gene locus_tag LOCUS_08690 4339 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140647.1 protein_id gnl|my_center|LOCUS_08690 4745 6007 gene locus_tag LOCUS_08700 4745 6007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338895.1 protein_id gnl|my_center|LOCUS_08700 7055 6048 gene locus_tag LOCUS_08710 7055 6048 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094813.1 protein_id gnl|my_center|LOCUS_08710 7263 8642 gene locus_tag LOCUS_08720 7263 8642 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120368.1 protein_id gnl|my_center|LOCUS_08720 <9559 8672 gene locus_tag LOCUS_08730 <9559 8672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118989.1:sulfatase >Feature sequence0082 792 1937 gene locus_tag LOCUS_08740 792 1937 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064866.1 protein_id gnl|my_center|LOCUS_08740 4093 1934 gene locus_tag LOCUS_08750 4093 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 6352 4274 gene locus_tag LOCUS_08760 6352 4274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 7234 6386 gene locus_tag LOCUS_08770 7234 6386 CDS product tagatose 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339518.1 protein_id gnl|my_center|LOCUS_08770 8472 7339 gene locus_tag LOCUS_08780 8472 7339 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_08780 9404 8661 gene locus_tag LOCUS_08790 9404 8661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119395.1 protein_id gnl|my_center|LOCUS_08790 >Feature sequence0083 3 875 gene locus_tag LOCUS_08800 3 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 1384 974 gene locus_tag LOCUS_08810 gene vapC 1384 974 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AB8 protein_id gnl|my_center|LOCUS_08810 1617 1381 gene locus_tag LOCUS_08820 1617 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 2704 1682 gene locus_tag LOCUS_08830 2704 1682 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978349.1 protein_id gnl|my_center|LOCUS_08830 3553 2759 gene locus_tag LOCUS_08840 3553 2759 CDS product UPF0309 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K3V1 protein_id gnl|my_center|LOCUS_08840 4399 3605 gene locus_tag LOCUS_08850 gene ybxI 4399 3605 CDS product putative beta-lactamase YbxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54427 protein_id gnl|my_center|LOCUS_08850 5302 4406 gene locus_tag LOCUS_08860 gene glcK 5302 4406 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391706.1 protein_id gnl|my_center|LOCUS_08860 6142 5354 gene locus_tag LOCUS_08870 6142 5354 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_08870 7490 6366 gene locus_tag LOCUS_08880 gene clpX 7490 6366 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A128 protein_id gnl|my_center|LOCUS_08880 8530 7856 gene locus_tag LOCUS_08890 gene clpP 8530 7856 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C3 protein_id gnl|my_center|LOCUS_08890 >Feature sequence0084 2945 1905 gene locus_tag LOCUS_08900 2945 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 4499 3183 gene locus_tag LOCUS_08910 4499 3183 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086520.1 protein_id gnl|my_center|LOCUS_08910 4995 4561 gene locus_tag LOCUS_08920 4995 4561 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121094.1 protein_id gnl|my_center|LOCUS_08920 5141 5335 gene locus_tag LOCUS_08930 5141 5335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 8210 5430 gene locus_tag LOCUS_08940 8210 5430 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140762.1 protein_id gnl|my_center|LOCUS_08940 >Feature sequence0085 614 1879 gene locus_tag LOCUS_08950 614 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 1883 2638 gene locus_tag LOCUS_08960 gene tylF 1883 2638 CDS product macrocin O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726905.1 protein_id gnl|my_center|LOCUS_08960 2656 3369 gene locus_tag LOCUS_08970 2656 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 3814 4539 gene locus_tag LOCUS_08980 3814 4539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 5094 5618 gene locus_tag LOCUS_08990 5094 5618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 6113 6817 gene locus_tag LOCUS_09000 6113 6817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 6814 7974 gene locus_tag LOCUS_09010 6814 7974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 7971 9284 gene locus_tag LOCUS_09020 7971 9284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 >Feature sequence0086 794 1726 gene locus_tag LOCUS_09030 794 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 2011 2853 gene locus_tag LOCUS_09040 2011 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 2936 3742 gene locus_tag LOCUS_09050 2936 3742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115216.1 protein_id gnl|my_center|LOCUS_09050 4023 5585 gene locus_tag LOCUS_09060 4023 5585 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787651.1 protein_id gnl|my_center|LOCUS_09060 5682 6350 gene locus_tag LOCUS_09070 5682 6350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 7178 6399 gene locus_tag LOCUS_09080 7178 6399 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404286.1 protein_id gnl|my_center|LOCUS_09080 7470 7850 gene locus_tag LOCUS_09090 7470 7850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 8013 8393 gene locus_tag LOCUS_09100 8013 8393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 8563 8943 gene locus_tag LOCUS_09110 8563 8943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 >Feature sequence0087 1380 1811 gene locus_tag LOCUS_09120 1380 1811 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642733.1 protein_id gnl|my_center|LOCUS_09120 3051 1831 gene locus_tag LOCUS_09130 3051 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 3869 3054 gene locus_tag LOCUS_09140 gene rsbQ 3869 3054 CDS product sigma factor SigB regulation protein RsbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07015 protein_id gnl|my_center|LOCUS_09140 4033 4359 gene locus_tag LOCUS_09150 4033 4359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 4438 5643 gene locus_tag LOCUS_09160 4438 5643 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014092.1 protein_id gnl|my_center|LOCUS_09160 5633 6247 gene locus_tag LOCUS_09170 5633 6247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002255036.1 protein_id gnl|my_center|LOCUS_09170 6382 7647 gene locus_tag LOCUS_09180 6382 7647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119390.1 protein_id gnl|my_center|LOCUS_09180 7889 7656 gene locus_tag LOCUS_09190 7889 7656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 <9435 8031 gene locus_tag LOCUS_09200 <9435 8031 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767780.1:glycan metabolism protein RagB >Feature sequence0088 1648 776 gene locus_tag LOCUS_09210 1648 776 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228241.1 protein_id gnl|my_center|LOCUS_09210 2656 1781 gene locus_tag LOCUS_09220 2656 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 3510 2845 gene locus_tag LOCUS_09230 gene nth 3510 2845 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64R69 protein_id gnl|my_center|LOCUS_09230 3866 3618 gene locus_tag LOCUS_09240 3866 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 4440 3841 gene locus_tag LOCUS_09250 4440 3841 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_09250 4825 5130 gene locus_tag LOCUS_09260 4825 5130 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522937.1 protein_id gnl|my_center|LOCUS_09260 5189 5719 gene locus_tag LOCUS_09270 5189 5719 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889309.1 protein_id gnl|my_center|LOCUS_09270 5894 7603 gene locus_tag LOCUS_09280 gene kaiC2 5894 7603 CDS product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331300.1 protein_id gnl|my_center|LOCUS_09280 7642 7941 gene locus_tag LOCUS_09290 7642 7941 CDS product KaiB 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390296.1 protein_id gnl|my_center|LOCUS_09290 7938 8258 gene locus_tag LOCUS_09300 7938 8258 CDS product KaiB 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390296.1 protein_id gnl|my_center|LOCUS_09300 >Feature sequence0089 568 2592 gene locus_tag LOCUS_09310 568 2592 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_09310 2797 4128 gene locus_tag LOCUS_09320 2797 4128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 4216 5655 gene locus_tag LOCUS_09330 gene cry 4216 5655 CDS product cryptochrome DASH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMD1 protein_id gnl|my_center|LOCUS_09330 5777 5980 gene locus_tag LOCUS_09340 5777 5980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 5977 9360 gene locus_tag LOCUS_09350 5977 9360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 >Feature sequence0090 222 518 gene locus_tag LOCUS_09360 222 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 530 1027 gene locus_tag LOCUS_09370 gene amsI 530 1027 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228998.1 protein_id gnl|my_center|LOCUS_09370 1024 2556 gene locus_tag LOCUS_09380 gene gpmI 1024 2556 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1H2 protein_id gnl|my_center|LOCUS_09380 2597 3259 gene locus_tag LOCUS_09390 2597 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 3296 4798 gene locus_tag LOCUS_09400 3296 4798 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920680.1 protein_id gnl|my_center|LOCUS_09400 5343 6221 gene locus_tag LOCUS_09410 5343 6221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 7171 6281 gene locus_tag LOCUS_09420 7171 6281 CDS product polyphosphate--nucleotide phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932760.1 protein_id gnl|my_center|LOCUS_09420 7850 7257 gene locus_tag LOCUS_09430 7850 7257 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L2 protein_id gnl|my_center|LOCUS_09430 8819 7929 gene locus_tag LOCUS_09440 8819 7929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 <9411 8825 gene locus_tag LOCUS_09450 <9411 8825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZW30:peptidyl-prolyl cis-trans isomerase >Feature sequence0091 1533 331 gene locus_tag LOCUS_09460 1533 331 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963410.1 protein_id gnl|my_center|LOCUS_09460 2138 1530 gene locus_tag LOCUS_09470 2138 1530 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795841.1 protein_id gnl|my_center|LOCUS_09470 2791 2168 gene locus_tag LOCUS_09480 2791 2168 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202153.1 protein_id gnl|my_center|LOCUS_09480 4876 2867 gene locus_tag LOCUS_09490 4876 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 7420 5009 gene locus_tag LOCUS_09500 7420 5009 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_09500 7715 8044 gene locus_tag LOCUS_09510 7715 8044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 >Feature sequence0092 241 1293 gene locus_tag LOCUS_09520 241 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001178915.1 protein_id gnl|my_center|LOCUS_09520 1915 1397 gene locus_tag LOCUS_09530 1915 1397 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918364.1 protein_id gnl|my_center|LOCUS_09530 2014 3366 gene locus_tag LOCUS_09540 gene mnmE 2014 3366 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X55 protein_id gnl|my_center|LOCUS_09540 3450 4307 gene locus_tag LOCUS_09550 3450 4307 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809962.1 protein_id gnl|my_center|LOCUS_09550 4300 5211 gene locus_tag LOCUS_09560 4300 5211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 5208 6119 gene locus_tag LOCUS_09570 gene miaA2 5208 6119 CDS product tRNA dimethylallyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZQ3 protein_id gnl|my_center|LOCUS_09570 6135 6557 gene locus_tag LOCUS_09580 6135 6557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 6554 7837 gene locus_tag LOCUS_09590 6554 7837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 8080 9363 gene locus_tag LOCUS_09600 gene gltA 8080 9363 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ68 protein_id gnl|my_center|LOCUS_09600 >Feature sequence0093 2085 796 gene locus_tag LOCUS_09610 gene purD 2085 796 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2F2 protein_id gnl|my_center|LOCUS_09610 4362 2149 gene locus_tag LOCUS_09620 4362 2149 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764112.1 protein_id gnl|my_center|LOCUS_09620 4497 5432 gene locus_tag LOCUS_09630 gene kdsD 4497 5432 CDS product D-arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963366.1 protein_id gnl|my_center|LOCUS_09630 5918 5442 gene locus_tag LOCUS_09640 5918 5442 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788196.1 protein_id gnl|my_center|LOCUS_09640 7362 6052 gene locus_tag LOCUS_09650 gene rimO 7362 6052 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF6 protein_id gnl|my_center|LOCUS_09650 8105 7491 gene locus_tag LOCUS_09660 8105 7491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 8899 8330 gene locus_tag LOCUS_09670 8899 8330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 >Feature sequence0094 1633 533 gene locus_tag LOCUS_09680 1633 533 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964539.1 protein_id gnl|my_center|LOCUS_09680 4011 1633 gene locus_tag LOCUS_09690 4011 1633 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074066.1 protein_id gnl|my_center|LOCUS_09690 4915 4196 gene locus_tag LOCUS_09700 4915 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 5402 5019 gene locus_tag LOCUS_09710 5402 5019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 6793 5426 gene locus_tag LOCUS_09720 6793 5426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 7644 6949 gene locus_tag LOCUS_09730 gene recO 7644 6949 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB0 protein_id gnl|my_center|LOCUS_09730 8329 7724 gene locus_tag LOCUS_09740 gene arsC 8329 7724 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123107.1 protein_id gnl|my_center|LOCUS_09740 <9355 8390 gene locus_tag LOCUS_09750 <9355 8390 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876533.1:arsenical-resistance protein >Feature sequence0095 <1 528 gene locus_tag LOCUS_09760 <1 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964414.1:aldehyde dehydrogenase 2661 583 gene locus_tag LOCUS_09770 gene ftsH 2661 583 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX85 protein_id gnl|my_center|LOCUS_09770 3115 2732 gene locus_tag LOCUS_09780 gene rsfS 3115 2732 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX84 protein_id gnl|my_center|LOCUS_09780 3196 3960 gene locus_tag LOCUS_09790 3196 3960 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108184.1 protein_id gnl|my_center|LOCUS_09790 4292 3957 gene locus_tag LOCUS_09800 4292 3957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 5131 4409 gene locus_tag LOCUS_09810 5131 4409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 5419 6075 gene locus_tag LOCUS_09820 gene tal 5419 6075 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG9 protein_id gnl|my_center|LOCUS_09820 6127 6804 gene locus_tag LOCUS_09830 gene ftsE 6127 6804 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_09830 7486 6833 gene locus_tag LOCUS_09840 7486 6833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 <9317 7483 gene locus_tag LOCUS_09850 <9317 7483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971984.1:histidine kinase >Feature sequence0096 1034 1606 gene locus_tag LOCUS_09860 1034 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 1706 2818 gene locus_tag LOCUS_09870 gene gmd 1706 2818 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AC90 protein_id gnl|my_center|LOCUS_09870 4516 2990 gene locus_tag LOCUS_09880 4516 2990 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_09880 5158 4727 gene locus_tag LOCUS_09890 5158 4727 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788218.1 protein_id gnl|my_center|LOCUS_09890 6211 5465 gene locus_tag LOCUS_09900 6211 5465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 7486 6233 gene locus_tag LOCUS_09910 gene fabF 7486 6233 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW44 protein_id gnl|my_center|LOCUS_09910 7767 7531 gene locus_tag LOCUS_09920 gene acpP 7767 7531 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E6 protein_id gnl|my_center|LOCUS_09920 8047 8808 gene locus_tag LOCUS_09930 8047 8808 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZQ5 protein_id gnl|my_center|LOCUS_09930 >Feature sequence0097 417 1187 gene locus_tag LOCUS_09940 417 1187 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788741.1 protein_id gnl|my_center|LOCUS_09940 1591 1956 gene locus_tag LOCUS_09950 1591 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 1978 2673 gene locus_tag LOCUS_09960 1978 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 2711 3529 gene locus_tag LOCUS_09970 2711 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 3589 4251 gene locus_tag LOCUS_09980 3589 4251 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564604.1 protein_id gnl|my_center|LOCUS_09980 5210 4254 gene locus_tag LOCUS_09990 5210 4254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140563.1 protein_id gnl|my_center|LOCUS_09990 5351 7030 gene locus_tag LOCUS_10000 gene aspS 5351 7030 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TQ1 protein_id gnl|my_center|LOCUS_10000 7298 7119 gene locus_tag LOCUS_10010 7298 7119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 7834 7301 gene locus_tag LOCUS_10020 7834 7301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 8270 7881 gene locus_tag LOCUS_10030 8270 7881 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964456.1 protein_id gnl|my_center|LOCUS_10030 8506 9204 gene locus_tag LOCUS_10040 8506 9204 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405245.1 protein_id gnl|my_center|LOCUS_10040 >Feature sequence0098 469 1041 gene locus_tag LOCUS_10050 469 1041 CDS product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331372.1 protein_id gnl|my_center|LOCUS_10050 1031 1777 gene locus_tag LOCUS_10060 1031 1777 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118862.1 protein_id gnl|my_center|LOCUS_10060 1957 3165 gene locus_tag LOCUS_10070 1957 3165 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790532.1 protein_id gnl|my_center|LOCUS_10070 3345 5543 gene locus_tag LOCUS_10080 gene maeB 3345 5543 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964222.1 protein_id gnl|my_center|LOCUS_10080 6356 5613 gene locus_tag LOCUS_10090 6356 5613 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286976.1 protein_id gnl|my_center|LOCUS_10090 6849 7523 gene locus_tag LOCUS_10100 6849 7523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 8160 7555 gene locus_tag LOCUS_10110 8160 7555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 8759 8499 gene locus_tag LOCUS_10120 8759 8499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 >Feature sequence0099 647 1789 gene locus_tag LOCUS_10130 gene acdA 647 1789 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45867 protein_id gnl|my_center|LOCUS_10130 1999 2913 gene locus_tag LOCUS_10140 1999 2913 CDS product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811759.1 protein_id gnl|my_center|LOCUS_10140 2938 3375 gene locus_tag LOCUS_10150 2938 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 5202 3466 gene locus_tag LOCUS_10160 gene pafA 5202 3466 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_10160 5292 6017 gene locus_tag LOCUS_10170 gene crtO 5292 6017 CDS product beta-carotene ketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141726.1 protein_id gnl|my_center|LOCUS_10170 6121 7326 gene locus_tag LOCUS_10180 6121 7326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 8332 7358 gene locus_tag LOCUS_10190 8332 7358 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_10190 >Feature sequence0100 <1 515 gene locus_tag LOCUS_10200 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933174.1:agmatine deiminase 664 1347 gene locus_tag LOCUS_10210 664 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 1464 3767 gene locus_tag LOCUS_10220 1464 3767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 3799 5169 gene locus_tag LOCUS_10230 3799 5169 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NW8 protein_id gnl|my_center|LOCUS_10230 5395 6357 gene locus_tag LOCUS_10240 5395 6357 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_10240 6550 8091 gene locus_tag LOCUS_10250 6550 8091 CDS product fatty aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539579.1 protein_id gnl|my_center|LOCUS_10250 8611 9150 gene locus_tag LOCUS_10260 8611 9150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 >Feature sequence0101 151 633 gene locus_tag LOCUS_10270 151 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 709 921 gene locus_tag LOCUS_10280 709 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 1724 945 gene locus_tag LOCUS_10290 1724 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 3221 2043 gene locus_tag LOCUS_10300 3221 2043 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109402.1 protein_id gnl|my_center|LOCUS_10300 4447 3767 gene locus_tag LOCUS_10310 4447 3767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 4572 4817 gene locus_tag LOCUS_10320 4572 4817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 5129 6160 gene locus_tag LOCUS_10330 5129 6160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 6163 6414 gene locus_tag LOCUS_10340 6163 6414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 6569 7855 gene locus_tag LOCUS_10350 6569 7855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962655.1 protein_id gnl|my_center|LOCUS_10350 8224 9072 gene locus_tag LOCUS_10360 8224 9072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 >Feature sequence0102 3847 1616 gene locus_tag LOCUS_10370 3847 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 3995 4228 gene locus_tag LOCUS_10380 3995 4228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 4322 4684 gene locus_tag LOCUS_10390 4322 4684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 4772 5797 gene locus_tag LOCUS_10400 gene atpB 4772 5797 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UA8 protein_id gnl|my_center|LOCUS_10400 5850 6113 gene locus_tag LOCUS_10410 gene atpE 5850 6113 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UA7 protein_id gnl|my_center|LOCUS_10410 6316 6810 gene locus_tag LOCUS_10420 gene atpF 6316 6810 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D9 protein_id gnl|my_center|LOCUS_10420 6838 7374 gene locus_tag LOCUS_10430 gene atpH 6838 7374 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72E01 protein_id gnl|my_center|LOCUS_10430 7510 8565 gene locus_tag LOCUS_10440 7510 8565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 <9165 8557 gene locus_tag LOCUS_10450 <9165 8557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760381.1:potassium transporter >Feature sequence0103 897 394 gene locus_tag LOCUS_10460 897 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 1132 1635 gene locus_tag LOCUS_10470 1132 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 2864 1683 gene locus_tag LOCUS_10480 2864 1683 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_10480 3094 4281 gene locus_tag LOCUS_10490 3094 4281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 4290 5483 gene locus_tag LOCUS_10500 gene metZ 4290 5483 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JM6 protein_id gnl|my_center|LOCUS_10500 5582 6295 gene locus_tag LOCUS_10510 gene cysH 5582 6295 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993603.1 protein_id gnl|my_center|LOCUS_10510 6402 7343 gene locus_tag LOCUS_10520 gene cysD 6402 7343 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYJ4 protein_id gnl|my_center|LOCUS_10520 7460 8707 gene locus_tag LOCUS_10530 gene cysN 7460 8707 CDS product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYJ5 protein_id gnl|my_center|LOCUS_10530 >Feature sequence0104 <1 886 gene locus_tag LOCUS_10540 <1 886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941065.1:MBL fold metallo-hydrolase 987 2006 gene locus_tag LOCUS_10550 987 2006 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114217.1 protein_id gnl|my_center|LOCUS_10550 2445 2780 gene locus_tag LOCUS_10560 2445 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 2857 3723 gene locus_tag LOCUS_10570 2857 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 3900 4658 gene locus_tag LOCUS_10580 gene bla 3900 4658 CDS product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HFY5 protein_id gnl|my_center|LOCUS_10580 4837 5469 gene locus_tag LOCUS_10590 4837 5469 CDS product NAD dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902568.1 protein_id gnl|my_center|LOCUS_10590 6532 5522 gene locus_tag LOCUS_10600 6532 5522 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530516.1 protein_id gnl|my_center|LOCUS_10600 7059 7628 gene locus_tag LOCUS_10610 7059 7628 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035327.1 protein_id gnl|my_center|LOCUS_10610 7750 8499 gene locus_tag LOCUS_10620 gene ygaJ 7750 8499 CDS product putative peptidase YgaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71089 protein_id gnl|my_center|LOCUS_10620 <9127 8512 gene locus_tag LOCUS_10630 <9127 8512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889623.1:NAD(P)-dependent oxidoreductase >Feature sequence0105 304 1782 gene locus_tag LOCUS_10640 304 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 1891 3342 gene locus_tag LOCUS_10650 1891 3342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 3393 3806 gene locus_tag LOCUS_10660 3393 3806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 4123 4455 gene locus_tag LOCUS_10670 4123 4455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 4626 4805 gene locus_tag LOCUS_10680 4626 4805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 5158 5523 gene locus_tag LOCUS_10690 5158 5523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 5671 7701 gene locus_tag LOCUS_10700 gene nadE 5671 7701 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192277.1 protein_id gnl|my_center|LOCUS_10700 8976 7792 gene locus_tag LOCUS_10710 8976 7792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004541251.1 protein_id gnl|my_center|LOCUS_10710 >Feature sequence0106 2117 1464 gene locus_tag LOCUS_10720 2117 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 3605 2136 gene locus_tag LOCUS_10730 3605 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791097.1 protein_id gnl|my_center|LOCUS_10730 7089 3634 gene locus_tag LOCUS_10740 7089 3634 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405543.1 protein_id gnl|my_center|LOCUS_10740 8134 7124 gene locus_tag LOCUS_10750 8134 7124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 8421 8185 gene locus_tag LOCUS_10760 8421 8185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 8847 8566 gene locus_tag LOCUS_10770 8847 8566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 >Feature sequence0107 2915 879 gene locus_tag LOCUS_10780 2915 879 CDS product xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117861.1 protein_id gnl|my_center|LOCUS_10780 3646 2951 gene locus_tag LOCUS_10790 3646 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 4491 3907 gene locus_tag LOCUS_10800 4491 3907 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104154.1 protein_id gnl|my_center|LOCUS_10800 5285 4473 gene locus_tag LOCUS_10810 gene cheR 5285 4473 CDS product chemotaxis protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429025.1 protein_id gnl|my_center|LOCUS_10810 5669 5292 gene locus_tag LOCUS_10820 5669 5292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10820 <9010 5681 gene locus_tag LOCUS_10830 <9010 5681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NMY0:histidine kinase >Feature sequence0108 801 163 gene locus_tag LOCUS_10840 801 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 1904 813 gene locus_tag LOCUS_10850 1904 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 3932 1917 gene locus_tag LOCUS_10860 3932 1917 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109421.1 protein_id gnl|my_center|LOCUS_10860 4979 4650 gene locus_tag LOCUS_10870 4979 4650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 5664 5245 gene locus_tag LOCUS_10880 5664 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 6019 5714 gene locus_tag LOCUS_10890 6019 5714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 6708 6022 gene locus_tag LOCUS_10900 6708 6022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 6965 7132 gene locus_tag LOCUS_10910 6965 7132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 7448 8053 gene locus_tag LOCUS_10920 7448 8053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 8114 8479 gene locus_tag LOCUS_10930 8114 8479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 >Feature sequence0109 5153 4017 gene locus_tag LOCUS_10940 5153 4017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 6370 5207 gene locus_tag LOCUS_10950 6370 5207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 7536 6370 gene locus_tag LOCUS_10960 7536 6370 CDS product putative adenine-specific methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q50290 protein_id gnl|my_center|LOCUS_10960 8287 7664 gene locus_tag LOCUS_10970 8287 7664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 8825 8289 gene locus_tag LOCUS_10980 8825 8289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 >Feature sequence0110 3793 407 gene locus_tag LOCUS_10990 3793 407 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_10990 5059 3980 gene locus_tag LOCUS_11000 5059 3980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 5690 5121 gene locus_tag LOCUS_11010 5690 5121 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766891.1 protein_id gnl|my_center|LOCUS_11010 6146 7279 gene locus_tag LOCUS_11020 gene pntAA 6146 7279 CDS product NAD(P) transhydrogenase subunit alpha part 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSB2 protein_id gnl|my_center|LOCUS_11020 7429 7710 gene locus_tag LOCUS_11030 7429 7710 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325302.1 protein_id gnl|my_center|LOCUS_11030 >Feature sequence0111 <1 579 gene locus_tag LOCUS_11040 <1 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403534.1:esterase 1456 704 gene locus_tag LOCUS_11050 1456 704 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107255.1 protein_id gnl|my_center|LOCUS_11050 1657 2826 gene locus_tag LOCUS_11060 gene iscS 1657 2826 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P0D4 protein_id gnl|my_center|LOCUS_11060 2886 3386 gene locus_tag LOCUS_11070 gene greB 2886 3386 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MFI0 protein_id gnl|my_center|LOCUS_11070 4858 3416 gene locus_tag LOCUS_11080 4858 3416 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140567.1 protein_id gnl|my_center|LOCUS_11080 5107 6090 gene locus_tag LOCUS_11090 5107 6090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 6258 6707 gene locus_tag LOCUS_11100 6258 6707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 6747 7226 gene locus_tag LOCUS_11110 6747 7226 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_11110 >Feature sequence0112 948 34 gene locus_tag LOCUS_11120 gene natA 948 34 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_11120 1584 1147 gene locus_tag LOCUS_11130 1584 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 1815 3125 gene locus_tag LOCUS_11140 gene gltP 1815 3125 CDS product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_11140 3251 5146 gene locus_tag LOCUS_11150 3251 5146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 5468 8383 gene locus_tag LOCUS_11160 5468 8383 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798907.1 protein_id gnl|my_center|LOCUS_11160 >Feature sequence0113 <1 932 gene locus_tag LOCUS_11170 <1 932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107805.1:AI-2E family transporter 1116 1553 gene locus_tag LOCUS_11180 1116 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 1614 2357 gene locus_tag LOCUS_11190 1614 2357 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814727.1 protein_id gnl|my_center|LOCUS_11190 2433 3632 gene locus_tag LOCUS_11200 gene macA 2433 3632 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941134.1 protein_id gnl|my_center|LOCUS_11200 4354 3647 gene locus_tag LOCUS_11210 4354 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 5292 4474 gene locus_tag LOCUS_11220 5292 4474 CDS product zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_11220 5579 6364 gene locus_tag LOCUS_11230 gene yagT 5579 6364 CDS product aldehyde dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037859.1 protein_id gnl|my_center|LOCUS_11230 6516 7511 gene locus_tag LOCUS_11240 6516 7511 CDS product FAD-binding molybdopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268938.1 protein_id gnl|my_center|LOCUS_11240 >Feature sequence0114 1296 22 gene locus_tag LOCUS_11250 1296 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123792.1 protein_id gnl|my_center|LOCUS_11250 3039 1402 gene locus_tag LOCUS_11260 3039 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 6589 3179 gene locus_tag LOCUS_11270 6589 3179 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_11270 6926 6726 gene locus_tag LOCUS_11280 6926 6726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 7681 7142 gene locus_tag LOCUS_11290 7681 7142 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108581.1 protein_id gnl|my_center|LOCUS_11290 >Feature sequence0115 772 602 gene locus_tag LOCUS_11300 772 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 1504 800 gene locus_tag LOCUS_11310 1504 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 2393 4747 gene locus_tag LOCUS_11320 2393 4747 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 protein_id gnl|my_center|LOCUS_11320 4902 7334 gene locus_tag LOCUS_11330 4902 7334 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_11330 >Feature sequence0116 88 2037 gene locus_tag LOCUS_11340 88 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 2280 4028 gene locus_tag LOCUS_11350 2280 4028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 4561 6876 gene locus_tag LOCUS_11360 4561 6876 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963986.1 protein_id gnl|my_center|LOCUS_11360 7007 8236 gene locus_tag LOCUS_11370 7007 8236 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104094.1 protein_id gnl|my_center|LOCUS_11370 8258 8551 gene locus_tag LOCUS_11380 8258 8551 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404552.1 protein_id gnl|my_center|LOCUS_11380 >Feature sequence0117 1518 1898 gene locus_tag LOCUS_11390 1518 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 3042 1969 gene locus_tag LOCUS_11400 3042 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962872.1 protein_id gnl|my_center|LOCUS_11400 3264 3827 gene locus_tag LOCUS_11410 3264 3827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 4033 3958 gene locus_tag LOCUS_t00090 4033 3958 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4826 4143 gene locus_tag LOCUS_11420 gene porT 4826 4143 CDS product PorT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962497.1 protein_id gnl|my_center|LOCUS_11420 5560 4832 gene locus_tag LOCUS_11430 gene menG 5560 4832 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG7 protein_id gnl|my_center|LOCUS_11430 5754 6920 gene locus_tag LOCUS_11440 5754 6920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 <8693 7007 gene locus_tag LOCUS_11450 <8693 7007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962373.1:amidophosphoribosyltransferase >Feature sequence0118 3376 350 gene locus_tag LOCUS_11460 3376 350 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962291.1 protein_id gnl|my_center|LOCUS_11460 3849 4916 gene locus_tag LOCUS_11470 3849 4916 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791384.1 protein_id gnl|my_center|LOCUS_11470 6004 4973 gene locus_tag LOCUS_11480 gene thiL 6004 4973 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H207 protein_id gnl|my_center|LOCUS_11480 6582 6082 gene locus_tag LOCUS_11490 6582 6082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 6691 6918 gene locus_tag LOCUS_11500 6691 6918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 6915 7763 gene locus_tag LOCUS_11510 6915 7763 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767088.1 protein_id gnl|my_center|LOCUS_11510 >Feature sequence0119 1061 189 gene locus_tag LOCUS_11520 1061 189 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119308.1 protein_id gnl|my_center|LOCUS_11520 1210 2040 gene locus_tag LOCUS_11530 1210 2040 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123406.1 protein_id gnl|my_center|LOCUS_11530 2191 3312 gene locus_tag LOCUS_11540 2191 3312 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_11540 3379 7125 gene locus_tag LOCUS_11550 3379 7125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 7751 7281 gene locus_tag LOCUS_11560 7751 7281 CDS product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036724.1 protein_id gnl|my_center|LOCUS_11560 >Feature sequence0120 720 118 gene locus_tag LOCUS_11570 720 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 1312 842 gene locus_tag LOCUS_11580 1312 842 CDS product DUF1456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073612.1 protein_id gnl|my_center|LOCUS_11580 3093 1435 gene locus_tag LOCUS_11590 3093 1435 CDS product sodium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403056.1 protein_id gnl|my_center|LOCUS_11590 3842 3291 gene locus_tag LOCUS_11600 3842 3291 CDS product fasciclin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038746.1 protein_id gnl|my_center|LOCUS_11600 5139 4171 gene locus_tag LOCUS_11610 5139 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404936.1 protein_id gnl|my_center|LOCUS_11610 6253 5027 gene locus_tag LOCUS_11620 gene crtY 6253 5027 CDS product lycopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963565.1 protein_id gnl|my_center|LOCUS_11620 7127 6375 gene locus_tag LOCUS_11630 7127 6375 CDS product xanthorhodopsin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404249.1 protein_id gnl|my_center|LOCUS_11630 7700 8212 gene locus_tag LOCUS_11640 7700 8212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11640 >Feature sequence0121 2 997 gene locus_tag LOCUS_11650 2 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 4527 1075 gene locus_tag LOCUS_11660 4527 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 5825 4566 gene locus_tag LOCUS_11670 5825 4566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 7428 5866 gene locus_tag LOCUS_11680 7428 5866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 <8538 7800 gene locus_tag LOCUS_11690 <8538 7800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64TJ3:tricorn protease >Feature sequence0122 1497 1129 gene locus_tag LOCUS_11700 1497 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 2644 1655 gene locus_tag LOCUS_11710 2644 1655 CDS product ISAs1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957722.1 protein_id gnl|my_center|LOCUS_11710 2877 3335 gene locus_tag LOCUS_11720 2877 3335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 4117 3437 gene locus_tag LOCUS_11730 4117 3437 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW2 protein_id gnl|my_center|LOCUS_11730 4230 4838 gene locus_tag LOCUS_11740 4230 4838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 5231 5461 gene locus_tag LOCUS_11750 5231 5461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 5649 5999 gene locus_tag LOCUS_11760 5649 5999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 6229 7185 gene locus_tag LOCUS_11770 gene metF 6229 7185 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0T1 protein_id gnl|my_center|LOCUS_11770 7656 7333 gene locus_tag LOCUS_11780 7656 7333 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZQ7 protein_id gnl|my_center|LOCUS_11780 <8527 7758 gene locus_tag LOCUS_11790 <8527 7758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A2I6:signal peptidase I >Feature sequence0123 138 317 gene locus_tag LOCUS_11800 138 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 503 1012 gene locus_tag LOCUS_11810 503 1012 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYT0 protein_id gnl|my_center|LOCUS_11810 1400 1161 gene locus_tag LOCUS_11820 1400 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 1763 2665 gene locus_tag LOCUS_11830 1763 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 3315 4133 gene locus_tag LOCUS_11840 3315 4133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 4163 5254 gene locus_tag LOCUS_11850 4163 5254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 5251 6021 gene locus_tag LOCUS_11860 5251 6021 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791451.1 protein_id gnl|my_center|LOCUS_11860 6821 6018 gene locus_tag LOCUS_11870 6821 6018 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976314.1 protein_id gnl|my_center|LOCUS_11870 <8486 6882 gene locus_tag LOCUS_11880 <8486 6882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010976013.1:dihydroxy-acid dehydratase >Feature sequence0124 530 1582 gene locus_tag LOCUS_11890 530 1582 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403627.1 protein_id gnl|my_center|LOCUS_11890 1579 2280 gene locus_tag LOCUS_11900 1579 2280 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038463.1 protein_id gnl|my_center|LOCUS_11900 2329 2628 gene locus_tag LOCUS_11910 2329 2628 CDS product DabB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640452.1 protein_id gnl|my_center|LOCUS_11910 3721 2705 gene locus_tag LOCUS_11920 3721 2705 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644533.1 protein_id gnl|my_center|LOCUS_11920 4614 3802 gene locus_tag LOCUS_11930 gene murQ 4614 3802 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXK5 protein_id gnl|my_center|LOCUS_11930 5000 6697 gene locus_tag LOCUS_11940 gene ilvD 5000 6697 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT7 protein_id gnl|my_center|LOCUS_11940 >Feature sequence0125 3155 783 gene locus_tag LOCUS_11950 3155 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 5035 3233 gene locus_tag LOCUS_11960 5035 3233 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108167.1 protein_id gnl|my_center|LOCUS_11960 8396 5109 gene locus_tag LOCUS_11970 8396 5109 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_11970 >Feature sequence0126 <1 2724 gene locus_tag LOCUS_11980 <1 2724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107158.1:SusC/RagA family TonB-linked outer membrane protein 2759 4321 gene locus_tag LOCUS_11990 2759 4321 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_11990 5124 4381 gene locus_tag LOCUS_12000 5124 4381 CDS product acyl-ACP thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263557.1 protein_id gnl|my_center|LOCUS_12000 5633 7015 gene locus_tag LOCUS_12010 5633 7015 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119180.1 protein_id gnl|my_center|LOCUS_12010 7288 7097 gene locus_tag LOCUS_12020 7288 7097 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_12020 >Feature sequence0127 170 409 gene locus_tag LOCUS_12030 170 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 406 789 gene locus_tag LOCUS_12040 406 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 2405 942 gene locus_tag LOCUS_12050 2405 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 3916 2492 gene locus_tag LOCUS_12060 3916 2492 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798159.1 protein_id gnl|my_center|LOCUS_12060 4156 6387 gene locus_tag LOCUS_12070 4156 6387 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814008.1 protein_id gnl|my_center|LOCUS_12070 >Feature sequence0128 <1 826 gene locus_tag LOCUS_12080 <1 826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937475.1:cation transporter 887 1816 gene locus_tag LOCUS_12090 887 1816 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123934.1 protein_id gnl|my_center|LOCUS_12090 2623 1916 gene locus_tag LOCUS_12100 2623 1916 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 protein_id gnl|my_center|LOCUS_12100 3391 2690 gene locus_tag LOCUS_12110 gene folE2 3391 2690 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX79 protein_id gnl|my_center|LOCUS_12110 3770 3351 gene locus_tag LOCUS_12120 gene ygcM 3770 3351 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I4 protein_id gnl|my_center|LOCUS_12120 4092 5444 gene locus_tag LOCUS_12130 gene nagA 4092 5444 CDS product alpha-N-acetylgalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECL7 protein_id gnl|my_center|LOCUS_12130 5518 6741 gene locus_tag LOCUS_12140 gene gluP 5518 6741 CDS product glucose/galactose MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038511.1 protein_id gnl|my_center|LOCUS_12140 >Feature sequence0129 872 588 gene locus_tag LOCUS_12150 872 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 2052 1015 gene locus_tag LOCUS_12160 2052 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 2288 2437 gene locus_tag LOCUS_12170 2288 2437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 2805 3908 gene locus_tag LOCUS_12180 2805 3908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 3973 4458 gene locus_tag LOCUS_12190 3973 4458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 4463 4687 gene locus_tag LOCUS_12200 4463 4687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 4716 5045 gene locus_tag LOCUS_12210 4716 5045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 5118 6497 gene locus_tag LOCUS_12220 5118 6497 CDS product chromosome segregation ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195116.1 protein_id gnl|my_center|LOCUS_12220 >Feature sequence0130 932 1318 gene locus_tag LOCUS_12230 932 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 1578 2033 gene locus_tag LOCUS_12240 1578 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 2023 2586 gene locus_tag LOCUS_12250 2023 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 2818 3165 gene locus_tag LOCUS_12260 2818 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 5278 3794 gene locus_tag LOCUS_12270 5278 3794 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258272.1 protein_id gnl|my_center|LOCUS_12270 6831 5362 gene locus_tag LOCUS_12280 6831 5362 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808616.1 protein_id gnl|my_center|LOCUS_12280 >Feature sequence0131 181 399 gene locus_tag LOCUS_12290 gene infA 181 399 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A498 protein_id gnl|my_center|LOCUS_12290 567 944 gene locus_tag LOCUS_12300 gene rpsM 567 944 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ76 protein_id gnl|my_center|LOCUS_12300 995 1390 gene locus_tag LOCUS_12310 gene rpsK 995 1390 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ75 protein_id gnl|my_center|LOCUS_12310 1484 2089 gene locus_tag LOCUS_12320 gene rpsD 1484 2089 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4A1 protein_id gnl|my_center|LOCUS_12320 2265 3215 gene locus_tag LOCUS_12330 gene rpoA 2265 3215 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4A2 protein_id gnl|my_center|LOCUS_12330 3358 4035 gene locus_tag LOCUS_12340 3358 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 4184 5290 gene locus_tag LOCUS_12350 gene carA 4184 5290 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ71 protein_id gnl|my_center|LOCUS_12350 6178 5366 gene locus_tag LOCUS_12360 6178 5366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 7011 6301 gene locus_tag LOCUS_12370 7011 6301 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964101.1 protein_id gnl|my_center|LOCUS_12370 >Feature sequence0132 545 943 gene locus_tag LOCUS_12380 545 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12380 1447 2184 gene locus_tag LOCUS_12390 gene accD 1447 2184 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG2 protein_id gnl|my_center|LOCUS_12390 2187 3164 gene locus_tag LOCUS_12400 2187 3164 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057690.1 protein_id gnl|my_center|LOCUS_12400 3641 3168 gene locus_tag LOCUS_12410 3641 3168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404629.1 protein_id gnl|my_center|LOCUS_12410 3701 4159 gene locus_tag LOCUS_12420 gene smpB 3701 4159 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0S6 protein_id gnl|my_center|LOCUS_12420 4581 4333 gene locus_tag LOCUS_12430 4581 4333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 5125 6954 gene locus_tag LOCUS_12440 5125 6954 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_12440 7026 7097 gene locus_tag LOCUS_t00100 7026 7097 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0133 1089 304 gene locus_tag LOCUS_12450 1089 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 2082 1264 gene locus_tag LOCUS_12460 2082 1264 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A033 protein_id gnl|my_center|LOCUS_12460 3376 2366 gene locus_tag LOCUS_12470 3376 2366 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531457.1 protein_id gnl|my_center|LOCUS_12470 3593 4288 gene locus_tag LOCUS_12480 3593 4288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 4393 6645 gene locus_tag LOCUS_12490 4393 6645 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TA4 protein_id gnl|my_center|LOCUS_12490 6755 8221 gene locus_tag LOCUS_12500 6755 8221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107406.1 protein_id gnl|my_center|LOCUS_12500 >Feature sequence0134 158 5290 gene locus_tag LOCUS_12510 158 5290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 5302 5727 gene locus_tag LOCUS_12520 5302 5727 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977989.1 protein_id gnl|my_center|LOCUS_12520 6378 5788 gene locus_tag LOCUS_12530 6378 5788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 7149 6406 gene locus_tag LOCUS_12540 gene truA 7149 6406 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XV0 protein_id gnl|my_center|LOCUS_12540 >Feature sequence0135 1261 2670 gene locus_tag LOCUS_12550 1261 2670 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919252.1 protein_id gnl|my_center|LOCUS_12550 3433 2747 gene locus_tag LOCUS_12560 gene mtgA 3433 2747 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZM52 protein_id gnl|my_center|LOCUS_12560 3542 4822 gene locus_tag LOCUS_12570 3542 4822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769170.1 protein_id gnl|my_center|LOCUS_12570 5019 4819 gene locus_tag LOCUS_12580 5019 4819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 6476 5040 gene locus_tag LOCUS_12590 6476 5040 CDS product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108074.1 protein_id gnl|my_center|LOCUS_12590 6621 7997 gene locus_tag LOCUS_12600 6621 7997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582791.1 protein_id gnl|my_center|LOCUS_12600 >Feature sequence0136 3203 174 gene locus_tag LOCUS_12610 3203 174 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_12610 4775 6919 gene locus_tag LOCUS_12620 4775 6919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 >Feature sequence0137 1786 956 gene locus_tag LOCUS_12630 gene prmA 1786 956 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VV4 protein_id gnl|my_center|LOCUS_12630 3170 1932 gene locus_tag LOCUS_12640 3170 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 3976 3263 gene locus_tag LOCUS_12650 3976 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 5050 4073 gene locus_tag LOCUS_12660 5050 4073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 6434 5121 gene locus_tag LOCUS_12670 6434 5121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 6559 7107 gene locus_tag LOCUS_12680 6559 7107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 7159 7956 gene locus_tag LOCUS_12690 7159 7956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 >Feature sequence0138 655 41 gene locus_tag LOCUS_12700 655 41 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020461.1 protein_id gnl|my_center|LOCUS_12700 1603 677 gene locus_tag LOCUS_12710 1603 677 CDS product aldehyde oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088295.1 protein_id gnl|my_center|LOCUS_12710 2216 1743 gene locus_tag LOCUS_12720 2216 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 2668 2216 gene locus_tag LOCUS_12730 2668 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 2855 3772 gene locus_tag LOCUS_12740 2855 3772 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_12740 3902 4357 gene locus_tag LOCUS_12750 3902 4357 CDS product isoquinoline 1-oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917912.1 protein_id gnl|my_center|LOCUS_12750 4489 6747 gene locus_tag LOCUS_12760 4489 6747 CDS product isoquinoline 1-oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_12760 6938 7771 gene locus_tag LOCUS_12770 6938 7771 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207883.1 protein_id gnl|my_center|LOCUS_12770 7849 8094 gene locus_tag LOCUS_12780 7849 8094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 >Feature sequence0139 <1 561 gene locus_tag LOCUS_12790 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000633861.1:ABC transporter ATP-binding protein 2088 613 gene locus_tag LOCUS_12800 2088 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 2794 2150 gene locus_tag LOCUS_12810 2794 2150 CDS product transcriptional initiation protein Tat inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405240.1 protein_id gnl|my_center|LOCUS_12810 4283 2856 gene locus_tag LOCUS_12820 4283 2856 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405241.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12820 4808 5785 gene locus_tag LOCUS_12830 4808 5785 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZW3 protein_id gnl|my_center|LOCUS_12830 7306 5876 gene locus_tag LOCUS_12840 7306 5876 CDS product ATP-dependent exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362006.1 protein_id gnl|my_center|LOCUS_12840 7532 7975 gene locus_tag LOCUS_12850 7532 7975 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112686.1 protein_id gnl|my_center|LOCUS_12850 >Feature sequence0140 3490 509 gene locus_tag LOCUS_12860 3490 509 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_12860 4192 3506 gene locus_tag LOCUS_12870 4192 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12870 5413 4409 gene locus_tag LOCUS_12880 5413 4409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 6215 5748 gene locus_tag LOCUS_12890 6215 5748 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798225.1 protein_id gnl|my_center|LOCUS_12890 7294 6914 gene locus_tag LOCUS_12900 7294 6914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 7469 7323 gene locus_tag LOCUS_12910 7469 7323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12910 8136 7747 gene locus_tag LOCUS_12920 8136 7747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 >Feature sequence0141 1176 76 gene locus_tag LOCUS_12930 1176 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202653.1 protein_id gnl|my_center|LOCUS_12930 1930 1199 gene locus_tag LOCUS_12940 1930 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 3024 2080 gene locus_tag LOCUS_12950 3024 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 4841 3021 gene locus_tag LOCUS_12960 4841 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 5354 4845 gene locus_tag LOCUS_12970 5354 4845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 5819 5385 gene locus_tag LOCUS_12980 5819 5385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 7632 5824 gene locus_tag LOCUS_12990 7632 5824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202657.1 protein_id gnl|my_center|LOCUS_12990 8135 7683 gene locus_tag LOCUS_13000 8135 7683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 >Feature sequence0142 <1 635 gene locus_tag LOCUS_13010 <1 635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963061.1:peptidase M61 1664 717 gene locus_tag LOCUS_13020 1664 717 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338139.1 protein_id gnl|my_center|LOCUS_13020 3871 2339 gene locus_tag LOCUS_13030 3871 2339 CDS product microcystin degradation protein MlrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030661.1 protein_id gnl|my_center|LOCUS_13030 4237 5373 gene locus_tag LOCUS_13040 4237 5373 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087744.1 protein_id gnl|my_center|LOCUS_13040 5463 5693 gene locus_tag LOCUS_13050 5463 5693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 5686 6003 gene locus_tag LOCUS_13060 5686 6003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 6085 7965 gene locus_tag LOCUS_13070 gene ggt 6085 7965 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974101.1 protein_id gnl|my_center|LOCUS_13070 >Feature sequence0143 3598 2261 gene locus_tag LOCUS_13080 gene tilS 3598 2261 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H020 protein_id gnl|my_center|LOCUS_13080 3749 5362 gene locus_tag LOCUS_13090 3749 5362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993642.1 protein_id gnl|my_center|LOCUS_13090 5544 6170 gene locus_tag LOCUS_13100 5544 6170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 6245 7156 gene locus_tag LOCUS_13110 6245 7156 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788200.1 protein_id gnl|my_center|LOCUS_13110 7188 7502 gene locus_tag LOCUS_13120 7188 7502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004299989.1 protein_id gnl|my_center|LOCUS_13120 >Feature sequence0144 1176 1838 gene locus_tag LOCUS_13130 1176 1838 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256831.1 protein_id gnl|my_center|LOCUS_13130 1962 5654 gene locus_tag LOCUS_13140 1962 5654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 5747 6196 gene locus_tag LOCUS_13150 5747 6196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 7002 6433 gene locus_tag LOCUS_13160 7002 6433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 >Feature sequence0145 1820 492 gene locus_tag LOCUS_13170 1820 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 2228 1890 gene locus_tag LOCUS_13180 2228 1890 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405177.1 protein_id gnl|my_center|LOCUS_13180 2582 6715 gene locus_tag LOCUS_13190 2582 6715 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_13190 7041 7415 gene locus_tag LOCUS_13200 7041 7415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 >Feature sequence0146 <1 847 gene locus_tag LOCUS_13210 <1 847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962867.1:cysteine desulfurase 1520 927 gene locus_tag LOCUS_13220 1520 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 2682 1618 gene locus_tag LOCUS_13230 gene hemH 2682 1618 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYE7 protein_id gnl|my_center|LOCUS_13230 3545 2787 gene locus_tag LOCUS_13240 3545 2787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 4760 3675 gene locus_tag LOCUS_13250 gene nuoH 4760 3675 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEB9 protein_id gnl|my_center|LOCUS_13250 6357 4906 gene locus_tag LOCUS_13260 gene asnS 6357 4906 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T2 protein_id gnl|my_center|LOCUS_13260 >Feature sequence0147 4835 1614 gene locus_tag LOCUS_13270 4835 1614 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202118.1 protein_id gnl|my_center|LOCUS_13270 7186 5405 gene locus_tag LOCUS_13280 7186 5405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784783.1 protein_id gnl|my_center|LOCUS_13280 <8074 7232 gene locus_tag LOCUS_13290 <8074 7232 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202118.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence0148 <1 893 gene locus_tag LOCUS_13300 <1 893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963716.1:TonB-dependent receptor 1005 1190 gene locus_tag LOCUS_13310 1005 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13310 1368 2291 gene locus_tag LOCUS_13320 1368 2291 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402958.1 protein_id gnl|my_center|LOCUS_13320 2288 5908 gene locus_tag LOCUS_13330 2288 5908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402959.1 protein_id gnl|my_center|LOCUS_13330 >Feature sequence0149 2172 1198 gene locus_tag LOCUS_13340 2172 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 2356 3102 gene locus_tag LOCUS_13350 gene ebs 2356 3102 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880557.1 protein_id gnl|my_center|LOCUS_13350 3977 3240 gene locus_tag LOCUS_13360 3977 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 6481 4178 gene locus_tag LOCUS_13370 6481 4178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 6701 7003 gene locus_tag LOCUS_13380 6701 7003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 7406 7158 gene locus_tag LOCUS_13390 7406 7158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 >Feature sequence0150 855 22 gene locus_tag LOCUS_13400 855 22 CDS product semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969407.1 protein_id gnl|my_center|LOCUS_13400 1686 865 gene locus_tag LOCUS_13410 1686 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 1831 2709 gene locus_tag LOCUS_13420 1831 2709 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767385.1 protein_id gnl|my_center|LOCUS_13420 2780 3373 gene locus_tag LOCUS_13430 2780 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 3379 4668 gene locus_tag LOCUS_13440 3379 4668 CDS product N-glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707052.1 protein_id gnl|my_center|LOCUS_13440 6418 4721 gene locus_tag LOCUS_13450 6418 4721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 7495 6473 gene locus_tag LOCUS_13460 7495 6473 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760322.1 protein_id gnl|my_center|LOCUS_13460 >Feature sequence0151 560 2647 gene locus_tag LOCUS_13470 560 2647 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119288.1 protein_id gnl|my_center|LOCUS_13470 2657 3802 gene locus_tag LOCUS_13480 2657 3802 CDS product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583041.1 protein_id gnl|my_center|LOCUS_13480 4064 4327 gene locus_tag LOCUS_13490 4064 4327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 4381 5109 gene locus_tag LOCUS_13500 4381 5109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 5216 6136 gene locus_tag LOCUS_13510 gene lolI 5216 6136 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122269.1 protein_id gnl|my_center|LOCUS_13510 7562 6396 gene locus_tag LOCUS_13520 7562 6396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 >Feature sequence0152 3 1241 gene locus_tag LOCUS_13530 3 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 1432 3150 gene locus_tag LOCUS_13540 1432 3150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 3473 3832 gene locus_tag LOCUS_13550 3473 3832 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 protein_id gnl|my_center|LOCUS_13550 3868 6411 gene locus_tag LOCUS_13560 3868 6411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 6497 7189 gene locus_tag LOCUS_13570 6497 7189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 7298 7630 gene locus_tag LOCUS_13580 7298 7630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811823.1 protein_id gnl|my_center|LOCUS_13580 >Feature sequence0153 390 692 gene locus_tag LOCUS_13590 390 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 878 1183 gene locus_tag LOCUS_13600 878 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 1763 1560 gene locus_tag LOCUS_13610 1763 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 2526 2290 gene locus_tag LOCUS_13620 2526 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 3237 3488 gene locus_tag LOCUS_13630 3237 3488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 4418 3498 gene locus_tag LOCUS_13640 4418 3498 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109282.1 protein_id gnl|my_center|LOCUS_13640 4737 5204 gene locus_tag LOCUS_13650 4737 5204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 6291 5383 gene locus_tag LOCUS_13660 6291 5383 CDS product L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097437.1 protein_id gnl|my_center|LOCUS_13660 7793 6288 gene locus_tag LOCUS_13670 gene mqo 7793 6288 CDS product putative malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E6 protein_id gnl|my_center|LOCUS_13670 >Feature sequence0154 183 1028 gene locus_tag LOCUS_13680 183 1028 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970029.1 protein_id gnl|my_center|LOCUS_13680 1182 2882 gene locus_tag LOCUS_13690 gene fadD 1182 2882 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084137.1 protein_id gnl|my_center|LOCUS_13690 3041 3778 gene locus_tag LOCUS_13700 3041 3778 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962331.1 protein_id gnl|my_center|LOCUS_13700 3873 5075 gene locus_tag LOCUS_13710 3873 5075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946837.1 protein_id gnl|my_center|LOCUS_13710 5246 6202 gene locus_tag LOCUS_13720 gene mscS-2 5246 6202 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942953.1 protein_id gnl|my_center|LOCUS_13720 6311 7183 gene locus_tag LOCUS_13730 6311 7183 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ43 protein_id gnl|my_center|LOCUS_13730 >Feature sequence0155 1418 921 gene locus_tag LOCUS_13740 gene nuoE 1418 921 CDS product NADH dehydrogenase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964318.1 protein_id gnl|my_center|LOCUS_13740 2726 1497 gene locus_tag LOCUS_13750 gene nuoD 2726 1497 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1R1 protein_id gnl|my_center|LOCUS_13750 3323 2823 gene locus_tag LOCUS_13760 gene nuoC 3323 2823 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1R2 protein_id gnl|my_center|LOCUS_13760 3879 3334 gene locus_tag LOCUS_13770 gene nuoB 3879 3334 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1R3 protein_id gnl|my_center|LOCUS_13770 4288 3914 gene locus_tag LOCUS_13780 gene nuoA 4288 3914 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1R4 protein_id gnl|my_center|LOCUS_13780 6583 4490 gene locus_tag LOCUS_13790 6583 4490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 >Feature sequence0156 1530 541 gene locus_tag LOCUS_13800 1530 541 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887835.1 protein_id gnl|my_center|LOCUS_13800 1602 2534 gene locus_tag LOCUS_13810 1602 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107505.1 protein_id gnl|my_center|LOCUS_13810 2583 3941 gene locus_tag LOCUS_13820 2583 3941 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947961.1 protein_id gnl|my_center|LOCUS_13820 3971 5011 gene locus_tag LOCUS_13830 3971 5011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 5047 5895 gene locus_tag LOCUS_13840 gene nagD 5047 5895 CDS product acid sugar phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DH38 protein_id gnl|my_center|LOCUS_13840 6846 5917 gene locus_tag LOCUS_13850 6846 5917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227986.1 protein_id gnl|my_center|LOCUS_13850 7340 6819 gene locus_tag LOCUS_13860 7340 6819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 >Feature sequence0157 1771 581 gene locus_tag LOCUS_13870 1771 581 CDS product dehydrogenase MviM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706516.1 protein_id gnl|my_center|LOCUS_13870 3295 1850 gene locus_tag LOCUS_13880 3295 1850 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963148.1 protein_id gnl|my_center|LOCUS_13880 3726 3301 gene locus_tag LOCUS_13890 3726 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120045.1 protein_id gnl|my_center|LOCUS_13890 3973 6198 gene locus_tag LOCUS_13900 3973 6198 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768395.1 protein_id gnl|my_center|LOCUS_13900 6333 6644 gene locus_tag LOCUS_13910 6333 6644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 >Feature sequence0158 <1 795 gene locus_tag LOCUS_13920 <1 795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963945.1:DUF4835 domain-containing protein 818 1057 gene locus_tag LOCUS_13930 818 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 1182 2873 gene locus_tag LOCUS_13940 1182 2873 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A813 protein_id gnl|my_center|LOCUS_13940 2893 3327 gene locus_tag LOCUS_13950 2893 3327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 3473 4030 gene locus_tag LOCUS_13960 3473 4030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 4027 4455 gene locus_tag LOCUS_13970 4027 4455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 5044 4460 gene locus_tag LOCUS_13980 5044 4460 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109225.1 protein_id gnl|my_center|LOCUS_13980 6383 5088 gene locus_tag LOCUS_13990 6383 5088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 7026 6361 gene locus_tag LOCUS_14000 7026 6361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 >Feature sequence0159 1338 208 gene locus_tag LOCUS_14010 1338 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 4115 1368 gene locus_tag LOCUS_14020 4115 1368 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202132.1 protein_id gnl|my_center|LOCUS_14020 4795 4112 gene locus_tag LOCUS_14030 4795 4112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 5066 6010 gene locus_tag LOCUS_14040 gene corA-2 5066 6010 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747E5 protein_id gnl|my_center|LOCUS_14040 7220 6045 gene locus_tag LOCUS_14050 7220 6045 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229252.1 protein_id gnl|my_center|LOCUS_14050 >Feature sequence0160 212 1714 gene locus_tag LOCUS_14060 212 1714 CDS product C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001253926.1 protein_id gnl|my_center|LOCUS_14060 1889 2620 gene locus_tag LOCUS_14070 1889 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 3536 2727 gene locus_tag LOCUS_14080 3536 2727 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788251.1 protein_id gnl|my_center|LOCUS_14080 4133 3684 gene locus_tag LOCUS_14090 4133 3684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 4170 4346 gene locus_tag LOCUS_14100 4170 4346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 4467 5534 gene locus_tag LOCUS_14110 4467 5534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 6684 5644 gene locus_tag LOCUS_14120 6684 5644 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265797.1 protein_id gnl|my_center|LOCUS_14120 7324 6764 gene locus_tag LOCUS_14130 7324 6764 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S591 protein_id gnl|my_center|LOCUS_14130 >Feature sequence0161 355 897 gene locus_tag LOCUS_14140 355 897 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483964.1 protein_id gnl|my_center|LOCUS_14140 1156 1554 gene locus_tag LOCUS_14150 1156 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 2113 1661 gene locus_tag LOCUS_14160 2113 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 2434 3351 gene locus_tag LOCUS_14170 2434 3351 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789714.1 protein_id gnl|my_center|LOCUS_14170 3348 3638 gene locus_tag LOCUS_14180 3348 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763244.1 protein_id gnl|my_center|LOCUS_14180 3724 4308 gene locus_tag LOCUS_14190 3724 4308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 6697 4457 gene locus_tag LOCUS_14200 6697 4457 CDS product folate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141367.1 protein_id gnl|my_center|LOCUS_14200 6883 7491 gene locus_tag LOCUS_14210 6883 7491 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963973.1 protein_id gnl|my_center|LOCUS_14210 >Feature sequence0162 400 831 gene locus_tag LOCUS_14220 400 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 932 1387 gene locus_tag LOCUS_14230 932 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 1488 2399 gene locus_tag LOCUS_14240 1488 2399 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263960.1 protein_id gnl|my_center|LOCUS_14240 2592 2822 gene locus_tag LOCUS_14250 2592 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 3306 3734 gene locus_tag LOCUS_14260 3306 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 4940 5896 gene locus_tag LOCUS_14270 4940 5896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 6161 7075 gene locus_tag LOCUS_14280 6161 7075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 >Feature sequence0163 1308 181 gene locus_tag LOCUS_14290 1308 181 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962384.1 protein_id gnl|my_center|LOCUS_14290 1826 1383 gene locus_tag LOCUS_14300 gene rplI 1826 1383 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5S7 protein_id gnl|my_center|LOCUS_14300 2100 1849 gene locus_tag LOCUS_14310 gene rpsR 2100 1849 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P2 protein_id gnl|my_center|LOCUS_14310 2475 2104 gene locus_tag LOCUS_14320 gene rpsF 2475 2104 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5S5 protein_id gnl|my_center|LOCUS_14320 3536 2595 gene locus_tag LOCUS_14330 3536 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 3668 4330 gene locus_tag LOCUS_14340 3668 4330 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964017.1 protein_id gnl|my_center|LOCUS_14340 5369 4308 gene locus_tag LOCUS_14350 gene xapJ 5369 4308 CDS product heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942153.1 protein_id gnl|my_center|LOCUS_14350 5488 5865 gene locus_tag LOCUS_14360 5488 5865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144314.1 protein_id gnl|my_center|LOCUS_14360 7210 6185 gene locus_tag LOCUS_14370 7210 6185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 >Feature sequence0164 <1 888 gene locus_tag LOCUS_14380 <1 888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109196.1:zinc protease 1452 1078 gene locus_tag LOCUS_14390 1452 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 1675 2655 gene locus_tag LOCUS_14400 1675 2655 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362004.1 protein_id gnl|my_center|LOCUS_14400 2740 3066 gene locus_tag LOCUS_14410 2740 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 3126 3554 gene locus_tag LOCUS_14420 gene yqiW 3126 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_14420 3755 4858 gene locus_tag LOCUS_14430 3755 4858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_14430 5390 4932 gene locus_tag LOCUS_14440 5390 4932 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963486.1 protein_id gnl|my_center|LOCUS_14440 5941 5543 gene locus_tag LOCUS_14450 5941 5543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 6819 5953 gene locus_tag LOCUS_14460 6819 5953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 6836 7123 gene locus_tag LOCUS_14470 6836 7123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 >Feature sequence0165 1370 2983 gene locus_tag LOCUS_14480 1370 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 3086 3988 gene locus_tag LOCUS_14490 3086 3988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 4025 5170 gene locus_tag LOCUS_14500 4025 5170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 5171 6466 gene locus_tag LOCUS_14510 5171 6466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 6987 6502 gene locus_tag LOCUS_14520 6987 6502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 7497 7012 gene locus_tag LOCUS_14530 7497 7012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 >Feature sequence0166 <1 2633 gene locus_tag LOCUS_14540 <1 2633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202065.1:SusC/RagA family TonB-linked outer membrane protein 2664 4073 gene locus_tag LOCUS_14550 2664 4073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 4233 5552 gene locus_tag LOCUS_14560 4233 5552 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120368.1 protein_id gnl|my_center|LOCUS_14560 5595 7037 gene locus_tag LOCUS_14570 gene arsA 5595 7037 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122622.1 protein_id gnl|my_center|LOCUS_14570 >Feature sequence0167 <1 1635 gene locus_tag LOCUS_14580 <1 1635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZA1:elongation factor G 1772 2077 gene locus_tag LOCUS_14590 gene rpsJ 1772 2077 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA0 protein_id gnl|my_center|LOCUS_14590 2407 2997 gene locus_tag LOCUS_14600 gene rplC 2407 2997 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NK8 protein_id gnl|my_center|LOCUS_14600 3003 3632 gene locus_tag LOCUS_14610 gene rplD 3003 3632 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ98 protein_id gnl|my_center|LOCUS_14610 3635 3922 gene locus_tag LOCUS_14620 gene rplW 3635 3922 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A478 protein_id gnl|my_center|LOCUS_14620 3964 4788 gene locus_tag LOCUS_14630 gene rplB 3964 4788 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL1 protein_id gnl|my_center|LOCUS_14630 4798 5076 gene locus_tag LOCUS_14640 gene rpsS 4798 5076 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL2 protein_id gnl|my_center|LOCUS_14640 5133 5522 gene locus_tag LOCUS_14650 gene rplV 5133 5522 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ94 protein_id gnl|my_center|LOCUS_14650 5539 6327 gene locus_tag LOCUS_14660 gene rpsC 5539 6327 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ93 protein_id gnl|my_center|LOCUS_14660 6374 6799 gene locus_tag LOCUS_14670 gene rplP 6374 6799 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A483 protein_id gnl|my_center|LOCUS_14670 6845 7042 gene locus_tag LOCUS_14680 gene rpmC 6845 7042 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ91 protein_id gnl|my_center|LOCUS_14680 7060 7323 gene locus_tag LOCUS_14690 gene rpsQ 7060 7323 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ90 protein_id gnl|my_center|LOCUS_14690 >Feature sequence0168 <1 746 gene locus_tag LOCUS_14700 <1 746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A8K7:Na(+)-translocating NADH-quinone reductase subunit A 1149 904 gene locus_tag LOCUS_14710 1149 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 1063 2067 gene locus_tag LOCUS_14720 gene nqrB 1063 2067 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64US0 protein_id gnl|my_center|LOCUS_14720 2060 2791 gene locus_tag LOCUS_14730 gene nqrC 2060 2791 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K9 protein_id gnl|my_center|LOCUS_14730 2879 3571 gene locus_tag LOCUS_14740 gene nqrD 2879 3571 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR8 protein_id gnl|my_center|LOCUS_14740 3665 4279 gene locus_tag LOCUS_14750 gene nqrE 3665 4279 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS1 protein_id gnl|my_center|LOCUS_14750 4369 5673 gene locus_tag LOCUS_14760 gene nqrF 4369 5673 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS0 protein_id gnl|my_center|LOCUS_14760 5670 6671 gene locus_tag LOCUS_14770 5670 6671 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X44 protein_id gnl|my_center|LOCUS_14770 >Feature sequence0169 2268 1417 gene locus_tag LOCUS_14780 2268 1417 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930427.1 protein_id gnl|my_center|LOCUS_14780 2561 3628 gene locus_tag LOCUS_14790 2561 3628 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0D5 protein_id gnl|my_center|LOCUS_14790 4673 3789 gene locus_tag LOCUS_14800 4673 3789 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775503.1 protein_id gnl|my_center|LOCUS_14800 4866 6695 gene locus_tag LOCUS_14810 4866 6695 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108596.1 protein_id gnl|my_center|LOCUS_14810 6805 7314 gene locus_tag LOCUS_14820 6805 7314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 >Feature sequence0170 224 36 gene locus_tag LOCUS_14830 224 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 1327 338 gene locus_tag LOCUS_14840 gene argC 1327 338 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YZ5 protein_id gnl|my_center|LOCUS_14840 1643 1467 gene locus_tag LOCUS_14850 1643 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 2867 1665 gene locus_tag LOCUS_14860 2867 1665 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762697.1 protein_id gnl|my_center|LOCUS_14860 3862 3143 gene locus_tag LOCUS_14870 3862 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 4420 5043 gene locus_tag LOCUS_14880 gene aat 4420 5043 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFI0 protein_id gnl|my_center|LOCUS_14880 5124 6161 gene locus_tag LOCUS_14890 gene proB 5124 6161 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NPI6 protein_id gnl|my_center|LOCUS_14890 >Feature sequence0171 1448 2452 gene locus_tag LOCUS_14900 1448 2452 CDS product adenosine monophosphate-protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y4R5 protein_id gnl|my_center|LOCUS_14900 2483 4441 gene locus_tag LOCUS_14910 2483 4441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 5526 4582 gene locus_tag LOCUS_14920 5526 4582 CDS product DUF1338 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256553.1 protein_id gnl|my_center|LOCUS_14920 6182 5589 gene locus_tag LOCUS_14930 6182 5589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 6761 6339 gene locus_tag LOCUS_14940 6761 6339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877101.1 protein_id gnl|my_center|LOCUS_14940 >Feature sequence0172 321 896 gene locus_tag LOCUS_14950 321 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 1013 2239 gene locus_tag LOCUS_14960 1013 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 2236 3891 gene locus_tag LOCUS_14970 2236 3891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 4558 3965 gene locus_tag LOCUS_14980 4558 3965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 4672 5829 gene locus_tag LOCUS_14990 4672 5829 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888049.1 protein_id gnl|my_center|LOCUS_14990 >Feature sequence0173 2111 1104 gene locus_tag LOCUS_15000 2111 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 3362 2487 gene locus_tag LOCUS_15010 3362 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 5026 3359 gene locus_tag LOCUS_15020 5026 3359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 6192 5044 gene locus_tag LOCUS_15030 6192 5044 CDS product outer membrane beta barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071616.1 protein_id gnl|my_center|LOCUS_15030 <7564 6864 gene locus_tag LOCUS_15040 <7564 6864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963922.1:MBL fold metallo-hydrolase >Feature sequence0174 1181 300 gene locus_tag LOCUS_15050 1181 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 1381 1857 gene locus_tag LOCUS_15060 1381 1857 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870309.1 protein_id gnl|my_center|LOCUS_15060 2007 2285 gene locus_tag LOCUS_15070 2007 2285 CDS product protein killer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737444.1 protein_id gnl|my_center|LOCUS_15070 2298 2630 gene locus_tag LOCUS_15080 2298 2630 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390183.1 protein_id gnl|my_center|LOCUS_15080 2853 3173 gene locus_tag LOCUS_15090 2853 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 3170 4414 gene locus_tag LOCUS_15100 3170 4414 CDS product toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816638.1 protein_id gnl|my_center|LOCUS_15100 6024 4495 gene locus_tag LOCUS_15110 6024 4495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767560.1 protein_id gnl|my_center|LOCUS_15110 7005 6115 gene locus_tag LOCUS_15120 gene glpQ 7005 6115 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403347.1 protein_id gnl|my_center|LOCUS_15120 >Feature sequence0175 221 1405 gene locus_tag LOCUS_15130 221 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 2175 1363 gene locus_tag LOCUS_15140 2175 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784354.1 protein_id gnl|my_center|LOCUS_15140 2541 3722 gene locus_tag LOCUS_15150 2541 3722 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388935.1 protein_id gnl|my_center|LOCUS_15150 4664 3732 gene locus_tag LOCUS_15160 4664 3732 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168169.1 protein_id gnl|my_center|LOCUS_15160 4915 5679 gene locus_tag LOCUS_15170 4915 5679 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889003.1 protein_id gnl|my_center|LOCUS_15170 <7562 5748 gene locus_tag LOCUS_15180 <7562 5748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121470.1:peptidase M16 >Feature sequence0176 2245 653 gene locus_tag LOCUS_15190 2245 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 2582 2495 gene locus_tag LOCUS_t00110 2582 2495 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3704 2631 gene locus_tag LOCUS_15200 gene ansA 3704 2631 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964381.1 protein_id gnl|my_center|LOCUS_15200 4692 3922 gene locus_tag LOCUS_15210 gene tatD 4692 3922 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260929.1 protein_id gnl|my_center|LOCUS_15210 5711 4701 gene locus_tag LOCUS_15220 5711 4701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 6265 5708 gene locus_tag LOCUS_15230 6265 5708 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_15230 7532 6393 gene locus_tag LOCUS_15240 7532 6393 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_15240 >Feature sequence0177 145 1191 gene locus_tag LOCUS_15250 145 1191 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786905.1 protein_id gnl|my_center|LOCUS_15250 1188 1955 gene locus_tag LOCUS_15260 1188 1955 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763423.1 protein_id gnl|my_center|LOCUS_15260 2439 3647 gene locus_tag LOCUS_15270 2439 3647 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268774.1 protein_id gnl|my_center|LOCUS_15270 3894 3706 gene locus_tag LOCUS_15280 3894 3706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 6757 3917 gene locus_tag LOCUS_15290 6757 3917 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA87 protein_id gnl|my_center|LOCUS_15290 >Feature sequence0178 746 450 gene locus_tag LOCUS_15300 746 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 1574 876 gene locus_tag LOCUS_15310 1574 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 2017 1823 gene locus_tag LOCUS_15320 2017 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 2557 2027 gene locus_tag LOCUS_15330 2557 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 4453 2705 gene locus_tag LOCUS_15340 4453 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 4880 4506 gene locus_tag LOCUS_15350 4880 4506 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963859.1 protein_id gnl|my_center|LOCUS_15350 5094 5303 gene locus_tag LOCUS_15360 5094 5303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 5303 5557 gene locus_tag LOCUS_15370 5303 5557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020108.1 protein_id gnl|my_center|LOCUS_15370 >Feature sequence0179 1009 59 gene locus_tag LOCUS_15380 1009 59 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479611.1 protein_id gnl|my_center|LOCUS_15380 1521 1021 gene locus_tag LOCUS_15390 1521 1021 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963592.1 protein_id gnl|my_center|LOCUS_15390 1692 2681 gene locus_tag LOCUS_15400 1692 2681 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229553.1 protein_id gnl|my_center|LOCUS_15400 4279 2720 gene locus_tag LOCUS_15410 4279 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 4874 4494 gene locus_tag LOCUS_15420 4874 4494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 5229 6086 gene locus_tag LOCUS_15430 5229 6086 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109261.1 protein_id gnl|my_center|LOCUS_15430 <7524 6214 gene locus_tag LOCUS_15440 <7524 6214 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582505.1:beta-galactosidase >Feature sequence0180 826 473 gene locus_tag LOCUS_15450 826 473 CDS product mRNA interferase PemK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942865.1 protein_id gnl|my_center|LOCUS_15450 1104 829 gene locus_tag LOCUS_15460 1104 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 1512 2264 gene locus_tag LOCUS_15470 1512 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 2921 2619 gene locus_tag LOCUS_15480 2921 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 3956 3225 gene locus_tag LOCUS_15490 3956 3225 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405245.1 protein_id gnl|my_center|LOCUS_15490 4525 5898 gene locus_tag LOCUS_15500 4525 5898 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119046.1 protein_id gnl|my_center|LOCUS_15500 6963 5965 gene locus_tag LOCUS_15510 6963 5965 CDS product xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124069.1 protein_id gnl|my_center|LOCUS_15510 >Feature sequence0181 <1 1181 gene locus_tag LOCUS_15520 <1 1181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803973.1:penicillin-binding protein 3482 1188 gene locus_tag LOCUS_15530 3482 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227787.1 protein_id gnl|my_center|LOCUS_15530 5060 3573 gene locus_tag LOCUS_15540 5060 3573 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122518.1 protein_id gnl|my_center|LOCUS_15540 >Feature sequence0182 834 172 gene locus_tag LOCUS_15550 834 172 CDS product cytochrome C biogenesis protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404914.1 protein_id gnl|my_center|LOCUS_15550 1164 1394 gene locus_tag LOCUS_15560 gene feoA 1164 1394 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962269.1 protein_id gnl|my_center|LOCUS_15560 1436 3613 gene locus_tag LOCUS_15570 gene feoB 1436 3613 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVT6 protein_id gnl|my_center|LOCUS_15570 3790 3623 gene locus_tag LOCUS_15580 3790 3623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 5524 4010 gene locus_tag LOCUS_15590 5524 4010 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZJ4 protein_id gnl|my_center|LOCUS_15590 5635 5997 gene locus_tag LOCUS_15600 gene rplS 5635 5997 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YK97 protein_id gnl|my_center|LOCUS_15600 6091 6876 gene locus_tag LOCUS_15610 gene dapF 6091 6876 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX5 protein_id gnl|my_center|LOCUS_15610 7208 6888 gene locus_tag LOCUS_15620 7208 6888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 >Feature sequence0183 3206 1212 gene locus_tag LOCUS_15630 3206 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 3527 3213 gene locus_tag LOCUS_15640 gene rhaM 3527 3213 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A044 protein_id gnl|my_center|LOCUS_15640 5113 3629 gene locus_tag LOCUS_15650 5113 3629 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118989.1 protein_id gnl|my_center|LOCUS_15650 5905 5444 gene locus_tag LOCUS_15660 5905 5444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 <7451 6238 gene locus_tag LOCUS_15670 <7451 6238 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120406.1:oxidoreductase >Feature sequence0184 2620 2348 gene locus_tag LOCUS_15680 2620 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 4145 3042 gene locus_tag LOCUS_15690 4145 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 5999 4236 gene locus_tag LOCUS_15700 5999 4236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 6807 6040 gene locus_tag LOCUS_15710 6807 6040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 >Feature sequence0185 105 347 gene locus_tag LOCUS_15720 105 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 344 757 gene locus_tag LOCUS_15730 344 757 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666459.1 protein_id gnl|my_center|LOCUS_15730 1733 828 gene locus_tag LOCUS_15740 1733 828 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089805.1 protein_id gnl|my_center|LOCUS_15740 1929 3059 gene locus_tag LOCUS_15750 1929 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 3076 3852 gene locus_tag LOCUS_15760 3076 3852 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107682.1 protein_id gnl|my_center|LOCUS_15760 3993 4238 gene locus_tag LOCUS_15770 3993 4238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 4282 4665 gene locus_tag LOCUS_15780 4282 4665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 5632 4670 gene locus_tag LOCUS_15790 5632 4670 CDS product AP endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368543.1 protein_id gnl|my_center|LOCUS_15790 5952 5695 gene locus_tag LOCUS_15800 5952 5695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 >Feature sequence0186 467 1024 gene locus_tag LOCUS_15810 467 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 3678 1042 gene locus_tag LOCUS_15820 3678 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 4807 3824 gene locus_tag LOCUS_15830 4807 3824 CDS product phytanoyl-CoA dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030607.1 protein_id gnl|my_center|LOCUS_15830 4969 5823 gene locus_tag LOCUS_15840 4969 5823 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551739.1 protein_id gnl|my_center|LOCUS_15840 6684 5923 gene locus_tag LOCUS_15850 gene madM 6684 5923 CDS product malonate transporter subunit MadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765415.1 protein_id gnl|my_center|LOCUS_15850 7054 6668 gene locus_tag LOCUS_15860 7054 6668 CDS product malonate transporter MadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112671.1 protein_id gnl|my_center|LOCUS_15860 >Feature sequence0187 524 3583 gene locus_tag LOCUS_15870 524 3583 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_15870 3614 5284 gene locus_tag LOCUS_15880 3614 5284 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108167.1 protein_id gnl|my_center|LOCUS_15880 5568 6935 gene locus_tag LOCUS_15890 5568 6935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767657.1 protein_id gnl|my_center|LOCUS_15890 >Feature sequence0188 1761 790 gene locus_tag LOCUS_15900 1761 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123957.1 protein_id gnl|my_center|LOCUS_15900 1924 2169 gene locus_tag LOCUS_15910 1924 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 2294 2485 gene locus_tag LOCUS_15920 2294 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 4142 2607 gene locus_tag LOCUS_15930 4142 2607 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203677.1 protein_id gnl|my_center|LOCUS_15930 <7366 4158 gene locus_tag LOCUS_15940 <7366 4158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108758.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence0189 930 313 gene locus_tag LOCUS_15950 930 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 1123 1872 gene locus_tag LOCUS_15960 1123 1872 CDS product polyphosphate glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704857.1 protein_id gnl|my_center|LOCUS_15960 2028 1873 gene locus_tag LOCUS_15970 2028 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 2299 3063 gene locus_tag LOCUS_15980 2299 3063 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790934.1 protein_id gnl|my_center|LOCUS_15980 3392 6400 gene locus_tag LOCUS_15990 3392 6400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 >Feature sequence0190 427 1710 gene locus_tag LOCUS_16000 427 1710 CDS product L-rhamnose catabolism isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973080.1 protein_id gnl|my_center|LOCUS_16000 1764 2510 gene locus_tag LOCUS_16010 1764 2510 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121486.1 protein_id gnl|my_center|LOCUS_16010 2579 3418 gene locus_tag LOCUS_16020 2579 3418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230326.1 protein_id gnl|my_center|LOCUS_16020 3444 4814 gene locus_tag LOCUS_16030 3444 4814 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121485.1 protein_id gnl|my_center|LOCUS_16030 4783 5388 gene locus_tag LOCUS_16040 4783 5388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121484.1 protein_id gnl|my_center|LOCUS_16040 5545 6951 gene locus_tag LOCUS_16050 5545 6951 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118019.1 protein_id gnl|my_center|LOCUS_16050 6948 7154 gene locus_tag LOCUS_16060 6948 7154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 >Feature sequence0191 440 703 gene locus_tag LOCUS_16070 440 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 850 1296 gene locus_tag LOCUS_16080 850 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 1445 2350 gene locus_tag LOCUS_16090 gene moaCB 1445 2350 CDS product bifunctional molybdenum cofactor biosynthesis protein MoaC/MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207007.1 protein_id gnl|my_center|LOCUS_16090 2439 3431 gene locus_tag LOCUS_16100 gene moaA 2439 3431 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y870 protein_id gnl|my_center|LOCUS_16100 3656 3441 gene locus_tag LOCUS_16110 3656 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 5110 3779 gene locus_tag LOCUS_16120 5110 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 5843 5211 gene locus_tag LOCUS_16130 gene udk 5843 5211 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RE1 protein_id gnl|my_center|LOCUS_16130 <7284 6060 gene locus_tag LOCUS_16140 <7284 6060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962444.1:ABC transporter substrate-binding protein >Feature sequence0192 1051 233 gene locus_tag LOCUS_16150 1051 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 1399 3195 gene locus_tag LOCUS_16160 1399 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 4354 3326 gene locus_tag LOCUS_16170 4354 3326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 5413 4493 gene locus_tag LOCUS_16180 5413 4493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 6300 5617 gene locus_tag LOCUS_16190 6300 5617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 >Feature sequence0193 <1 838 gene locus_tag LOCUS_16200 <1 838 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120624.1:alkaline phosphatase 1054 1932 gene locus_tag LOCUS_16210 1054 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001975788.1 protein_id gnl|my_center|LOCUS_16210 2046 3221 gene locus_tag LOCUS_16220 2046 3221 CDS product alginate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227813.1 protein_id gnl|my_center|LOCUS_16220 4469 3342 gene locus_tag LOCUS_16230 4469 3342 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_16230 6376 4874 gene locus_tag LOCUS_16240 6376 4874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 7088 6318 gene locus_tag LOCUS_16250 7088 6318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 >Feature sequence0194 702 418 gene locus_tag LOCUS_16260 702 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 1170 1715 gene locus_tag LOCUS_16270 1170 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 1712 2683 gene locus_tag LOCUS_16280 1712 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202383.1 protein_id gnl|my_center|LOCUS_16280 2874 3641 gene locus_tag LOCUS_16290 2874 3641 CDS product ABC transporter-associated protein EcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454391.1 protein_id gnl|my_center|LOCUS_16290 4457 3672 gene locus_tag LOCUS_16300 4457 3672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 5103 4447 gene locus_tag LOCUS_16310 5103 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 5715 5116 gene locus_tag LOCUS_16320 5715 5116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 6123 6362 gene locus_tag LOCUS_16330 6123 6362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 6591 6818 gene locus_tag LOCUS_16340 6591 6818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 7231 6896 gene locus_tag LOCUS_16350 7231 6896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 >Feature sequence0195 301 1608 gene locus_tag LOCUS_16360 301 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 1614 2504 gene locus_tag LOCUS_16370 1614 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 2509 3765 gene locus_tag LOCUS_16380 2509 3765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 3777 4922 gene locus_tag LOCUS_16390 3777 4922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 4937 6343 gene locus_tag LOCUS_16400 4937 6343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 >Feature sequence0196 725 24 gene locus_tag LOCUS_16410 725 24 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_16410 1758 706 gene locus_tag LOCUS_16420 1758 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 1971 4355 gene locus_tag LOCUS_16430 1971 4355 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_16430 4849 4457 gene locus_tag LOCUS_16440 4849 4457 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962706.1 protein_id gnl|my_center|LOCUS_16440 5693 5013 gene locus_tag LOCUS_16450 5693 5013 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962705.1 protein_id gnl|my_center|LOCUS_16450 5938 6282 gene locus_tag LOCUS_16460 5938 6282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 <7200 6357 gene locus_tag LOCUS_16470 <7200 6357 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964142.1:cryptochrome/photolyase family protein >Feature sequence0197 <1 1082 gene locus_tag LOCUS_16480 <1 1082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766268.1:arylsulfatase 1064 2575 gene locus_tag LOCUS_16490 1064 2575 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108982.1 protein_id gnl|my_center|LOCUS_16490 2721 3191 gene locus_tag LOCUS_16500 2721 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 3325 4230 gene locus_tag LOCUS_16510 3325 4230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 4327 6207 gene locus_tag LOCUS_16520 4327 6207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 6239 7102 gene locus_tag LOCUS_16530 6239 7102 CDS product type I-B CRISPR-associated protein Cas7/Csh2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582996.1 protein_id gnl|my_center|LOCUS_16530 >Feature sequence0198 <1 651 gene locus_tag LOCUS_16540 <1 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DLF3:glucose-6-phosphate 1-dehydrogenase 776 1507 gene locus_tag LOCUS_16550 776 1507 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056919.1 protein_id gnl|my_center|LOCUS_16550 3009 1516 gene locus_tag LOCUS_16560 3009 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730930.1 protein_id gnl|my_center|LOCUS_16560 3301 4362 gene locus_tag LOCUS_16570 3301 4362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404559.1 protein_id gnl|my_center|LOCUS_16570 4512 4724 gene locus_tag LOCUS_16580 4512 4724 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681617.1 protein_id gnl|my_center|LOCUS_16580 4717 5046 gene locus_tag LOCUS_16590 4717 5046 CDS product phosphatidylinositol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681615.1 protein_id gnl|my_center|LOCUS_16590 5043 5990 gene locus_tag LOCUS_16600 5043 5990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681613.1 protein_id gnl|my_center|LOCUS_16600 6280 6657 gene locus_tag LOCUS_16610 6280 6657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 >Feature sequence0199 924 2018 gene locus_tag LOCUS_16620 924 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 2015 4432 gene locus_tag LOCUS_16630 2015 4432 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_16630 5024 4602 gene locus_tag LOCUS_16640 5024 4602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 6593 5316 gene locus_tag LOCUS_16650 6593 5316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200075.1 protein_id gnl|my_center|LOCUS_16650 >Feature sequence0200 2392 2646 gene locus_tag LOCUS_16660 2392 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 3872 3799 gene locus_tag LOCUS_t00120 3872 3799 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6447 4150 gene locus_tag LOCUS_16670 6447 4150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 >Feature sequence0201 768 2987 gene locus_tag LOCUS_16680 gene dpp4 768 2987 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118275.1 protein_id gnl|my_center|LOCUS_16680 3160 5625 gene locus_tag LOCUS_16690 3160 5625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107570.1 protein_id gnl|my_center|LOCUS_16690 <7091 5639 gene locus_tag LOCUS_16700 <7091 5639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122093.1:serine dehydratase >Feature sequence0202 1392 493 gene locus_tag LOCUS_16710 1392 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 2674 1481 gene locus_tag LOCUS_16720 2674 1481 CDS product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403533.1 protein_id gnl|my_center|LOCUS_16720 3724 2744 gene locus_tag LOCUS_16730 3724 2744 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404056.1 protein_id gnl|my_center|LOCUS_16730 5986 3875 gene locus_tag LOCUS_16740 5986 3875 CDS product isoquinoline 1-oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_16740 6486 6025 gene locus_tag LOCUS_16750 6486 6025 CDS product isoquinoline 1-oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917912.1 protein_id gnl|my_center|LOCUS_16750 >Feature sequence0203 <1 1399 gene locus_tag LOCUS_16760 <1 1399 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965973.1:maltose phosphorylase 1594 3831 gene locus_tag LOCUS_16770 1594 3831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 4688 3840 gene locus_tag LOCUS_16780 4688 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 4984 5652 gene locus_tag LOCUS_16790 4984 5652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 5708 6400 gene locus_tag LOCUS_16800 5708 6400 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403125.1 protein_id gnl|my_center|LOCUS_16800 <7064 6481 gene locus_tag LOCUS_16810 <7064 6481 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267572.1:glucose-1-dehydrogenase >Feature sequence0204 1186 695 gene locus_tag LOCUS_16820 1186 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 2071 1331 gene locus_tag LOCUS_16830 2071 1331 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817185.1 protein_id gnl|my_center|LOCUS_16830 3111 2068 gene locus_tag LOCUS_16840 3111 2068 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763424.1 protein_id gnl|my_center|LOCUS_16840 3420 6029 gene locus_tag LOCUS_16850 3420 6029 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784143.1 protein_id gnl|my_center|LOCUS_16850 6173 6838 gene locus_tag LOCUS_16860 gene msrA 6173 6838 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBS2 protein_id gnl|my_center|LOCUS_16860 >Feature sequence0205 1298 1777 gene locus_tag LOCUS_16870 1298 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 2308 1823 gene locus_tag LOCUS_16880 2308 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 3378 2701 gene locus_tag LOCUS_16890 3378 2701 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787762.1 protein_id gnl|my_center|LOCUS_16890 4812 3490 gene locus_tag LOCUS_16900 4812 3490 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202492.1 protein_id gnl|my_center|LOCUS_16900 5185 6531 gene locus_tag LOCUS_16910 5185 6531 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202491.1 protein_id gnl|my_center|LOCUS_16910 >Feature sequence0206 3271 3903 gene locus_tag LOCUS_16920 3271 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 4194 6833 gene locus_tag LOCUS_16930 4194 6833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 >Feature sequence0207 2265 3044 gene locus_tag LOCUS_16940 2265 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 4572 3160 gene locus_tag LOCUS_16950 4572 3160 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224565.1 protein_id gnl|my_center|LOCUS_16950 6067 5234 gene locus_tag LOCUS_16960 6067 5234 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X2I9 protein_id gnl|my_center|LOCUS_16960 <6999 6060 gene locus_tag LOCUS_16970 <6999 6060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015943755.1:sodium:solute symporter >Feature sequence0208 2133 1630 gene locus_tag LOCUS_16980 2133 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043223.1 protein_id gnl|my_center|LOCUS_16980 3232 2183 gene locus_tag LOCUS_16990 3232 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 4579 3527 gene locus_tag LOCUS_17000 4579 3527 CDS product AP endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529509.1 protein_id gnl|my_center|LOCUS_17000 5033 4629 gene locus_tag LOCUS_17010 5033 4629 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964356.1 protein_id gnl|my_center|LOCUS_17010 6293 5148 gene locus_tag LOCUS_17020 6293 5148 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097689.1 protein_id gnl|my_center|LOCUS_17020 <6991 6422 gene locus_tag LOCUS_17030 <6991 6422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338817.1:oxidoreductase >Feature sequence0209 1444 830 gene locus_tag LOCUS_17040 1444 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 1581 2165 gene locus_tag LOCUS_17050 1581 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 3375 2326 gene locus_tag LOCUS_17060 3375 2326 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272562.1 protein_id gnl|my_center|LOCUS_17060 3770 3438 gene locus_tag LOCUS_17070 3770 3438 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811834.1 protein_id gnl|my_center|LOCUS_17070 3894 4877 gene locus_tag LOCUS_17080 3894 4877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 5937 4885 gene locus_tag LOCUS_17090 5937 4885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 6727 5993 gene locus_tag LOCUS_17100 6727 5993 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933083.1 protein_id gnl|my_center|LOCUS_17100 >Feature sequence0210 511 2484 gene locus_tag LOCUS_17110 511 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 2481 3302 gene locus_tag LOCUS_17120 2481 3302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 3295 3828 gene locus_tag LOCUS_17130 3295 3828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 3828 4454 gene locus_tag LOCUS_17140 3828 4454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 4596 5999 gene locus_tag LOCUS_17150 4596 5999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 6109 6861 gene locus_tag LOCUS_17160 6109 6861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 >Feature sequence0211 511 1515 gene locus_tag LOCUS_17170 gene moxR 511 1515 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035349.1 protein_id gnl|my_center|LOCUS_17170 1551 1787 gene locus_tag LOCUS_17180 1551 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 1801 2667 gene locus_tag LOCUS_17190 1801 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118532.1 protein_id gnl|my_center|LOCUS_17190 2664 3848 gene locus_tag LOCUS_17200 2664 3848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 3845 6022 gene locus_tag LOCUS_17210 3845 6022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 >Feature sequence0212 381 836 gene locus_tag LOCUS_17220 381 836 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240402.1 protein_id gnl|my_center|LOCUS_17220 1230 934 gene locus_tag LOCUS_17230 1230 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 1780 2406 gene locus_tag LOCUS_17240 1780 2406 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H133 protein_id gnl|my_center|LOCUS_17240 3188 2427 gene locus_tag LOCUS_17250 3188 2427 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794868.1 protein_id gnl|my_center|LOCUS_17250 3383 4741 gene locus_tag LOCUS_17260 3383 4741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 4741 5310 gene locus_tag LOCUS_17270 4741 5310 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964091.1 protein_id gnl|my_center|LOCUS_17270 5541 6095 gene locus_tag LOCUS_17280 5541 6095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 6252 6617 gene locus_tag LOCUS_17290 6252 6617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 >Feature sequence0213 1082 486 gene locus_tag LOCUS_17300 1082 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 1693 1088 gene locus_tag LOCUS_17310 1693 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 1810 3759 gene locus_tag LOCUS_17320 1810 3759 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405513.1 protein_id gnl|my_center|LOCUS_17320 4355 3762 gene locus_tag LOCUS_17330 4355 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121865.1 protein_id gnl|my_center|LOCUS_17330 4495 5787 gene locus_tag LOCUS_17340 4495 5787 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404472.1 protein_id gnl|my_center|LOCUS_17340 6093 6515 gene locus_tag LOCUS_17350 6093 6515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 >Feature sequence0214 2718 403 gene locus_tag LOCUS_17360 2718 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 4094 2877 gene locus_tag LOCUS_17370 4094 2877 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A529 protein_id gnl|my_center|LOCUS_17370 4587 4249 gene locus_tag LOCUS_17380 4587 4249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 5242 4592 gene locus_tag LOCUS_17390 5242 4592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 5589 5239 gene locus_tag LOCUS_17400 5589 5239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 >Feature sequence0215 608 1687 gene locus_tag LOCUS_17410 608 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703911.1 protein_id gnl|my_center|LOCUS_17410 1694 2836 gene locus_tag LOCUS_17420 1694 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703911.1 protein_id gnl|my_center|LOCUS_17420 2865 3980 gene locus_tag LOCUS_17430 gene xynA 2865 3980 CDS product beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3F6 protein_id gnl|my_center|LOCUS_17430 4269 4652 gene locus_tag LOCUS_17440 4269 4652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 4952 4563 gene locus_tag LOCUS_17450 4952 4563 CDS product motility twitching protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392206.1 protein_id gnl|my_center|LOCUS_17450 5155 4934 gene locus_tag LOCUS_17460 5155 4934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 6630 5491 gene locus_tag LOCUS_17470 6630 5491 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_17470 >Feature sequence0216 259 1278 gene locus_tag LOCUS_17480 259 1278 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787842.1 protein_id gnl|my_center|LOCUS_17480 1500 1426 gene locus_tag LOCUS_t00130 1500 1426 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1719 2111 gene locus_tag LOCUS_17490 1719 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784512.1 protein_id gnl|my_center|LOCUS_17490 2111 3622 gene locus_tag LOCUS_17500 2111 3622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 3713 3988 gene locus_tag LOCUS_17510 gene rpsO 3713 3988 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MT6 protein_id gnl|my_center|LOCUS_17510 4205 6340 gene locus_tag LOCUS_17520 gene pnp 4205 6340 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64N73 protein_id gnl|my_center|LOCUS_17520 >Feature sequence0217 1446 355 gene locus_tag LOCUS_17530 1446 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 3052 1484 gene locus_tag LOCUS_17540 3052 1484 CDS product starch-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108773.1 protein_id gnl|my_center|LOCUS_17540 6138 3079 gene locus_tag LOCUS_17550 6138 3079 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405543.1 protein_id gnl|my_center|LOCUS_17550 >Feature sequence0218 281 901 gene locus_tag LOCUS_17560 281 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 898 1638 gene locus_tag LOCUS_17570 898 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 1604 1918 gene locus_tag LOCUS_17580 1604 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 1866 2114 gene locus_tag LOCUS_17590 1866 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 2378 3253 gene locus_tag LOCUS_17600 2378 3253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 3314 3532 gene locus_tag LOCUS_17610 3314 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 3520 4335 gene locus_tag LOCUS_17620 3520 4335 CDS product type I restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108375.1 protein_id gnl|my_center|LOCUS_17620 4480 4914 gene locus_tag LOCUS_17630 4480 4914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 5084 5248 gene locus_tag LOCUS_17640 5084 5248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 5328 5513 gene locus_tag LOCUS_17650 5328 5513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 5500 6069 gene locus_tag LOCUS_17660 5500 6069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 6184 6735 gene locus_tag LOCUS_17670 6184 6735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 >Feature sequence0219 <1 592 gene locus_tag LOCUS_17680 <1 592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765612.1:phosphatidylinositol-4-phosphate 5-kinase 1925 672 gene locus_tag LOCUS_17690 gene rocD 1925 672 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_17690 2015 2212 gene locus_tag LOCUS_17700 2015 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 2288 2527 gene locus_tag LOCUS_17710 gene rpmB 2288 2527 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI6 protein_id gnl|my_center|LOCUS_17710 2778 5147 gene locus_tag LOCUS_17720 2778 5147 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_17720 5225 6097 gene locus_tag LOCUS_17730 5225 6097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 >Feature sequence0220 3077 2070 gene locus_tag LOCUS_17740 gene obg 3077 2070 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZI9 protein_id gnl|my_center|LOCUS_17740 3825 3250 gene locus_tag LOCUS_17750 gene adk 3825 3250 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZB9 protein_id gnl|my_center|LOCUS_17750 4769 3978 gene locus_tag LOCUS_17760 4769 3978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 4950 6704 gene locus_tag LOCUS_17770 4950 6704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 >Feature sequence0221 <1 1117 gene locus_tag LOCUS_17780 <1 1117 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005776823.1:transposase 1120 1371 gene locus_tag LOCUS_17790 1120 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 1471 2667 gene locus_tag LOCUS_17800 1471 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962655.1 protein_id gnl|my_center|LOCUS_17800 3004 3762 gene locus_tag LOCUS_17810 3004 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 4130 4684 gene locus_tag LOCUS_17820 4130 4684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 4850 5890 gene locus_tag LOCUS_17830 4850 5890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 >Feature sequence0222 1837 2079 gene locus_tag LOCUS_17840 1837 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 6401 2790 gene locus_tag LOCUS_17850 6401 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 >Feature sequence0223 1984 620 gene locus_tag LOCUS_17860 gene hemN 1984 620 CDS product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYS7 protein_id gnl|my_center|LOCUS_17860 2220 3392 gene locus_tag LOCUS_17870 2220 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 3358 4089 gene locus_tag LOCUS_17880 3358 4089 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107796.1 protein_id gnl|my_center|LOCUS_17880 4670 5590 gene locus_tag LOCUS_17890 4670 5590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 5713 6282 gene locus_tag LOCUS_17900 5713 6282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 >Feature sequence0224 1159 860 gene locus_tag LOCUS_17910 1159 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 1935 1264 gene locus_tag LOCUS_17920 1935 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 3065 2079 gene locus_tag LOCUS_17930 3065 2079 CDS product ring canal kelch-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639451.2 protein_id gnl|my_center|LOCUS_17930 3163 4437 gene locus_tag LOCUS_17940 3163 4437 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103653.1 protein_id gnl|my_center|LOCUS_17940 5425 4490 gene locus_tag LOCUS_17950 5425 4490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 5617 6456 gene locus_tag LOCUS_17960 5617 6456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 >Feature sequence0225 <1 1294 gene locus_tag LOCUS_17970 <1 1294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963986.1:TonB-dependent receptor 1456 2127 gene locus_tag LOCUS_17980 gene chd1 1456 2127 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119974.1 protein_id gnl|my_center|LOCUS_17980 3638 2205 gene locus_tag LOCUS_17990 3638 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 4979 3789 gene locus_tag LOCUS_18000 gene pgk 4979 3789 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64R68 protein_id gnl|my_center|LOCUS_18000 5237 5986 gene locus_tag LOCUS_18010 5237 5986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 >Feature sequence0226 1232 39 gene locus_tag LOCUS_18020 gene uxuA 1232 39 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44488 protein_id gnl|my_center|LOCUS_18020 1919 1308 gene locus_tag LOCUS_18030 1919 1308 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760954.1 protein_id gnl|my_center|LOCUS_18030 2208 3284 gene locus_tag LOCUS_18040 2208 3284 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_18040 4506 3229 gene locus_tag LOCUS_18050 4506 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 4726 6243 gene locus_tag LOCUS_18060 4726 6243 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_18060 >Feature sequence0227 780 1781 gene locus_tag LOCUS_18070 780 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 1814 3250 gene locus_tag LOCUS_18080 gene hslU 1814 3250 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S217 protein_id gnl|my_center|LOCUS_18080 4444 3341 gene locus_tag LOCUS_18090 4444 3341 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249477.1 protein_id gnl|my_center|LOCUS_18090 5008 4493 gene locus_tag LOCUS_18100 gene folA 5008 4493 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCE6 protein_id gnl|my_center|LOCUS_18100 6098 5160 gene locus_tag LOCUS_18110 gene fmt 6098 5160 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PD6 protein_id gnl|my_center|LOCUS_18110 >Feature sequence0228 1640 882 gene locus_tag LOCUS_18120 1640 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 1767 2195 gene locus_tag LOCUS_18130 gene osmC 1767 2195 CDS product stress-induced protein OsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964001.1 protein_id gnl|my_center|LOCUS_18130 2614 2252 gene locus_tag LOCUS_18140 gene ytxJ 2614 2252 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963932.1 protein_id gnl|my_center|LOCUS_18140 3019 2687 gene locus_tag LOCUS_18150 3019 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 3140 4360 gene locus_tag LOCUS_18160 3140 4360 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203604.1 protein_id gnl|my_center|LOCUS_18160 5581 4361 gene locus_tag LOCUS_18170 5581 4361 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107265.1 protein_id gnl|my_center|LOCUS_18170 6006 6203 gene locus_tag LOCUS_18180 6006 6203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18180 >Feature sequence0229 1643 462 gene locus_tag LOCUS_18190 gene hmgA 1643 462 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962401.1 protein_id gnl|my_center|LOCUS_18190 1893 5072 gene locus_tag LOCUS_18200 1893 5072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 5210 6538 gene locus_tag LOCUS_18210 5210 6538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 >Feature sequence0230 2525 1572 gene locus_tag LOCUS_18220 2525 1572 CDS product glucosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525085.1 protein_id gnl|my_center|LOCUS_18220 3620 2544 gene locus_tag LOCUS_18230 3620 2544 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545331.1 protein_id gnl|my_center|LOCUS_18230 4092 3844 gene locus_tag LOCUS_18240 4092 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 4388 4852 gene locus_tag LOCUS_18250 4388 4852 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963832.1 protein_id gnl|my_center|LOCUS_18250 >Feature sequence0231 1995 832 gene locus_tag LOCUS_18260 1995 832 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765765.1 protein_id gnl|my_center|LOCUS_18260 3495 2263 gene locus_tag LOCUS_18270 3495 2263 CDS product periplasmic siderophore cleavage esterase IroE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072930.1 protein_id gnl|my_center|LOCUS_18270 4859 3540 gene locus_tag LOCUS_18280 gene amaA 4859 3540 CDS product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 protein_id gnl|my_center|LOCUS_18280 <6579 4907 gene locus_tag LOCUS_18290 <6579 4907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109778.1:peptidase S9 >Feature sequence0232 <1 1128 gene locus_tag LOCUS_18300 <1 1128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259368.1:peptide synthase 1813 1325 gene locus_tag LOCUS_18310 1813 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 2013 3263 gene locus_tag LOCUS_18320 gene arsA 2013 3263 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122187.1 protein_id gnl|my_center|LOCUS_18320 3563 3381 gene locus_tag LOCUS_18330 3563 3381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 4449 3547 gene locus_tag LOCUS_18340 4449 3547 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707740.1 protein_id gnl|my_center|LOCUS_18340 4678 5550 gene locus_tag LOCUS_18350 4678 5550 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760345.1 protein_id gnl|my_center|LOCUS_18350 >Feature sequence0233 1283 2128 gene locus_tag LOCUS_18360 1283 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 2764 2138 gene locus_tag LOCUS_18370 2764 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 4261 2780 gene locus_tag LOCUS_18380 4261 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 4625 5125 gene locus_tag LOCUS_18390 4625 5125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 <6572 5318 gene locus_tag LOCUS_18400 <6572 5318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108546.1:chloramphenicol resistance protein >Feature sequence0234 1001 51 gene locus_tag LOCUS_18410 1001 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 5077 1115 gene locus_tag LOCUS_18420 5077 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 >Feature sequence0235 96 1349 gene locus_tag LOCUS_18430 96 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964376.1 protein_id gnl|my_center|LOCUS_18430 4067 1482 gene locus_tag LOCUS_18440 gene ppc 4067 1482 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JXG5 protein_id gnl|my_center|LOCUS_18440 5021 4134 gene locus_tag LOCUS_18450 gene xerC 5021 4134 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A461 protein_id gnl|my_center|LOCUS_18450 5324 5130 gene locus_tag LOCUS_18460 gene rpsU 5324 5130 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYV0 protein_id gnl|my_center|LOCUS_18460 5490 6419 gene locus_tag LOCUS_18470 5490 6419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 >Feature sequence0236 <1 1102 gene locus_tag LOCUS_18480 <1 1102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784545.1:bifunctional aspartate kinase/homoserine dehydrogenase I 1192 1566 gene locus_tag LOCUS_18490 1192 1566 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942019.1 protein_id gnl|my_center|LOCUS_18490 1664 2602 gene locus_tag LOCUS_18500 gene thrB 1664 2602 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW7 protein_id gnl|my_center|LOCUS_18500 3589 2642 gene locus_tag LOCUS_18510 gene abnA 3589 2642 CDS product extracellular endo-alpha-(1->5)-L-arabinanase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94522 protein_id gnl|my_center|LOCUS_18510 5080 3677 gene locus_tag LOCUS_18520 5080 3677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 5252 5578 gene locus_tag LOCUS_18530 gene sufA 5252 5578 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_18530 >Feature sequence0237 <1 1624 gene locus_tag LOCUS_18540 <1 1624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107216.1:carbohydrate-binding protein 1624 2073 gene locus_tag LOCUS_18550 1624 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 2086 3081 gene locus_tag LOCUS_18560 2086 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 3156 5207 gene locus_tag LOCUS_18570 3156 5207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 >Feature sequence0238 1 525 gene locus_tag LOCUS_18580 1 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 623 985 gene locus_tag LOCUS_18590 623 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788752.1 protein_id gnl|my_center|LOCUS_18590 1124 2026 gene locus_tag LOCUS_18600 1124 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 2268 5036 gene locus_tag LOCUS_18610 2268 5036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 5554 5288 gene locus_tag LOCUS_18620 5554 5288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 <6539 5649 gene locus_tag LOCUS_18630 <6539 5649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009897651.1:amino acid permease >Feature sequence0239 2178 1003 gene locus_tag LOCUS_18640 2178 1003 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739648.1 protein_id gnl|my_center|LOCUS_18640 3287 2331 gene locus_tag LOCUS_18650 3287 2331 CDS product flavonol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 protein_id gnl|my_center|LOCUS_18650 4274 3411 gene locus_tag LOCUS_18660 4274 3411 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142885.1 protein_id gnl|my_center|LOCUS_18660 4428 5363 gene locus_tag LOCUS_18670 4428 5363 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267100.1 protein_id gnl|my_center|LOCUS_18670 >Feature sequence0240 2173 1817 gene locus_tag LOCUS_18680 2173 1817 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107105.1 protein_id gnl|my_center|LOCUS_18680 2493 2173 gene locus_tag LOCUS_18690 2493 2173 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107106.1 protein_id gnl|my_center|LOCUS_18690 3555 2977 gene locus_tag LOCUS_18700 3555 2977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 4031 3558 gene locus_tag LOCUS_18710 4031 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 4689 4012 gene locus_tag LOCUS_18720 4689 4012 CDS product conjugal transfer protein TraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108210.1 protein_id gnl|my_center|LOCUS_18720 5235 5378 gene locus_tag LOCUS_18730 5235 5378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 5386 5838 gene locus_tag LOCUS_18740 5386 5838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 >Feature sequence0241 2173 806 gene locus_tag LOCUS_18750 2173 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035976.1 protein_id gnl|my_center|LOCUS_18750 3654 4646 gene locus_tag LOCUS_18760 3654 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 5446 4730 gene locus_tag LOCUS_18770 5446 4730 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552295.1 protein_id gnl|my_center|LOCUS_18770 5983 5714 gene locus_tag LOCUS_18780 5983 5714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 6164 6433 gene locus_tag LOCUS_18790 6164 6433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 >Feature sequence0242 2612 1101 gene locus_tag LOCUS_18800 2612 1101 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 protein_id gnl|my_center|LOCUS_18800 5854 2666 gene locus_tag LOCUS_18810 5854 2666 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_18810 >Feature sequence0243 <1 511 gene locus_tag LOCUS_18820 <1 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GX95:acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha 513 1151 gene locus_tag LOCUS_18830 513 1151 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791331.1 protein_id gnl|my_center|LOCUS_18830 1141 2280 gene locus_tag LOCUS_18840 1141 2280 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403700.1 protein_id gnl|my_center|LOCUS_18840 2331 2906 gene locus_tag LOCUS_18850 2331 2906 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947974.1 protein_id gnl|my_center|LOCUS_18850 3245 4249 gene locus_tag LOCUS_18860 gene mreB 3245 4249 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_18860 5380 4265 gene locus_tag LOCUS_18870 gene lpxB 5380 4265 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_18870 5908 5483 gene locus_tag LOCUS_18880 5908 5483 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYU6 protein_id gnl|my_center|LOCUS_18880 >Feature sequence0244 1070 2011 gene locus_tag LOCUS_18890 gene pdhB 1070 2011 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 protein_id gnl|my_center|LOCUS_18890 2172 3662 gene locus_tag LOCUS_18900 2172 3662 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203207.1 protein_id gnl|my_center|LOCUS_18900 3837 4166 gene locus_tag LOCUS_18910 3837 4166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 5724 4171 gene locus_tag LOCUS_18920 gene dagA 5724 4171 CDS product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122885.1 protein_id gnl|my_center|LOCUS_18920 <6470 5875 gene locus_tag LOCUS_18930 <6470 5875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005796334.1:amino acid permease >Feature sequence0245 3244 2441 gene locus_tag LOCUS_18940 3244 2441 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963408.1 protein_id gnl|my_center|LOCUS_18940 4213 3458 gene locus_tag LOCUS_18950 4213 3458 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_18950 5407 4511 gene locus_tag LOCUS_18960 5407 4511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 6442 5900 gene locus_tag LOCUS_18970 6442 5900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 protein_id gnl|my_center|LOCUS_18970 >Feature sequence0246 1172 330 gene locus_tag LOCUS_18980 1172 330 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088717.1 protein_id gnl|my_center|LOCUS_18980 2157 1189 gene locus_tag LOCUS_18990 2157 1189 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261006.1 protein_id gnl|my_center|LOCUS_18990 2886 2161 gene locus_tag LOCUS_19000 gene neuA 2886 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132016.1 protein_id gnl|my_center|LOCUS_19000 3767 2883 gene locus_tag LOCUS_19010 3767 2883 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023669.1 protein_id gnl|my_center|LOCUS_19010 6222 3778 gene locus_tag LOCUS_19020 6222 3778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 >Feature sequence0247 2 202 gene locus_tag LOCUS_19030 2 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 2024 633 gene locus_tag LOCUS_19040 2024 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 2657 2262 gene locus_tag LOCUS_19050 2657 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 3819 2740 gene locus_tag LOCUS_19060 3819 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 4597 4175 gene locus_tag LOCUS_19070 4597 4175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 >Feature sequence0248 927 1148 gene locus_tag LOCUS_19080 927 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 1151 1315 gene locus_tag LOCUS_19090 1151 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 1378 1578 gene locus_tag LOCUS_19100 1378 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 1583 1870 gene locus_tag LOCUS_19110 gene gatC 1583 1870 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HP82 protein_id gnl|my_center|LOCUS_19110 2515 1883 gene locus_tag LOCUS_19120 2515 1883 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037362.1 protein_id gnl|my_center|LOCUS_19120 3294 2716 gene locus_tag LOCUS_19130 gene def 3294 2716 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E7 protein_id gnl|my_center|LOCUS_19130 3780 3346 gene locus_tag LOCUS_19140 3780 3346 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VP6 protein_id gnl|my_center|LOCUS_19140 4030 5751 gene locus_tag LOCUS_19150 gene recJ 4030 5751 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963032.1 protein_id gnl|my_center|LOCUS_19150 5748 6308 gene locus_tag LOCUS_19160 5748 6308 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550021.1 protein_id gnl|my_center|LOCUS_19160 >Feature sequence0249 171 1718 gene locus_tag LOCUS_19170 171 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 2104 2670 gene locus_tag LOCUS_19180 2104 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19180 2677 3012 gene locus_tag LOCUS_19190 2677 3012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 3242 3589 gene locus_tag LOCUS_19200 3242 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 3663 4154 gene locus_tag LOCUS_19210 3663 4154 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259372.1 protein_id gnl|my_center|LOCUS_19210 4311 5543 gene locus_tag LOCUS_19220 4311 5543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 5731 5570 gene locus_tag LOCUS_19230 5731 5570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 >Feature sequence0250 219 1778 gene locus_tag LOCUS_19240 219 1778 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767669.1 protein_id gnl|my_center|LOCUS_19240 1923 3425 gene locus_tag LOCUS_19250 1923 3425 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_19250 3602 4861 gene locus_tag LOCUS_19260 3602 4861 CDS product 3-hydroxy-3-methylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480279.1 protein_id gnl|my_center|LOCUS_19260 5062 5829 gene locus_tag LOCUS_19270 5062 5829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 >Feature sequence0251 1625 342 gene locus_tag LOCUS_19280 1625 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 2080 1622 gene locus_tag LOCUS_19290 2080 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 >Feature sequence0252 348 718 gene locus_tag LOCUS_tm00010 348 718 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 1196 816 gene locus_tag LOCUS_19300 1196 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 1519 1226 gene locus_tag LOCUS_19310 1519 1226 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_19310 2636 2010 gene locus_tag LOCUS_19320 2636 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 3184 2636 gene locus_tag LOCUS_19330 3184 2636 CDS product RNA polymerase sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027940.1 protein_id gnl|my_center|LOCUS_19330 3432 4958 gene locus_tag LOCUS_19340 3432 4958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 6008 5052 gene locus_tag LOCUS_19350 6008 5052 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888022.1 protein_id gnl|my_center|LOCUS_19350 >Feature sequence0253 2700 1366 gene locus_tag LOCUS_19360 2700 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 5054 2769 gene locus_tag LOCUS_19370 5054 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19370 >Feature sequence0254 538 1728 gene locus_tag LOCUS_19380 538 1728 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765881.1 protein_id gnl|my_center|LOCUS_19380 1970 3439 gene locus_tag LOCUS_19390 1970 3439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 4197 3787 gene locus_tag LOCUS_19400 4197 3787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 5112 4342 gene locus_tag LOCUS_19410 5112 4342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 >Feature sequence0255 <1 572 gene locus_tag LOCUS_19420 <1 572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H1G3:Holliday junction ATP-dependent DNA helicase RuvB 664 1092 gene locus_tag LOCUS_19430 664 1092 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854931.1 protein_id gnl|my_center|LOCUS_19430 2036 1098 gene locus_tag LOCUS_19440 2036 1098 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347004.1 protein_id gnl|my_center|LOCUS_19440 3356 2046 gene locus_tag LOCUS_19450 gene der 3356 2046 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H103 protein_id gnl|my_center|LOCUS_19450 4382 3462 gene locus_tag LOCUS_19460 gene era 4382 3462 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H104 protein_id gnl|my_center|LOCUS_19460 4499 4572 gene locus_tag LOCUS_t00140 4499 4572 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5430 5050 gene locus_tag LOCUS_19470 5430 5050 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_19470 >Feature sequence0256 220 302 gene locus_tag LOCUS_t00150 220 302 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 491 1864 gene locus_tag LOCUS_19480 491 1864 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791866.1 protein_id gnl|my_center|LOCUS_19480 2388 1966 gene locus_tag LOCUS_19490 2388 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 2498 2773 gene locus_tag LOCUS_19500 2498 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 3047 2862 gene locus_tag LOCUS_19510 3047 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 4891 3131 gene locus_tag LOCUS_19520 4891 3131 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117992.1 protein_id gnl|my_center|LOCUS_19520 >Feature sequence0257 2928 1576 gene locus_tag LOCUS_19530 2928 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 3909 3289 gene locus_tag LOCUS_19540 3909 3289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 5032 3929 gene locus_tag LOCUS_19550 5032 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 5352 5876 gene locus_tag LOCUS_19560 5352 5876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918302.1 protein_id gnl|my_center|LOCUS_19560 >Feature sequence0258 2551 1061 gene locus_tag LOCUS_19570 2551 1061 CDS product D-mannonate dehydratase CC0532 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAR4 protein_id gnl|my_center|LOCUS_19570 2641 3573 gene locus_tag LOCUS_19580 2641 3573 CDS product ribonuclease activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969653.1 protein_id gnl|my_center|LOCUS_19580 3674 4714 gene locus_tag LOCUS_19590 gene rfaE 3674 4714 CDS product ADP-heptose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291586.1 protein_id gnl|my_center|LOCUS_19590 4753 6027 gene locus_tag LOCUS_19600 4753 6027 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970646.1 protein_id gnl|my_center|LOCUS_19600 >Feature sequence0259 1769 3148 gene locus_tag LOCUS_19610 1769 3148 CDS product peptidoglycan synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963483.1 protein_id gnl|my_center|LOCUS_19610 3265 3867 gene locus_tag LOCUS_19620 3265 3867 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAJ9 protein_id gnl|my_center|LOCUS_19620 3871 5466 gene locus_tag LOCUS_19630 3871 5466 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557282.1 protein_id gnl|my_center|LOCUS_19630 >Feature sequence0260 <1 2530 gene locus_tag LOCUS_19640 <1 2530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121181.1:L-sorbosone dehydrogenase 3303 2707 gene locus_tag LOCUS_19650 3303 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880985.1 protein_id gnl|my_center|LOCUS_19650 3508 6126 gene locus_tag LOCUS_19660 gene valS 3508 6126 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XH6 protein_id gnl|my_center|LOCUS_19660 >Feature sequence0261 1273 1025 gene locus_tag LOCUS_19670 1273 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 2173 1388 gene locus_tag LOCUS_19680 2173 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 4447 2213 gene locus_tag LOCUS_19690 4447 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 4784 4554 gene locus_tag LOCUS_19700 4784 4554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 4771 5478 gene locus_tag LOCUS_19710 4771 5478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 5730 5539 gene locus_tag LOCUS_19720 5730 5539 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_19720 >Feature sequence0262 547 3894 gene locus_tag LOCUS_19730 gene secA 547 3894 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX63 protein_id gnl|my_center|LOCUS_19730 4031 4696 gene locus_tag LOCUS_19740 gene psd 4031 4696 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_19740 5324 4704 gene locus_tag LOCUS_19750 5324 4704 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117778.1 protein_id gnl|my_center|LOCUS_19750 <6277 5493 gene locus_tag LOCUS_19760 <6277 5493 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203421.1:isoprenyl synthetase >Feature sequence0263 484 119 gene locus_tag LOCUS_19770 484 119 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680824.1 protein_id gnl|my_center|LOCUS_19770 791 465 gene locus_tag LOCUS_19780 791 465 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667001.1 protein_id gnl|my_center|LOCUS_19780 1729 881 gene locus_tag LOCUS_19790 1729 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 3007 1736 gene locus_tag LOCUS_19800 gene ilvA 3007 1736 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT3 protein_id gnl|my_center|LOCUS_19800 4299 3253 gene locus_tag LOCUS_19810 4299 3253 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108126.1 protein_id gnl|my_center|LOCUS_19810 5979 4351 gene locus_tag LOCUS_19820 5979 4351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 >Feature sequence0264 1244 2428 gene locus_tag LOCUS_19830 1244 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 2652 3074 gene locus_tag LOCUS_19840 2652 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 5576 3075 gene locus_tag LOCUS_19850 5576 3075 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086596.1 protein_id gnl|my_center|LOCUS_19850 >Feature sequence0265 1946 2284 gene locus_tag LOCUS_19860 1946 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 2299 3657 gene locus_tag LOCUS_19870 2299 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 3689 4846 gene locus_tag LOCUS_19880 3689 4846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 >Feature sequence0266 1032 409 gene locus_tag LOCUS_19890 1032 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 1480 1124 gene locus_tag LOCUS_19900 1480 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 3926 1485 gene locus_tag LOCUS_19910 3926 1485 CDS product beta-lactam antibiotic acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454344.1 protein_id gnl|my_center|LOCUS_19910 4725 3979 gene locus_tag LOCUS_19920 gene cutC 4725 3979 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6Q4 protein_id gnl|my_center|LOCUS_19920 5145 5366 gene locus_tag LOCUS_19930 5145 5366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_19930 5887 5402 gene locus_tag LOCUS_19940 gene crtZ 5887 5402 CDS product beta-carotene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_19940 >Feature sequence0267 565 4251 gene locus_tag LOCUS_19950 565 4251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 4416 6167 gene locus_tag LOCUS_19960 4416 6167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 >Feature sequence0268 <1 904 gene locus_tag LOCUS_19970 <1 904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963634.1:histidine kinase 1005 2198 gene locus_tag LOCUS_19980 1005 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 2273 3259 gene locus_tag LOCUS_19990 2273 3259 CDS product protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525053.1 protein_id gnl|my_center|LOCUS_19990 >Feature sequence0269 1164 3374 gene locus_tag LOCUS_20000 1164 3374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 >Feature sequence0270 302 1030 gene locus_tag LOCUS_20010 302 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 1345 2832 gene locus_tag LOCUS_20020 1345 2832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 4176 2899 gene locus_tag LOCUS_20030 gene deaD-2 4176 2899 CDS product DEAD/DEAH box family ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932712.1 protein_id gnl|my_center|LOCUS_20030 4457 5695 gene locus_tag LOCUS_20040 4457 5695 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671775.1 protein_id gnl|my_center|LOCUS_20040 >Feature sequence0271 2519 930 gene locus_tag LOCUS_20050 2519 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 2854 3855 gene locus_tag LOCUS_20060 2854 3855 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_20060 4000 5496 gene locus_tag LOCUS_20070 4000 5496 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_20070 5696 5514 gene locus_tag LOCUS_20080 5696 5514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 >Feature sequence0272 870 520 gene locus_tag LOCUS_20090 gene panD 870 520 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81FN5 protein_id gnl|my_center|LOCUS_20090 1299 2789 gene locus_tag LOCUS_20100 1299 2789 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_20100 3038 2841 gene locus_tag LOCUS_20110 3038 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 4303 3296 gene locus_tag LOCUS_20120 4303 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530707.1 protein_id gnl|my_center|LOCUS_20120 4627 5490 gene locus_tag LOCUS_20130 4627 5490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 5539 5955 gene locus_tag LOCUS_20140 5539 5955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143455.1 protein_id gnl|my_center|LOCUS_20140 >Feature sequence0273 894 445 gene locus_tag LOCUS_20150 894 445 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784022.1 protein_id gnl|my_center|LOCUS_20150 1897 1247 gene locus_tag LOCUS_20160 1897 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_661095.1 protein_id gnl|my_center|LOCUS_20160 2142 3239 gene locus_tag LOCUS_20170 gene gldB 2142 3239 CDS product gliding motility lipoprotein GldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964168.1 protein_id gnl|my_center|LOCUS_20170 3273 5096 gene locus_tag LOCUS_20180 3273 5096 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962990.1 protein_id gnl|my_center|LOCUS_20180 >Feature sequence0274 <1 3372 gene locus_tag LOCUS_20190 <1 3372 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085646.1:ATPase >Feature sequence0275 2390 801 gene locus_tag LOCUS_20200 2390 801 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107897.1 protein_id gnl|my_center|LOCUS_20200 2885 3706 gene locus_tag LOCUS_20210 2885 3706 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_20210 4792 3785 gene locus_tag LOCUS_20220 4792 3785 CDS product aryldialkylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584001.1 protein_id gnl|my_center|LOCUS_20220 <6130 4789 gene locus_tag LOCUS_20230 <6130 4789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003103012.1:long-chain-fatty-acid--CoA ligase >Feature sequence0276 4531 5529 gene locus_tag LOCUS_20240 gene tsaD 4531 5529 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H010 protein_id gnl|my_center|LOCUS_20240 >Feature sequence0277 1992 1297 gene locus_tag LOCUS_20250 1992 1297 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963408.1 protein_id gnl|my_center|LOCUS_20250 5043 3571 gene locus_tag LOCUS_20260 gene algL 5043 3571 CDS product lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223691.1 protein_id gnl|my_center|LOCUS_20260 <6106 5157 gene locus_tag LOCUS_20270 <6106 5157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113143.1:non-ribosomal peptide synthetase >Feature sequence0278 113 733 gene locus_tag LOCUS_20280 113 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 915 833 gene locus_tag LOCUS_t00160 915 833 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2438 1041 gene locus_tag LOCUS_20290 2438 1041 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811709.1 protein_id gnl|my_center|LOCUS_20290 3115 2585 gene locus_tag LOCUS_20300 3115 2585 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760055.1 protein_id gnl|my_center|LOCUS_20300 3333 4472 gene locus_tag LOCUS_20310 3333 4472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 4999 4526 gene locus_tag LOCUS_20320 4999 4526 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112855.1 protein_id gnl|my_center|LOCUS_20320 5474 5172 gene locus_tag LOCUS_20330 5474 5172 CDS product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964138.1 protein_id gnl|my_center|LOCUS_20330 <6098 5478 gene locus_tag LOCUS_20340 <6098 5478 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to D1B7K6:GDP-L-fucose synthase >Feature sequence0279 1371 109 gene locus_tag LOCUS_20350 1371 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 2391 1405 gene locus_tag LOCUS_20360 2391 1405 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978446.1 protein_id gnl|my_center|LOCUS_20360 3023 2388 gene locus_tag LOCUS_20370 3023 2388 CDS product Vat family streptogramin A O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459533.1 protein_id gnl|my_center|LOCUS_20370 4057 3164 gene locus_tag LOCUS_20380 4057 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244996.1 protein_id gnl|my_center|LOCUS_20380 5105 4191 gene locus_tag LOCUS_20390 5105 4191 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962404.1 protein_id gnl|my_center|LOCUS_20390 >Feature sequence0280 1674 4055 gene locus_tag LOCUS_20400 1674 4055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 4233 4580 gene locus_tag LOCUS_20410 4233 4580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918611.1 protein_id gnl|my_center|LOCUS_20410 4582 4791 gene locus_tag LOCUS_20420 4582 4791 CDS product DUF4926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143982.1 protein_id gnl|my_center|LOCUS_20420 <6076 4880 gene locus_tag LOCUS_20430 <6076 4880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140627.1:prolyl endopeptidase >Feature sequence0281 129 467 gene locus_tag LOCUS_20440 gene rplX 129 467 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL9 protein_id gnl|my_center|LOCUS_20440 544 1107 gene locus_tag LOCUS_20450 gene rplE 544 1107 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ87 protein_id gnl|my_center|LOCUS_20450 1135 1404 gene locus_tag LOCUS_20460 gene rpsN 1135 1404 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ86 protein_id gnl|my_center|LOCUS_20460 1479 1877 gene locus_tag LOCUS_20470 gene rpsH 1479 1877 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ85 protein_id gnl|my_center|LOCUS_20470 1897 2454 gene locus_tag LOCUS_20480 gene rplF 1897 2454 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NM3 protein_id gnl|my_center|LOCUS_20480 2503 2856 gene locus_tag LOCUS_20490 gene rplR 2503 2856 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6MSP1 protein_id gnl|my_center|LOCUS_20490 2868 3383 gene locus_tag LOCUS_20500 gene rpsE 2868 3383 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A493 protein_id gnl|my_center|LOCUS_20500 3421 3600 gene locus_tag LOCUS_20510 gene rpmD 3421 3600 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q839E6 protein_id gnl|my_center|LOCUS_20510 3615 4061 gene locus_tag LOCUS_20520 gene rplO 3615 4061 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A495 protein_id gnl|my_center|LOCUS_20520 4125 5441 gene locus_tag LOCUS_20530 gene secY 4125 5441 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NM8 protein_id gnl|my_center|LOCUS_20530 >Feature sequence0282 1283 2125 gene locus_tag LOCUS_20540 gene ppx 1283 2125 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963116.1 protein_id gnl|my_center|LOCUS_20540 2507 2139 gene locus_tag LOCUS_20550 2507 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 2728 2579 gene locus_tag LOCUS_20560 2728 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 3973 2825 gene locus_tag LOCUS_20570 3973 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 5968 4106 gene locus_tag LOCUS_20580 5968 4106 CDS product nodulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975332.1 protein_id gnl|my_center|LOCUS_20580 >Feature sequence0283 3818 2913 gene locus_tag LOCUS_20590 3818 2913 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402958.1 protein_id gnl|my_center|LOCUS_20590 4669 3959 gene locus_tag LOCUS_20600 4669 3959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726991.1 protein_id gnl|my_center|LOCUS_20600 <6071 4802 gene locus_tag LOCUS_20610 <6071 4802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765688.1:RNA helicase >Feature sequence0284 2220 754 gene locus_tag LOCUS_20620 2220 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962728.1 protein_id gnl|my_center|LOCUS_20620 3407 2310 gene locus_tag LOCUS_20630 3407 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 4139 3447 gene locus_tag LOCUS_20640 4139 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 4674 4126 gene locus_tag LOCUS_20650 4674 4126 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_20650 5830 4775 gene locus_tag LOCUS_20660 gene ganA 5830 4775 CDS product arabinogalactan endo-beta-1,4-galactanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97G04 protein_id gnl|my_center|LOCUS_20660 >Feature sequence0285 1969 386 gene locus_tag LOCUS_20670 gene yngK 1969 386 CDS product UPF0748 protein YngK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O35015 protein_id gnl|my_center|LOCUS_20670 2326 4140 gene locus_tag LOCUS_20680 2326 4140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 5953 4223 gene locus_tag LOCUS_20690 5953 4223 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973790.1 protein_id gnl|my_center|LOCUS_20690 >Feature sequence0286 692 1777 gene locus_tag LOCUS_20700 692 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 1865 3391 gene locus_tag LOCUS_20710 1865 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 3562 4641 gene locus_tag LOCUS_20720 3562 4641 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762996.1 protein_id gnl|my_center|LOCUS_20720 >Feature sequence0287 <1 857 gene locus_tag LOCUS_20730 <1 857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404972.1:methylmalonyl-CoA carboxyltransferase 910 1974 gene locus_tag LOCUS_20740 910 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 2132 4603 gene locus_tag LOCUS_20750 2132 4603 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202406.1 protein_id gnl|my_center|LOCUS_20750 5491 4646 gene locus_tag LOCUS_20760 5491 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 >Feature sequence0288 1591 3045 gene locus_tag LOCUS_20770 1591 3045 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_20770 3183 3671 gene locus_tag LOCUS_20780 3183 3671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 3798 4832 gene locus_tag LOCUS_20790 3798 4832 CDS product glycosyl hydrolase family 43 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767655.1 protein_id gnl|my_center|LOCUS_20790 4949 5368 gene locus_tag LOCUS_20800 4949 5368 CDS product CHRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088650.1 protein_id gnl|my_center|LOCUS_20800 >Feature sequence0289 387 1700 gene locus_tag LOCUS_20810 387 1700 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963825.1 protein_id gnl|my_center|LOCUS_20810 1720 1795 gene locus_tag LOCUS_t00170 1720 1795 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2875 1856 gene locus_tag LOCUS_20820 2875 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 5552 2877 gene locus_tag LOCUS_20830 5552 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 >Feature sequence0290 1463 2140 gene locus_tag LOCUS_20840 1463 2140 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084072.1 protein_id gnl|my_center|LOCUS_20840 2762 2106 gene locus_tag LOCUS_20850 2762 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 4088 2772 gene locus_tag LOCUS_20860 4088 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 4782 4102 gene locus_tag LOCUS_20870 4782 4102 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022642.1 protein_id gnl|my_center|LOCUS_20870 >Feature sequence0291 468 1391 gene locus_tag LOCUS_20880 gene fjo11 468 1391 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 protein_id gnl|my_center|LOCUS_20880 1501 2037 gene locus_tag LOCUS_20890 gene pycA 1501 2037 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403592.1 protein_id gnl|my_center|LOCUS_20890 2052 2822 gene locus_tag LOCUS_20900 gene pyrH 2052 2822 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS3 protein_id gnl|my_center|LOCUS_20900 2861 4120 gene locus_tag LOCUS_20910 2861 4120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203374.1 protein_id gnl|my_center|LOCUS_20910 4282 4590 gene locus_tag LOCUS_20920 4282 4590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 4600 5160 gene locus_tag LOCUS_20930 gene frr 4600 5160 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS4 protein_id gnl|my_center|LOCUS_20930 >Feature sequence0292 595 1947 gene locus_tag LOCUS_20940 595 1947 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791107.1 protein_id gnl|my_center|LOCUS_20940 2082 3614 gene locus_tag LOCUS_20950 2082 3614 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117991.1 protein_id gnl|my_center|LOCUS_20950 3617 4855 gene locus_tag LOCUS_20960 3617 4855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 >Feature sequence0293 545 1930 gene locus_tag LOCUS_20970 gene wcaJ 545 1930 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964563.1 protein_id gnl|my_center|LOCUS_20970 2162 2494 gene locus_tag LOCUS_20980 2162 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 2682 3962 gene locus_tag LOCUS_20990 gene wbpO 2682 3962 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931326.1 protein_id gnl|my_center|LOCUS_20990 4029 4844 gene locus_tag LOCUS_21000 4029 4844 CDS product SnoK protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954677.1 protein_id gnl|my_center|LOCUS_21000 >Feature sequence0294 1938 946 gene locus_tag LOCUS_21010 1938 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123438.1 protein_id gnl|my_center|LOCUS_21010 2098 3987 gene locus_tag LOCUS_21020 2098 3987 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107811.1 protein_id gnl|my_center|LOCUS_21020 4008 4304 gene locus_tag LOCUS_21030 4008 4304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21030 4437 4637 gene locus_tag LOCUS_21040 4437 4637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 5299 4784 gene locus_tag LOCUS_21050 5299 4784 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 protein_id gnl|my_center|LOCUS_21050 >Feature sequence0295 1421 1131 gene locus_tag LOCUS_21060 1421 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 1652 2470 gene locus_tag LOCUS_21070 1652 2470 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339107.1 protein_id gnl|my_center|LOCUS_21070 3896 2553 gene locus_tag LOCUS_21080 gene accC 3896 2553 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_21080 4438 3971 gene locus_tag LOCUS_21090 gene accB 4438 3971 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_21090 5143 4577 gene locus_tag LOCUS_21100 gene efp 5143 4577 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY96 protein_id gnl|my_center|LOCUS_21100 <5944 5194 gene locus_tag LOCUS_21110 <5944 5194 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A137:3-oxoacyl-[acyl-carrier-protein] synthase 3 protein 2 >Feature sequence0296 1292 837 gene locus_tag LOCUS_21120 1292 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 2671 1355 gene locus_tag LOCUS_21130 2671 1355 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVS7 protein_id gnl|my_center|LOCUS_21130 3586 2894 gene locus_tag LOCUS_21140 3586 2894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 4561 3602 gene locus_tag LOCUS_21150 4561 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 5553 4693 gene locus_tag LOCUS_21160 5553 4693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256777.1 protein_id gnl|my_center|LOCUS_21160 5812 5564 gene locus_tag LOCUS_21170 5812 5564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 >Feature sequence0297 970 2076 gene locus_tag LOCUS_21180 970 2076 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0X6 protein_id gnl|my_center|LOCUS_21180 2142 2405 gene locus_tag LOCUS_21190 2142 2405 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933446.1 protein_id gnl|my_center|LOCUS_21190 2571 4304 gene locus_tag LOCUS_21200 2571 4304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 >Feature sequence0298 4622 1212 gene locus_tag LOCUS_21210 gene porU 4622 1212 CDS product peptidase C25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_21210 5208 4597 gene locus_tag LOCUS_21220 5208 4597 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963510.1 protein_id gnl|my_center|LOCUS_21220 5449 5276 gene locus_tag LOCUS_21230 5449 5276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 >Feature sequence0299 375 1094 gene locus_tag LOCUS_21240 375 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 1268 2845 gene locus_tag LOCUS_21250 1268 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871155.1 protein_id gnl|my_center|LOCUS_21250 4181 2850 gene locus_tag LOCUS_21260 4181 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 >Feature sequence0300 1331 24 gene locus_tag LOCUS_21270 gene tyrS 1331 24 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650K7 protein_id gnl|my_center|LOCUS_21270 1783 2439 gene locus_tag LOCUS_21280 1783 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 2473 3264 gene locus_tag LOCUS_21290 2473 3264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 3482 4234 gene locus_tag LOCUS_21300 3482 4234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531518.1 protein_id gnl|my_center|LOCUS_21300 4237 4974 gene locus_tag LOCUS_21310 4237 4974 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709534.1 protein_id gnl|my_center|LOCUS_21310 5722 4991 gene locus_tag LOCUS_21320 5722 4991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 >Feature sequence0301 8 584 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtattccctacatgcgtggggatggaccg 809 1363 gene locus_tag LOCUS_21330 809 1363 CDS product DNA invertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100847.1 protein_id gnl|my_center|LOCUS_21330 3685 1436 gene locus_tag LOCUS_21340 3685 1436 CDS product isoquinoline 1-oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_21340 4179 3724 gene locus_tag LOCUS_21350 4179 3724 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084347.1 protein_id gnl|my_center|LOCUS_21350 5211 4309 gene locus_tag LOCUS_21360 5211 4309 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_21360 >Feature sequence0302 1003 416 gene locus_tag LOCUS_21370 1003 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 3683 1053 gene locus_tag LOCUS_21380 3683 1053 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108949.1 protein_id gnl|my_center|LOCUS_21380 4432 3683 gene locus_tag LOCUS_21390 gene uppS 4432 3683 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D3 protein_id gnl|my_center|LOCUS_21390 5398 4619 gene locus_tag LOCUS_21400 5398 4619 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405557.1 protein_id gnl|my_center|LOCUS_21400 >Feature sequence0303 924 556 gene locus_tag LOCUS_21410 gene yjgF 924 556 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962909.1 protein_id gnl|my_center|LOCUS_21410 973 1590 gene locus_tag LOCUS_21420 973 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_21420 2586 1600 gene locus_tag LOCUS_21430 2586 1600 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063683.1 protein_id gnl|my_center|LOCUS_21430 2900 3352 gene locus_tag LOCUS_21440 2900 3352 CDS product 2-keto-3-deoxygluconate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462830.1 protein_id gnl|my_center|LOCUS_21440 3427 3858 gene locus_tag LOCUS_21450 gene phnB 3427 3858 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173977.1 protein_id gnl|my_center|LOCUS_21450 4239 5759 gene locus_tag LOCUS_21460 4239 5759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 >Feature sequence0304 2502 529 gene locus_tag LOCUS_21470 2502 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 3804 2701 gene locus_tag LOCUS_21480 gene gfo 3804 2701 CDS product glucose-fructose oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036051.1 protein_id gnl|my_center|LOCUS_21480 >Feature sequence0305 2273 243 gene locus_tag LOCUS_21490 2273 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 3362 2286 gene locus_tag LOCUS_21500 3362 2286 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965647.1 protein_id gnl|my_center|LOCUS_21500 4614 3355 gene locus_tag LOCUS_21510 gene rfbB 4614 3355 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963401.1 protein_id gnl|my_center|LOCUS_21510 5471 4632 gene locus_tag LOCUS_21520 gene xapG 5471 4632 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D15 protein_id gnl|my_center|LOCUS_21520 >Feature sequence0306 1545 2186 gene locus_tag LOCUS_21530 1545 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21530 2731 2201 gene locus_tag LOCUS_21540 2731 2201 CDS product NADH:ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933738.1 protein_id gnl|my_center|LOCUS_21540 4175 2985 gene locus_tag LOCUS_21550 gene fdh 4175 2985 CDS product formaldehyde dehydrogenase, glutathione-independent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118811.1 protein_id gnl|my_center|LOCUS_21550 5438 4647 gene locus_tag LOCUS_21560 5438 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 >Feature sequence0307 1337 12 gene locus_tag LOCUS_21570 gene ffh 1337 12 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM6 protein_id gnl|my_center|LOCUS_21570 1822 2271 gene locus_tag LOCUS_21580 1822 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 3567 2359 gene locus_tag LOCUS_21590 3567 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 4158 3730 gene locus_tag LOCUS_21600 4158 3730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143823.1 protein_id gnl|my_center|LOCUS_21600 4437 4967 gene locus_tag LOCUS_21610 4437 4967 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_21610 >Feature sequence0308 3043 2804 gene locus_tag LOCUS_21620 3043 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 4404 3148 gene locus_tag LOCUS_21630 4404 3148 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_21630 4590 4811 gene locus_tag LOCUS_21640 4590 4811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 5331 5834 gene locus_tag LOCUS_21650 5331 5834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 >Feature sequence0309 1756 863 gene locus_tag LOCUS_21660 gene menA 1756 863 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0WKJ4 protein_id gnl|my_center|LOCUS_21660 2541 1957 gene locus_tag LOCUS_21670 2541 1957 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PF3 protein_id gnl|my_center|LOCUS_21670 4388 2604 gene locus_tag LOCUS_21680 gene argS 4388 2604 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3X5 protein_id gnl|my_center|LOCUS_21680 >Feature sequence0310 707 3103 gene locus_tag LOCUS_21690 707 3103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 3795 3199 gene locus_tag LOCUS_21700 3795 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 4237 3959 gene locus_tag LOCUS_21710 gene rpmA 4237 3959 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P8 protein_id gnl|my_center|LOCUS_21710 4671 4360 gene locus_tag LOCUS_21720 4671 4360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 4877 5476 gene locus_tag LOCUS_21730 4877 5476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 >Feature sequence0311 <1 680 gene locus_tag LOCUS_21740 <1 680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121135.1:NADH-dependent dehydrogenase 853 1851 gene locus_tag LOCUS_21750 853 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 2226 1864 gene locus_tag LOCUS_21760 2226 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 2476 2261 gene locus_tag LOCUS_21770 2476 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 3283 2525 gene locus_tag LOCUS_21780 3283 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121303.1 protein_id gnl|my_center|LOCUS_21780 4452 3418 gene locus_tag LOCUS_21790 4452 3418 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_21790 >Feature sequence0312 354 3443 gene locus_tag LOCUS_21800 gene actB 354 3443 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962544.1 protein_id gnl|my_center|LOCUS_21800 3498 4925 gene locus_tag LOCUS_21810 gene actC 3498 4925 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 protein_id gnl|my_center|LOCUS_21810 4946 5476 gene locus_tag LOCUS_21820 4946 5476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404832.1 protein_id gnl|my_center|LOCUS_21820 >Feature sequence0313 973 128 gene locus_tag LOCUS_21830 973 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 1116 1685 gene locus_tag LOCUS_21840 1116 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 1770 2114 gene locus_tag LOCUS_21850 1770 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 2126 2287 gene locus_tag LOCUS_21860 2126 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 2303 3331 gene locus_tag LOCUS_21870 2303 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 3351 4016 gene locus_tag LOCUS_21880 3351 4016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 4075 4308 gene locus_tag LOCUS_21890 4075 4308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 4322 4594 gene locus_tag LOCUS_21900 4322 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 4746 5732 gene locus_tag LOCUS_21910 4746 5732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 >Feature sequence0314 1311 2321 gene locus_tag LOCUS_21920 1311 2321 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964539.1 protein_id gnl|my_center|LOCUS_21920 5459 2352 gene locus_tag LOCUS_21930 5459 2352 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764017.1 protein_id gnl|my_center|LOCUS_21930 >Feature sequence0315 143 577 gene locus_tag LOCUS_21940 143 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 1085 642 gene locus_tag LOCUS_21950 1085 642 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811528.1 protein_id gnl|my_center|LOCUS_21950 1746 1087 gene locus_tag LOCUS_21960 1746 1087 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680175.1 protein_id gnl|my_center|LOCUS_21960 1885 4383 gene locus_tag LOCUS_21970 1885 4383 CDS product glutaminyl-tRNA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405453.1 protein_id gnl|my_center|LOCUS_21970 5078 4461 gene locus_tag LOCUS_21980 5078 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880985.1 protein_id gnl|my_center|LOCUS_21980 <5802 5178 gene locus_tag LOCUS_21990 <5802 5178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868662.1:diacetylchitobiose deacetylase >Feature sequence0316 1340 825 gene locus_tag LOCUS_22000 1340 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 1773 3185 gene locus_tag LOCUS_22010 gene trpE 1773 3185 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962677.1 protein_id gnl|my_center|LOCUS_22010 3231 3797 gene locus_tag LOCUS_22020 gene pabA 3231 3797 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962676.1 protein_id gnl|my_center|LOCUS_22020 3947 4936 gene locus_tag LOCUS_22030 gene trpD 3947 4936 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ4 protein_id gnl|my_center|LOCUS_22030 4933 5523 gene locus_tag LOCUS_22040 4933 5523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754228.1 protein_id gnl|my_center|LOCUS_22040 >Feature sequence0317 >Feature sequence0318 1011 340 gene locus_tag LOCUS_22050 1011 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 2388 1051 gene locus_tag LOCUS_22060 gene tldD 2388 1051 CDS product TldD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035351.1 protein_id gnl|my_center|LOCUS_22060 4036 2396 gene locus_tag LOCUS_22070 gene tldD 4036 2396 CDS product TldD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035352.1 protein_id gnl|my_center|LOCUS_22070 5435 4086 gene locus_tag LOCUS_22080 gene tldD 5435 4086 CDS product TldD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035351.1 protein_id gnl|my_center|LOCUS_22080 >Feature sequence0319 5212 3116 gene locus_tag LOCUS_22090 5212 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 >Feature sequence0320 440 1714 gene locus_tag LOCUS_22100 440 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 2231 2398 gene locus_tag LOCUS_22110 2231 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 2835 2548 gene locus_tag LOCUS_22120 2835 2548 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250981.1 protein_id gnl|my_center|LOCUS_22120 3125 2832 gene locus_tag LOCUS_22130 3125 2832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 3350 4351 gene locus_tag LOCUS_22140 3350 4351 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707803.1 protein_id gnl|my_center|LOCUS_22140 5502 4480 gene locus_tag LOCUS_22150 gene rbsC 5502 4480 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330724.1 protein_id gnl|my_center|LOCUS_22150 >Feature sequence0321 496 2787 gene locus_tag LOCUS_22160 496 2787 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963130.1 protein_id gnl|my_center|LOCUS_22160 >Feature sequence0322 <1 780 gene locus_tag LOCUS_22170 <1 780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119516.1:MFS transporter 3364 956 gene locus_tag LOCUS_22180 gene mutS2 3364 956 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YQ1 protein_id gnl|my_center|LOCUS_22180 4018 3500 gene locus_tag LOCUS_22190 4018 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963023.1 protein_id gnl|my_center|LOCUS_22190 4113 4454 gene locus_tag LOCUS_22200 4113 4454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 >Feature sequence0323 899 285 gene locus_tag LOCUS_22210 899 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 2525 906 gene locus_tag LOCUS_22220 2525 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 3288 2515 gene locus_tag LOCUS_22230 3288 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 >Feature sequence0324 166 1992 gene locus_tag LOCUS_22240 166 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 2013 2345 gene locus_tag LOCUS_22250 2013 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 2347 4488 gene locus_tag LOCUS_22260 gene glgX 2347 4488 CDS product glycogen operon protein GlgX homolog inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULT9 protein_id gnl|my_center|LOCUS_22260 4540 4875 gene locus_tag LOCUS_22270 4540 4875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 4888 5316 gene locus_tag LOCUS_22280 gene rsbW 4888 5316 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871913.1 protein_id gnl|my_center|LOCUS_22280 >Feature sequence0325 1847 3442 gene locus_tag LOCUS_22290 1847 3442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404208.1 protein_id gnl|my_center|LOCUS_22290 4239 3472 gene locus_tag LOCUS_22300 4239 3472 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_22300 <5635 4423 gene locus_tag LOCUS_22310 <5635 4423 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113740.1:2-ketogluconate transporter >Feature sequence0326 1269 838 gene locus_tag LOCUS_22320 1269 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404629.1 protein_id gnl|my_center|LOCUS_22320 2955 1339 gene locus_tag LOCUS_22330 2955 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 3378 4592 gene locus_tag LOCUS_22340 3378 4592 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404271.1 protein_id gnl|my_center|LOCUS_22340 >Feature sequence0327 1302 1841 gene locus_tag LOCUS_22350 gene hslV 1302 1841 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S219 protein_id gnl|my_center|LOCUS_22350 3364 1922 gene locus_tag LOCUS_22360 gene dacC 3364 1922 CDS product D-alanyl-D-alanine carboxypeptidase DacC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39844 protein_id gnl|my_center|LOCUS_22360 3700 5130 gene locus_tag LOCUS_22370 3700 5130 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811709.1 protein_id gnl|my_center|LOCUS_22370 >Feature sequence0328 208 1281 gene locus_tag LOCUS_22380 208 1281 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228754.1 protein_id gnl|my_center|LOCUS_22380 1496 1810 gene locus_tag LOCUS_22390 1496 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 >Feature sequence0329 2 1156 gene locus_tag LOCUS_22400 2 1156 CDS product oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120646.1 protein_id gnl|my_center|LOCUS_22400 1799 1146 gene locus_tag LOCUS_22410 1799 1146 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881043.1 protein_id gnl|my_center|LOCUS_22410 2637 1852 gene locus_tag LOCUS_22420 2637 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 3068 2634 gene locus_tag LOCUS_22430 3068 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 3694 4089 gene locus_tag LOCUS_22440 3694 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 5386 4112 gene locus_tag LOCUS_22450 5386 4112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918537.1 protein_id gnl|my_center|LOCUS_22450 >Feature sequence0330 2099 1026 gene locus_tag LOCUS_22460 2099 1026 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763955.1 protein_id gnl|my_center|LOCUS_22460 2862 2290 gene locus_tag LOCUS_22470 2862 2290 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992764.1 protein_id gnl|my_center|LOCUS_22470 3277 4431 gene locus_tag LOCUS_22480 3277 4431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 >Feature sequence0331 1085 1246 gene locus_tag LOCUS_22490 gene rpmH 1085 1246 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z40 protein_id gnl|my_center|LOCUS_22490 1330 1722 gene locus_tag LOCUS_22500 gene rnpA 1330 1722 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H257 protein_id gnl|my_center|LOCUS_22500 1789 3444 gene locus_tag LOCUS_22510 1789 3444 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791282.1 protein_id gnl|my_center|LOCUS_22510 3520 4248 gene locus_tag LOCUS_22520 3520 4248 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790587.1 protein_id gnl|my_center|LOCUS_22520 4339 4854 gene locus_tag LOCUS_22530 4339 4854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 protein_id gnl|my_center|LOCUS_22530 4943 5437 gene locus_tag LOCUS_22540 4943 5437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 >Feature sequence0332 3142 3696 gene locus_tag LOCUS_22550 3142 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 3726 4508 gene locus_tag LOCUS_22560 3726 4508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 4592 4987 gene locus_tag LOCUS_22570 4592 4987 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258723.1 protein_id gnl|my_center|LOCUS_22570 4984 5301 gene locus_tag LOCUS_22580 4984 5301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258722.1 protein_id gnl|my_center|LOCUS_22580 >Feature sequence0333 1113 3893 gene locus_tag LOCUS_22590 1113 3893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 4312 4842 gene locus_tag LOCUS_22600 4312 4842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 4888 5415 gene locus_tag LOCUS_22610 4888 5415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 >Feature sequence0334 869 2071 gene locus_tag LOCUS_22620 gene putA 869 2071 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_22620 2176 2958 gene locus_tag LOCUS_22630 2176 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 4538 3051 gene locus_tag LOCUS_22640 4538 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 4821 5408 gene locus_tag LOCUS_22650 4821 5408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 >Feature sequence0335 259 1746 gene locus_tag LOCUS_22660 gene uxaB 259 1746 CDS product altronate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34354 protein_id gnl|my_center|LOCUS_22660 1861 3015 gene locus_tag LOCUS_22670 1861 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090572.1 protein_id gnl|my_center|LOCUS_22670 3355 3113 gene locus_tag LOCUS_22680 3355 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 4935 3421 gene locus_tag LOCUS_22690 gene atpD 4935 3421 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV9 protein_id gnl|my_center|LOCUS_22690 >Feature sequence0336 4242 985 gene locus_tag LOCUS_22700 4242 985 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786949.1 protein_id gnl|my_center|LOCUS_22700 <5534 4601 gene locus_tag LOCUS_22710 <5534 4601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005797826.1:WYL domain-containing protein >Feature sequence0337 4240 2498 gene locus_tag LOCUS_22720 4240 2498 CDS product glucoamylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027969.1 protein_id gnl|my_center|LOCUS_22720 4605 4387 gene locus_tag LOCUS_22730 4605 4387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 5111 5461 gene locus_tag LOCUS_22740 5111 5461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 >Feature sequence0338 623 204 gene locus_tag LOCUS_22750 623 204 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_22750 3840 625 gene locus_tag LOCUS_22760 3840 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 4373 4978 gene locus_tag LOCUS_22770 4373 4978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 >Feature sequence0339 712 1092 gene locus_tag LOCUS_22780 712 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 2495 1194 gene locus_tag LOCUS_22790 2495 1194 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403495.1 protein_id gnl|my_center|LOCUS_22790 2661 4310 gene locus_tag LOCUS_22800 2661 4310 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403922.1 protein_id gnl|my_center|LOCUS_22800 4322 5143 gene locus_tag LOCUS_22810 4322 5143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 >Feature sequence0340 619 3039 gene locus_tag LOCUS_22820 619 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 3110 3385 gene locus_tag LOCUS_22830 3110 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 3566 4093 gene locus_tag LOCUS_22840 3566 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 4285 4106 gene locus_tag LOCUS_22850 4285 4106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 >Feature sequence0341 1870 1031 gene locus_tag LOCUS_22860 1870 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 2977 2387 gene locus_tag LOCUS_22870 2977 2387 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_22870 3777 3172 gene locus_tag LOCUS_22880 3777 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 5159 4701 gene locus_tag LOCUS_22890 5159 4701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 >Feature sequence0342 1730 2494 gene locus_tag LOCUS_22900 1730 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 3483 2482 gene locus_tag LOCUS_22910 3483 2482 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528466.1 protein_id gnl|my_center|LOCUS_22910 4668 3604 gene locus_tag LOCUS_22920 4668 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 <5506 4671 gene locus_tag LOCUS_22930 <5506 4671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143551.1:sensor histidine kinase >Feature sequence0343 84 833 gene locus_tag LOCUS_22940 84 833 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706132.1 protein_id gnl|my_center|LOCUS_22940 909 3842 gene locus_tag LOCUS_22950 909 3842 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_22950 4200 3949 gene locus_tag LOCUS_22960 4200 3949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 4541 4236 gene locus_tag LOCUS_22970 4541 4236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 <5502 4818 gene locus_tag LOCUS_22980 <5502 4818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989646.1:beta-glucosidase >Feature sequence0344 793 212 gene locus_tag LOCUS_22990 793 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 950 1507 gene locus_tag LOCUS_23000 950 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 2128 1562 gene locus_tag LOCUS_23010 2128 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 3091 2333 gene locus_tag LOCUS_23020 3091 2333 CDS product endo-1,3-1,4-beta glucanase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265727.1 protein_id gnl|my_center|LOCUS_23020 3242 5101 gene locus_tag LOCUS_23030 3242 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 >Feature sequence0345 240 1424 gene locus_tag LOCUS_23040 240 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 1469 2254 gene locus_tag LOCUS_23050 1469 2254 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_23050 2387 3340 gene locus_tag LOCUS_23060 2387 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 3593 4666 gene locus_tag LOCUS_23070 3593 4666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 >Feature sequence0346 998 2293 gene locus_tag LOCUS_23080 998 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23080 2290 4224 gene locus_tag LOCUS_23090 2290 4224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23090 4175 5461 gene locus_tag LOCUS_23100 4175 5461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 >Feature sequence0347 2 442 gene locus_tag LOCUS_23110 2 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 540 4862 gene locus_tag LOCUS_23120 gene rpoC 540 4862 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ8 protein_id gnl|my_center|LOCUS_23120 4996 5325 gene locus_tag LOCUS_23130 4996 5325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_23130 >Feature sequence0348 <1 1247 gene locus_tag LOCUS_23140 <1 1247 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0L3:inosine-5'-monophosphate dehydrogenase 3275 1323 gene locus_tag LOCUS_23150 3275 1323 CDS product heparinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201967.1 protein_id gnl|my_center|LOCUS_23150 5186 3288 gene locus_tag LOCUS_23160 5186 3288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 >Feature sequence0349 <1 1041 gene locus_tag LOCUS_23170 <1 1041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767964.1:phosphoglucomutase 2159 1122 gene locus_tag LOCUS_23180 2159 1122 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768800.1 protein_id gnl|my_center|LOCUS_23180 2470 2910 gene locus_tag LOCUS_23190 2470 2910 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963212.1 protein_id gnl|my_center|LOCUS_23190 2963 4189 gene locus_tag LOCUS_23200 gene ald 2963 4189 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_23200 4235 4639 gene locus_tag LOCUS_23210 4235 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 4838 5056 gene locus_tag LOCUS_23220 4838 5056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 >Feature sequence0350 1732 2895 gene locus_tag LOCUS_23230 1732 2895 CDS product glutathione-dependent formaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966646.1 protein_id gnl|my_center|LOCUS_23230 3860 2970 gene locus_tag LOCUS_23240 3860 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932949.1 protein_id gnl|my_center|LOCUS_23240 4260 3874 gene locus_tag LOCUS_23250 4260 3874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 4543 4364 gene locus_tag LOCUS_23260 4543 4364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 4700 5104 gene locus_tag LOCUS_23270 4700 5104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 >Feature sequence0351 265 1704 gene locus_tag LOCUS_23280 265 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963476.1 protein_id gnl|my_center|LOCUS_23280 1985 5128 gene locus_tag LOCUS_23290 1985 5128 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963475.1 protein_id gnl|my_center|LOCUS_23290 >Feature sequence0352 2381 1362 gene locus_tag LOCUS_23300 gene ltaE 2381 1362 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 protein_id gnl|my_center|LOCUS_23300 3643 2498 gene locus_tag LOCUS_23310 3643 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963799.1 protein_id gnl|my_center|LOCUS_23310 3822 4361 gene locus_tag LOCUS_23320 3822 4361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 >Feature sequence0353 200 1159 gene locus_tag LOCUS_23330 200 1159 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785156.1 protein_id gnl|my_center|LOCUS_23330 1140 2462 gene locus_tag LOCUS_23340 1140 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 2471 4537 gene locus_tag LOCUS_23350 2471 4537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 4604 5242 gene locus_tag LOCUS_23360 4604 5242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963624.1 protein_id gnl|my_center|LOCUS_23360 >Feature sequence0354 <1 828 gene locus_tag LOCUS_23370 <1 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64MP7:methionine--tRNA ligase 1339 935 gene locus_tag LOCUS_23380 1339 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 1692 1477 gene locus_tag LOCUS_23390 1692 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 2745 1813 gene locus_tag LOCUS_23400 2745 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022977.1 protein_id gnl|my_center|LOCUS_23400 3385 2810 gene locus_tag LOCUS_23410 3385 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 4122 3388 gene locus_tag LOCUS_23420 4122 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 4955 4176 gene locus_tag LOCUS_23430 4955 4176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 >Feature sequence0355 2620 4302 gene locus_tag LOCUS_23440 2620 4302 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791194.1 protein_id gnl|my_center|LOCUS_23440 4340 5419 gene locus_tag LOCUS_23450 4340 5419 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107471.1 protein_id gnl|my_center|LOCUS_23450 >Feature sequence0356 1498 2697 gene locus_tag LOCUS_23460 1498 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 2849 5038 gene locus_tag LOCUS_23470 2849 5038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 >Feature sequence0357 1043 309 gene locus_tag LOCUS_23480 1043 309 CDS product GLPGLI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962440.1 protein_id gnl|my_center|LOCUS_23480 3989 1173 gene locus_tag LOCUS_23490 3989 1173 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_23490 5374 4145 gene locus_tag LOCUS_23500 gene queA 5374 4145 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0P8 protein_id gnl|my_center|LOCUS_23500 >Feature sequence0358 362 1396 gene locus_tag LOCUS_23510 362 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 1587 4046 gene locus_tag LOCUS_23520 1587 4046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 >Feature sequence0359 961 1251 gene locus_tag LOCUS_23530 961 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 3515 1317 gene locus_tag LOCUS_23540 3515 1317 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814149.1 protein_id gnl|my_center|LOCUS_23540 <5377 3788 gene locus_tag LOCUS_23550 <5377 3788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64ZN0:DNA gyrase subunit B >Feature sequence0360 1050 1655 gene locus_tag LOCUS_23560 1050 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 1672 2127 gene locus_tag LOCUS_23570 gene recX 1672 2127 CDS product recombinase RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964333.1 protein_id gnl|my_center|LOCUS_23570 3245 2247 gene locus_tag LOCUS_23580 gene nrdB 3245 2247 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 protein_id gnl|my_center|LOCUS_23580 3512 4381 gene locus_tag LOCUS_23590 3512 4381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 4498 5334 gene locus_tag LOCUS_23600 4498 5334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 >Feature sequence0361 1469 393 gene locus_tag LOCUS_23610 1469 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 2873 1641 gene locus_tag LOCUS_23620 2873 1641 CDS product glucarate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334635.1 protein_id gnl|my_center|LOCUS_23620 4464 3130 gene locus_tag LOCUS_23630 4464 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119546.1 protein_id gnl|my_center|LOCUS_23630 5182 4544 gene locus_tag LOCUS_23640 5182 4544 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119544.1 protein_id gnl|my_center|LOCUS_23640 >Feature sequence0362 4187 843 gene locus_tag LOCUS_23650 4187 843 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_23650 5343 4219 gene locus_tag LOCUS_23660 5343 4219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 >Feature sequence0363 1875 3305 gene locus_tag LOCUS_23670 1875 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 3712 4326 gene locus_tag LOCUS_23680 3712 4326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 4459 4911 gene locus_tag LOCUS_23690 4459 4911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 >Feature sequence0364 3966 2803 gene locus_tag LOCUS_23700 3966 2803 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963079.1 protein_id gnl|my_center|LOCUS_23700 4543 4148 gene locus_tag LOCUS_23710 4543 4148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 <5359 4844 gene locus_tag LOCUS_23720 <5359 4844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011975094.1:NADH-quinone oxidoreductase subunit M >Feature sequence0365 1816 3198 gene locus_tag LOCUS_23730 gene mdsA 1816 3198 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121930.1 protein_id gnl|my_center|LOCUS_23730 3276 4718 gene locus_tag LOCUS_23740 3276 4718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 >Feature sequence0366 2904 2218 gene locus_tag LOCUS_23750 2904 2218 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209109.1 protein_id gnl|my_center|LOCUS_23750 3134 4111 gene locus_tag LOCUS_23760 gene trpS 3134 4111 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964337.1 protein_id gnl|my_center|LOCUS_23760 4108 4692 gene locus_tag LOCUS_23770 gene lpxF 4108 4692 CDS product lipid A 4'-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6M3 protein_id gnl|my_center|LOCUS_23770 >Feature sequence0367 436 167 gene locus_tag LOCUS_23780 436 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 317 1585 gene locus_tag LOCUS_23790 317 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 2053 3690 gene locus_tag LOCUS_23800 2053 3690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 >Feature sequence0368 2727 3572 gene locus_tag LOCUS_23810 gene pfkA 2727 3572 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PU0 protein_id gnl|my_center|LOCUS_23810 4400 3627 gene locus_tag LOCUS_23820 4400 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404405.1 protein_id gnl|my_center|LOCUS_23820 >Feature sequence0369 1559 588 gene locus_tag LOCUS_23830 gene rbsK 1559 588 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCE6 protein_id gnl|my_center|LOCUS_23830 2538 1750 gene locus_tag LOCUS_23840 2538 1750 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703669.1 protein_id gnl|my_center|LOCUS_23840 3057 2620 gene locus_tag LOCUS_23850 3057 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 3192 3545 gene locus_tag LOCUS_23860 3192 3545 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206564.1 protein_id gnl|my_center|LOCUS_23860 3599 4588 gene locus_tag LOCUS_23870 3599 4588 CDS product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108502.1 protein_id gnl|my_center|LOCUS_23870 >Feature sequence0370 <1 655 gene locus_tag LOCUS_23880 <1 655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005789261.1:arylsulfatase 714 4706 gene locus_tag LOCUS_23890 714 4706 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767023.1 protein_id gnl|my_center|LOCUS_23890 >Feature sequence0371 598 257 gene locus_tag LOCUS_23900 598 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 2191 617 gene locus_tag LOCUS_23910 2191 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 3638 2316 gene locus_tag LOCUS_23920 3638 2316 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 protein_id gnl|my_center|LOCUS_23920 4027 3758 gene locus_tag LOCUS_23930 4027 3758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 >Feature sequence0372 848 384 gene locus_tag LOCUS_23940 848 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 1154 2116 gene locus_tag LOCUS_23950 1154 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 2245 2922 gene locus_tag LOCUS_23960 2245 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 3178 3435 gene locus_tag LOCUS_23970 3178 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808730.1 protein_id gnl|my_center|LOCUS_23970 3442 3693 gene locus_tag LOCUS_23980 3442 3693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 3903 4481 gene locus_tag LOCUS_23990 3903 4481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208083.1 protein_id gnl|my_center|LOCUS_23990 4913 5221 gene locus_tag LOCUS_24000 4913 5221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 >Feature sequence0373 697 107 gene locus_tag LOCUS_24010 697 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 2542 902 gene locus_tag LOCUS_24020 2542 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 3077 2718 gene locus_tag LOCUS_24030 3077 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 3607 3110 gene locus_tag LOCUS_24040 3607 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 4243 3713 gene locus_tag LOCUS_24050 4243 3713 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782842.1 protein_id gnl|my_center|LOCUS_24050 4434 5129 gene locus_tag LOCUS_24060 4434 5129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 >Feature sequence0374 1524 487 gene locus_tag LOCUS_24070 1524 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 2192 1521 gene locus_tag LOCUS_24080 2192 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 3348 2251 gene locus_tag LOCUS_24090 3348 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 <5294 3345 gene locus_tag LOCUS_24100 <5294 3345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836868.1:phosphoenolpyruvate synthase >Feature sequence0375 426 1304 gene locus_tag LOCUS_24110 426 1304 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759986.1 protein_id gnl|my_center|LOCUS_24110 2764 1301 gene locus_tag LOCUS_24120 gene ndhB 2764 1301 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEB3 protein_id gnl|my_center|LOCUS_24120 2890 3573 gene locus_tag LOCUS_24130 2890 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 4342 3635 gene locus_tag LOCUS_24140 gene phoP 4342 3635 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_24140 >Feature sequence0376 <1 1820 gene locus_tag LOCUS_24150 <1 1820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107802.1:ABC transporter permease 1920 4370 gene locus_tag LOCUS_24160 1920 4370 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_24160 >Feature sequence0377 801 3221 gene locus_tag LOCUS_24170 801 3221 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_24170 5200 3305 gene locus_tag LOCUS_24180 5200 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 >Feature sequence0378 2786 1950 gene locus_tag LOCUS_24190 gene fdhD 2786 1950 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QNU3 protein_id gnl|my_center|LOCUS_24190 4189 2858 gene locus_tag LOCUS_24200 gene rhlE 4189 2858 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963231.1 protein_id gnl|my_center|LOCUS_24200 4877 4260 gene locus_tag LOCUS_24210 4877 4260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 5060 5212 gene locus_tag LOCUS_24220 5060 5212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 >Feature sequence0379 981 2843 gene locus_tag LOCUS_24230 gene susA 981 2843 CDS product neopullulanase SusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1G0 protein_id gnl|my_center|LOCUS_24230 3544 3176 gene locus_tag LOCUS_24240 3544 3176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 4267 3833 gene locus_tag LOCUS_24250 4267 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803505.1 protein_id gnl|my_center|LOCUS_24250 5076 4345 gene locus_tag LOCUS_24260 5076 4345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 >Feature sequence0380 <5263 2011 gene locus_tag LOCUS_24270 <5263 2011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007330113.1:RNA-binding protein >Feature sequence0381 167 1528 gene locus_tag LOCUS_24280 167 1528 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765356.1 protein_id gnl|my_center|LOCUS_24280 1559 2650 gene locus_tag LOCUS_24290 1559 2650 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262874.1 protein_id gnl|my_center|LOCUS_24290 >Feature sequence0382 1505 2965 gene locus_tag LOCUS_24300 1505 2965 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_24300 3841 3005 gene locus_tag LOCUS_24310 3841 3005 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918288.1 protein_id gnl|my_center|LOCUS_24310 >Feature sequence0383 1929 673 gene locus_tag LOCUS_24320 1929 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 5136 1978 gene locus_tag LOCUS_24330 5136 1978 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_24330 >Feature sequence0384 141 806 gene locus_tag LOCUS_24340 gene ung2 141 806 CDS product uracil-DNA glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM3 protein_id gnl|my_center|LOCUS_24340 1272 868 gene locus_tag LOCUS_24350 1272 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 1706 2653 gene locus_tag LOCUS_24360 1706 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 3554 2655 gene locus_tag LOCUS_24370 3554 2655 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109261.1 protein_id gnl|my_center|LOCUS_24370 3648 4850 gene locus_tag LOCUS_24380 3648 4850 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760004.1 protein_id gnl|my_center|LOCUS_24380 4861 5064 gene locus_tag LOCUS_24390 4861 5064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 >Feature sequence0385 4171 3371 gene locus_tag LOCUS_24400 gene trpA 4171 3371 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ0 protein_id gnl|my_center|LOCUS_24400 4569 4168 gene locus_tag LOCUS_24410 4569 4168 CDS product stress responsive protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329772.1 protein_id gnl|my_center|LOCUS_24410 4824 4624 gene locus_tag LOCUS_24420 4824 4624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 >Feature sequence0386 101 1342 gene locus_tag LOCUS_24430 101 1342 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405434.1 protein_id gnl|my_center|LOCUS_24430 1352 2548 gene locus_tag LOCUS_24440 1352 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124068.1 protein_id gnl|my_center|LOCUS_24440 3857 2613 gene locus_tag LOCUS_24450 3857 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 4467 3955 gene locus_tag LOCUS_24460 4467 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 >Feature sequence0387 587 1771 gene locus_tag LOCUS_24470 587 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 1784 2092 gene locus_tag LOCUS_24480 1784 2092 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930735.1 protein_id gnl|my_center|LOCUS_24480 2099 3349 gene locus_tag LOCUS_24490 2099 3349 CDS product putative ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702783.1 protein_id gnl|my_center|LOCUS_24490 3857 4594 gene locus_tag LOCUS_24500 3857 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 >Feature sequence0388 857 147 gene locus_tag LOCUS_24510 857 147 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_24510 1455 937 gene locus_tag LOCUS_24520 1455 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 2582 1473 gene locus_tag LOCUS_24530 2582 1473 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023320.1 protein_id gnl|my_center|LOCUS_24530 3103 2603 gene locus_tag LOCUS_24540 3103 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 >Feature sequence0389 1840 866 gene locus_tag LOCUS_24550 1840 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 2108 2539 gene locus_tag LOCUS_24560 2108 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 2605 2817 gene locus_tag LOCUS_24570 gene tatA 2605 2817 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XY4 protein_id gnl|my_center|LOCUS_24570 2928 4379 gene locus_tag LOCUS_24580 gene gatA 2928 4379 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFQ4 protein_id gnl|my_center|LOCUS_24580 >Feature sequence0390 33 425 gene locus_tag LOCUS_24590 33 425 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090087.1 protein_id gnl|my_center|LOCUS_24590 525 1178 gene locus_tag LOCUS_24600 525 1178 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458063.1 protein_id gnl|my_center|LOCUS_24600 3027 1159 gene locus_tag LOCUS_24610 3027 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 3698 3084 gene locus_tag LOCUS_24620 3698 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 <5199 3802 gene locus_tag LOCUS_24630 <5199 3802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258810.1:protein kinase >Feature sequence0391 49 1590 gene locus_tag LOCUS_24640 49 1590 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_24640 1590 2633 gene locus_tag LOCUS_24650 1590 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 5141 2640 gene locus_tag LOCUS_24660 gene aguA 5141 2640 CDS product xylan alpha-1,2-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3G9 protein_id gnl|my_center|LOCUS_24660 >Feature sequence0392 590 2350 gene locus_tag LOCUS_24670 590 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 2368 2988 gene locus_tag LOCUS_24680 2368 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 3241 3933 gene locus_tag LOCUS_24690 3241 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 4015 4638 gene locus_tag LOCUS_24700 4015 4638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 4687 5094 gene locus_tag LOCUS_24710 4687 5094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 >Feature sequence0393 2192 2899 gene locus_tag LOCUS_24720 2192 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 3122 3883 gene locus_tag LOCUS_24730 gene deoC 3122 3883 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPT7 protein_id gnl|my_center|LOCUS_24730 4770 3931 gene locus_tag LOCUS_24740 gene menB 4770 3931 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWW1 protein_id gnl|my_center|LOCUS_24740 >Feature sequence0394 <1 522 gene locus_tag LOCUS_24750 <1 522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141661.1:sensor histidine kinase 566 2227 gene locus_tag LOCUS_24760 566 2227 CDS product fused response regulator/thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140483.1 protein_id gnl|my_center|LOCUS_24760 2313 3239 gene locus_tag LOCUS_24770 2313 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 3351 3734 gene locus_tag LOCUS_24780 3351 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 >Feature sequence0395 3663 2068 gene locus_tag LOCUS_24790 3663 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 >Feature sequence0396 955 59 gene locus_tag LOCUS_24800 955 59 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050431.1 protein_id gnl|my_center|LOCUS_24800 1121 2221 gene locus_tag LOCUS_24810 gene bplD 1121 2221 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929613.1 protein_id gnl|my_center|LOCUS_24810 2225 3070 gene locus_tag LOCUS_24820 gene noeI 2225 3070 CDS product nodulation protein noeI- methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122208.1 protein_id gnl|my_center|LOCUS_24820 3107 3943 gene locus_tag LOCUS_24830 3107 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 4134 4910 gene locus_tag LOCUS_24840 4134 4910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 >Feature sequence0397 2230 260 gene locus_tag LOCUS_24850 2230 260 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107131.1 protein_id gnl|my_center|LOCUS_24850 3249 2608 gene locus_tag LOCUS_24860 3249 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 4504 3290 gene locus_tag LOCUS_24870 4504 3290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108579.1 protein_id gnl|my_center|LOCUS_24870 4562 4825 gene locus_tag LOCUS_24880 4562 4825 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262767.1 protein_id gnl|my_center|LOCUS_24880 >Feature sequence0398 848 1723 gene locus_tag LOCUS_24890 848 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 2384 3805 gene locus_tag LOCUS_24900 2384 3805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 4571 3828 gene locus_tag LOCUS_24910 4571 3828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 <5119 4611 gene locus_tag LOCUS_24920 <5119 4611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039971.1:cytochrome c >Feature sequence0399 719 39 gene locus_tag LOCUS_24930 719 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 1409 723 gene locus_tag LOCUS_24940 1409 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 2267 2061 gene locus_tag LOCUS_24950 2267 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 3271 2333 gene locus_tag LOCUS_24960 3271 2333 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_24960 3421 4527 gene locus_tag LOCUS_24970 gene pdxA 3421 4527 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H263 protein_id gnl|my_center|LOCUS_24970 >Feature sequence0400 2526 1612 gene locus_tag LOCUS_24980 2526 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 2842 2543 gene locus_tag LOCUS_24990 2842 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 3148 2954 gene locus_tag LOCUS_25000 3148 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 3527 4417 gene locus_tag LOCUS_25010 3527 4417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 4643 4891 gene locus_tag LOCUS_25020 4643 4891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 >Feature sequence0401 <1 750 gene locus_tag LOCUS_25030 <1 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763077.1:bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase 758 1582 gene locus_tag LOCUS_25040 758 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 1607 2656 gene locus_tag LOCUS_25050 1607 2656 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036137.1 protein_id gnl|my_center|LOCUS_25050 3513 2953 gene locus_tag LOCUS_25060 3513 2953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 >Feature sequence0402 725 1096 gene locus_tag LOCUS_25070 725 1096 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_25070 1135 2997 gene locus_tag LOCUS_25080 1135 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 3058 3489 gene locus_tag LOCUS_25090 3058 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 >Feature sequence0403 597 1403 gene locus_tag LOCUS_25100 597 1403 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962288.1 protein_id gnl|my_center|LOCUS_25100 1426 2742 gene locus_tag LOCUS_25110 1426 2742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 2870 4708 gene locus_tag LOCUS_25120 gene glmS 2870 4708 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV6 protein_id gnl|my_center|LOCUS_25120 >Feature sequence0404 <1 1683 gene locus_tag LOCUS_25130 <1 1683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918005.1:amidohydrolase 1901 2359 gene locus_tag LOCUS_25140 1901 2359 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942039.1 protein_id gnl|my_center|LOCUS_25140 2356 2943 gene locus_tag LOCUS_25150 2356 2943 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942040.1 protein_id gnl|my_center|LOCUS_25150 3156 4076 gene locus_tag LOCUS_25160 3156 4076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 4970 4149 gene locus_tag LOCUS_25170 4970 4149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 >Feature sequence0405 1947 1066 gene locus_tag LOCUS_25180 1947 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 <5068 2028 gene locus_tag LOCUS_25190 <5068 2028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085890.1:sensor histidine kinase >Feature sequence0406 602 988 gene locus_tag LOCUS_25200 602 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 1011 1565 gene locus_tag LOCUS_25210 1011 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 2828 1584 gene locus_tag LOCUS_25220 gene porY 2828 1584 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_25220 3162 4430 gene locus_tag LOCUS_25230 gene hemA 3162 4430 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93ST4 protein_id gnl|my_center|LOCUS_25230 >Feature sequence0407 1064 198 gene locus_tag LOCUS_25240 1064 198 CDS product conjugative transposon protein TraN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008024669.1 protein_id gnl|my_center|LOCUS_25240 2319 1072 gene locus_tag LOCUS_25250 2319 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 2633 2319 gene locus_tag LOCUS_25260 2633 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 3274 2630 gene locus_tag LOCUS_25270 3274 2630 CDS product conjugative transposon protein TraK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776802.1 protein_id gnl|my_center|LOCUS_25270 4392 3277 gene locus_tag LOCUS_25280 4392 3277 CDS product conjugative transposon protein TraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291518.1 protein_id gnl|my_center|LOCUS_25280 <5053 4412 gene locus_tag LOCUS_25290 <5053 4412 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109421.1:transposase >Feature sequence0408 491 925 gene locus_tag LOCUS_25300 491 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 1732 1115 gene locus_tag LOCUS_25310 1732 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 1886 3025 gene locus_tag LOCUS_25320 1886 3025 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405081.1 protein_id gnl|my_center|LOCUS_25320 3178 4158 gene locus_tag LOCUS_25330 gene hemB 3178 4158 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLQ6 protein_id gnl|my_center|LOCUS_25330 4416 4204 gene locus_tag LOCUS_25340 4416 4204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 >Feature sequence0409 3701 2571 gene locus_tag LOCUS_25350 3701 2571 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784707.1 protein_id gnl|my_center|LOCUS_25350 >Feature sequence0410 <1 824 gene locus_tag LOCUS_25360 <1 824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109139.1:exopolygalacturonase 1051 1512 gene locus_tag LOCUS_25370 1051 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 1849 1580 gene locus_tag LOCUS_25380 1849 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 2290 2072 gene locus_tag LOCUS_25390 2290 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 3931 2408 gene locus_tag LOCUS_25400 3931 2408 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_25400 4320 4135 gene locus_tag LOCUS_25410 4320 4135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 >Feature sequence0411 724 1410 gene locus_tag LOCUS_25420 724 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918966.1 protein_id gnl|my_center|LOCUS_25420 1562 4003 gene locus_tag LOCUS_25430 1562 4003 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 protein_id gnl|my_center|LOCUS_25430 >Feature sequence0412 1987 653 gene locus_tag LOCUS_25440 gene exuT 1987 653 CDS product hexuronate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039188.1 protein_id gnl|my_center|LOCUS_25440 2388 2014 gene locus_tag LOCUS_25450 2388 2014 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108621.1 protein_id gnl|my_center|LOCUS_25450 3198 2446 gene locus_tag LOCUS_25460 3198 2446 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972695.1 protein_id gnl|my_center|LOCUS_25460 >Feature sequence0413 344 1090 gene locus_tag LOCUS_25470 344 1090 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 protein_id gnl|my_center|LOCUS_25470 2614 1097 gene locus_tag LOCUS_25480 2614 1097 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769160.1 protein_id gnl|my_center|LOCUS_25480 3357 2749 gene locus_tag LOCUS_25490 3357 2749 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971537.1 protein_id gnl|my_center|LOCUS_25490 3903 4088 gene locus_tag LOCUS_25500 3903 4088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 >Feature sequence0414 2089 3744 gene locus_tag LOCUS_25510 2089 3744 CDS product trehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083724.1 protein_id gnl|my_center|LOCUS_25510 3927 4616 gene locus_tag LOCUS_25520 3927 4616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 >Feature sequence0415 1454 450 gene locus_tag LOCUS_25530 1454 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25530 2098 2763 gene locus_tag LOCUS_25540 2098 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 2993 4549 gene locus_tag LOCUS_25550 2993 4549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 >Feature sequence0416 1361 96 gene locus_tag LOCUS_25560 1361 96 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837658.1 protein_id gnl|my_center|LOCUS_25560 1691 3460 gene locus_tag LOCUS_25570 gene lutP 1691 3460 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71067 protein_id gnl|my_center|LOCUS_25570 3585 4322 gene locus_tag LOCUS_25580 3585 4322 CDS product glycolate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760113.1 protein_id gnl|my_center|LOCUS_25580 >Feature sequence0417 <1 849 gene locus_tag LOCUS_25590 <1 849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256205.1:CSLREA domain-containing protein 984 1487 gene locus_tag LOCUS_25600 984 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 2601 1555 gene locus_tag LOCUS_25610 2601 1555 CDS product luciferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528461.1 protein_id gnl|my_center|LOCUS_25610 2750 3664 gene locus_tag LOCUS_25620 2750 3664 CDS product pirin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921014.1 protein_id gnl|my_center|LOCUS_25620 3805 4563 gene locus_tag LOCUS_25630 3805 4563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 >Feature sequence0418 2487 1438 gene locus_tag LOCUS_25640 2487 1438 CDS product adenylate/guanylate cyclase domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085648.1 protein_id gnl|my_center|LOCUS_25640 2870 2484 gene locus_tag LOCUS_25650 2870 2484 CDS product two-component response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_769503.2 protein_id gnl|my_center|LOCUS_25650 3451 2873 gene locus_tag LOCUS_25660 3451 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25660 4240 3479 gene locus_tag LOCUS_25670 4240 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25670 <4998 4345 gene locus_tag LOCUS_25680 <4998 4345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q92XH8:DNA polymerase IV 2 >Feature sequence0419 3515 1296 gene locus_tag LOCUS_25690 3515 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 3851 4768 gene locus_tag LOCUS_25700 gene hemF 3851 4768 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL15 protein_id gnl|my_center|LOCUS_25700 >Feature sequence0420 1965 1210 gene locus_tag LOCUS_25710 1965 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880895.1 protein_id gnl|my_center|LOCUS_25710 2877 2041 gene locus_tag LOCUS_25720 2877 2041 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_25720 >Feature sequence0421 1055 546 gene locus_tag LOCUS_25730 1055 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144040.1 protein_id gnl|my_center|LOCUS_25730 1160 1798 gene locus_tag LOCUS_25740 1160 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 1915 4854 gene locus_tag LOCUS_25750 1915 4854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 >Feature sequence0422 3030 1549 gene locus_tag LOCUS_25760 3030 1549 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202497.1 protein_id gnl|my_center|LOCUS_25760 <4964 3051 gene locus_tag LOCUS_25770 <4964 3051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202496.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence0423 1678 2472 gene locus_tag LOCUS_25780 1678 2472 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496681.1 protein_id gnl|my_center|LOCUS_25780 2712 4070 gene locus_tag LOCUS_25790 2712 4070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201988.1 protein_id gnl|my_center|LOCUS_25790 >Feature sequence0424 1000 2625 gene locus_tag LOCUS_25800 1000 2625 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257472.1 protein_id gnl|my_center|LOCUS_25800 >Feature sequence0425 <1 667 gene locus_tag LOCUS_25810 <1 667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941118.1:DNA-binding response regulator 678 2051 gene locus_tag LOCUS_25820 678 2051 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765564.1 protein_id gnl|my_center|LOCUS_25820 2195 2683 gene locus_tag LOCUS_25830 2195 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 2787 3254 gene locus_tag LOCUS_25840 2787 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 3258 4043 gene locus_tag LOCUS_25850 3258 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 >Feature sequence0426 394 1347 gene locus_tag LOCUS_25860 394 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142872.1 protein_id gnl|my_center|LOCUS_25860 >Feature sequence0427 552 130 gene locus_tag LOCUS_25870 552 130 CDS product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763578.1 protein_id gnl|my_center|LOCUS_25870 1842 601 gene locus_tag LOCUS_25880 1842 601 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKV3 protein_id gnl|my_center|LOCUS_25880 3155 1842 gene locus_tag LOCUS_25890 gene sufD 3155 1842 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404137.1 protein_id gnl|my_center|LOCUS_25890 3959 3198 gene locus_tag LOCUS_25900 3959 3198 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763669.1 protein_id gnl|my_center|LOCUS_25900 >Feature sequence0428 227 625 gene locus_tag LOCUS_25910 227 625 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977989.1 protein_id gnl|my_center|LOCUS_25910 1125 628 gene locus_tag LOCUS_25920 1125 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 1477 1109 gene locus_tag LOCUS_25930 1477 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 1869 1582 gene locus_tag LOCUS_25940 1869 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 2181 2564 gene locus_tag LOCUS_25950 2181 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 3722 2571 gene locus_tag LOCUS_25960 3722 2571 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411484.1 protein_id gnl|my_center|LOCUS_25960 4347 4772 gene locus_tag LOCUS_25970 4347 4772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 >Feature sequence0429 929 516 gene locus_tag LOCUS_25980 929 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 3157 926 gene locus_tag LOCUS_25990 3157 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 4673 3231 gene locus_tag LOCUS_26000 4673 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 >Feature sequence0430 <1 901 gene locus_tag LOCUS_26010 <1 901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107802.1:ABC transporter permease 984 1283 gene locus_tag LOCUS_26020 984 1283 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953389.1 protein_id gnl|my_center|LOCUS_26020 1430 2830 gene locus_tag LOCUS_26030 1430 2830 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0Q1 protein_id gnl|my_center|LOCUS_26030 2921 3292 gene locus_tag LOCUS_26040 2921 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 3545 4207 gene locus_tag LOCUS_26050 3545 4207 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761370.1 protein_id gnl|my_center|LOCUS_26050 >Feature sequence0431 1099 197 gene locus_tag LOCUS_26060 1099 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 1995 2948 gene locus_tag LOCUS_26070 1995 2948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 2948 4087 gene locus_tag LOCUS_26080 2948 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 >Feature sequence0432 1222 260 gene locus_tag LOCUS_26090 1222 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 1366 2046 gene locus_tag LOCUS_26100 gene ytkL 1366 2046 CDS product UPF0173 metal-dependent hydrolase YtkL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q795U4 protein_id gnl|my_center|LOCUS_26100 2834 2142 gene locus_tag LOCUS_26110 2834 2142 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085687.1 protein_id gnl|my_center|LOCUS_26110 3988 2867 gene locus_tag LOCUS_26120 3988 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 >Feature sequence0433 729 304 gene locus_tag LOCUS_26130 729 304 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546540.1 protein_id gnl|my_center|LOCUS_26130 953 1696 gene locus_tag LOCUS_26140 953 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811460.1 protein_id gnl|my_center|LOCUS_26140 1792 2817 gene locus_tag LOCUS_26150 1792 2817 CDS product DUF1016 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022383.1 protein_id gnl|my_center|LOCUS_26150 3014 4048 gene locus_tag LOCUS_26160 3014 4048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038032.1 protein_id gnl|my_center|LOCUS_26160 4229 4477 gene locus_tag LOCUS_26170 4229 4477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 >Feature sequence0434 2988 3434 gene locus_tag LOCUS_26180 gene ppi 2988 3434 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P985 protein_id gnl|my_center|LOCUS_26180 3572 4885 gene locus_tag LOCUS_26190 3572 4885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 >Feature sequence0435 >Feature sequence0436 235 1020 gene locus_tag LOCUS_26200 235 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 1024 2325 gene locus_tag LOCUS_26210 1024 2325 CDS product folylpolyglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788733.1 protein_id gnl|my_center|LOCUS_26210 2339 3010 gene locus_tag LOCUS_26220 2339 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 4061 3054 gene locus_tag LOCUS_26230 gene gapA 4061 3054 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181T9 protein_id gnl|my_center|LOCUS_26230 >Feature sequence0437 177 1565 gene locus_tag LOCUS_26240 177 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 >Feature sequence0438 153 19 gene locus_tag LOCUS_26250 153 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 395 156 gene locus_tag LOCUS_26260 395 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 608 1240 gene locus_tag LOCUS_26270 608 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107677.1 protein_id gnl|my_center|LOCUS_26270 1284 1607 gene locus_tag LOCUS_26280 1284 1607 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 protein_id gnl|my_center|LOCUS_26280 1666 2916 gene locus_tag LOCUS_26290 1666 2916 CDS product DUF4153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181621.1 protein_id gnl|my_center|LOCUS_26290 3381 2974 gene locus_tag LOCUS_26300 3381 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 <4861 3622 gene locus_tag LOCUS_26310 <4861 3622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704425.1:glucose dehydrogenase >Feature sequence0439 <1 1279 gene locus_tag LOCUS_26320 <1 1279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963297.1:cytochrome c oxidase accessory protein CcoG 1489 1986 gene locus_tag LOCUS_26330 gene ccoH 1489 1986 CDS product cytochrome Cbb3 oxidase maturation protein CcoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963298.1 protein_id gnl|my_center|LOCUS_26330 1999 2706 gene locus_tag LOCUS_26340 1999 2706 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_26340 2985 2782 gene locus_tag LOCUS_26350 2985 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 3458 2982 gene locus_tag LOCUS_26360 3458 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414677.1 protein_id gnl|my_center|LOCUS_26360 >Feature sequence0440 1597 761 gene locus_tag LOCUS_26370 gene yxxB 1597 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39139 protein_id gnl|my_center|LOCUS_26370 2161 1736 gene locus_tag LOCUS_26380 2161 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 3497 2250 gene locus_tag LOCUS_26390 gene ribBA 3497 2250 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YT3 protein_id gnl|my_center|LOCUS_26390 >Feature sequence0441 784 266 gene locus_tag LOCUS_26400 784 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 979 2343 gene locus_tag LOCUS_26410 979 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_26410 >Feature sequence0442 2054 2533 gene locus_tag LOCUS_26420 2054 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 3493 2729 gene locus_tag LOCUS_26430 gene tpiA 3493 2729 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0U2 protein_id gnl|my_center|LOCUS_26430 >Feature sequence0443 562 3954 gene locus_tag LOCUS_26440 562 3954 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785431.1 protein_id gnl|my_center|LOCUS_26440 >Feature sequence0444 687 2042 gene locus_tag LOCUS_26450 687 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 2375 2133 gene locus_tag LOCUS_26460 2375 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 3083 2505 gene locus_tag LOCUS_26470 gene purN 3083 2505 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E5 protein_id gnl|my_center|LOCUS_26470 3856 3233 gene locus_tag LOCUS_26480 3856 3233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 <4758 4031 gene locus_tag LOCUS_26490 <4758 4031 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963542.1:prenyltransferase >Feature sequence0445 2 355 gene locus_tag LOCUS_26500 2 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 492 1541 gene locus_tag LOCUS_26510 492 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087510.1 protein_id gnl|my_center|LOCUS_26510 1647 3158 gene locus_tag LOCUS_26520 1647 3158 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767323.1 protein_id gnl|my_center|LOCUS_26520 3286 4710 gene locus_tag LOCUS_26530 gene arsA 3286 4710 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_26530 >Feature sequence0446 <1 876 gene locus_tag LOCUS_26540 <1 876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389819.1:dihydrodipicolinate synthase family protein 964 1965 gene locus_tag LOCUS_26550 964 1965 CDS product hydroxyproline-2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529091.1 protein_id gnl|my_center|LOCUS_26550 2013 3260 gene locus_tag LOCUS_26560 gene dadA 2013 3260 CDS product D-amino-acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037710.1 protein_id gnl|my_center|LOCUS_26560 4061 3306 gene locus_tag LOCUS_26570 gene ste14 4061 3306 CDS product lipid A Kdo2 1-phosphate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173879.1 protein_id gnl|my_center|LOCUS_26570 <4751 4192 gene locus_tag LOCUS_26580 <4751 4192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403494.1:multidrug resistance protein >Feature sequence0447 1710 298 gene locus_tag LOCUS_26590 1710 298 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074151.1 protein_id gnl|my_center|LOCUS_26590 3098 1779 gene locus_tag LOCUS_26600 3098 1779 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074152.1 protein_id gnl|my_center|LOCUS_26600 >Feature sequence0448 <1 1071 gene locus_tag LOCUS_26610 <1 1071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036606.1:ABC transporter ATP-binding protein 1135 1368 gene locus_tag LOCUS_26620 1135 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 1365 1769 gene locus_tag LOCUS_26630 1365 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 >Feature sequence0449 2040 961 gene locus_tag LOCUS_26640 2040 961 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202126.1 protein_id gnl|my_center|LOCUS_26640 2677 2084 gene locus_tag LOCUS_26650 2677 2084 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766891.1 protein_id gnl|my_center|LOCUS_26650 2934 3137 gene locus_tag LOCUS_26660 2934 3137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 <4734 3428 gene locus_tag LOCUS_26670 <4734 3428 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919507.1:GMC family oxidoreductase >Feature sequence0450 259 702 gene locus_tag LOCUS_26680 259 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 736 1143 gene locus_tag LOCUS_26690 736 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 1198 2025 gene locus_tag LOCUS_26700 1198 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 2015 3721 gene locus_tag LOCUS_26710 gene mdlC 2015 3721 CDS product benzoylformate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090330.1 protein_id gnl|my_center|LOCUS_26710 >Feature sequence0451 331 2976 gene locus_tag LOCUS_26720 gene parC 331 2976 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962810.1 protein_id gnl|my_center|LOCUS_26720 3009 3698 gene locus_tag LOCUS_26730 3009 3698 CDS product protein SanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763153.1 protein_id gnl|my_center|LOCUS_26730 4686 3706 gene locus_tag LOCUS_26740 gene afuC 4686 3706 CDS product spermidine/putrescine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263897.1 protein_id gnl|my_center|LOCUS_26740 >Feature sequence0452 623 294 gene locus_tag LOCUS_26750 623 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 721 1458 gene locus_tag LOCUS_26760 gene etfB 721 1458 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_26760 1503 2468 gene locus_tag LOCUS_26770 gene etfA 1503 2468 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_26770 2598 3194 gene locus_tag LOCUS_26780 2598 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_26780 3321 4199 gene locus_tag LOCUS_26790 gene ftsX 3321 4199 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H241 protein_id gnl|my_center|LOCUS_26790 4225 4440 gene locus_tag LOCUS_26800 4225 4440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 >Feature sequence0453 59 724 gene locus_tag LOCUS_26810 59 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 699 1745 gene locus_tag LOCUS_26820 699 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 1909 2550 gene locus_tag LOCUS_26830 1909 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 2660 3832 gene locus_tag LOCUS_26840 2660 3832 CDS product glutathionylspermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858689.1 protein_id gnl|my_center|LOCUS_26840 3904 4278 gene locus_tag LOCUS_26850 3904 4278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963100.1 protein_id gnl|my_center|LOCUS_26850 >Feature sequence0454 1116 874 gene locus_tag LOCUS_26860 1116 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26860 2538 1144 gene locus_tag LOCUS_26870 2538 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26870 3374 2538 gene locus_tag LOCUS_26880 3374 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 <4701 3465 gene locus_tag LOCUS_26890 <4701 3465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011201972.1:membrane protein >Feature sequence0455 3913 4557 gene locus_tag LOCUS_26900 gene plsY 3913 4557 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG75 protein_id gnl|my_center|LOCUS_26900 >Feature sequence0456 >Feature sequence0457 <1 625 gene locus_tag LOCUS_26910 <1 625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108774.1:SusC/RagA family TonB-linked outer membrane protein 637 2127 gene locus_tag LOCUS_26920 637 2127 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_26920 2141 3466 gene locus_tag LOCUS_26930 gene GALNS 2141 3466 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121616.1 protein_id gnl|my_center|LOCUS_26930 >Feature sequence0458 2809 1583 gene locus_tag LOCUS_26940 gene argD 2809 1583 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_26940 4007 2814 gene locus_tag LOCUS_26950 4007 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 >Feature sequence0459 1782 82 gene locus_tag LOCUS_26960 1782 82 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108599.1 protein_id gnl|my_center|LOCUS_26960 3827 1902 gene locus_tag LOCUS_26970 3827 1902 CDS product acetoacetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259232.1 protein_id gnl|my_center|LOCUS_26970 >Feature sequence0460 466 1257 gene locus_tag LOCUS_26980 466 1257 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113172.1 protein_id gnl|my_center|LOCUS_26980 1306 2283 gene locus_tag LOCUS_26990 gene hpnA 1306 2283 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_26990 2312 2884 gene locus_tag LOCUS_27000 2312 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 3891 2953 gene locus_tag LOCUS_27010 3891 2953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 >Feature sequence0461 2920 512 gene locus_tag LOCUS_27020 2920 512 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_27020 3348 2989 gene locus_tag LOCUS_27030 3348 2989 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123903.1 protein_id gnl|my_center|LOCUS_27030 <4643 3548 gene locus_tag LOCUS_27040 <4643 3548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008659317.1:ABC transporter permease >Feature sequence0462 951 604 gene locus_tag LOCUS_27050 951 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142681.1 protein_id gnl|my_center|LOCUS_27050 1181 948 gene locus_tag LOCUS_27060 1181 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_27060 1439 1233 gene locus_tag LOCUS_27070 1439 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 2958 1729 gene locus_tag LOCUS_27080 2958 1729 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 protein_id gnl|my_center|LOCUS_27080 4358 3063 gene locus_tag LOCUS_27090 4358 3063 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203533.1 protein_id gnl|my_center|LOCUS_27090 >Feature sequence0463 1747 1058 gene locus_tag LOCUS_27100 1747 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 1969 2790 gene locus_tag LOCUS_27110 1969 2790 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964038.1 protein_id gnl|my_center|LOCUS_27110 >Feature sequence0464 1305 2153 gene locus_tag LOCUS_27120 1305 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 2194 2577 gene locus_tag LOCUS_27130 2194 2577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 2632 2853 gene locus_tag LOCUS_27140 2632 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 2841 3644 gene locus_tag LOCUS_27150 2841 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 3777 3962 gene locus_tag LOCUS_27160 3777 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 3959 4123 gene locus_tag LOCUS_27170 3959 4123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 4205 4390 gene locus_tag LOCUS_27180 4205 4390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 >Feature sequence0465 534 2630 gene locus_tag LOCUS_27190 534 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404722.1 protein_id gnl|my_center|LOCUS_27190 >Feature sequence0466 <1 563 gene locus_tag LOCUS_27200 <1 563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYI0:adenine deaminase 723 1304 gene locus_tag LOCUS_27210 723 1304 CDS product RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762480.1 protein_id gnl|my_center|LOCUS_27210 1457 2728 gene locus_tag LOCUS_27220 1457 2728 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963479.1 protein_id gnl|my_center|LOCUS_27220 2846 2774 gene locus_tag LOCUS_t00180 2846 2774 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3618 2947 gene locus_tag LOCUS_27230 3618 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 3702 4175 gene locus_tag LOCUS_27240 3702 4175 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107744.1 protein_id gnl|my_center|LOCUS_27240 >Feature sequence0467 756 238 gene locus_tag LOCUS_27250 756 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 2516 873 gene locus_tag LOCUS_27260 2516 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 <4624 2579 gene locus_tag LOCUS_27270 <4624 2579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108195.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence0468 <1 931 gene locus_tag LOCUS_27280 <1 931 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107708.1:histidine kinase 888 1619 gene locus_tag LOCUS_27290 888 1619 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_27290 2533 2003 gene locus_tag LOCUS_27300 2533 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 3145 4383 gene locus_tag LOCUS_27310 3145 4383 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884008.1 protein_id gnl|my_center|LOCUS_27310 >Feature sequence0469 691 422 gene locus_tag LOCUS_27320 691 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 1924 728 gene locus_tag LOCUS_27330 1924 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921106.1 protein_id gnl|my_center|LOCUS_27330 2848 2138 gene locus_tag LOCUS_27340 2848 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 4378 3020 gene locus_tag LOCUS_27350 4378 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 4293 4520 gene locus_tag LOCUS_27360 4293 4520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 >Feature sequence0470 <1 741 gene locus_tag LOCUS_27370 <1 741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141113.1:glucosidase 778 1665 gene locus_tag LOCUS_27380 778 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 2240 4447 gene locus_tag LOCUS_27390 2240 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 >Feature sequence0471 66 533 gene locus_tag LOCUS_27400 66 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 566 1576 gene locus_tag LOCUS_27410 566 1576 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031646.1 protein_id gnl|my_center|LOCUS_27410 1631 3121 gene locus_tag LOCUS_27420 1631 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 3630 3205 gene locus_tag LOCUS_27430 3630 3205 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_27430 >Feature sequence0472 <1 830 gene locus_tag LOCUS_27440 <1 830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202915.1:CRISPR-associated helicase/endonuclease Cas3 832 2154 gene locus_tag LOCUS_27450 832 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768970.1 protein_id gnl|my_center|LOCUS_27450 2181 3221 gene locus_tag LOCUS_27460 2181 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768969.1 protein_id gnl|my_center|LOCUS_27460 3221 3769 gene locus_tag LOCUS_27470 3221 3769 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016964.1 protein_id gnl|my_center|LOCUS_27470 >Feature sequence0473 <1 663 gene locus_tag LOCUS_27480 <1 663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877664.1:heavy metal translocating P-type ATPase 669 1226 gene locus_tag LOCUS_27490 669 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 protein_id gnl|my_center|LOCUS_27490 1229 1630 gene locus_tag LOCUS_27500 1229 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 1694 3214 gene locus_tag LOCUS_27510 1694 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 3363 3863 gene locus_tag LOCUS_27520 3363 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 >Feature sequence0474 <1 879 gene locus_tag LOCUS_27530 <1 879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393149.1:AI-2E family transporter 1480 851 gene locus_tag LOCUS_27540 1480 851 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403957.1 protein_id gnl|my_center|LOCUS_27540 1978 1493 gene locus_tag LOCUS_27550 1978 1493 CDS product gliding motility lipoprotein GldH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799202.1 protein_id gnl|my_center|LOCUS_27550 2534 2037 gene locus_tag LOCUS_27560 2534 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_27560 2716 3231 gene locus_tag LOCUS_27570 gene wecD 2716 3231 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704154.1 protein_id gnl|my_center|LOCUS_27570 4266 3475 gene locus_tag LOCUS_27580 4266 3475 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_27580 >Feature sequence0475 198 893 gene locus_tag LOCUS_27590 198 893 CDS product noncanonical pyrimidine nucleotidase, YjjG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108200.1 protein_id gnl|my_center|LOCUS_27590 1317 907 gene locus_tag LOCUS_27600 gene ctb 1317 907 CDS product group 3 truncated hemoglobin ctb inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PB48 protein_id gnl|my_center|LOCUS_27600 1496 2284 gene locus_tag LOCUS_27610 gene argB 1496 2284 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2B0 protein_id gnl|my_center|LOCUS_27610 3813 2296 gene locus_tag LOCUS_27620 3813 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 <4576 3828 gene locus_tag LOCUS_27630 <4576 3828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64Z15:argininosuccinate lyase >Feature sequence0476 1254 1628 gene locus_tag LOCUS_27640 1254 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 1625 2260 gene locus_tag LOCUS_27650 1625 2260 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225188.1 protein_id gnl|my_center|LOCUS_27650 >Feature sequence0477 352 11 gene locus_tag LOCUS_27660 gene gldC 352 11 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_27660 1147 386 gene locus_tag LOCUS_27670 1147 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964041.1 protein_id gnl|my_center|LOCUS_27670 1230 2507 gene locus_tag LOCUS_27680 1230 2507 CDS product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TK0 protein_id gnl|my_center|LOCUS_27680 2524 3855 gene locus_tag LOCUS_27690 gene bfmBB 2524 3855 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX72 protein_id gnl|my_center|LOCUS_27690 3852 4388 gene locus_tag LOCUS_27700 3852 4388 CDS product putative 5'(3')-deoxyribonucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CTG7 protein_id gnl|my_center|LOCUS_27700 >Feature sequence0478 <1 1238 gene locus_tag LOCUS_27710 <1 1238 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389949.1:alpha-amylase 1244 3100 gene locus_tag LOCUS_27720 1244 3100 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHI0 protein_id gnl|my_center|LOCUS_27720 <4544 3197 gene locus_tag LOCUS_27730 <4544 3197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S4T3:4-alpha-glucanotransferase >Feature sequence0479 2014 455 gene locus_tag LOCUS_27740 gene cafA 2014 455 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963779.1 protein_id gnl|my_center|LOCUS_27740 3176 2334 gene locus_tag LOCUS_27750 3176 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 3514 3209 gene locus_tag LOCUS_27760 gene hupA 3514 3209 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963778.1 protein_id gnl|my_center|LOCUS_27760 >Feature sequence0480 1597 2511 gene locus_tag LOCUS_27770 1597 2511 CDS product DUF2279 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963344.1 protein_id gnl|my_center|LOCUS_27770 2572 3555 gene locus_tag LOCUS_27780 2572 3555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 >Feature sequence0481 41 469 gene locus_tag LOCUS_27790 41 469 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021290.1 protein_id gnl|my_center|LOCUS_27790 478 1488 gene locus_tag LOCUS_27800 478 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 1656 2168 gene locus_tag LOCUS_27810 1656 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 2744 2244 gene locus_tag LOCUS_27820 2744 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 3123 2758 gene locus_tag LOCUS_27830 gene dgkA 3123 2758 CDS product UDP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356746.1 protein_id gnl|my_center|LOCUS_27830 4062 3157 gene locus_tag LOCUS_27840 4062 3157 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036050.1 protein_id gnl|my_center|LOCUS_27840 >Feature sequence0482 369 1157 gene locus_tag LOCUS_27850 369 1157 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867386.1 protein_id gnl|my_center|LOCUS_27850 2310 1315 gene locus_tag LOCUS_27860 2310 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 >Feature sequence0483 1025 423 gene locus_tag LOCUS_27870 1025 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 2223 1042 gene locus_tag LOCUS_27880 2223 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 3423 2236 gene locus_tag LOCUS_27890 gene hisC 3423 2236 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RL44 protein_id gnl|my_center|LOCUS_27890 4132 3659 gene locus_tag LOCUS_27900 4132 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 >Feature sequence0484 <1 1945 gene locus_tag LOCUS_27910 <1 1945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963971.1:RelA/SpoT family protein 2047 2553 gene locus_tag LOCUS_27920 2047 2553 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405408.1 protein_id gnl|my_center|LOCUS_27920 2625 3920 gene locus_tag LOCUS_27930 gene purA 2625 3920 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U4 protein_id gnl|my_center|LOCUS_27930 >Feature sequence0485 <1 891 gene locus_tag LOCUS_27940 <1 891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108840.1:penicillin-binding protein 904 2400 gene locus_tag LOCUS_27950 gene murE 904 2400 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZL7 protein_id gnl|my_center|LOCUS_27950 2533 3747 gene locus_tag LOCUS_27960 gene mraY 2533 3747 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H198 protein_id gnl|my_center|LOCUS_27960 >Feature sequence0486 1046 2257 gene locus_tag LOCUS_27970 1046 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108150.1 protein_id gnl|my_center|LOCUS_27970 3746 2343 gene locus_tag LOCUS_27980 3746 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405406.1 protein_id gnl|my_center|LOCUS_27980 <4473 3840 gene locus_tag LOCUS_27990 <4473 3840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962339.1:NAD-dependent epimerase >Feature sequence0487 >Feature sequence0488 239 3262 gene locus_tag LOCUS_28000 239 3262 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_28000 >Feature sequence0489 2950 2865 gene locus_tag LOCUS_t00190 2950 2865 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0490 1564 317 gene locus_tag LOCUS_28010 gene nhaP 1564 317 CDS product Na(+)/H(+) antiporter NhaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD29 protein_id gnl|my_center|LOCUS_28010 1684 3063 gene locus_tag LOCUS_28020 1684 3063 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783735.1 protein_id gnl|my_center|LOCUS_28020 <4431 3157 gene locus_tag LOCUS_28030 <4431 3157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114561.1:acyl-CoA dehydrogenase >Feature sequence0491 1631 990 gene locus_tag LOCUS_28040 1631 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 1952 2233 gene locus_tag LOCUS_28050 1952 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 2769 2314 gene locus_tag LOCUS_28060 2769 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027268.1 protein_id gnl|my_center|LOCUS_28060 2950 3837 gene locus_tag LOCUS_28070 2950 3837 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962779.1 protein_id gnl|my_center|LOCUS_28070 >Feature sequence0492 <1 594 gene locus_tag LOCUS_28080 <1 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107965.1:2,6-beta-D-fructofuranosidase 728 2065 gene locus_tag LOCUS_28090 gene xylE 728 2065 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122710.1 protein_id gnl|my_center|LOCUS_28090 2078 2977 gene locus_tag LOCUS_28100 2078 2977 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067996.1 protein_id gnl|my_center|LOCUS_28100 3576 2998 gene locus_tag LOCUS_28110 3576 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_28110 >Feature sequence0493 6 1136 gene locus_tag LOCUS_28120 gene anmK 6 1136 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81DH0 protein_id gnl|my_center|LOCUS_28120 1179 2378 gene locus_tag LOCUS_28130 1179 2378 CDS product hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 protein_id gnl|my_center|LOCUS_28130 2869 3087 gene locus_tag LOCUS_28140 2869 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 >Feature sequence0494 415 1638 gene locus_tag LOCUS_28150 gene sucC 415 1638 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY30 protein_id gnl|my_center|LOCUS_28150 1772 2956 gene locus_tag LOCUS_28160 1772 2956 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545078.1 protein_id gnl|my_center|LOCUS_28160 2960 3496 gene locus_tag LOCUS_28170 2960 3496 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110142.1 protein_id gnl|my_center|LOCUS_28170 >Feature sequence0495 1425 2102 gene locus_tag LOCUS_28180 1425 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 >Feature sequence0496 292 1044 gene locus_tag LOCUS_28190 292 1044 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_28190 1977 1318 gene locus_tag LOCUS_28200 1977 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 2144 3055 gene locus_tag LOCUS_28210 2144 3055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 >Feature sequence0497 773 2413 gene locus_tag LOCUS_28220 773 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 2543 3958 gene locus_tag LOCUS_28230 2543 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903543.1 protein_id gnl|my_center|LOCUS_28230 >Feature sequence0498 3881 909 gene locus_tag LOCUS_28240 3881 909 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797413.1 protein_id gnl|my_center|LOCUS_28240 >Feature sequence0499 851 1468 gene locus_tag LOCUS_28250 851 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 1538 2155 gene locus_tag LOCUS_28260 1538 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 2273 3520 gene locus_tag LOCUS_28270 gene aroA 2273 3520 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5Q2 protein_id gnl|my_center|LOCUS_28270 3520 4194 gene locus_tag LOCUS_28280 3520 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 >Feature sequence0500 69 524 gene locus_tag LOCUS_28290 69 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 1072 548 gene locus_tag LOCUS_28300 gene tdk 1072 548 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5G4 protein_id gnl|my_center|LOCUS_28300 1246 2355 gene locus_tag LOCUS_28310 1246 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 2371 3213 gene locus_tag LOCUS_28320 2371 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 4302 3217 gene locus_tag LOCUS_28330 4302 3217 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201961.1 protein_id gnl|my_center|LOCUS_28330 >Feature sequence0501 2452 650 gene locus_tag LOCUS_28340 2452 650 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117792.1 protein_id gnl|my_center|LOCUS_28340 3506 2676 gene locus_tag LOCUS_28350 3506 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 4389 3601 gene locus_tag LOCUS_28360 gene fbp 4389 3601 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SW0 protein_id gnl|my_center|LOCUS_28360 >Feature sequence0502 255 3095 gene locus_tag LOCUS_28370 255 3095 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796991.1 protein_id gnl|my_center|LOCUS_28370 3303 3899 gene locus_tag LOCUS_28380 3303 3899 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107550.1 protein_id gnl|my_center|LOCUS_28380 4036 4281 gene locus_tag LOCUS_28390 4036 4281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 >Feature sequence0503 1139 1324 gene locus_tag LOCUS_28400 1139 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 1703 1374 gene locus_tag LOCUS_28410 1703 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 1900 2664 gene locus_tag LOCUS_28420 1900 2664 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962587.1 protein_id gnl|my_center|LOCUS_28420 3643 2642 gene locus_tag LOCUS_28430 3643 2642 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202022.1 protein_id gnl|my_center|LOCUS_28430 <4372 3677 gene locus_tag LOCUS_28440 <4372 3677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KAQ7:glutamate-1-semialdehyde 2,1-aminomutase >Feature sequence0504 1200 1045 gene locus_tag LOCUS_28450 1200 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 1353 1859 gene locus_tag LOCUS_28460 1353 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 1887 4310 gene locus_tag LOCUS_28470 1887 4310 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_28470 >Feature sequence0505 1645 3180 gene locus_tag LOCUS_28480 1645 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 3833 3255 gene locus_tag LOCUS_28490 3833 3255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 >Feature sequence0506 <1 1175 gene locus_tag LOCUS_28500 <1 1175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867265.1:aminoacylase 1909 1226 gene locus_tag LOCUS_28510 1909 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 2874 2041 gene locus_tag LOCUS_28520 2874 2041 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861584.1 protein_id gnl|my_center|LOCUS_28520 3556 3203 gene locus_tag LOCUS_28530 3556 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 3607 3726 gene locus_tag LOCUS_28540 3607 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 >Feature sequence0507 <1 1259 gene locus_tag LOCUS_28550 <1 1259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963409.1:polysaccharide biosynthesis protein CapD 1382 2590 gene locus_tag LOCUS_28560 1382 2590 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917966.1 protein_id gnl|my_center|LOCUS_28560 >Feature sequence0508 <1 1153 gene locus_tag LOCUS_28570 <1 1153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXC8:DNA topoisomerase (ATP-hydrolyzing) 1189 2262 gene locus_tag LOCUS_28580 gene pheA 1189 2262 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858741.1 protein_id gnl|my_center|LOCUS_28580 3213 2281 gene locus_tag LOCUS_28590 gene ribF 3213 2281 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW76 protein_id gnl|my_center|LOCUS_28590 3920 3210 gene locus_tag LOCUS_28600 gene truB 3920 3210 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H238 protein_id gnl|my_center|LOCUS_28600 4342 3923 gene locus_tag LOCUS_28610 4342 3923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 >Feature sequence0509 <1 893 gene locus_tag LOCUS_28620 <1 893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964501.1:T9SS C-terminal target domain-containing protein 1076 2653 gene locus_tag LOCUS_28630 1076 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 2730 2969 gene locus_tag LOCUS_28640 2730 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 3157 4098 gene locus_tag LOCUS_28650 3157 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 >Feature sequence0510 <1 1370 gene locus_tag LOCUS_28660 <1 1370 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962998.1:peptidase M14 >Feature sequence0511 1594 584 gene locus_tag LOCUS_28670 1594 584 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785419.1 protein_id gnl|my_center|LOCUS_28670 2243 1650 gene locus_tag LOCUS_28680 2243 1650 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766886.1 protein_id gnl|my_center|LOCUS_28680 <4340 2489 gene locus_tag LOCUS_28690 <4340 2489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207312.1:cell wall-associated protease precursor >Feature sequence0512 1595 450 gene locus_tag LOCUS_28700 1595 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 2572 1658 gene locus_tag LOCUS_28710 2572 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 protein_id gnl|my_center|LOCUS_28710 3069 2641 gene locus_tag LOCUS_28720 3069 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 3326 3664 gene locus_tag LOCUS_28730 3326 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 >Feature sequence0513 653 2152 gene locus_tag LOCUS_28740 653 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 3326 2169 gene locus_tag LOCUS_28750 gene gcdH 3326 2169 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_28750 3462 3803 gene locus_tag LOCUS_28760 3462 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281604.1 protein_id gnl|my_center|LOCUS_28760 >Feature sequence0514 685 1899 gene locus_tag LOCUS_28770 685 1899 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962646.1 protein_id gnl|my_center|LOCUS_28770 1954 3939 gene locus_tag LOCUS_28780 1954 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 >Feature sequence0515 <1 817 gene locus_tag LOCUS_28790 <1 817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122518.1:sulfatase 845 1879 gene locus_tag LOCUS_28800 gene pam 845 1879 CDS product peptidylglycine monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122516.1 protein_id gnl|my_center|LOCUS_28800 1977 3542 gene locus_tag LOCUS_28810 1977 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767560.1 protein_id gnl|my_center|LOCUS_28810 4194 3553 gene locus_tag LOCUS_28820 4194 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 >Feature sequence0516 2715 850 gene locus_tag LOCUS_28830 2715 850 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788911.1 protein_id gnl|my_center|LOCUS_28830 2881 2735 gene locus_tag LOCUS_28840 2881 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 4285 2990 gene locus_tag LOCUS_28850 4285 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28850 >Feature sequence0517 <1 837 gene locus_tag LOCUS_28860 <1 837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532875.1:multidrug efflux RND transporter permease subunit 1827 946 gene locus_tag LOCUS_28870 1827 946 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768221.1 protein_id gnl|my_center|LOCUS_28870 2259 1840 gene locus_tag LOCUS_28880 2259 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529396.1 protein_id gnl|my_center|LOCUS_28880 2888 2331 gene locus_tag LOCUS_28890 2888 2331 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQB9 protein_id gnl|my_center|LOCUS_28890 3071 3454 gene locus_tag LOCUS_28900 gene yjgA 3071 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093444.1 protein_id gnl|my_center|LOCUS_28900 >Feature sequence0518 <4278 1374 gene locus_tag LOCUS_28910 <4278 1374 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108629.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence0519 <1 640 gene locus_tag LOCUS_28920 <1 640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NDJ2:endonuclease V 1037 837 gene locus_tag LOCUS_28930 1037 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 1328 2605 gene locus_tag LOCUS_28940 1328 2605 CDS product sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887900.1 protein_id gnl|my_center|LOCUS_28940 >Feature sequence0520 1823 2800 gene locus_tag LOCUS_28950 1823 2800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 >Feature sequence0521 <1 820 gene locus_tag LOCUS_28960 <1 820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791110.1:SusC/RagA family TonB-linked outer membrane protein 826 2520 gene locus_tag LOCUS_28970 826 2520 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801521.1 protein_id gnl|my_center|LOCUS_28970 >Feature sequence0522 534 1352 gene locus_tag LOCUS_28980 gene panB 534 1352 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY12 protein_id gnl|my_center|LOCUS_28980 1396 2148 gene locus_tag LOCUS_28990 1396 2148 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_28990 2154 2459 gene locus_tag LOCUS_29000 2154 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 2693 2565 gene locus_tag LOCUS_29010 2693 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 >Feature sequence0523 <1 2025 gene locus_tag LOCUS_29020 <1 2025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A9K9:isoleucine--tRNA ligase 2815 2105 gene locus_tag LOCUS_29030 2815 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 3019 3990 gene locus_tag LOCUS_29040 3019 3990 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123535.1 protein_id gnl|my_center|LOCUS_29040 >Feature sequence0524 337 912 gene locus_tag LOCUS_29050 337 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 1301 963 gene locus_tag LOCUS_29060 1301 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250020.1 protein_id gnl|my_center|LOCUS_29060 1524 1291 gene locus_tag LOCUS_29070 1524 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 1796 2920 gene locus_tag LOCUS_29080 1796 2920 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266711.1 protein_id gnl|my_center|LOCUS_29080 3020 3592 gene locus_tag LOCUS_29090 3020 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 >Feature sequence0525 1757 837 gene locus_tag LOCUS_29100 1757 837 CDS product DUF4886 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119653.1 protein_id gnl|my_center|LOCUS_29100 1955 2569 gene locus_tag LOCUS_29110 1955 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 >Feature sequence0526 1515 112 gene locus_tag LOCUS_29120 gene fumC 1515 112 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H000 protein_id gnl|my_center|LOCUS_29120 1679 2785 gene locus_tag LOCUS_29130 1679 2785 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703897.1 protein_id gnl|my_center|LOCUS_29130 3710 2805 gene locus_tag LOCUS_29140 3710 2805 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888863.1 protein_id gnl|my_center|LOCUS_29140 >Feature sequence0527 2219 1473 gene locus_tag LOCUS_29150 2219 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 3369 2350 gene locus_tag LOCUS_29160 3369 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123797.1 protein_id gnl|my_center|LOCUS_29160 <4255 3526 gene locus_tag LOCUS_29170 <4255 3526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970212.1:proline iminopeptidase >Feature sequence0528 967 134 gene locus_tag LOCUS_29180 967 134 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962641.1 protein_id gnl|my_center|LOCUS_29180 2011 1013 gene locus_tag LOCUS_29190 2011 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 2768 2343 gene locus_tag LOCUS_29200 2768 2343 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005618719.1 protein_id gnl|my_center|LOCUS_29200 2854 3498 gene locus_tag LOCUS_29210 gene gpm 2854 3498 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404101.1 protein_id gnl|my_center|LOCUS_29210 >Feature sequence0529 3566 327 gene locus_tag LOCUS_29220 3566 327 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_29220 >Feature sequence0530 2114 2341 gene locus_tag LOCUS_29230 2114 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 2344 2679 gene locus_tag LOCUS_29240 2344 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 3221 2664 gene locus_tag LOCUS_29250 3221 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 3844 3353 gene locus_tag LOCUS_29260 3844 3353 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080530.1 protein_id gnl|my_center|LOCUS_29260 >Feature sequence0531 1145 3976 gene locus_tag LOCUS_29270 1145 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 >Feature sequence0532 2 1360 gene locus_tag LOCUS_29280 gene natB 2 1360 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_29280 1496 4048 gene locus_tag LOCUS_29290 1496 4048 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962806.1 protein_id gnl|my_center|LOCUS_29290 >Feature sequence0533 1770 697 gene locus_tag LOCUS_29300 1770 697 CDS product O-succinylbenzoic acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786035.1 protein_id gnl|my_center|LOCUS_29300 1898 2350 gene locus_tag LOCUS_29310 1898 2350 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964139.1 protein_id gnl|my_center|LOCUS_29310 2396 2803 gene locus_tag LOCUS_29320 2396 2803 CDS product ubiquinol-cytochrome c reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538032.1 protein_id gnl|my_center|LOCUS_29320 >Feature sequence0534 3 536 gene locus_tag LOCUS_29330 3 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 548 2002 gene locus_tag LOCUS_29340 548 2002 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038799.1 protein_id gnl|my_center|LOCUS_29340 2131 3447 gene locus_tag LOCUS_29350 2131 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 >Feature sequence0535 1282 464 gene locus_tag LOCUS_29360 1282 464 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767365.1 protein_id gnl|my_center|LOCUS_29360 2587 1619 gene locus_tag LOCUS_29370 2587 1619 CDS product large multifunctional protein- glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120043.1 protein_id gnl|my_center|LOCUS_29370 3908 2661 gene locus_tag LOCUS_29380 3908 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 >Feature sequence0536 207 884 gene locus_tag LOCUS_29390 207 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121534.1 protein_id gnl|my_center|LOCUS_29390 1100 3385 gene locus_tag LOCUS_29400 1100 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 >Feature sequence0537 495 1517 gene locus_tag LOCUS_29410 495 1517 CDS product sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119313.1 protein_id gnl|my_center|LOCUS_29410 1678 2313 gene locus_tag LOCUS_29420 1678 2313 CDS product antioxidant protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114495.1 protein_id gnl|my_center|LOCUS_29420 2480 3184 gene locus_tag LOCUS_29430 2480 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640172.1 protein_id gnl|my_center|LOCUS_29430 3226 4005 gene locus_tag LOCUS_29440 gene rluF 3226 4005 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E4I3 protein_id gnl|my_center|LOCUS_29440 >Feature sequence0538 230 2020 gene locus_tag LOCUS_29450 230 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 2026 2874 gene locus_tag LOCUS_29460 2026 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 2938 3789 gene locus_tag LOCUS_29470 2938 3789 CDS product protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_29470 >Feature sequence0539 1553 792 gene locus_tag LOCUS_29480 gene trn2 1553 792 CDS product tropinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038842.1 protein_id gnl|my_center|LOCUS_29480 >Feature sequence0540 3214 1103 gene locus_tag LOCUS_29490 3214 1103 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546064.1 protein_id gnl|my_center|LOCUS_29490 >Feature sequence0541 2707 1055 gene locus_tag LOCUS_29500 2707 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 <4114 2737 gene locus_tag LOCUS_29510 <4114 2737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109107.1:starch-binding protein >Feature sequence0542 <1 939 gene locus_tag LOCUS_29520 <1 939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640182.1:glucose-fructose oxidoreductase 1669 941 gene locus_tag LOCUS_29530 gene gldF 1669 941 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_29530 2281 1766 gene locus_tag LOCUS_29540 2281 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 2917 2357 gene locus_tag LOCUS_29550 2917 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 <4105 2961 gene locus_tag LOCUS_29560 <4105 2961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S0H8:dihydroorotase >Feature sequence0543 472 666 gene locus_tag LOCUS_29570 472 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 1437 718 gene locus_tag LOCUS_29580 1437 718 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_29580 2984 1437 gene locus_tag LOCUS_29590 2984 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 <4102 3198 gene locus_tag LOCUS_29600 <4102 3198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004196218.1:penicillin amidase >Feature sequence0544 3637 722 gene locus_tag LOCUS_29610 3637 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 >Feature sequence0545 3163 2333 gene locus_tag LOCUS_29620 3163 2333 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404736.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29620 <4086 3473 gene locus_tag LOCUS_29630 <4086 3473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119788.1:ergothioneine biosynthesis protein EgtB >Feature sequence0546 3 374 gene locus_tag LOCUS_29640 3 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 792 382 gene locus_tag LOCUS_29650 792 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 1285 869 gene locus_tag LOCUS_29660 1285 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143216.1 protein_id gnl|my_center|LOCUS_29660 1579 1701 gene locus_tag LOCUS_29670 1579 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 1796 2635 gene locus_tag LOCUS_29680 1796 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 2699 2878 gene locus_tag LOCUS_29690 2699 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 3736 2936 gene locus_tag LOCUS_29700 3736 2936 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259182.1 protein_id gnl|my_center|LOCUS_29700 >Feature sequence0547 676 266 gene locus_tag LOCUS_29710 676 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 1819 695 gene locus_tag LOCUS_29720 1819 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 3262 1880 gene locus_tag LOCUS_29730 3262 1880 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082946.1 protein_id gnl|my_center|LOCUS_29730 4076 3273 gene locus_tag LOCUS_29740 4076 3273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 >Feature sequence0548 <1 549 gene locus_tag LOCUS_29750 <1 549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H125:60 kDa chaperonin 1029 1343 gene locus_tag LOCUS_29760 1029 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 >Feature sequence0549 2678 564 gene locus_tag LOCUS_29770 2678 564 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2B0 protein_id gnl|my_center|LOCUS_29770 3310 2819 gene locus_tag LOCUS_29780 3310 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 3515 3814 gene locus_tag LOCUS_29790 3515 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 >Feature sequence0550 1471 2754 gene locus_tag LOCUS_29800 1471 2754 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122793.1 protein_id gnl|my_center|LOCUS_29800 2760 3665 gene locus_tag LOCUS_29810 2760 3665 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121783.1 protein_id gnl|my_center|LOCUS_29810 >Feature sequence0551 <1 1118 gene locus_tag LOCUS_29820 <1 1118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405543.1:SusC/RagA family TonB-linked outer membrane protein 1245 2786 gene locus_tag LOCUS_29830 1245 2786 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203677.1 protein_id gnl|my_center|LOCUS_29830 >Feature sequence0552 413 1861 gene locus_tag LOCUS_29840 gene miaB 413 1861 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H119 protein_id gnl|my_center|LOCUS_29840 1897 3234 gene locus_tag LOCUS_29850 1897 3234 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785466.1 protein_id gnl|my_center|LOCUS_29850 3448 3819 gene locus_tag LOCUS_29860 3448 3819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 >Feature sequence0553 35 1360 gene locus_tag LOCUS_29870 gene murD 35 1360 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H197 protein_id gnl|my_center|LOCUS_29870 1373 2530 gene locus_tag LOCUS_29880 gene ftsW 1373 2530 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964157.1 protein_id gnl|my_center|LOCUS_29880 2618 3715 gene locus_tag LOCUS_29890 gene murG 2618 3715 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZM1 protein_id gnl|my_center|LOCUS_29890 >Feature sequence0554 1659 556 gene locus_tag LOCUS_29900 1659 556 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257672.1 protein_id gnl|my_center|LOCUS_29900 2705 1662 gene locus_tag LOCUS_29910 2705 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 3964 2702 gene locus_tag LOCUS_29920 3964 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 >Feature sequence0555 562 1194 gene locus_tag LOCUS_29930 562 1194 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189288.1 protein_id gnl|my_center|LOCUS_29930 1264 2223 gene locus_tag LOCUS_29940 1264 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 2329 2748 gene locus_tag LOCUS_29950 2329 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 2898 3938 gene locus_tag LOCUS_29960 2898 3938 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254572.1 protein_id gnl|my_center|LOCUS_29960 >Feature sequence0556 1321 2061 gene locus_tag LOCUS_29970 1321 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 2215 2559 gene locus_tag LOCUS_29980 2215 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 2913 2608 gene locus_tag LOCUS_29990 2913 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 <3996 3391 gene locus_tag LOCUS_30000 <3996 3391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389628.1:PAS domain-containing sensor histidine kinase >Feature sequence0557 886 188 gene locus_tag LOCUS_30010 886 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 1042 1335 gene locus_tag LOCUS_30020 1042 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967828.1 protein_id gnl|my_center|LOCUS_30020 1513 1794 gene locus_tag LOCUS_30030 1513 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 1927 2283 gene locus_tag LOCUS_30040 1927 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 3963 2368 gene locus_tag LOCUS_30050 gene prfC 3963 2368 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE72 protein_id gnl|my_center|LOCUS_30050 >Feature sequence0558 1801 113 gene locus_tag LOCUS_30060 1801 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 2786 1866 gene locus_tag LOCUS_30070 2786 1866 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004349090.1 protein_id gnl|my_center|LOCUS_30070 3035 3604 gene locus_tag LOCUS_30080 3035 3604 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_30080 >Feature sequence0559 1451 384 gene locus_tag LOCUS_30090 gene serC 1451 384 CDS product putative phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33062 protein_id gnl|my_center|LOCUS_30090 2309 1452 gene locus_tag LOCUS_30100 2309 1452 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786401.1 protein_id gnl|my_center|LOCUS_30100 3969 2338 gene locus_tag LOCUS_30110 3969 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140284.1 protein_id gnl|my_center|LOCUS_30110 >Feature sequence0560 500 925 gene locus_tag LOCUS_30120 500 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 946 1866 gene locus_tag LOCUS_30130 gene rnz 946 1866 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XI2 protein_id gnl|my_center|LOCUS_30130 >Feature sequence0561 735 1706 gene locus_tag LOCUS_30140 735 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 1850 2761 gene locus_tag LOCUS_30150 1850 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 2778 3362 gene locus_tag LOCUS_30160 2778 3362 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_30160 >Feature sequence0562 <1 1692 gene locus_tag LOCUS_30170 <1 1692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013368424.1:type I restriction endonuclease subunit R <3960 1860 gene locus_tag LOCUS_30180 <3960 1860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257823.1:cellulose synthase >Feature sequence0563 2626 914 gene locus_tag LOCUS_30190 2626 914 CDS product glycan metabolism protein RagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767780.1 protein_id gnl|my_center|LOCUS_30190 <3959 2641 gene locus_tag LOCUS_30200 <3959 2641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107964.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence0564 <1 1844 gene locus_tag LOCUS_30210 <1 1844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228113.1:ferredoxin--nitrite reductase 1878 2639 gene locus_tag LOCUS_30220 1878 2639 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496681.1 protein_id gnl|my_center|LOCUS_30220 3069 2725 gene locus_tag LOCUS_30230 3069 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 >Feature sequence0565 1314 400 gene locus_tag LOCUS_30240 1314 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 2095 3171 gene locus_tag LOCUS_30250 2095 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 >Feature sequence0566 595 59 gene locus_tag LOCUS_30260 595 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 859 1602 gene locus_tag LOCUS_30270 859 1602 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_30270 2474 1599 gene locus_tag LOCUS_30280 2474 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786111.1 protein_id gnl|my_center|LOCUS_30280 2835 2521 gene locus_tag LOCUS_30290 2835 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389227.1 protein_id gnl|my_center|LOCUS_30290 3359 2832 gene locus_tag LOCUS_30300 3359 2832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30300 3950 3543 gene locus_tag LOCUS_30310 3950 3543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30310 >Feature sequence0567 2667 37 gene locus_tag LOCUS_30320 2667 37 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119295.1 protein_id gnl|my_center|LOCUS_30320 2879 2733 gene locus_tag LOCUS_30330 2879 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 2893 3129 gene locus_tag LOCUS_30340 2893 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 3949 3662 gene locus_tag LOCUS_30350 3949 3662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 >Feature sequence0568 1968 970 gene locus_tag LOCUS_30360 1968 970 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816609.1 protein_id gnl|my_center|LOCUS_30360 2547 1990 gene locus_tag LOCUS_30370 2547 1990 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791946.1 protein_id gnl|my_center|LOCUS_30370 3140 3361 gene locus_tag LOCUS_30380 3140 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 >Feature sequence0569 2319 535 gene locus_tag LOCUS_30390 2319 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 >Feature sequence0570 1230 1892 gene locus_tag LOCUS_30400 1230 1892 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109055.1 protein_id gnl|my_center|LOCUS_30400 1943 2938 gene locus_tag LOCUS_30410 1943 2938 CDS product sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112389.1 protein_id gnl|my_center|LOCUS_30410 >Feature sequence0571 3190 905 gene locus_tag LOCUS_30420 3190 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 <3911 3326 gene locus_tag LOCUS_30430 <3911 3326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O67899:phosphoenolpyruvate synthase >Feature sequence0572 <1 945 gene locus_tag LOCUS_30440 <1 945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64NI3:glutamate--tRNA ligase 1118 1366 gene locus_tag LOCUS_30450 1118 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 1560 2339 gene locus_tag LOCUS_30460 1560 2339 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072060.1 protein_id gnl|my_center|LOCUS_30460 2610 3374 gene locus_tag LOCUS_30470 2610 3374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 >Feature sequence0573 724 1350 gene locus_tag LOCUS_30480 724 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 1618 3363 gene locus_tag LOCUS_30490 1618 3363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201932.1 protein_id gnl|my_center|LOCUS_30490 >Feature sequence0574 <1 1864 gene locus_tag LOCUS_30500 <1 1864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203206.1:peptide-binding protein 3661 2780 gene locus_tag LOCUS_30510 3661 2780 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295301.1 protein_id gnl|my_center|LOCUS_30510 >Feature sequence0575 <1 1575 gene locus_tag LOCUS_30520 <1 1575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403147.1:beta-N-acetylhexosaminidase 1572 2417 gene locus_tag LOCUS_30530 1572 2417 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794957.1 protein_id gnl|my_center|LOCUS_30530 2479 3768 gene locus_tag LOCUS_30540 2479 3768 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109360.1 protein_id gnl|my_center|LOCUS_30540 >Feature sequence0576 2 457 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggtccatccccacctgtgtagggaaaac 788 504 gene locus_tag LOCUS_30550 788 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 1420 785 gene locus_tag LOCUS_30560 1420 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 1847 2845 gene locus_tag LOCUS_30570 1847 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 >Feature sequence0577 1018 392 gene locus_tag LOCUS_30580 1018 392 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791598.1 protein_id gnl|my_center|LOCUS_30580 1560 3041 gene locus_tag LOCUS_30590 gene speA 1560 3041 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A2 protein_id gnl|my_center|LOCUS_30590 >Feature sequence0578 1170 1850 gene locus_tag LOCUS_30600 1170 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 >Feature sequence0579 2767 2171 gene locus_tag LOCUS_30610 2767 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 3271 2924 gene locus_tag LOCUS_30620 3271 2924 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N13 protein_id gnl|my_center|LOCUS_30620 >Feature sequence0580 908 1879 gene locus_tag LOCUS_30630 gene bioB 908 1879 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW77 protein_id gnl|my_center|LOCUS_30630 2442 1978 gene locus_tag LOCUS_30640 2442 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338413.1 protein_id gnl|my_center|LOCUS_30640 3649 2570 gene locus_tag LOCUS_30650 3649 2570 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804964.1 protein_id gnl|my_center|LOCUS_30650 >Feature sequence0581 897 124 gene locus_tag LOCUS_30660 897 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 1113 1565 gene locus_tag LOCUS_30670 gene rplM 1113 1565 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P27 protein_id gnl|my_center|LOCUS_30670 1586 1972 gene locus_tag LOCUS_30680 gene rpsI 1586 1972 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P28 protein_id gnl|my_center|LOCUS_30680 2175 2993 gene locus_tag LOCUS_30690 gene rpsB 2175 2993 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU2 protein_id gnl|my_center|LOCUS_30690 >Feature sequence0582 680 9 gene locus_tag LOCUS_30700 680 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 2101 704 gene locus_tag LOCUS_30710 2101 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 3112 3729 gene locus_tag LOCUS_30720 3112 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 >Feature sequence0583 2998 320 gene locus_tag LOCUS_30730 2998 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 >Feature sequence0584 3437 333 gene locus_tag LOCUS_30740 3437 333 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766148.1 protein_id gnl|my_center|LOCUS_30740 >Feature sequence0585 458 21 gene locus_tag LOCUS_30750 458 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30750 1027 545 gene locus_tag LOCUS_30760 1027 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 <3823 1029 gene locus_tag LOCUS_30770 <3823 1029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109348.1:restriction endonuclease subunit M >Feature sequence0586 1737 2378 gene locus_tag LOCUS_30780 1737 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 3797 2379 gene locus_tag LOCUS_30790 3797 2379 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962589.1 protein_id gnl|my_center|LOCUS_30790 >Feature sequence0587 228 455 gene locus_tag LOCUS_30800 228 455 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902968.1 protein_id gnl|my_center|LOCUS_30800 649 1491 gene locus_tag LOCUS_30810 649 1491 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108968.1 protein_id gnl|my_center|LOCUS_30810 2740 1655 gene locus_tag LOCUS_30820 gene galE 2740 1655 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119071.1 protein_id gnl|my_center|LOCUS_30820 >Feature sequence0588 1138 365 gene locus_tag LOCUS_30830 1138 365 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948483.1 protein_id gnl|my_center|LOCUS_30830 1510 1274 gene locus_tag LOCUS_30840 1510 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 1763 1533 gene locus_tag LOCUS_30850 1763 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 3255 1846 gene locus_tag LOCUS_30860 gene gltT 3255 1846 CDS product proton glutamate symport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821127.1 protein_id gnl|my_center|LOCUS_30860 >Feature sequence0589 238 675 gene locus_tag LOCUS_30870 238 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 678 1145 gene locus_tag LOCUS_30880 678 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 1929 1240 gene locus_tag LOCUS_30890 1929 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 >Feature sequence0590 1637 99 gene locus_tag LOCUS_30900 1637 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865224.1 protein_id gnl|my_center|LOCUS_30900 2700 1729 gene locus_tag LOCUS_30910 2700 1729 CDS product large multifunctional protein- glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120043.1 protein_id gnl|my_center|LOCUS_30910 2870 3058 gene locus_tag LOCUS_30920 2870 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 >Feature sequence0591 >Feature sequence0592 >Feature sequence0593 >Feature sequence0594 2566 1172 gene locus_tag LOCUS_30930 2566 1172 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762735.1 protein_id gnl|my_center|LOCUS_30930 <3784 2660 gene locus_tag LOCUS_30940 <3784 2660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403901.1:RNA polymerase sigma-54 factor >Feature sequence0595 939 3716 gene locus_tag LOCUS_30950 gene sucA 939 3716 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 protein_id gnl|my_center|LOCUS_30950 >Feature sequence0596 3300 1930 gene locus_tag LOCUS_30960 3300 1930 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119292.1 protein_id gnl|my_center|LOCUS_30960 >Feature sequence0597 <1 547 gene locus_tag LOCUS_30970 <1 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003907436.1:peptidase M23 1781 1996 gene locus_tag LOCUS_30980 1781 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30980 >Feature sequence0598 718 3063 gene locus_tag LOCUS_30990 718 3063 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203587.1 protein_id gnl|my_center|LOCUS_30990 3506 3096 gene locus_tag LOCUS_31000 3506 3096 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962412.1 protein_id gnl|my_center|LOCUS_31000 >Feature sequence0599 2581 3264 gene locus_tag LOCUS_31010 2581 3264 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074612.1 protein_id gnl|my_center|LOCUS_31010 >Feature sequence0600 394 909 gene locus_tag LOCUS_31020 394 909 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PR9 protein_id gnl|my_center|LOCUS_31020 1442 963 gene locus_tag LOCUS_31030 1442 963 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879260.1 protein_id gnl|my_center|LOCUS_31030 1556 2617 gene locus_tag LOCUS_31040 1556 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 <3753 2614 gene locus_tag LOCUS_31050 <3753 2614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963623.1:ABC transporter >Feature sequence0601 <1 1524 gene locus_tag LOCUS_31060 <1 1524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A5K9:DNA-directed DNA polymerase 1739 2386 gene locus_tag LOCUS_31070 1739 2386 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810448.1 protein_id gnl|my_center|LOCUS_31070 >Feature sequence0602 1025 33 gene locus_tag LOCUS_31080 1025 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 2444 1041 gene locus_tag LOCUS_31090 2444 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 3581 2670 gene locus_tag LOCUS_31100 3581 2670 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963067.1 protein_id gnl|my_center|LOCUS_31100 >Feature sequence0603 1983 820 gene locus_tag LOCUS_31110 1983 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 2608 2225 gene locus_tag LOCUS_31120 2608 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837198.1 protein_id gnl|my_center|LOCUS_31120 3150 2800 gene locus_tag LOCUS_31130 3150 2800 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460613.1 protein_id gnl|my_center|LOCUS_31130 3437 3147 gene locus_tag LOCUS_31140 3437 3147 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809266.1 protein_id gnl|my_center|LOCUS_31140 >Feature sequence0604 <1 713 gene locus_tag LOCUS_31150 <1 713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005801521.1:membrane protein 858 2243 gene locus_tag LOCUS_31160 858 2243 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120368.1 protein_id gnl|my_center|LOCUS_31160 >Feature sequence0605 317 1681 gene locus_tag LOCUS_31170 317 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 1686 2501 gene locus_tag LOCUS_31180 1686 2501 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202928.1 protein_id gnl|my_center|LOCUS_31180 3604 2498 gene locus_tag LOCUS_31190 gene wbyK 3604 2498 CDS product mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208591.1 protein_id gnl|my_center|LOCUS_31190 >Feature sequence0606 342 2411 gene locus_tag LOCUS_31200 342 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 2449 2865 gene locus_tag LOCUS_31210 2449 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 >Feature sequence0607 2586 316 gene locus_tag LOCUS_31220 gene katG 2586 316 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066164.1 protein_id gnl|my_center|LOCUS_31220 >Feature sequence0608 901 677 gene locus_tag LOCUS_31230 901 677 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791339.1 protein_id gnl|my_center|LOCUS_31230 1428 904 gene locus_tag LOCUS_31240 1428 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 2589 1591 gene locus_tag LOCUS_31250 gene fbp 2589 1591 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SW0 protein_id gnl|my_center|LOCUS_31250 3615 2734 gene locus_tag LOCUS_31260 3615 2734 CDS product fructosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403507.1 protein_id gnl|my_center|LOCUS_31260 >Feature sequence0609 <1 778 gene locus_tag LOCUS_31270 <1 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963528.1:radical SAM protein 1466 783 gene locus_tag LOCUS_31280 1466 783 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889003.1 protein_id gnl|my_center|LOCUS_31280 2774 1554 gene locus_tag LOCUS_31290 2774 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 <3697 2942 gene locus_tag LOCUS_31300 <3697 2942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224450.1:hydrogenase expression protein >Feature sequence0610 495 1280 gene locus_tag LOCUS_31310 495 1280 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203690.1 protein_id gnl|my_center|LOCUS_31310 1284 2201 gene locus_tag LOCUS_31320 1284 2201 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791185.1 protein_id gnl|my_center|LOCUS_31320 >Feature sequence0611 1188 736 gene locus_tag LOCUS_31330 1188 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 >Feature sequence0612 <1 749 gene locus_tag LOCUS_31340 <1 749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9ZBF6:beta-galactosidase 1156 833 gene locus_tag LOCUS_31350 1156 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 1708 2415 gene locus_tag LOCUS_31360 gene gldA 1708 2415 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 protein_id gnl|my_center|LOCUS_31360 3064 2495 gene locus_tag LOCUS_31370 3064 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 <3683 3164 gene locus_tag LOCUS_31380 <3683 3164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0A1:3-dehydroquinate synthase >Feature sequence0613 710 2980 gene locus_tag LOCUS_31390 gene acn 710 2980 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863308.1 protein_id gnl|my_center|LOCUS_31390 >Feature sequence0614 1357 2634 gene locus_tag LOCUS_31400 gene hflX 1357 2634 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YK6 protein_id gnl|my_center|LOCUS_31400 2687 2759 gene locus_tag LOCUS_t00200 2687 2759 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0615 438 31 gene locus_tag LOCUS_31410 438 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 545 1138 gene locus_tag LOCUS_31420 545 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 1128 1805 gene locus_tag LOCUS_31430 1128 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 2522 1932 gene locus_tag LOCUS_31440 2522 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 2728 2534 gene locus_tag LOCUS_31450 2728 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 >Feature sequence0616 1332 73 gene locus_tag LOCUS_31460 1332 73 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528753.1 protein_id gnl|my_center|LOCUS_31460 2680 1415 gene locus_tag LOCUS_31470 gene selA 2680 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972893.1 protein_id gnl|my_center|LOCUS_31470 >Feature sequence0617 2026 137 gene locus_tag LOCUS_31480 gene acsA 2026 137 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 protein_id gnl|my_center|LOCUS_31480 <3645 2098 gene locus_tag LOCUS_31490 <3645 2098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933466.1:cation acetate symporter >Feature sequence0618 <1 1311 gene locus_tag LOCUS_31500 <1 1311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64TL9:DNA gyrase subunit A 1377 2831 gene locus_tag LOCUS_31510 1377 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 >Feature sequence0619 1664 306 gene locus_tag LOCUS_31520 gene ftsA 1664 306 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H192 protein_id gnl|my_center|LOCUS_31520 2316 1687 gene locus_tag LOCUS_31530 2316 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 <3628 2491 gene locus_tag LOCUS_31540 <3628 2491 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A259:UDP-N-acetylmuramate--L-alanine ligase >Feature sequence0620 496 44 gene locus_tag LOCUS_31550 496 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 2010 796 gene locus_tag LOCUS_31560 2010 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 2233 2838 gene locus_tag LOCUS_31570 2233 2838 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389562.1 protein_id gnl|my_center|LOCUS_31570 2890 3219 gene locus_tag LOCUS_31580 2890 3219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 >Feature sequence0621 1562 744 gene locus_tag LOCUS_31590 gene pyrF 1562 744 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A012 protein_id gnl|my_center|LOCUS_31590 1675 2220 gene locus_tag LOCUS_31600 1675 2220 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107717.1 protein_id gnl|my_center|LOCUS_31600 2964 2272 gene locus_tag LOCUS_31610 2964 2272 CDS product peptidase C56 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294671.1 protein_id gnl|my_center|LOCUS_31610 >Feature sequence0622 975 217 gene locus_tag LOCUS_31620 975 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 2589 1468 gene locus_tag LOCUS_31630 gene xdhC 2589 1468 CDS product xanthine dehydrogenase accessory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223762.1 protein_id gnl|my_center|LOCUS_31630 <3610 2704 gene locus_tag LOCUS_31640 <3610 2704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143401.1:molybdenum cofactor biosynthesis protein MoeB >Feature sequence0623 1874 1605 gene locus_tag LOCUS_31650 1874 1605 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113265.1 protein_id gnl|my_center|LOCUS_31650 2083 1871 gene locus_tag LOCUS_31660 2083 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 <3591 2734 gene locus_tag LOCUS_31670 <3591 2734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267249.1:membrane protein >Feature sequence0624 <1 873 gene locus_tag LOCUS_31680 <1 873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYD1:ATP-dependent DNA helicase RecG 2224 866 gene locus_tag LOCUS_31690 2224 866 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974440.1 protein_id gnl|my_center|LOCUS_31690 3043 2345 gene locus_tag LOCUS_31700 3043 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036017.1 protein_id gnl|my_center|LOCUS_31700 >Feature sequence0625 1308 1958 gene locus_tag LOCUS_31710 1308 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 2418 1972 gene locus_tag LOCUS_31720 2418 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 >Feature sequence0626 <3584 1168 gene locus_tag LOCUS_31730 <3584 1168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107158.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence0627 3 215 gene locus_tag LOCUS_31740 3 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 220 1431 gene locus_tag LOCUS_31750 220 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405075.1 protein_id gnl|my_center|LOCUS_31750 1421 2212 gene locus_tag LOCUS_31760 1421 2212 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791250.1 protein_id gnl|my_center|LOCUS_31760 2309 2716 gene locus_tag LOCUS_31770 2309 2716 CDS product dTDP-6-deoxy-3,4-keto-hexulose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461015.1 protein_id gnl|my_center|LOCUS_31770 >Feature sequence0628 486 1607 gene locus_tag LOCUS_31780 486 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 1678 3024 gene locus_tag LOCUS_31790 1678 3024 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765356.1 protein_id gnl|my_center|LOCUS_31790 >Feature sequence0629 >Feature sequence0630 1919 1581 gene locus_tag LOCUS_31800 1919 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184933.1 protein_id gnl|my_center|LOCUS_31800 2576 2196 gene locus_tag LOCUS_31810 2576 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 >Feature sequence0631 3545 1119 gene locus_tag LOCUS_31820 3545 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 >Feature sequence0632 278 1573 gene locus_tag LOCUS_31830 gene actF 278 1573 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962548.1 protein_id gnl|my_center|LOCUS_31830 1595 2722 gene locus_tag LOCUS_31840 gene ctaC 1595 2722 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962549.1 protein_id gnl|my_center|LOCUS_31840 >Feature sequence0633 564 725 gene locus_tag LOCUS_31850 564 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 1281 856 gene locus_tag LOCUS_31860 1281 856 CDS product CHRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088650.1 protein_id gnl|my_center|LOCUS_31860 2145 1372 gene locus_tag LOCUS_31870 2145 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 2381 2533 gene locus_tag LOCUS_31880 2381 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 2680 3096 gene locus_tag LOCUS_31890 2680 3096 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962361.1 protein_id gnl|my_center|LOCUS_31890 >Feature sequence0634 3119 1608 gene locus_tag LOCUS_31900 3119 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 >Feature sequence0635 2843 1704 gene locus_tag LOCUS_31910 gene nagX 2843 1704 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_31910 3533 2943 gene locus_tag LOCUS_31920 3533 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 >Feature sequence0636 2429 3172 gene locus_tag LOCUS_31930 gene sdhC 2429 3172 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962272.1 protein_id gnl|my_center|LOCUS_31930 >Feature sequence0637 1670 2146 gene locus_tag LOCUS_31940 1670 2146 CDS product fasciclin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083338.1 protein_id gnl|my_center|LOCUS_31940 2437 2607 gene locus_tag LOCUS_31950 2437 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 >Feature sequence0638 655 62 gene locus_tag LOCUS_31960 655 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 855 2318 gene locus_tag LOCUS_31970 855 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332558.1 protein_id gnl|my_center|LOCUS_31970 3278 2370 gene locus_tag LOCUS_31980 3278 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 >Feature sequence0639 <1 1972 gene locus_tag LOCUS_31990 <1 1972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009934486.1:histidine kinase 2095 2778 gene locus_tag LOCUS_32000 2095 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 >Feature sequence0640 78 854 gene locus_tag LOCUS_32010 78 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 1198 941 gene locus_tag LOCUS_32020 1198 941 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367020.1 protein_id gnl|my_center|LOCUS_32020 2755 1328 gene locus_tag LOCUS_32030 2755 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 >Feature sequence0641 210 2468 gene locus_tag LOCUS_32040 gene fecA 210 2468 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963607.1 protein_id gnl|my_center|LOCUS_32040 3275 2472 gene locus_tag LOCUS_32050 3275 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 >Feature sequence0642 <1 1742 gene locus_tag LOCUS_32060 <1 1742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031513.1:glycosyl hydrolase 2046 3341 gene locus_tag LOCUS_32070 2046 3341 CDS product citrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389229.1 protein_id gnl|my_center|LOCUS_32070 >Feature sequence0643 178 639 gene locus_tag LOCUS_32080 178 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 636 1058 gene locus_tag LOCUS_32090 636 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 1240 2118 gene locus_tag LOCUS_32100 1240 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 2147 2653 gene locus_tag LOCUS_32110 2147 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 >Feature sequence0644 2878 368 gene locus_tag LOCUS_32120 2878 368 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107653.1 protein_id gnl|my_center|LOCUS_32120 >Feature sequence0645 834 580 gene locus_tag LOCUS_32130 834 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 851 1882 gene locus_tag LOCUS_32140 851 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 <3477 1883 gene locus_tag LOCUS_32150 <3477 1883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H070:2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase >Feature sequence0646 794 2152 gene locus_tag LOCUS_32160 794 2152 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209169.1 protein_id gnl|my_center|LOCUS_32160 >Feature sequence0647 991 1947 gene locus_tag LOCUS_32170 991 1947 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202798.1 protein_id gnl|my_center|LOCUS_32170 1949 2500 gene locus_tag LOCUS_32180 1949 2500 CDS product 4-amino-4-deoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107438.1 protein_id gnl|my_center|LOCUS_32180 2931 2503 gene locus_tag LOCUS_32190 2931 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 3152 2934 gene locus_tag LOCUS_32200 3152 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 3418 3185 gene locus_tag LOCUS_32210 3418 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_32210 >Feature sequence0648 1009 251 gene locus_tag LOCUS_32220 1009 251 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107611.1 protein_id gnl|my_center|LOCUS_32220 2223 1006 gene locus_tag LOCUS_32230 2223 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 3065 2430 gene locus_tag LOCUS_32240 3065 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 >Feature sequence0649 1019 468 gene locus_tag LOCUS_32250 1019 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 2308 1109 gene locus_tag LOCUS_32260 2308 1109 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941985.1 protein_id gnl|my_center|LOCUS_32260 <3463 2313 gene locus_tag LOCUS_32270 <3463 2313 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941985.1:RND transporter >Feature sequence0650 688 464 gene locus_tag LOCUS_32280 688 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 2502 1831 gene locus_tag LOCUS_32290 2502 1831 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085274.1 protein_id gnl|my_center|LOCUS_32290 3352 2840 gene locus_tag LOCUS_32300 3352 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 >Feature sequence0651 222 1601 gene locus_tag LOCUS_32310 222 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 1598 2962 gene locus_tag LOCUS_32320 1598 2962 CDS product alkaline ceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048700.1 protein_id gnl|my_center|LOCUS_32320 >Feature sequence0652 <1 2804 gene locus_tag LOCUS_32330 <1 2804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein >Feature sequence0653 1760 663 gene locus_tag LOCUS_32340 1760 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 >Feature sequence0654 3 815 gene locus_tag LOCUS_32350 3 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 870 2285 gene locus_tag LOCUS_32360 870 2285 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107431.1 protein_id gnl|my_center|LOCUS_32360 2740 2495 gene locus_tag LOCUS_32370 2740 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 >Feature sequence0655 <1 614 gene locus_tag LOCUS_32380 <1 614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529177.1:DNA-binding response regulator 1542 595 gene locus_tag LOCUS_32390 1542 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 1743 2009 gene locus_tag LOCUS_32400 1743 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 2039 3151 gene locus_tag LOCUS_32410 2039 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 >Feature sequence0656 3052 2459 gene locus_tag LOCUS_32420 gene ruvA 3052 2459 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PZ9 protein_id gnl|my_center|LOCUS_32420 >Feature sequence0657 909 3305 gene locus_tag LOCUS_32430 909 3305 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203489.1 protein_id gnl|my_center|LOCUS_32430 >Feature sequence0658 594 3032 gene locus_tag LOCUS_32440 594 3032 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_32440 >Feature sequence0659 2770 1205 gene locus_tag LOCUS_32450 2770 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 protein_id gnl|my_center|LOCUS_32450 >Feature sequence0660 3146 2112 gene locus_tag LOCUS_32460 3146 2112 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121934.1 protein_id gnl|my_center|LOCUS_32460 >Feature sequence0661 >Feature sequence0662 379 1398 gene locus_tag LOCUS_32470 379 1398 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973397.1 protein_id gnl|my_center|LOCUS_32470 1543 1459 gene locus_tag LOCUS_t00210 1543 1459 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2863 1619 gene locus_tag LOCUS_32480 2863 1619 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964122.1 protein_id gnl|my_center|LOCUS_32480 >Feature sequence0663 <1 587 gene locus_tag LOCUS_32490 <1 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202773.1:acetylhydrolase 1555 2181 gene locus_tag LOCUS_32500 1555 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 2233 3369 gene locus_tag LOCUS_32510 2233 3369 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946555.1 protein_id gnl|my_center|LOCUS_32510 >Feature sequence0664 585 190 gene locus_tag LOCUS_32520 585 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 1526 624 gene locus_tag LOCUS_32530 1526 624 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404794.1 protein_id gnl|my_center|LOCUS_32530 1749 2372 gene locus_tag LOCUS_32540 1749 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784472.1 protein_id gnl|my_center|LOCUS_32540 2425 3081 gene locus_tag LOCUS_32550 2425 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 >Feature sequence0665 <1 1539 gene locus_tag LOCUS_32560 <1 1539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144042.1:amidase 2026 1589 gene locus_tag LOCUS_32570 2026 1589 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669943.1 protein_id gnl|my_center|LOCUS_32570 2286 2023 gene locus_tag LOCUS_32580 2286 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 >Feature sequence0666 481 912 gene locus_tag LOCUS_32590 481 912 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B849 protein_id gnl|my_center|LOCUS_32590 1618 980 gene locus_tag LOCUS_32600 1618 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 2743 1622 gene locus_tag LOCUS_32610 gene smf 2743 1622 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964524.1 protein_id gnl|my_center|LOCUS_32610 >Feature sequence0667 1401 52 gene locus_tag LOCUS_32620 1401 52 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_32620 2292 1438 gene locus_tag LOCUS_32630 2292 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 3122 2451 gene locus_tag LOCUS_32640 3122 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 >Feature sequence0668 156 1361 gene locus_tag LOCUS_32650 156 1361 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786608.1 protein_id gnl|my_center|LOCUS_32650 >Feature sequence0669 2807 681 gene locus_tag LOCUS_32660 2807 681 CDS product xylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117993.1 protein_id gnl|my_center|LOCUS_32660 >Feature sequence0670 >Feature sequence0671 1577 2821 gene locus_tag LOCUS_32670 1577 2821 CDS product aminotransferase AlaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365583.1 protein_id gnl|my_center|LOCUS_32670 >Feature sequence0672 1433 1065 gene locus_tag LOCUS_32680 1433 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787945.1 protein_id gnl|my_center|LOCUS_32680 1986 1543 gene locus_tag LOCUS_32690 1986 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 2662 3090 gene locus_tag LOCUS_32700 2662 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 >Feature sequence0673 337 1089 gene locus_tag LOCUS_32710 337 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787827.1 protein_id gnl|my_center|LOCUS_32710 1305 2765 gene locus_tag LOCUS_32720 1305 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 >Feature sequence0674 <1 1233 gene locus_tag LOCUS_32730 <1 1233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016362015.1:sulfate permease <3322 1311 gene locus_tag LOCUS_32740 <3322 1311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071046.1:TonB-dependent receptor >Feature sequence0675 1541 414 gene locus_tag LOCUS_32750 1541 414 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RG7 protein_id gnl|my_center|LOCUS_32750 2299 1529 gene locus_tag LOCUS_32760 2299 1529 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202198.1 protein_id gnl|my_center|LOCUS_32760 3122 2469 gene locus_tag LOCUS_32770 3122 2469 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461663.1 protein_id gnl|my_center|LOCUS_32770 >Feature sequence0676 114 2246 gene locus_tag LOCUS_32780 gene ppk 114 2246 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PX4 protein_id gnl|my_center|LOCUS_32780 2257 2988 gene locus_tag LOCUS_32790 2257 2988 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765986.1 protein_id gnl|my_center|LOCUS_32790 >Feature sequence0677 <1 1215 gene locus_tag LOCUS_32800 <1 1215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227612.1:type I-E CRISPR-associated protein Cas7/Cse4/CasC 1248 2027 gene locus_tag LOCUS_32810 1248 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 2024 2704 gene locus_tag LOCUS_32820 2024 2704 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227610.1 protein_id gnl|my_center|LOCUS_32820 2777 3293 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtattccctacatgcgtggggatggaccg >Feature sequence0678 1521 685 gene locus_tag LOCUS_32830 1521 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 2050 1619 gene locus_tag LOCUS_32840 2050 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 2916 2086 gene locus_tag LOCUS_32850 2916 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 >Feature sequence0679 315 2105 gene locus_tag LOCUS_32860 315 2105 CDS product X-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405524.1 protein_id gnl|my_center|LOCUS_32860 3017 2367 gene locus_tag LOCUS_32870 3017 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 >Feature sequence0680 1047 337 gene locus_tag LOCUS_32880 1047 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 1820 1044 gene locus_tag LOCUS_32890 1820 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 2398 1853 gene locus_tag LOCUS_32900 2398 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 <3298 2523 gene locus_tag LOCUS_32910 <3298 2523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0I8:aspartate carbamoyltransferase >Feature sequence0681 1586 2737 gene locus_tag LOCUS_32920 1586 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 >Feature sequence0682 811 524 gene locus_tag LOCUS_32930 811 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116400.1 protein_id gnl|my_center|LOCUS_32930 2383 827 gene locus_tag LOCUS_32940 gene treA 2383 827 CDS product periplasmic trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FU73 protein_id gnl|my_center|LOCUS_32940 <3292 2483 gene locus_tag LOCUS_32950 <3292 2483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001705460.1:putative amidohydrolase >Feature sequence0683 <1 711 gene locus_tag LOCUS_32960 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963759.1:DNA-binding response regulator 1443 715 gene locus_tag LOCUS_32970 1443 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729187.1 protein_id gnl|my_center|LOCUS_32970 <3288 1509 gene locus_tag LOCUS_32980 <3288 1509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228465.1:sensor histidine kinase >Feature sequence0684 1333 761 gene locus_tag LOCUS_32990 1333 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66416 protein_id gnl|my_center|LOCUS_32990 1638 1342 gene locus_tag LOCUS_33000 1638 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 1844 2260 gene locus_tag LOCUS_33010 gene rpsL 1844 2260 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A472 protein_id gnl|my_center|LOCUS_33010 2388 2855 gene locus_tag LOCUS_33020 gene rpsG 2388 2855 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NK5 protein_id gnl|my_center|LOCUS_33020 >Feature sequence0685 452 1306 gene locus_tag LOCUS_33030 gene rbsB 452 1306 CDS product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119385.1 protein_id gnl|my_center|LOCUS_33030 1462 2091 gene locus_tag LOCUS_33040 1462 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 >Feature sequence0686 1312 2076 gene locus_tag LOCUS_33050 1312 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 >Feature sequence0687 <1 894 gene locus_tag LOCUS_33060 <1 894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109244.1:anti-sigma factor 973 2784 gene locus_tag LOCUS_33070 973 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 >Feature sequence0688 <1 705 gene locus_tag LOCUS_33080 <1 705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004079973.1:cystathionine gamma-synthase 3183 781 gene locus_tag LOCUS_33090 3183 781 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_33090 >Feature sequence0689 2096 228 gene locus_tag LOCUS_33100 2096 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 3010 2102 gene locus_tag LOCUS_33110 3010 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 >Feature sequence0690 <1 723 gene locus_tag LOCUS_33120 <1 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964501.1:T9SS C-terminal target domain-containing protein 864 2243 gene locus_tag LOCUS_33130 864 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 2322 2888 gene locus_tag LOCUS_33140 2322 2888 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964425.1 protein_id gnl|my_center|LOCUS_33140 >Feature sequence0691 <1 1661 gene locus_tag LOCUS_33150 <1 1661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013368537.1:dehydrogenase >Feature sequence0692 814 1404 gene locus_tag LOCUS_33160 814 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 1435 1905 gene locus_tag LOCUS_33170 1435 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 3028 1862 gene locus_tag LOCUS_33180 3028 1862 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403218.1 protein_id gnl|my_center|LOCUS_33180 >Feature sequence0693 3199 1001 gene locus_tag LOCUS_33190 3199 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 >Feature sequence0694 <1 1061 gene locus_tag LOCUS_33200 <1 1061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107797.1:histidine kinase 1065 1802 gene locus_tag LOCUS_33210 1065 1802 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_33210 1960 1829 gene locus_tag LOCUS_33220 1960 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 3199 2096 gene locus_tag LOCUS_33230 3199 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 >Feature sequence0695 197 1627 gene locus_tag LOCUS_33240 197 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057806.1 protein_id gnl|my_center|LOCUS_33240 1771 1643 gene locus_tag LOCUS_33250 1771 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 2693 1998 gene locus_tag LOCUS_33260 gene truC 2693 1998 CDS product tRNA pseudouridine synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943781.1 protein_id gnl|my_center|LOCUS_33260 <3236 2696 gene locus_tag LOCUS_33270 <3236 2696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876948.1:diaminopimelate decarboxylase >Feature sequence0696 >Feature sequence0697 405 614 gene locus_tag LOCUS_33280 405 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 601 1392 gene locus_tag LOCUS_33290 601 1392 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962792.1 protein_id gnl|my_center|LOCUS_33290 1653 1444 gene locus_tag LOCUS_33300 1653 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 1844 3127 gene locus_tag LOCUS_33310 1844 3127 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103171.1 protein_id gnl|my_center|LOCUS_33310 >Feature sequence0698 <3221 2391 gene locus_tag LOCUS_33320 <3221 2391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002225587.1:glucose/galactose MFS transporter >Feature sequence0699 <3217 621 gene locus_tag LOCUS_33330 <3217 621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202162.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence0700 1545 1156 gene locus_tag LOCUS_33340 1545 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 2043 1678 gene locus_tag LOCUS_33350 2043 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 2450 2040 gene locus_tag LOCUS_33360 2450 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 >Feature sequence0701 988 545 gene locus_tag LOCUS_33370 988 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761554.1 protein_id gnl|my_center|LOCUS_33370 1024 1794 gene locus_tag LOCUS_33380 1024 1794 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787839.1 protein_id gnl|my_center|LOCUS_33380 2934 2218 gene locus_tag LOCUS_33390 2934 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33390 >Feature sequence0702 831 37 gene locus_tag LOCUS_33400 831 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361984.1 protein_id gnl|my_center|LOCUS_33400 2414 924 gene locus_tag LOCUS_33410 2414 924 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057589.1 protein_id gnl|my_center|LOCUS_33410 2495 3157 gene locus_tag LOCUS_33420 2495 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 >Feature sequence0703 >Feature sequence0704 <1 540 gene locus_tag LOCUS_33430 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113025.1:dehydrogenase 582 1010 gene locus_tag LOCUS_33440 582 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 1050 1442 gene locus_tag LOCUS_33450 1050 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 1483 2238 gene locus_tag LOCUS_33460 1483 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 2294 2872 gene locus_tag LOCUS_33470 2294 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 >Feature sequence0705 <3174 1591 gene locus_tag LOCUS_33480 <3174 1591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005789258.1:sulfatase >Feature sequence0706 172 372 gene locus_tag LOCUS_33490 172 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 391 756 gene locus_tag LOCUS_33500 391 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 760 1374 gene locus_tag LOCUS_33510 760 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 1377 1523 gene locus_tag LOCUS_33520 1377 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 1537 1713 gene locus_tag LOCUS_33530 1537 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 1902 3068 gene locus_tag LOCUS_33540 1902 3068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 >Feature sequence0707 >Feature sequence0708 1032 646 gene locus_tag LOCUS_33550 1032 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 <3164 1517 gene locus_tag LOCUS_33560 <3164 1517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223297.1:phosphoesterase >Feature sequence0709 1254 787 gene locus_tag LOCUS_33570 1254 787 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097907.1 protein_id gnl|my_center|LOCUS_33570 1685 2395 gene locus_tag LOCUS_33580 gene yggG 1685 2395 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962471.1 protein_id gnl|my_center|LOCUS_33580 >Feature sequence0710 2168 687 gene locus_tag LOCUS_33590 2168 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 <3157 2291 gene locus_tag LOCUS_33600 <3157 2291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962729.1:cytochrome-c peroxidase >Feature sequence0711 1181 909 gene locus_tag LOCUS_33610 1181 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 2170 1205 gene locus_tag LOCUS_33620 2170 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 2559 2170 gene locus_tag LOCUS_33630 2559 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 2936 2556 gene locus_tag LOCUS_33640 2936 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 >Feature sequence0712 342 1778 gene locus_tag LOCUS_33650 342 1778 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFU0 protein_id gnl|my_center|LOCUS_33650 1934 2101 gene locus_tag LOCUS_33660 1934 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 2982 2122 gene locus_tag LOCUS_33670 2982 2122 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767385.1 protein_id gnl|my_center|LOCUS_33670 >Feature sequence0713 1284 775 gene locus_tag LOCUS_33680 1284 775 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107442.1 protein_id gnl|my_center|LOCUS_33680 1680 1291 gene locus_tag LOCUS_33690 1680 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268377.1 protein_id gnl|my_center|LOCUS_33690 2102 2479 gene locus_tag LOCUS_33700 2102 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 >Feature sequence0714 516 1424 gene locus_tag LOCUS_33710 516 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962731.1 protein_id gnl|my_center|LOCUS_33710 >Feature sequence0715 <1 851 gene locus_tag LOCUS_33720 <1 851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RHI0:malto-oligosyltrehalose trehalohydrolase >Feature sequence0716 <1 750 gene locus_tag LOCUS_33730 <1 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096014.1:glycosylase 851 1696 gene locus_tag LOCUS_33740 851 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 1736 2704 gene locus_tag LOCUS_33750 1736 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 >Feature sequence0717 <1 744 gene locus_tag LOCUS_33760 <1 744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000202725.1:permease 841 1629 gene locus_tag LOCUS_33770 841 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 2703 1696 gene locus_tag LOCUS_33780 2703 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 >Feature sequence0718 3086 117 gene locus_tag LOCUS_33790 3086 117 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765759.1 protein_id gnl|my_center|LOCUS_33790 >Feature sequence0719 1 285 gene locus_tag LOCUS_33800 1 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 2448 301 gene locus_tag LOCUS_33810 gene mcm3 2448 301 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828556.1 protein_id gnl|my_center|LOCUS_33810 3129 2464 gene locus_tag LOCUS_33820 3129 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 >Feature sequence0720 1082 468 gene locus_tag LOCUS_33830 1082 468 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966541.1 protein_id gnl|my_center|LOCUS_33830 1233 1889 gene locus_tag LOCUS_33840 1233 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 2537 2061 gene locus_tag LOCUS_33850 2537 2061 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963844.1 protein_id gnl|my_center|LOCUS_33850 >Feature sequence0721 <1 907 gene locus_tag LOCUS_33860 <1 907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64RC3:transcription termination factor Rho 1069 1332 gene locus_tag LOCUS_33870 1069 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 1371 1931 gene locus_tag LOCUS_33880 1371 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 1973 2506 gene locus_tag LOCUS_33890 1973 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 <3120 2591 gene locus_tag LOCUS_33900 <3120 2591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZQ9:chaperone protein HtpG >Feature sequence0722 1213 1686 gene locus_tag LOCUS_33910 1213 1686 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228165.1 protein_id gnl|my_center|LOCUS_33910 1683 2360 gene locus_tag LOCUS_33920 1683 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33920 2534 3083 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcaataccagaaggtactattgaggc >Feature sequence0723 436 1677 gene locus_tag LOCUS_33930 436 1677 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337262.1 protein_id gnl|my_center|LOCUS_33930 1955 2290 gene locus_tag LOCUS_33940 1955 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 >Feature sequence0724 <1 1265 gene locus_tag LOCUS_33950 <1 1265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64P92:DNA primase 1307 2164 gene locus_tag LOCUS_33960 1307 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_33960 >Feature sequence0725 <1 912 gene locus_tag LOCUS_33970 <1 912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3Y0K9:cysteine desulfurase 1090 1965 gene locus_tag LOCUS_33980 1090 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 <3115 1957 gene locus_tag LOCUS_33990 <3115 1957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GVU9:DNA repair protein RadA >Feature sequence0726 1566 2759 gene locus_tag LOCUS_34000 1566 2759 CDS product N-acylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108906.1 protein_id gnl|my_center|LOCUS_34000 >Feature sequence0727 218 1777 gene locus_tag LOCUS_34010 218 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783832.1 protein_id gnl|my_center|LOCUS_34010 2405 1791 gene locus_tag LOCUS_34020 2405 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 2958 2407 gene locus_tag LOCUS_34030 2958 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 >Feature sequence0728 <1 776 gene locus_tag LOCUS_34040 <1 776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121141.1:arylsulfatase 819 2000 gene locus_tag LOCUS_34050 819 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004541251.1 protein_id gnl|my_center|LOCUS_34050 >Feature sequence0729 >Feature sequence0730 2632 1166 gene locus_tag LOCUS_34060 2632 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 >Feature sequence0731 <1 774 gene locus_tag LOCUS_34070 <1 774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029014.1:galactonate dehydratase 920 1888 gene locus_tag LOCUS_34080 920 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 >Feature sequence0732 1595 738 gene locus_tag LOCUS_34090 1595 738 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086979.1 protein_id gnl|my_center|LOCUS_34090 <3097 1806 gene locus_tag LOCUS_34100 <3097 1806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118999.1:cytochrome c >Feature sequence0733 >Feature sequence0734 534 2111 gene locus_tag LOCUS_34110 534 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403146.1 protein_id gnl|my_center|LOCUS_34110 >Feature sequence0735 172 927 gene locus_tag LOCUS_34120 gene eutC 172 927 CDS product ethanolamine ammonia-lyase light chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WFC6 protein_id gnl|my_center|LOCUS_34120 1552 929 gene locus_tag LOCUS_34130 1552 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 2667 1618 gene locus_tag LOCUS_34140 2667 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39879 protein_id gnl|my_center|LOCUS_34140 >Feature sequence0736 250 906 gene locus_tag LOCUS_34150 250 906 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511395.1 protein_id gnl|my_center|LOCUS_34150 2573 1206 gene locus_tag LOCUS_34160 2573 1206 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657969.1 protein_id gnl|my_center|LOCUS_34160 <3081 2577 gene locus_tag LOCUS_34170 <3081 2577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783816.1:DNA-binding response regulator >Feature sequence0737 2062 530 gene locus_tag LOCUS_34180 2062 530 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107495.1 protein_id gnl|my_center|LOCUS_34180 <3077 2071 gene locus_tag LOCUS_34190 <3077 2071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142490.1:secretion protein HlyD >Feature sequence0738 >Feature sequence0739 >Feature sequence0740 >Feature sequence0741 1660 263 gene locus_tag LOCUS_34200 1660 263 CDS product 23S rRNA (uracil-5-)-methyltransferase RumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_34200 >Feature sequence0742 2872 1598 gene locus_tag LOCUS_34210 2872 1598 CDS product 4-hydroxybutyrate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211395.1 protein_id gnl|my_center|LOCUS_34210 >Feature sequence0743 <1 1218 gene locus_tag LOCUS_34220 <1 1218 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766188.1:hybrid sensor histidine kinase/response regulator >Feature sequence0744 1444 365 gene locus_tag LOCUS_34230 gene fbaA 1444 365 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962494.1 protein_id gnl|my_center|LOCUS_34230 1699 1941 gene locus_tag LOCUS_34240 1699 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 >Feature sequence0745 1545 616 gene locus_tag LOCUS_34250 1545 616 CDS product peptidase S66 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962239.1 protein_id gnl|my_center|LOCUS_34250 2522 1542 gene locus_tag LOCUS_34260 gene irk 2522 1542 CDS product inward rectifier potassium channel Irk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964090.1 protein_id gnl|my_center|LOCUS_34260 2917 2591 gene locus_tag LOCUS_34270 2917 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 >Feature sequence0746 145 1431 gene locus_tag LOCUS_34280 145 1431 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761420.1 protein_id gnl|my_center|LOCUS_34280 2175 1456 gene locus_tag LOCUS_34290 gene glpF 2175 1456 CDS product glycerol uptake facilitator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535419.1 protein_id gnl|my_center|LOCUS_34290 >Feature sequence0747 <1 1904 gene locus_tag LOCUS_34300 <1 1904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963992.1:peptidase M1 >Feature sequence0748 484 1005 gene locus_tag LOCUS_34310 gene ndhG 484 1005 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932454.1 protein_id gnl|my_center|LOCUS_34310 1002 1316 gene locus_tag LOCUS_34320 gene nuoK 1002 1316 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WED3 protein_id gnl|my_center|LOCUS_34320 1322 1795 gene locus_tag LOCUS_34330 1322 1795 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940309.1 protein_id gnl|my_center|LOCUS_34330 1803 2381 gene locus_tag LOCUS_34340 1803 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 >Feature sequence0749 2134 716 gene locus_tag LOCUS_34350 2134 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 >Feature sequence0750 <1 742 gene locus_tag LOCUS_34360 <1 742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202557.1:XylR family transcriptional regulator 1967 912 gene locus_tag LOCUS_34370 1967 912 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762561.1 protein_id gnl|my_center|LOCUS_34370 >Feature sequence0751 1398 2927 gene locus_tag LOCUS_34380 1398 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 >Feature sequence0752 1618 653 gene locus_tag LOCUS_34390 1618 653 CDS product transketolase, C-terminal subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_228761.1 protein_id gnl|my_center|LOCUS_34390 2492 1668 gene locus_tag LOCUS_34400 2492 1668 CDS product transketolase, N-terminal subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_228762.1 protein_id gnl|my_center|LOCUS_34400 >Feature sequence0753 1219 263 gene locus_tag LOCUS_34410 1219 263 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035380.1 protein_id gnl|my_center|LOCUS_34410 >Feature sequence0754 1531 710 gene locus_tag LOCUS_34420 1531 710 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QN5 protein_id gnl|my_center|LOCUS_34420 2795 1542 gene locus_tag LOCUS_34430 2795 1542 CDS product carbon dioxide concentrating mechanism protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056989.1 protein_id gnl|my_center|LOCUS_34430 >Feature sequence0755 231 1391 gene locus_tag LOCUS_34440 231 1391 CDS product lycopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257690.1 protein_id gnl|my_center|LOCUS_34440 1692 2972 gene locus_tag LOCUS_34450 gene metK 1692 2972 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA9 protein_id gnl|my_center|LOCUS_34450 >Feature sequence0756 2503 1376 gene locus_tag LOCUS_34460 gene acrA 2503 1376 CDS product MexX family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943335.1 protein_id gnl|my_center|LOCUS_34460 >Feature sequence0757 2435 219 gene locus_tag LOCUS_34470 2435 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 >Feature sequence0758 127 567 gene locus_tag LOCUS_34480 127 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 2447 633 gene locus_tag LOCUS_34490 gene typA 2447 633 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962640.1 protein_id gnl|my_center|LOCUS_34490 >Feature sequence0759 145 1164 gene locus_tag LOCUS_34500 145 1164 CDS product hydrolase TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368544.1 protein_id gnl|my_center|LOCUS_34500 1166 2035 gene locus_tag LOCUS_34510 1166 2035 CDS product transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028852.1 protein_id gnl|my_center|LOCUS_34510 >Feature sequence0760 1808 711 gene locus_tag LOCUS_34520 1808 711 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947388.1 protein_id gnl|my_center|LOCUS_34520 >Feature sequence0761 209 1480 gene locus_tag LOCUS_34530 gene hisD 209 1480 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABA9 protein_id gnl|my_center|LOCUS_34530 1661 2725 gene locus_tag LOCUS_34540 gene hisC 1661 2725 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABA8 protein_id gnl|my_center|LOCUS_34540 >Feature sequence0762 1160 2608 gene locus_tag LOCUS_34550 1160 2608 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964225.1 protein_id gnl|my_center|LOCUS_34550 >Feature sequence0763 <1 1456 gene locus_tag LOCUS_34560 <1 1456 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919507.1:GMC family oxidoreductase 1663 2853 gene locus_tag LOCUS_34570 1663 2853 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803908.1 protein_id gnl|my_center|LOCUS_34570 >Feature sequence0764 3 515 gene locus_tag LOCUS_34580 3 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 512 1630 gene locus_tag LOCUS_34590 512 1630 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582957.1 protein_id gnl|my_center|LOCUS_34590 1778 2722 gene locus_tag LOCUS_34600 gene fabH 1778 2722 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67185 protein_id gnl|my_center|LOCUS_34600 >Feature sequence0765 312 908 gene locus_tag LOCUS_34610 312 908 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QV1 protein_id gnl|my_center|LOCUS_34610 925 1110 gene locus_tag LOCUS_34620 925 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 1117 1944 gene locus_tag LOCUS_34630 gene cmpX 1117 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087830.1 protein_id gnl|my_center|LOCUS_34630 1970 2863 gene locus_tag LOCUS_34640 1970 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 >Feature sequence0766 2504 153 gene locus_tag LOCUS_34650 gene rnr 2504 153 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A378 protein_id gnl|my_center|LOCUS_34650 >Feature sequence0767 932 105 gene locus_tag LOCUS_34660 932 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 <2967 932 gene locus_tag LOCUS_34670 <2967 932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223297.1:phosphoesterase >Feature sequence0768 1199 2362 gene locus_tag LOCUS_34680 gene dxr 1199 2362 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PY9 protein_id gnl|my_center|LOCUS_34680 2359 2814 gene locus_tag LOCUS_34690 2359 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 >Feature sequence0769 2575 1661 gene locus_tag LOCUS_34700 2575 1661 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921395.1 protein_id gnl|my_center|LOCUS_34700 >Feature sequence0770 93 395 gene locus_tag LOCUS_34710 93 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 392 655 gene locus_tag LOCUS_34720 392 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 675 1967 gene locus_tag LOCUS_34730 675 1967 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028868.1 protein_id gnl|my_center|LOCUS_34730 1978 2829 gene locus_tag LOCUS_34740 1978 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 >Feature sequence0771 3 1115 gene locus_tag LOCUS_34750 3 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 1482 1075 gene locus_tag LOCUS_34760 1482 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 2217 1654 gene locus_tag LOCUS_34770 gene pfpI 2217 1654 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037891.1 protein_id gnl|my_center|LOCUS_34770 <2951 2359 gene locus_tag LOCUS_34780 <2951 2359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0F9:chaperone protein ClpB >Feature sequence0772 >Feature sequence0773 2176 161 gene locus_tag LOCUS_34790 gene uvrB 2176 161 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T09 protein_id gnl|my_center|LOCUS_34790 >Feature sequence0774 1021 557 gene locus_tag LOCUS_34800 1021 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 2171 1215 gene locus_tag LOCUS_34810 2171 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963436.1 protein_id gnl|my_center|LOCUS_34810 <2948 2266 gene locus_tag LOCUS_34820 <2948 2266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403437.1:arginine deiminase >Feature sequence0775 >Feature sequence0776 893 429 gene locus_tag LOCUS_34830 893 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 1209 2606 gene locus_tag LOCUS_34840 1209 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 >Feature sequence0777 530 81 gene locus_tag LOCUS_34850 530 81 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941998.1 protein_id gnl|my_center|LOCUS_34850 1646 585 gene locus_tag LOCUS_34860 1646 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 2839 1643 gene locus_tag LOCUS_34870 2839 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 >Feature sequence0778 884 159 gene locus_tag LOCUS_34880 884 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 1299 1138 gene locus_tag LOCUS_34890 1299 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 2561 1497 gene locus_tag LOCUS_34900 2561 1497 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768437.1 protein_id gnl|my_center|LOCUS_34900 >Feature sequence0779 1142 2836 gene locus_tag LOCUS_34910 1142 2836 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919430.1 protein_id gnl|my_center|LOCUS_34910 >Feature sequence0780 687 1553 gene locus_tag LOCUS_34920 687 1553 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109261.1 protein_id gnl|my_center|LOCUS_34920 1822 2307 gene locus_tag LOCUS_34930 1822 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107997.1 protein_id gnl|my_center|LOCUS_34930 2722 2366 gene locus_tag LOCUS_34940 2722 2366 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ6 protein_id gnl|my_center|LOCUS_34940 >Feature sequence0781 1869 2555 gene locus_tag LOCUS_34950 1869 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 >Feature sequence0782 3 2162 gene locus_tag LOCUS_34960 3 2162 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403467.1 protein_id gnl|my_center|LOCUS_34960 2301 2170 gene locus_tag LOCUS_34970 2301 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 >Feature sequence0783 616 1149 gene locus_tag LOCUS_34980 616 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 1137 2186 gene locus_tag LOCUS_34990 1137 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 >Feature sequence0784 387 130 gene locus_tag LOCUS_35000 387 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 1003 2763 gene locus_tag LOCUS_35010 1003 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 >Feature sequence0785 1005 595 gene locus_tag LOCUS_35020 1005 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 1179 1598 gene locus_tag LOCUS_35030 1179 1598 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202354.1 protein_id gnl|my_center|LOCUS_35030 2165 1599 gene locus_tag LOCUS_35040 2165 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 <2916 2218 gene locus_tag LOCUS_35050 <2916 2218 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107767.1:TonB-dependent receptor >Feature sequence0786 163 1758 gene locus_tag LOCUS_35060 gene gldM 163 1758 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_35060 1812 2861 gene locus_tag LOCUS_35070 1812 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 >Feature sequence0787 2905 2000 gene locus_tag LOCUS_35080 2905 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 >Feature sequence0788 333 1187 gene locus_tag LOCUS_35090 333 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 1324 2652 gene locus_tag LOCUS_35100 1324 2652 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_35100 >Feature sequence0789 153 1034 gene locus_tag LOCUS_35110 153 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 1327 1058 gene locus_tag LOCUS_35120 1327 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 1746 1372 gene locus_tag LOCUS_35130 1746 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 <2901 1892 gene locus_tag LOCUS_35140 <2901 1892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWV8:translation initiation factor IF-2 >Feature sequence0790 >Feature sequence0791 976 173 gene locus_tag LOCUS_35150 gene proC 976 173 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFV0 protein_id gnl|my_center|LOCUS_35150 2271 1126 gene locus_tag LOCUS_35160 2271 1126 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762996.1 protein_id gnl|my_center|LOCUS_35160 <2890 2329 gene locus_tag LOCUS_35170 <2890 2329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q1WSI0:aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B >Feature sequence0792 1334 2356 gene locus_tag LOCUS_35180 gene perM 1334 2356 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037914.1 protein_id gnl|my_center|LOCUS_35180 >Feature sequence0793 1 1071 gene locus_tag LOCUS_35190 1 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 2505 1153 gene locus_tag LOCUS_35200 2505 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 >Feature sequence0794 220 1419 gene locus_tag LOCUS_35210 220 1419 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368548.1 protein_id gnl|my_center|LOCUS_35210 1431 2798 gene locus_tag LOCUS_35220 1431 2798 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031019.1 protein_id gnl|my_center|LOCUS_35220 >Feature sequence0795 455 865 gene locus_tag LOCUS_35230 455 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 1522 926 gene locus_tag LOCUS_35240 gene tpm 1522 926 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963562.1 protein_id gnl|my_center|LOCUS_35240 1683 2003 gene locus_tag LOCUS_35250 1683 2003 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183698.1 protein_id gnl|my_center|LOCUS_35250 >Feature sequence0796 1664 2659 gene locus_tag LOCUS_35260 gene nadA 1664 2659 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MG0 protein_id gnl|my_center|LOCUS_35260 >Feature sequence0797 303 1151 gene locus_tag LOCUS_35270 303 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 1390 1779 gene locus_tag LOCUS_35280 1390 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 1823 2728 gene locus_tag LOCUS_35290 1823 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 >Feature sequence0798 843 2093 gene locus_tag LOCUS_35300 843 2093 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403490.1 protein_id gnl|my_center|LOCUS_35300 2433 2107 gene locus_tag LOCUS_35310 2433 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 >Feature sequence0799 1582 1091 gene locus_tag LOCUS_35320 1582 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 2262 1687 gene locus_tag LOCUS_35330 2262 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887081.1 protein_id gnl|my_center|LOCUS_35330 2532 2860 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccatctgaactggaaaggtactctggaag >Feature sequence0800 239 18 gene locus_tag LOCUS_35340 239 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 1379 351 gene locus_tag LOCUS_35350 1379 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 >Feature sequence0801 >Feature sequence0802 2525 78 gene locus_tag LOCUS_35360 2525 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 >Feature sequence0803 <1 2624 gene locus_tag LOCUS_35370 <1 2624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107964.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence0804 <1 1132 gene locus_tag LOCUS_35380 <1 1132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070480.1:penicillin-binding protein 1C 1179 1502 gene locus_tag LOCUS_35390 1179 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 1493 1774 gene locus_tag LOCUS_35400 1493 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 >Feature sequence0805 502 1737 gene locus_tag LOCUS_35410 502 1737 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108740.1 protein_id gnl|my_center|LOCUS_35410 >Feature sequence0806 >Feature sequence0807 690 343 gene locus_tag LOCUS_35420 gene ssb-1 690 343 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74B90 protein_id gnl|my_center|LOCUS_35420 1416 769 gene locus_tag LOCUS_35430 1416 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 <2830 1650 gene locus_tag LOCUS_35440 <2830 1650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108495.1:sodium:solute symporter >Feature sequence0808 <2827 181 gene locus_tag LOCUS_35450 <2827 181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108168.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence0809 1683 1072 gene locus_tag LOCUS_35460 1683 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35460 2378 1935 gene locus_tag LOCUS_35470 gene yjaB 2378 1935 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263862.1 protein_id gnl|my_center|LOCUS_35470 >Feature sequence0810 579 941 gene locus_tag LOCUS_35480 579 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 1347 1550 gene locus_tag LOCUS_35490 1347 1550 CDS product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765536.1 protein_id gnl|my_center|LOCUS_35490 1555 2148 gene locus_tag LOCUS_35500 1555 2148 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788060.1 protein_id gnl|my_center|LOCUS_35500 2145 2783 gene locus_tag LOCUS_35510 gene thiE 2145 2783 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA13 protein_id gnl|my_center|LOCUS_35510 >Feature sequence0811 230 1228 gene locus_tag LOCUS_35520 230 1228 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338139.1 protein_id gnl|my_center|LOCUS_35520 1444 2163 gene locus_tag LOCUS_35530 1444 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 >Feature sequence0812 1367 1945 gene locus_tag LOCUS_35540 gene gmhA 1367 1945 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FS79 protein_id gnl|my_center|LOCUS_35540 2666 1923 gene locus_tag LOCUS_35550 2666 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 >Feature sequence0813 <1 509 gene locus_tag LOCUS_35560 <1 509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121448.1:N-acetylgalactosamine-6-sulfatase 632 2074 gene locus_tag LOCUS_35570 632 2074 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121095.1 protein_id gnl|my_center|LOCUS_35570 >Feature sequence0814 <2817 982 gene locus_tag LOCUS_35580 <2817 982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108774.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence0815 230 481 gene locus_tag LOCUS_35590 gene purS 230 481 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4K3 protein_id gnl|my_center|LOCUS_35590 540 1541 gene locus_tag LOCUS_35600 gene fabH2 540 1541 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ1 protein_id gnl|my_center|LOCUS_35600 1914 1555 gene locus_tag LOCUS_35610 1914 1555 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_35610 >Feature sequence0816 <1 1023 gene locus_tag LOCUS_35620 <1 1023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963765.1:TonB-dependent receptor 1090 1743 gene locus_tag LOCUS_35630 1090 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963764.1 protein_id gnl|my_center|LOCUS_35630 >Feature sequence0817 919 1368 gene locus_tag LOCUS_35640 gene mgsA 919 1368 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E059 protein_id gnl|my_center|LOCUS_35640 1414 2028 gene locus_tag LOCUS_35650 1414 2028 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964444.1 protein_id gnl|my_center|LOCUS_35650 >Feature sequence0818 886 563 gene locus_tag LOCUS_35660 886 563 CDS product pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762871.1 protein_id gnl|my_center|LOCUS_35660 1352 900 gene locus_tag LOCUS_35670 gene dtd 1352 900 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650H8 protein_id gnl|my_center|LOCUS_35670 1782 1423 gene locus_tag LOCUS_35680 1782 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962264.1 protein_id gnl|my_center|LOCUS_35680 1993 2334 gene locus_tag LOCUS_35690 1993 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 >Feature sequence0819 527 279 gene locus_tag LOCUS_35700 527 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 <2799 802 gene locus_tag LOCUS_35710 <2799 802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964263.1:type III restriction endonuclease >Feature sequence0820 1878 34 gene locus_tag LOCUS_35720 1878 34 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963281.1 protein_id gnl|my_center|LOCUS_35720 2640 2029 gene locus_tag LOCUS_35730 2640 2029 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_35730 >Feature sequence0821 2 571 gene locus_tag LOCUS_35740 2 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 1293 628 gene locus_tag LOCUS_35750 1293 628 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788379.1 protein_id gnl|my_center|LOCUS_35750 2421 1426 gene locus_tag LOCUS_35760 2421 1426 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793314.1 protein_id gnl|my_center|LOCUS_35760 >Feature sequence0822 <1 942 gene locus_tag LOCUS_35770 <1 942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140682.1:gamma-glutamyltranspeptidase 1139 2338 gene locus_tag LOCUS_35780 1139 2338 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 protein_id gnl|my_center|LOCUS_35780 >Feature sequence0823 <1 1449 gene locus_tag LOCUS_35790 <1 1449 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8AA76:membrane protein insertase YidC >Feature sequence0824 894 1514 gene locus_tag LOCUS_35800 894 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 1694 2335 gene locus_tag LOCUS_35810 1694 2335 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787229.1 protein_id gnl|my_center|LOCUS_35810 >Feature sequence0825 <1 582 gene locus_tag LOCUS_35820 <1 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119366.1:dehydrogenase 1695 646 gene locus_tag LOCUS_35830 1695 646 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E299 protein_id gnl|my_center|LOCUS_35830 1676 1861 gene locus_tag LOCUS_35840 1676 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 <2780 1858 gene locus_tag LOCUS_35850 <2780 1858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXP5:chorismate synthase >Feature sequence0826 437 147 gene locus_tag LOCUS_35860 437 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 >Feature sequence0827 >Feature sequence0828 397 792 gene locus_tag LOCUS_35870 397 792 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888838.1 protein_id gnl|my_center|LOCUS_35870 1835 807 gene locus_tag LOCUS_35880 gene hemE 1835 807 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW2 protein_id gnl|my_center|LOCUS_35880 1996 2475 gene locus_tag LOCUS_35890 1996 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 >Feature sequence0829 <1 1694 gene locus_tag LOCUS_35900 <1 1694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964117.1:membrane protein >Feature sequence0830 <2757 2092 gene locus_tag LOCUS_35910 <2757 2092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H128:carbamoyl-phosphate synthase (glutamine-hydrolyzing) >Feature sequence0831 1383 1892 gene locus_tag LOCUS_35920 1383 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056674.1 protein_id gnl|my_center|LOCUS_35920 2053 2646 gene locus_tag LOCUS_35930 2053 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812610.1 protein_id gnl|my_center|LOCUS_35930 >Feature sequence0832 490 2733 gene locus_tag LOCUS_35940 490 2733 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945413.1 protein_id gnl|my_center|LOCUS_35940 >Feature sequence0833 >Feature sequence0834 1818 19 gene locus_tag LOCUS_35950 1818 19 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109365.1 protein_id gnl|my_center|LOCUS_35950 2500 1889 gene locus_tag LOCUS_35960 2500 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 >Feature sequence0835 <2748 881 gene locus_tag LOCUS_35970 <2748 881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942997.1:alpha-amylase >Feature sequence0836 884 651 gene locus_tag LOCUS_35980 884 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 1662 1129 gene locus_tag LOCUS_35990 1662 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 1840 1640 gene locus_tag LOCUS_36000 1840 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 2470 1904 gene locus_tag LOCUS_36010 2470 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 >Feature sequence0837 1825 41 gene locus_tag LOCUS_36020 1825 41 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962696.1 protein_id gnl|my_center|LOCUS_36020 >Feature sequence0838 >Feature sequence0839 2035 1082 gene locus_tag LOCUS_36030 2035 1082 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118345.1 protein_id gnl|my_center|LOCUS_36030 <2729 2145 gene locus_tag LOCUS_36040 <2729 2145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203417.1:rRNA cytosine-C5-methyltransferase >Feature sequence0840 <2717 2192 gene locus_tag LOCUS_36050 <2717 2192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203740.1:sulfite reductase >Feature sequence0841 <1 958 gene locus_tag LOCUS_36060 <1 958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104560.1:tyrosine protein kinase 1276 1683 gene locus_tag LOCUS_36070 1276 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 >Feature sequence0842 777 97 gene locus_tag LOCUS_36080 777 97 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406778.1 protein_id gnl|my_center|LOCUS_36080 952 1614 gene locus_tag LOCUS_36090 952 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 >Feature sequence0843 <1 960 gene locus_tag LOCUS_36100 <1 960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964501.1:T9SS C-terminal target domain-containing protein <2714 2165 gene locus_tag LOCUS_36110 <2714 2165 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963740.1:2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase >Feature sequence0844 2489 1971 gene locus_tag LOCUS_36120 2489 1971 CDS product tail Collar domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528766.1 protein_id gnl|my_center|LOCUS_36120 >Feature sequence0845 181 107 gene locus_tag LOCUS_t00220 181 107 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 894 280 gene locus_tag LOCUS_36130 894 280 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJC9 protein_id gnl|my_center|LOCUS_36130 1404 961 gene locus_tag LOCUS_36140 gene tadA 1404 961 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5K5 protein_id gnl|my_center|LOCUS_36140 >Feature sequence0846 1154 1954 gene locus_tag LOCUS_36150 1154 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 >Feature sequence0847 964 512 gene locus_tag LOCUS_36160 964 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 >Feature sequence0848 2305 617 gene locus_tag LOCUS_36170 2305 617 CDS product starch-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681494.1 protein_id gnl|my_center|LOCUS_36170 >Feature sequence0849 >Feature sequence0850 321 2039 gene locus_tag LOCUS_36180 321 2039 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919507.1 protein_id gnl|my_center|LOCUS_36180 >Feature sequence0851 3 140 gene locus_tag LOCUS_36190 3 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 152 778 gene locus_tag LOCUS_36200 gene thiE 152 778 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E0Q4 protein_id gnl|my_center|LOCUS_36200 775 1593 gene locus_tag LOCUS_36210 775 1593 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202801.1 protein_id gnl|my_center|LOCUS_36210 1590 2243 gene locus_tag LOCUS_36220 1590 2243 CDS product aminopyrimidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGB4 protein_id gnl|my_center|LOCUS_36220 >Feature sequence0852 <1 1040 gene locus_tag LOCUS_36230 <1 1040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963229.1:gliding motility-associated ABC transporter substrate-binding protein GldG 1292 2416 gene locus_tag LOCUS_36240 gene dnaN 1292 2416 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYK6 protein_id gnl|my_center|LOCUS_36240 >Feature sequence0853 715 113 gene locus_tag LOCUS_36250 715 113 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203445.1 protein_id gnl|my_center|LOCUS_36250 <2685 820 gene locus_tag LOCUS_36260 <2685 820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107131.1:alpha-glucosidase >Feature sequence0854 <1 1124 gene locus_tag LOCUS_36270 <1 1124 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814967.1:cell division protein Fic 1553 1125 gene locus_tag LOCUS_36280 1553 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 2125 1940 gene locus_tag LOCUS_36290 2125 1940 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388930.1 protein_id gnl|my_center|LOCUS_36290 >Feature sequence0855 1163 567 gene locus_tag LOCUS_36300 gene miaE 1163 567 CDS product tRNA 2-methylthio-N6-isopentenyl adenosine(37) hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_36300 >Feature sequence0856 <1 2169 gene locus_tag LOCUS_36310 <1 2169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122595.1:cytochrome c >Feature sequence0857 1961 2509 gene locus_tag LOCUS_36320 1961 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403631.1 protein_id gnl|my_center|LOCUS_36320 >Feature sequence0858 <1 1945 gene locus_tag LOCUS_36330 <1 1945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963704.1:DNA translocase FtsK >Feature sequence0859 290 1855 gene locus_tag LOCUS_36340 gene porX 290 1855 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_36340 2091 2501 gene locus_tag LOCUS_36350 2091 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 >Feature sequence0860 1412 126 gene locus_tag LOCUS_36360 1412 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 <2670 1363 gene locus_tag LOCUS_36370 <2670 1363 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941986.1:cation transporter >Feature sequence0861 1291 2478 gene locus_tag LOCUS_36380 1291 2478 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335856.1 protein_id gnl|my_center|LOCUS_36380 >Feature sequence0862 1088 2410 gene locus_tag LOCUS_36390 gene exuT 1088 2410 CDS product hexuronate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039188.1 protein_id gnl|my_center|LOCUS_36390 >Feature sequence0863 1363 689 gene locus_tag LOCUS_36400 1363 689 CDS product dimethylglycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190407.1 protein_id gnl|my_center|LOCUS_36400 1574 2542 gene locus_tag LOCUS_36410 gene pfkB 1574 2542 CDS product phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MK62 protein_id gnl|my_center|LOCUS_36410 >Feature sequence0864 1444 971 gene locus_tag LOCUS_36420 1444 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332434.1 protein_id gnl|my_center|LOCUS_36420 <2660 1544 gene locus_tag LOCUS_36430 <2660 1544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P39835:high-affinity gluconate transporter >Feature sequence0865 175 363 gene locus_tag LOCUS_36440 175 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 360 710 gene locus_tag LOCUS_36450 360 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706385.1 protein_id gnl|my_center|LOCUS_36450 736 1284 gene locus_tag LOCUS_36460 736 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 2561 1299 gene locus_tag LOCUS_36470 2561 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 >Feature sequence0866 390 160 gene locus_tag LOCUS_36480 390 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 965 429 gene locus_tag LOCUS_36490 965 429 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085781.1 protein_id gnl|my_center|LOCUS_36490 2409 1054 gene locus_tag LOCUS_36500 2409 1054 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_36500 >Feature sequence0867 <1 611 gene locus_tag LOCUS_36510 <1 611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941028.1:membrane protein 809 1330 gene locus_tag LOCUS_36520 gene rpsP 809 1330 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RQ15 protein_id gnl|my_center|LOCUS_36520 1445 2017 gene locus_tag LOCUS_36530 gene rimM 1445 2017 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI5 protein_id gnl|my_center|LOCUS_36530 >Feature sequence0868 2567 1215 gene locus_tag LOCUS_36540 2567 1215 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_36540 >Feature sequence0869 458 577 gene locus_tag LOCUS_36550 458 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 599 1537 gene locus_tag LOCUS_36560 599 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 1822 1682 gene locus_tag LOCUS_36570 1822 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 >Feature sequence0870 1183 635 gene locus_tag LOCUS_36580 1183 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 1958 1212 gene locus_tag LOCUS_36590 1958 1212 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115022.1 protein_id gnl|my_center|LOCUS_36590 >Feature sequence0871 <1 1943 gene locus_tag LOCUS_36600 <1 1943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974050.1:PIG-L domain-containing protein >Feature sequence0872 <1 882 gene locus_tag LOCUS_36610 <1 882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963149.1:peptidase M1 2073 907 gene locus_tag LOCUS_36620 2073 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256669.1 protein_id gnl|my_center|LOCUS_36620 >Feature sequence0873 248 667 gene locus_tag LOCUS_36630 248 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36630 763 1050 gene locus_tag LOCUS_36640 763 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36640 1489 1085 gene locus_tag LOCUS_36650 1489 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 1601 2206 gene locus_tag LOCUS_36660 1601 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 >Feature sequence0874 1477 230 gene locus_tag LOCUS_36670 1477 230 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533560.1 protein_id gnl|my_center|LOCUS_36670 1917 1474 gene locus_tag LOCUS_36680 1917 1474 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765008.1 protein_id gnl|my_center|LOCUS_36680 <2628 2022 gene locus_tag LOCUS_36690 <2628 2022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011204188.1:phenylalanine 4-monooxygenase >Feature sequence0875 <1 553 gene locus_tag LOCUS_36700 <1 553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203241.1:sensor histidine kinase >Feature sequence0876 2425 2303 gene locus_tag LOCUS_36710 2425 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 >Feature sequence0877 1111 113 gene locus_tag LOCUS_36720 1111 113 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764986.1 protein_id gnl|my_center|LOCUS_36720 1848 1162 gene locus_tag LOCUS_36730 1848 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 >Feature sequence0878 582 860 gene locus_tag LOCUS_36740 582 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 1308 1568 gene locus_tag LOCUS_36750 1308 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 <2610 1732 gene locus_tag LOCUS_36760 <2610 1732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003436788.1:nitrilase >Feature sequence0879 2 688 gene locus_tag LOCUS_36770 2 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 890 1807 gene locus_tag LOCUS_36780 890 1807 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404958.1 protein_id gnl|my_center|LOCUS_36780 >Feature sequence0880 220 645 gene locus_tag LOCUS_36790 220 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 1214 1639 gene locus_tag LOCUS_36800 1214 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 1898 2296 gene locus_tag LOCUS_36810 1898 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 >Feature sequence0881 324 1937 gene locus_tag LOCUS_36820 324 1937 CDS product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 protein_id gnl|my_center|LOCUS_36820 >Feature sequence0882 271 1347 gene locus_tag LOCUS_36830 271 1347 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098170.1 protein_id gnl|my_center|LOCUS_36830 1479 2453 gene locus_tag LOCUS_36840 1479 2453 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105383.1 protein_id gnl|my_center|LOCUS_36840 >Feature sequence0883 51 1082 gene locus_tag LOCUS_36850 51 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 >Feature sequence0884 <1 2539 gene locus_tag LOCUS_36860 <1 2539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122121.1:cytochrome c >Feature sequence0885 <1 1692 gene locus_tag LOCUS_36870 <1 1692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963291.1:ATPase 1726 1938 gene locus_tag LOCUS_36880 1726 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 >Feature sequence0886 156 803 gene locus_tag LOCUS_36890 156 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 891 2147 gene locus_tag LOCUS_36900 891 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 >Feature sequence0887 30 114 gene locus_tag LOCUS_t00230 30 114 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 737 177 gene locus_tag LOCUS_36910 737 177 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_36910 857 1681 gene locus_tag LOCUS_36920 gene ybfQ 857 1681 CDS product UPF0176 protein YbfQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31457 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36920 1694 1918 gene locus_tag LOCUS_36930 1694 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 >Feature sequence0888 >Feature sequence0889 1303 350 gene locus_tag LOCUS_36940 gene tktC 1303 350 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_36940 2246 1380 gene locus_tag LOCUS_36950 gene tktA 2246 1380 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 protein_id gnl|my_center|LOCUS_36950 >Feature sequence0890 645 25 gene locus_tag LOCUS_36960 645 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 1047 745 gene locus_tag LOCUS_36970 1047 745 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017079.1 protein_id gnl|my_center|LOCUS_36970 1569 1120 gene locus_tag LOCUS_36980 1569 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 1899 1597 gene locus_tag LOCUS_36990 1899 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 2571 1963 gene locus_tag LOCUS_37000 2571 1963 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X27 protein_id gnl|my_center|LOCUS_37000 >Feature sequence0891 616 104 gene locus_tag LOCUS_37010 616 104 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640076.1 protein_id gnl|my_center|LOCUS_37010 1411 761 gene locus_tag LOCUS_37020 1411 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 1611 2021 gene locus_tag LOCUS_37030 1611 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 2033 2494 gene locus_tag LOCUS_37040 2033 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402968.1 protein_id gnl|my_center|LOCUS_37040 >Feature sequence0892 <1 1989 gene locus_tag LOCUS_37050 <1 1989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031125.1:transcriptional regulator >Feature sequence0893 >Feature sequence0894 1767 925 gene locus_tag LOCUS_37060 1767 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203200.1 protein_id gnl|my_center|LOCUS_37060 <2563 2042 gene locus_tag LOCUS_37070 <2563 2042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206974.1:serine protease >Feature sequence0895 <1 1582 gene locus_tag LOCUS_37080 <1 1582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008759736.1:two-component sensor histidine kinase 1554 2288 gene locus_tag LOCUS_37090 1554 2288 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107418.1 protein_id gnl|my_center|LOCUS_37090 >Feature sequence0896 2517 1651 gene locus_tag LOCUS_37100 2517 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 >Feature sequence0897 2502 1057 gene locus_tag LOCUS_37110 2502 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 >Feature sequence0898 827 537 gene locus_tag LOCUS_37120 827 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 1246 956 gene locus_tag LOCUS_37130 1246 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 1625 1374 gene locus_tag LOCUS_37140 1625 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 >Feature sequence0899 246 2147 gene locus_tag LOCUS_37150 246 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 >Feature sequence0900 3 761 gene locus_tag LOCUS_37160 3 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 >Feature sequence0901 293 949 gene locus_tag LOCUS_37170 293 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 1006 1284 gene locus_tag LOCUS_37180 1006 1284 CDS product protein killer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737444.1 protein_id gnl|my_center|LOCUS_37180 1301 1624 gene locus_tag LOCUS_37190 gene higA 1301 1624 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958263.1 protein_id gnl|my_center|LOCUS_37190 1686 2039 gene locus_tag LOCUS_37200 1686 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 >Feature sequence0902 >Feature sequence0903 <2534 1697 gene locus_tag LOCUS_37210 <2534 1697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389689.1:murein L,D-transpeptidase >Feature sequence0904 722 1552 gene locus_tag LOCUS_37220 gene mtlR 722 1552 CDS product transcriptional regulator MtlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089438.1 protein_id gnl|my_center|LOCUS_37220 >Feature sequence0905 <1 529 gene locus_tag LOCUS_37230 <1 529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405499.1:oxidoreductase 609 1517 gene locus_tag LOCUS_37240 609 1517 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403550.1 protein_id gnl|my_center|LOCUS_37240 1586 2398 gene locus_tag LOCUS_37250 1586 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 >Feature sequence0906 4 504 gene locus_tag LOCUS_37260 4 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 1592 501 gene locus_tag LOCUS_37270 1592 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 >Feature sequence0907 >Feature sequence0908 1187 2173 gene locus_tag LOCUS_37280 1187 2173 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932840.1 protein_id gnl|my_center|LOCUS_37280 >Feature sequence0909 <1 728 gene locus_tag LOCUS_37290 <1 728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q889F7:selenide, water dikinase 839 1612 gene locus_tag LOCUS_37300 839 1612 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964187.1 protein_id gnl|my_center|LOCUS_37300 <2514 1618 gene locus_tag LOCUS_37310 <2514 1618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122408.1:N-acetylgalactosamine-6-sulfatase >Feature sequence0910 1138 1479 gene locus_tag LOCUS_37320 1138 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 <2513 1662 gene locus_tag LOCUS_37330 <2513 1662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012061665.1:xanthine dehydrogenase >Feature sequence0911 306 965 gene locus_tag LOCUS_37340 306 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 >Feature sequence0912 >Feature sequence0913 <2502 1393 gene locus_tag LOCUS_37350 <2502 1393 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970246.1:GlcNAc transferase >Feature sequence0914 465 1487 gene locus_tag LOCUS_37360 465 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 2365 1484 gene locus_tag LOCUS_37370 2365 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 >Feature sequence0915 608 1111 gene locus_tag LOCUS_37380 608 1111 CDS product 5'-3'-deoxyribonucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197262.1 protein_id gnl|my_center|LOCUS_37380 1176 1982 gene locus_tag LOCUS_37390 1176 1982 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962702.1 protein_id gnl|my_center|LOCUS_37390 >Feature sequence0916 >Feature sequence0917 640 1533 gene locus_tag LOCUS_37400 gene dcyD 640 1533 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205909.1 protein_id gnl|my_center|LOCUS_37400 <2489 1595 gene locus_tag LOCUS_37410 <2489 1595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008769206.1:Fe-S cluster assembly protein SufB >Feature sequence0918 290 940 gene locus_tag LOCUS_37420 290 940 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 protein_id gnl|my_center|LOCUS_37420 1009 1275 gene locus_tag LOCUS_37430 1009 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546126.1 protein_id gnl|my_center|LOCUS_37430 1618 1307 gene locus_tag LOCUS_37440 1618 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 >Feature sequence0919 2 925 gene locus_tag LOCUS_37450 2 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 >Feature sequence0920 <1 819 gene locus_tag LOCUS_37460 <1 819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964309.1:NADH-quinone oxidoreductase subunit M 841 2235 gene locus_tag LOCUS_37470 gene nuoN 841 2235 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1Q0 protein_id gnl|my_center|LOCUS_37470 >Feature sequence0921 491 802 gene locus_tag LOCUS_37480 491 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 1780 875 gene locus_tag LOCUS_37490 gene miaA1 1780 875 CDS product tRNA dimethylallyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A018 protein_id gnl|my_center|LOCUS_37490 >Feature sequence0922 1376 369 gene locus_tag LOCUS_37500 1376 369 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_37500 >Feature sequence0923 2014 500 gene locus_tag LOCUS_37510 gene gltD 2014 500 CDS product dihydropyrimidine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513713.1 protein_id gnl|my_center|LOCUS_37510 2469 2107 gene locus_tag LOCUS_37520 2469 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 >Feature sequence0924 <1 539 gene locus_tag LOCUS_37530 <1 539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533356.1:amidohydrolase 692 1726 gene locus_tag LOCUS_37540 692 1726 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658101.1 protein_id gnl|my_center|LOCUS_37540 >Feature sequence0925 <1 557 gene locus_tag LOCUS_37550 <1 557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546302.1:transketolase >Feature sequence0926 395 30 gene locus_tag LOCUS_37560 395 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 656 958 gene locus_tag LOCUS_37570 656 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 1287 2036 gene locus_tag LOCUS_37580 1287 2036 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202693.1 protein_id gnl|my_center|LOCUS_37580 >Feature sequence0927 2138 213 gene locus_tag LOCUS_37590 2138 213 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405126.1 protein_id gnl|my_center|LOCUS_37590 >Feature sequence0928 <1 889 gene locus_tag LOCUS_37600 <1 889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056720.1:hybrid sensor histidine kinase/response regulator >Feature sequence0929 99 2039 gene locus_tag LOCUS_37610 99 2039 CDS product heparinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109364.1 protein_id gnl|my_center|LOCUS_37610 >Feature sequence0930 897 1826 gene locus_tag LOCUS_37620 897 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 >Feature sequence0931 289 1194 gene locus_tag LOCUS_37630 289 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 >Feature sequence0932 3 1553 gene locus_tag LOCUS_37640 3 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 <2447 1648 gene locus_tag LOCUS_37650 <2447 1648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123560.1:hydroxypyruvate isomerase >Feature sequence0933 890 1243 gene locus_tag LOCUS_37660 890 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 1322 1471 gene locus_tag LOCUS_37670 1322 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 >Feature sequence0934 1173 1505 gene locus_tag LOCUS_37680 1173 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 >Feature sequence0935 1485 829 gene locus_tag LOCUS_37690 1485 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888029.1 protein_id gnl|my_center|LOCUS_37690 1609 2193 gene locus_tag LOCUS_37700 gene ribE 1609 2193 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_37700 >Feature sequence0936 >Feature sequence0937 235 759 gene locus_tag LOCUS_37710 235 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 >Feature sequence0938 >Feature sequence0939 129 533 gene locus_tag LOCUS_37720 129 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 1544 594 gene locus_tag LOCUS_37730 1544 594 CDS product beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202700.1 protein_id gnl|my_center|LOCUS_37730 2189 1551 gene locus_tag LOCUS_37740 2189 1551 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022240.1 protein_id gnl|my_center|LOCUS_37740 >Feature sequence0940 >Feature sequence0941 1013 204 gene locus_tag LOCUS_37750 1013 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 1738 1445 gene locus_tag LOCUS_37760 1738 1445 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809266.1 protein_id gnl|my_center|LOCUS_37760 <2432 1836 gene locus_tag LOCUS_37770 <2432 1836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962291.1:membrane protein >Feature sequence0942 >Feature sequence0943 1672 1091 gene locus_tag LOCUS_37780 1672 1091 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A749 protein_id gnl|my_center|LOCUS_37780 1821 2276 gene locus_tag LOCUS_37790 1821 2276 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_37790 >Feature sequence0944 914 2005 gene locus_tag LOCUS_37800 gene lpxK 914 2005 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM3 protein_id gnl|my_center|LOCUS_37800 >Feature sequence0945 1460 1092 gene locus_tag LOCUS_37810 1460 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 1992 1690 gene locus_tag LOCUS_37820 1992 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 protein_id gnl|my_center|LOCUS_37820 >Feature sequence0946 1926 391 gene locus_tag LOCUS_37830 1926 391 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108128.1 protein_id gnl|my_center|LOCUS_37830 >Feature sequence0947 1827 709 gene locus_tag LOCUS_37840 gene nuoG 1827 709 CDS product NADH dehydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964315.1 protein_id gnl|my_center|LOCUS_37840 >Feature sequence0948 154 1080 gene locus_tag LOCUS_37850 154 1080 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107967.1 protein_id gnl|my_center|LOCUS_37850 1161 1829 gene locus_tag LOCUS_37860 1161 1829 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768973.1 protein_id gnl|my_center|LOCUS_37860 1843 2403 gene locus_tag LOCUS_37870 1843 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768972.1 protein_id gnl|my_center|LOCUS_37870 >Feature sequence0949 708 544 gene locus_tag LOCUS_37880 708 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 >Feature sequence0950 2238 1279 gene locus_tag LOCUS_37890 2238 1279 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 protein_id gnl|my_center|LOCUS_37890 >Feature sequence0951 1541 165 gene locus_tag LOCUS_37900 1541 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 >Feature sequence0952 >Feature sequence0953 >Feature sequence0954 <2408 1251 gene locus_tag LOCUS_37910 <2408 1251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223948.1:oxidoreductase >Feature sequence0955 27 647 gene locus_tag LOCUS_37920 27 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 672 1199 gene locus_tag LOCUS_37930 672 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 1393 2379 gene locus_tag LOCUS_37940 1393 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 >Feature sequence0956 <1 698 gene locus_tag LOCUS_37950 <1 698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207014.1:nitrite reductase large subunit 878 1231 gene locus_tag LOCUS_37960 gene nirD 878 1231 CDS product nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707780.1 protein_id gnl|my_center|LOCUS_37960 >Feature sequence0957 1720 875 gene locus_tag LOCUS_37970 1720 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357903.1 protein_id gnl|my_center|LOCUS_37970 >Feature sequence0958 73 1317 gene locus_tag LOCUS_37980 73 1317 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 protein_id gnl|my_center|LOCUS_37980 >Feature sequence0959 2387 1527 gene locus_tag LOCUS_37990 2387 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 >Feature sequence0960 1076 630 gene locus_tag LOCUS_38000 gene aroQ 1076 630 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H157 protein_id gnl|my_center|LOCUS_38000 1150 2046 gene locus_tag LOCUS_38010 gene xerC 1150 2046 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MR6 protein_id gnl|my_center|LOCUS_38010 >Feature sequence0961 98 1462 gene locus_tag LOCUS_38020 gene mdsA 98 1462 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121930.1 protein_id gnl|my_center|LOCUS_38020 >Feature sequence0962 >Feature sequence0963 346 678 gene locus_tag LOCUS_38030 346 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 711 1568 gene locus_tag LOCUS_38040 gene tyrA 711 1568 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864662.1 protein_id gnl|my_center|LOCUS_38040 1702 2280 gene locus_tag LOCUS_38050 1702 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142405.1 protein_id gnl|my_center|LOCUS_38050 >Feature sequence0964 >Feature sequence0965 1435 122 gene locus_tag LOCUS_38060 1435 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 2008 1535 gene locus_tag LOCUS_38070 gene ssb 2008 1535 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4M7 protein_id gnl|my_center|LOCUS_38070 >Feature sequence0966 <1 959 gene locus_tag LOCUS_38080 <1 959 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764762.1:saccharopine dehydrogenase 2078 1194 gene locus_tag LOCUS_38090 2078 1194 CDS product myo-inositol catabolism protein IolH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120390.1 protein_id gnl|my_center|LOCUS_38090 >Feature sequence0967 954 2297 gene locus_tag LOCUS_38100 954 2297 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_38100 >Feature sequence0968 276 1196 gene locus_tag LOCUS_38110 276 1196 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957564.1 protein_id gnl|my_center|LOCUS_38110 1274 1870 gene locus_tag LOCUS_38120 1274 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812610.1 protein_id gnl|my_center|LOCUS_38120 >Feature sequence0969 562 26 gene locus_tag LOCUS_38130 562 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 1694 684 gene locus_tag LOCUS_38140 1694 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 2126 1710 gene locus_tag LOCUS_38150 2126 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 >Feature sequence0970 164 586 gene locus_tag LOCUS_38160 164 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 >Feature sequence0971 <2353 611 gene locus_tag LOCUS_38170 <2353 611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024484.1:tetratricopeptide repeat protein >Feature sequence0972 <1 516 gene locus_tag LOCUS_38180 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109116.1:glycoside hydrolase 575 1591 gene locus_tag LOCUS_38190 575 1591 CDS product pectinesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0B2 protein_id gnl|my_center|LOCUS_38190 2161 1763 gene locus_tag LOCUS_38200 2161 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 >Feature sequence0973 2004 613 gene locus_tag LOCUS_38210 gene fabZ 2004 613 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY98 protein_id gnl|my_center|LOCUS_38210 >Feature sequence0974 <1 2118 gene locus_tag LOCUS_38220 <1 2118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008658407.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence0975 <1 747 gene locus_tag LOCUS_38230 <1 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940937.1:Bcr/CflA family drug resistance efflux transporter 848 1177 gene locus_tag LOCUS_38240 gene yqjZ 848 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54563 protein_id gnl|my_center|LOCUS_38240 1239 1751 gene locus_tag LOCUS_38250 1239 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 1903 2148 gene locus_tag LOCUS_38260 1903 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 >Feature sequence0976 111 1370 gene locus_tag LOCUS_38270 gene hfsI 111 1370 CDS product ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918387.1 protein_id gnl|my_center|LOCUS_38270 >Feature sequence0977 635 880 gene locus_tag LOCUS_38280 635 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 <2342 887 gene locus_tag LOCUS_38290 <2342 887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143425.1:oxidoreductase >Feature sequence0978 2003 1002 gene locus_tag LOCUS_38300 2003 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 >Feature sequence0979 474 1142 gene locus_tag LOCUS_38310 474 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 >Feature sequence0980 392 670 gene locus_tag LOCUS_38320 392 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 1900 1256 gene locus_tag LOCUS_38330 1900 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 >Feature sequence0981 1009 584 gene locus_tag LOCUS_38340 1009 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 <2323 1109 gene locus_tag LOCUS_38350 <2323 1109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005463605.1:molybdopterin containing oxidoreductase >Feature sequence0982 761 1147 gene locus_tag LOCUS_38360 761 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088521.1 protein_id gnl|my_center|LOCUS_38360 1229 1543 gene locus_tag LOCUS_38370 1229 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035654.1 protein_id gnl|my_center|LOCUS_38370 <2322 1668 gene locus_tag LOCUS_38380 <2322 1668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919507.1:GMC family oxidoreductase >Feature sequence0983 <1 1420 gene locus_tag LOCUS_38390 <1 1420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64UE7:DNA helicase >Feature sequence0984 <1 599 gene locus_tag LOCUS_38400 <1 599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121652.1:cytochrome c 669 1775 gene locus_tag LOCUS_38410 669 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 >Feature sequence0985 <1 1174 gene locus_tag LOCUS_38420 <1 1174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011731063.1:glucarate dehydratase 1344 2123 gene locus_tag LOCUS_38430 1344 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38430 >Feature sequence0986 >Feature sequence0987 329 871 gene locus_tag LOCUS_38440 329 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 873 1040 gene locus_tag LOCUS_38450 873 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 1142 1264 gene locus_tag LOCUS_38460 1142 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 1261 2178 gene locus_tag LOCUS_38470 1261 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 >Feature sequence0988 540 325 gene locus_tag LOCUS_38480 540 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 >Feature sequence0989 842 234 gene locus_tag LOCUS_38490 842 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 1351 857 gene locus_tag LOCUS_38500 gene rfaY 1351 857 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037773.1 protein_id gnl|my_center|LOCUS_38500 2022 2180 gene locus_tag LOCUS_38510 2022 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 >Feature sequence0990 851 501 gene locus_tag LOCUS_38520 gene ywzG 851 501 CDS product putative DNA-binding protein YwzG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C0H3S6 protein_id gnl|my_center|LOCUS_38520 2013 970 gene locus_tag LOCUS_38530 2013 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 >Feature sequence0991 973 1503 gene locus_tag LOCUS_38540 973 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 <2290 1667 gene locus_tag LOCUS_38550 <2290 1667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886881.1:6-aminohexanoate-cyclic-dimer hydrolase >Feature sequence0992 1039 2 gene locus_tag LOCUS_38560 gene xsa 1039 2 CDS product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039191.1 protein_id gnl|my_center|LOCUS_38560 <2289 1196 gene locus_tag LOCUS_38570 <2289 1196 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803903.1:penicillin-binding protein >Feature sequence0993 592 1914 gene locus_tag LOCUS_38580 592 1914 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786418.1 protein_id gnl|my_center|LOCUS_38580 >Feature sequence0994 31 1410 gene locus_tag LOCUS_38590 31 1410 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764149.1 protein_id gnl|my_center|LOCUS_38590 1939 1400 gene locus_tag LOCUS_38600 1939 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704338.1 protein_id gnl|my_center|LOCUS_38600 >Feature sequence0995 1009 2238 gene locus_tag LOCUS_38610 1009 2238 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119680.1 protein_id gnl|my_center|LOCUS_38610 >Feature sequence0996 546 1343 gene locus_tag LOCUS_38620 546 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794237.1 protein_id gnl|my_center|LOCUS_38620 1321 1704 gene locus_tag LOCUS_38630 1321 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760453.1 protein_id gnl|my_center|LOCUS_38630 >Feature sequence0997 903 355 gene locus_tag LOCUS_38640 903 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 >Feature sequence0998 >Feature sequence0999 1925 21 gene locus_tag LOCUS_38650 1925 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 >Feature sequence1000 497 1594 gene locus_tag LOCUS_38660 497 1594 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957826.1 protein_id gnl|my_center|LOCUS_38660 >Feature sequence1001 556 2118 gene locus_tag LOCUS_38670 556 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 >Feature sequence1002 886 509 gene locus_tag LOCUS_38680 886 509 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462150.1 protein_id gnl|my_center|LOCUS_38680 <2270 924 gene locus_tag LOCUS_38690 <2270 924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962917.1:beta-N-acetylglucosaminidase >Feature sequence1003 1185 436 gene locus_tag LOCUS_38700 1185 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 <2270 1198 gene locus_tag LOCUS_38710 <2270 1198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986979.1:UDP-galactopyranose mutase >Feature sequence1004 955 2178 gene locus_tag LOCUS_38720 955 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119919.1 protein_id gnl|my_center|LOCUS_38720 >Feature sequence1005 1548 394 gene locus_tag LOCUS_38730 gene leuA 1548 394 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QP0 protein_id gnl|my_center|LOCUS_38730 2066 1884 gene locus_tag LOCUS_38740 2066 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 >Feature sequence1006 1349 219 gene locus_tag LOCUS_38750 1349 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 1858 1367 gene locus_tag LOCUS_38760 gene ispF 1858 1367 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0Y7 protein_id gnl|my_center|LOCUS_38760 >Feature sequence1007 <1 690 gene locus_tag LOCUS_38770 <1 690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000557282.1:membrane protein 1243 773 gene locus_tag LOCUS_38780 1243 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 2047 1487 gene locus_tag LOCUS_38790 gene pth 2047 1487 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X30 protein_id gnl|my_center|LOCUS_38790 >Feature sequence1008 1132 224 gene locus_tag LOCUS_38800 1132 224 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705611.1 protein_id gnl|my_center|LOCUS_38800 1457 2047 gene locus_tag LOCUS_38810 1457 2047 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785889.1 protein_id gnl|my_center|LOCUS_38810 >Feature sequence1009 387 1874 gene locus_tag LOCUS_38820 387 1874 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263383.1 protein_id gnl|my_center|LOCUS_38820 >Feature sequence1010 <2238 136 gene locus_tag LOCUS_38830 <2238 136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972100.1:methionine synthase >Feature sequence1011 <2233 1054 gene locus_tag LOCUS_38840 <2233 1054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KAR6:alpha-1,4-glucan:maltose-1-phosphate maltosyltransferase >Feature sequence1012 >Feature sequence1013 832 1938 gene locus_tag LOCUS_38850 832 1938 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887461.1 protein_id gnl|my_center|LOCUS_38850 >Feature sequence1014 83 1270 gene locus_tag LOCUS_38860 83 1270 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794276.1 protein_id gnl|my_center|LOCUS_38860 1542 1877 gene locus_tag LOCUS_38870 1542 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 >Feature sequence1015 444 1328 gene locus_tag LOCUS_38880 gene rsmH 444 1328 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A2 protein_id gnl|my_center|LOCUS_38880 1526 1936 gene locus_tag LOCUS_38890 1526 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 >Feature sequence1016 1814 336 gene locus_tag LOCUS_38900 1814 336 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_38900 >Feature sequence1017 >Feature sequence1018 <1 503 gene locus_tag LOCUS_38910 <1 503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072433.1:MFS transporter >Feature sequence1019 1436 195 gene locus_tag LOCUS_38920 gene nusA 1436 195 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV7 protein_id gnl|my_center|LOCUS_38920 2006 1530 gene locus_tag LOCUS_38930 2006 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 >Feature sequence1020 585 1847 gene locus_tag LOCUS_38940 585 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949085.1 protein_id gnl|my_center|LOCUS_38940 >Feature sequence1021 73 1095 gene locus_tag LOCUS_38950 73 1095 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888264.1 protein_id gnl|my_center|LOCUS_38950 >Feature sequence1022 58 903 gene locus_tag LOCUS_38960 gene lgt 58 903 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3W5 protein_id gnl|my_center|LOCUS_38960 1027 1629 gene locus_tag LOCUS_38970 1027 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 <2203 1703 gene locus_tag LOCUS_38980 <2203 1703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096549.1:aminoimidazole riboside kinase >Feature sequence1023 <1 1647 gene locus_tag LOCUS_38990 <1 1647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142438.1:L-sorbosone dehydrogenase >Feature sequence1024 <2200 1059 gene locus_tag LOCUS_39000 <2200 1059 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64P23:pseudouridine synthase >Feature sequence1025 >Feature sequence1026 <1 662 gene locus_tag LOCUS_39010 <1 662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763423.1:DNA-binding response regulator 1618 959 gene locus_tag LOCUS_39020 1618 959 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056165.1 protein_id gnl|my_center|LOCUS_39020 >Feature sequence1027 181 1182 gene locus_tag LOCUS_39030 181 1182 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109244.1 protein_id gnl|my_center|LOCUS_39030 >Feature sequence1028 568 2139 gene locus_tag LOCUS_39040 568 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083167.1 protein_id gnl|my_center|LOCUS_39040 >Feature sequence1029 941 1324 gene locus_tag LOCUS_39050 941 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 1798 1385 gene locus_tag LOCUS_39060 1798 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 >Feature sequence1030 1608 586 gene locus_tag LOCUS_39070 1608 586 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865054.1 protein_id gnl|my_center|LOCUS_39070 <2190 1666 gene locus_tag LOCUS_39080 <2190 1666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098254.1:sugar ABC transporter permease >Feature sequence1031 <1 773 gene locus_tag LOCUS_39090 <1 773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764318.1:9-O-acetylesterase 1818 847 gene locus_tag LOCUS_39100 1818 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 >Feature sequence1032 >Feature sequence1033 <1 1064 gene locus_tag LOCUS_39110 <1 1064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121854.1:sulfatase <2186 1120 gene locus_tag LOCUS_39120 <2186 1120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118166.1:imidazolonepropionase >Feature sequence1034 1492 584 gene locus_tag LOCUS_39130 1492 584 CDS product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259145.1 protein_id gnl|my_center|LOCUS_39130 <2185 1631 gene locus_tag LOCUS_39140 <2185 1631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933791.1:glycosyl hydrolase >Feature sequence1035 2183 1212 gene locus_tag LOCUS_39150 2183 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 >Feature sequence1036 1193 540 gene locus_tag LOCUS_39160 1193 540 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338042.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39160 1400 1203 gene locus_tag LOCUS_39170 1400 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 <2183 1432 gene locus_tag LOCUS_39180 <2183 1432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584118.1:oxidoreductase >Feature sequence1037 2 745 gene locus_tag LOCUS_39190 2 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 751 1224 gene locus_tag LOCUS_39200 751 1224 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258478.1 protein_id gnl|my_center|LOCUS_39200 2180 1356 gene locus_tag LOCUS_39210 2180 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 >Feature sequence1038 1002 415 gene locus_tag LOCUS_39220 gene hisH 1002 415 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z4 protein_id gnl|my_center|LOCUS_39220 >Feature sequence1039 393 28 gene locus_tag LOCUS_39230 393 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 1170 1667 gene locus_tag LOCUS_39240 gene dfrA 1170 1667 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HJC6 protein_id gnl|my_center|LOCUS_39240 >Feature sequence1040 <1 1028 gene locus_tag LOCUS_39250 <1 1028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404400.1:amidase >Feature sequence1041 365 1663 gene locus_tag LOCUS_39260 365 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 >Feature sequence1042 287 150 gene locus_tag LOCUS_39270 287 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 897 358 gene locus_tag LOCUS_39280 897 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 >Feature sequence1043 1549 1950 gene locus_tag LOCUS_39290 1549 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39290 >Feature sequence1044 >Feature sequence1045 <1 1818 gene locus_tag LOCUS_39300 <1 1818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766148.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence1046 641 925 gene locus_tag LOCUS_39310 641 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887568.1 protein_id gnl|my_center|LOCUS_39310 >Feature sequence1047 297 1223 gene locus_tag LOCUS_39320 297 1223 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962832.1 protein_id gnl|my_center|LOCUS_39320 >Feature sequence1048 808 425 gene locus_tag LOCUS_39330 808 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 879 1766 gene locus_tag LOCUS_39340 879 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405285.1 protein_id gnl|my_center|LOCUS_39340 >Feature sequence1049 1020 268 gene locus_tag LOCUS_39350 1020 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 1962 1078 gene locus_tag LOCUS_39360 1962 1078 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058149.1 protein_id gnl|my_center|LOCUS_39360 >Feature sequence1050 142 1935 gene locus_tag LOCUS_39370 142 1935 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203676.1 protein_id gnl|my_center|LOCUS_39370 >Feature sequence1051 1354 1124 gene locus_tag LOCUS_39380 1354 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 2065 1436 gene locus_tag LOCUS_39390 2065 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 >Feature sequence1052 463 657 gene locus_tag LOCUS_39400 463 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 691 885 gene locus_tag LOCUS_39410 691 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 882 1226 gene locus_tag LOCUS_39420 882 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 1231 1572 gene locus_tag LOCUS_39430 1231 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 >Feature sequence1053 308 1618 gene locus_tag LOCUS_39440 308 1618 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189169.1 protein_id gnl|my_center|LOCUS_39440 >Feature sequence1054 >Feature sequence1055 7 312 gene locus_tag LOCUS_39450 7 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 422 985 gene locus_tag LOCUS_39460 422 985 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU8 protein_id gnl|my_center|LOCUS_39460 1012 1479 gene locus_tag LOCUS_39470 1012 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 >Feature sequence1056 310 35 gene locus_tag LOCUS_39480 310 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 484 957 gene locus_tag LOCUS_39490 484 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043223.1 protein_id gnl|my_center|LOCUS_39490 >Feature sequence1057 >Feature sequence1058 2045 1536 gene locus_tag LOCUS_39500 gene defA 2045 1536 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I068 protein_id gnl|my_center|LOCUS_39500 >Feature sequence1059 <1 1029 gene locus_tag LOCUS_39510 <1 1029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64YZ6:acetylornithine aminotransferase 1106 2077 gene locus_tag LOCUS_39520 gene argF' 1106 2077 CDS product N-acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1E9 protein_id gnl|my_center|LOCUS_39520 >Feature sequence1060 <1 945 gene locus_tag LOCUS_39530 <1 945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117861.1:xanthan lyase 1552 977 gene locus_tag LOCUS_39540 1552 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44014 protein_id gnl|my_center|LOCUS_39540 >Feature sequence1061 >Feature sequence1062 3 1742 gene locus_tag LOCUS_39550 3 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118540.1 protein_id gnl|my_center|LOCUS_39550 >Feature sequence1063 <2102 612 gene locus_tag LOCUS_39560 <2102 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405543.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence1064 1073 246 gene locus_tag LOCUS_39570 1073 246 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067370.1 protein_id gnl|my_center|LOCUS_39570 <2101 1154 gene locus_tag LOCUS_39580 <2101 1154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012067533.1:oxidoreductase >Feature sequence1065 60 1139 gene locus_tag LOCUS_39590 60 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 1142 1873 gene locus_tag LOCUS_39600 1142 1873 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_39600 >Feature sequence1066 890 962 gene locus_tag LOCUS_t00240 890 962 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1383 1135 gene locus_tag LOCUS_39610 1383 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 >Feature sequence1067 157 1461 gene locus_tag LOCUS_39620 157 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 >Feature sequence1068 1431 835 gene locus_tag LOCUS_39630 1431 835 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789845.1 protein_id gnl|my_center|LOCUS_39630 1865 1479 gene locus_tag LOCUS_39640 1865 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962310.1 protein_id gnl|my_center|LOCUS_39640 >Feature sequence1069 1666 1319 gene locus_tag LOCUS_39650 gene fdx1 1666 1319 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_39650 >Feature sequence1070 <2086 330 gene locus_tag LOCUS_39660 <2086 330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0Y2:Fused isobutyryl-CoA mutase >Feature sequence1071 >Feature sequence1072 1045 566 gene locus_tag LOCUS_39670 1045 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 1223 1026 gene locus_tag LOCUS_39680 1223 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 1868 1290 gene locus_tag LOCUS_39690 1868 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 >Feature sequence1073 1200 853 gene locus_tag LOCUS_39700 1200 853 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJ43 protein_id gnl|my_center|LOCUS_39700 2081 1287 gene locus_tag LOCUS_39710 2081 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 >Feature sequence1074 <1 1139 gene locus_tag LOCUS_39720 <1 1139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120368.1:N-acetylgalactosamine-6-sulfatase 1606 1938 gene locus_tag LOCUS_39730 1606 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 >Feature sequence1075 >Feature sequence1076 >Feature sequence1077 3 1076 gene locus_tag LOCUS_39740 3 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 <2080 1059 gene locus_tag LOCUS_39750 <2080 1059 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942951.1:histidine kinase >Feature sequence1078 607 1509 gene locus_tag LOCUS_39760 607 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 >Feature sequence1079 <1 1096 gene locus_tag LOCUS_39770 <1 1096 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962917.1:beta-N-acetylglucosaminidase >Feature sequence1080 <2072 762 gene locus_tag LOCUS_39780 <2072 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964486.1:peptidase M1 >Feature sequence1081 <1 1121 gene locus_tag LOCUS_39790 <1 1121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein >Feature sequence1082 803 642 gene locus_tag LOCUS_39800 803 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 1253 816 gene locus_tag LOCUS_39810 1253 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 <2067 1327 gene locus_tag LOCUS_39820 <2067 1327 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZE4:dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex >Feature sequence1083 <1 1776 gene locus_tag LOCUS_39830 <1 1776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118043.1:cytochrome c >Feature sequence1084 507 1139 gene locus_tag LOCUS_39840 507 1139 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296462.1 protein_id gnl|my_center|LOCUS_39840 >Feature sequence1085 199 822 gene locus_tag LOCUS_39850 199 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39850 1244 870 gene locus_tag LOCUS_39860 1244 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 >Feature sequence1086 484 1683 gene locus_tag LOCUS_39870 484 1683 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800756.1 protein_id gnl|my_center|LOCUS_39870 >Feature sequence1087 >Feature sequence1088 >Feature sequence1089 412 1851 gene locus_tag LOCUS_39880 412 1851 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940696.1 protein_id gnl|my_center|LOCUS_39880 >Feature sequence1090 <1 1340 gene locus_tag LOCUS_39890 <1 1340 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963294.1:bifunctional cbb3-type cytochrome C oxidase subunit I/II >Feature sequence1091 <1 809 gene locus_tag LOCUS_39900 <1 809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258464.1:alkaline phosphatase >Feature sequence1092 >Feature sequence1093 <2045 452 gene locus_tag LOCUS_39910 <2045 452 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257750.1:succinate dehydrogenase flavoprotein subunit >Feature sequence1094 <1 597 gene locus_tag LOCUS_39920 <1 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765651.1:carbohydrate kinase 1358 768 gene locus_tag LOCUS_39930 1358 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 >Feature sequence1095 >Feature sequence1096 175 327 gene locus_tag LOCUS_39940 175 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 861 1958 gene locus_tag LOCUS_39950 861 1958 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957826.1 protein_id gnl|my_center|LOCUS_39950 >Feature sequence1097 538 1476 gene locus_tag LOCUS_39960 538 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39960 >Feature sequence1098 426 199 gene locus_tag LOCUS_39970 426 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583957.1 protein_id gnl|my_center|LOCUS_39970 1577 453 gene locus_tag LOCUS_39980 1577 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 >Feature sequence1099 <1 1132 gene locus_tag LOCUS_39990 <1 1132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123507.1:protein-xanthan lyase >Feature sequence1100 >Feature sequence1101 888 1295 gene locus_tag LOCUS_40000 888 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001971579.1 protein_id gnl|my_center|LOCUS_40000 >Feature sequence1102 134 1975 gene locus_tag LOCUS_40010 134 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 >Feature sequence1103 516 184 gene locus_tag LOCUS_40020 516 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 1571 576 gene locus_tag LOCUS_40030 1571 576 CDS product CRISPR-associated protein Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879371.1 protein_id gnl|my_center|LOCUS_40030 >Feature sequence1104 1725 700 gene locus_tag LOCUS_40040 1725 700 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120389.1 protein_id gnl|my_center|LOCUS_40040 >Feature sequence1105 <1 1548 gene locus_tag LOCUS_40050 <1 1548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108607.1:hybrid sensor histidine kinase/response regulator >Feature sequence1106 >Feature sequence1107 949 410 gene locus_tag LOCUS_40060 949 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40060 >Feature sequence1108 <1 1047 gene locus_tag LOCUS_40070 <1 1047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107802.1:ABC transporter permease >Feature sequence1109 >Feature sequence1110 >Feature sequence1111 67 774 gene locus_tag LOCUS_40080 67 774 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531660.1 protein_id gnl|my_center|LOCUS_40080 >Feature sequence1112 1 786 gene locus_tag LOCUS_40090 1 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40090 846 1043 gene locus_tag LOCUS_40100 846 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 1242 1853 gene locus_tag LOCUS_40110 gene ppa 1242 1853 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B0B8Z8 protein_id gnl|my_center|LOCUS_40110 >Feature sequence1113 1502 756 gene locus_tag LOCUS_40120 gene nagB 1502 756 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_864370.2 protein_id gnl|my_center|LOCUS_40120 >Feature sequence1114 314 1645 gene locus_tag LOCUS_40130 gene eutP 314 1645 CDS product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037403.1 protein_id gnl|my_center|LOCUS_40130 >Feature sequence1115 541 1971 gene locus_tag LOCUS_40140 541 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 >Feature sequence1116 352 1116 gene locus_tag LOCUS_40150 352 1116 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257442.1 protein_id gnl|my_center|LOCUS_40150 <1993 1200 gene locus_tag LOCUS_40160 <1993 1200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122554.1:NADH-dependent dehydrogenase >Feature sequence1117 921 580 gene locus_tag LOCUS_40170 921 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 >Feature sequence1118 >Feature sequence1119 <1 1379 gene locus_tag LOCUS_40180 <1 1379 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122060.1:cytochrome c >Feature sequence1120 703 56 gene locus_tag LOCUS_40190 703 56 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 protein_id gnl|my_center|LOCUS_40190 1424 939 gene locus_tag LOCUS_40200 1424 939 CDS product cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931903.1 protein_id gnl|my_center|LOCUS_40200 >Feature sequence1121 1980 1552 gene locus_tag LOCUS_40210 1980 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 >Feature sequence1122 1049 543 gene locus_tag LOCUS_40220 1049 543 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A668 protein_id gnl|my_center|LOCUS_40220 >Feature sequence1123 >Feature sequence1124 >Feature sequence1125 769 1374 gene locus_tag LOCUS_40230 769 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 1391 1813 gene locus_tag LOCUS_40240 1391 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 >Feature sequence1126 >Feature sequence1127 >Feature sequence1128 118 912 gene locus_tag LOCUS_40250 118 912 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775476.1 protein_id gnl|my_center|LOCUS_40250 909 1580 gene locus_tag LOCUS_40260 909 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 >Feature sequence1129 <1 653 gene locus_tag LOCUS_40270 <1 653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203185.1:serum resistance protein BrkB 840 1202 gene locus_tag LOCUS_40280 840 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 >Feature sequence1130 664 59 gene locus_tag LOCUS_40290 664 59 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL51 protein_id gnl|my_center|LOCUS_40290 1542 766 gene locus_tag LOCUS_40300 1542 766 CDS product exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765510.1 protein_id gnl|my_center|LOCUS_40300 >Feature sequence1131 84 353 gene locus_tag LOCUS_40310 84 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 1266 655 gene locus_tag LOCUS_40320 1266 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 1949 1719 gene locus_tag LOCUS_40330 1949 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 >Feature sequence1132 871 635 gene locus_tag LOCUS_40340 871 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 >Feature sequence1133 >Feature sequence1134 1696 143 gene locus_tag LOCUS_40350 1696 143 CDS product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_40350 >Feature sequence1135 >Feature sequence1136 >Feature sequence1137 <1 734 gene locus_tag LOCUS_40360 <1 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123560.1:hydroxypyruvate isomerase 1074 745 gene locus_tag LOCUS_40370 1074 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 1289 1071 gene locus_tag LOCUS_40380 1289 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 >Feature sequence1138 >Feature sequence1139 451 1665 gene locus_tag LOCUS_40390 451 1665 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963747.1 protein_id gnl|my_center|LOCUS_40390 >Feature sequence1140 888 226 gene locus_tag LOCUS_40400 888 226 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786661.1 protein_id gnl|my_center|LOCUS_40400 >Feature sequence1141 >Feature sequence1142 >Feature sequence1143 >Feature sequence1144 272 1060 gene locus_tag LOCUS_40410 gene hisF 272 1060 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY75 protein_id gnl|my_center|LOCUS_40410 1100 1699 gene locus_tag LOCUS_40420 gene hisIE 1100 1699 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY74 protein_id gnl|my_center|LOCUS_40420 >Feature sequence1145 892 227 gene locus_tag LOCUS_40430 892 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 1062 1529 gene locus_tag LOCUS_40440 gene nuoA 1062 1529 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEC3 protein_id gnl|my_center|LOCUS_40440 >Feature sequence1146 >Feature sequence1147 <1918 963 gene locus_tag LOCUS_40450 <1918 963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121383.1:membrane protein containing membrane-bound dehydrogenase >Feature sequence1148 <1 1201 gene locus_tag LOCUS_40460 <1 1201 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A451:primosomal protein N' >Feature sequence1149 >Feature sequence1150 1004 1372 gene locus_tag LOCUS_40470 1004 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 >Feature sequence1151 631 789 gene locus_tag LOCUS_40480 631 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 >Feature sequence1152 >Feature sequence1153 1635 217 gene locus_tag LOCUS_40490 1635 217 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964010.1 protein_id gnl|my_center|LOCUS_40490 >Feature sequence1154 >Feature sequence1155 120 1007 gene locus_tag LOCUS_40500 120 1007 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602530.1 protein_id gnl|my_center|LOCUS_40500 >Feature sequence1156 <1 590 gene locus_tag LOCUS_40510 <1 590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012255955.1:glutathione synthase 609 1715 gene locus_tag LOCUS_40520 609 1715 CDS product putative glutamate--cysteine ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAH5 protein_id gnl|my_center|LOCUS_40520 >Feature sequence1157 >Feature sequence1158 >Feature sequence1159 749 291 gene locus_tag LOCUS_40530 749 291 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963844.1 protein_id gnl|my_center|LOCUS_40530 >Feature sequence1160 649 1572 gene locus_tag LOCUS_40540 649 1572 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888525.1 protein_id gnl|my_center|LOCUS_40540 >Feature sequence1161 1443 793 gene locus_tag LOCUS_40550 gene trpF 1443 793 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ2 protein_id gnl|my_center|LOCUS_40550 >Feature sequence1162 89 214 gene locus_tag LOCUS_40560 89 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 653 246 gene locus_tag LOCUS_40570 653 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 928 659 gene locus_tag LOCUS_40580 928 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 <1879 943 gene locus_tag LOCUS_40590 <1879 943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404668.1:D-aminopeptidase >Feature sequence1163 802 515 gene locus_tag LOCUS_40600 gene rplT 802 515 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY19 protein_id gnl|my_center|LOCUS_40600 1158 961 gene locus_tag LOCUS_40610 gene rpmI 1158 961 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAP0 protein_id gnl|my_center|LOCUS_40610 1752 1288 gene locus_tag LOCUS_40620 1752 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 >Feature sequence1164 341 72 gene locus_tag LOCUS_40630 341 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 358 579 gene locus_tag LOCUS_40640 358 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40640 792 1349 gene locus_tag LOCUS_40650 792 1349 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_40650 >Feature sequence1165 <1 1192 gene locus_tag LOCUS_40660 <1 1192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141168.1:glucosidase >Feature sequence1166 1063 266 gene locus_tag LOCUS_40670 1063 266 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970670.1 protein_id gnl|my_center|LOCUS_40670 >Feature sequence1167 920 141 gene locus_tag LOCUS_40680 gene paaG 920 141 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206400.1 protein_id gnl|my_center|LOCUS_40680 1605 967 gene locus_tag LOCUS_40690 1605 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 >Feature sequence1168 >Feature sequence1169 2 1663 gene locus_tag LOCUS_40700 2 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 >Feature sequence1170 1291 716 gene locus_tag LOCUS_40710 1291 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 >Feature sequence1171 166 1218 gene locus_tag LOCUS_40720 gene metX 166 1218 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KES7 protein_id gnl|my_center|LOCUS_40720 <1865 1339 gene locus_tag LOCUS_40730 <1865 1339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943387.1:potassium transporter >Feature sequence1172 <1 725 gene locus_tag LOCUS_40740 <1 725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118275.1:peptidase S9 <1865 781 gene locus_tag LOCUS_40750 <1865 781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64Y26:cellobiose 2-epimerase >Feature sequence1173 <1 1122 gene locus_tag LOCUS_40760 <1 1122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405543.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence1174 129 416 gene locus_tag LOCUS_40770 129 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 >Feature sequence1175 >Feature sequence1176 >Feature sequence1177 <1858 1097 gene locus_tag LOCUS_40780 <1858 1097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404904.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence1178 >Feature sequence1179 38 781 gene locus_tag LOCUS_40790 38 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 >Feature sequence1180 349 1734 gene locus_tag LOCUS_40800 349 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 >Feature sequence1181 <1852 48 gene locus_tag LOCUS_40810 <1852 48 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109364.1:heparinase >Feature sequence1182 1467 481 gene locus_tag LOCUS_40820 1467 481 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118345.1 protein_id gnl|my_center|LOCUS_40820 >Feature sequence1183 <1 1470 gene locus_tag LOCUS_40830 <1 1470 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962492.1:cell envelope biogenesis protein OmpA >Feature sequence1184 <1 573 gene locus_tag LOCUS_40840 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8AA41:4-diphosphocytidyl-2-C-methyl-D-erythritol kinase 657 1274 gene locus_tag LOCUS_40850 657 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40850 <1847 1283 gene locus_tag LOCUS_40860 <1847 1283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000509587.1:tetracycline resistance MFS efflux pump >Feature sequence1185 >Feature sequence1186 >Feature sequence1187 >Feature sequence1188 30 890 gene locus_tag LOCUS_40870 30 890 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ30 protein_id gnl|my_center|LOCUS_40870 >Feature sequence1189 >Feature sequence1190 <1 1252 gene locus_tag LOCUS_40880 <1 1252 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202602.1:RNA-binding protein <1829 1297 gene locus_tag LOCUS_40890 <1829 1297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972239.1:RNA helicase >Feature sequence1191 327 839 gene locus_tag LOCUS_40900 327 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40900 942 1130 gene locus_tag LOCUS_40910 942 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 1266 1637 gene locus_tag LOCUS_40920 1266 1637 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_40920 >Feature sequence1192 <1827 116 gene locus_tag LOCUS_40930 <1827 116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64TX8:Lon protease >Feature sequence1193 >Feature sequence1194 >Feature sequence1195 655 1221 gene locus_tag LOCUS_40940 655 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40940 >Feature sequence1196 1689 205 gene locus_tag LOCUS_40950 gene glpK2 1689 205 CDS product glycerol kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1E4 protein_id gnl|my_center|LOCUS_40950 >Feature sequence1197 <1 886 gene locus_tag LOCUS_40960 <1 886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119292.1:oxidoreductase >Feature sequence1198 <1 808 gene locus_tag LOCUS_40970 <1 808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765466.1:signal peptide peptidase SppA <1816 887 gene locus_tag LOCUS_40980 <1816 887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A5HZD9:nucleoside permease >Feature sequence1199 >Feature sequence1200 415 684 gene locus_tag LOCUS_40990 415 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 978 1343 gene locus_tag LOCUS_41000 978 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258318.1 protein_id gnl|my_center|LOCUS_41000 >Feature sequence1201 638 1360 gene locus_tag LOCUS_41010 638 1360 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963342.1 protein_id gnl|my_center|LOCUS_41010 >Feature sequence1202 934 356 gene locus_tag LOCUS_41020 934 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764615.1 protein_id gnl|my_center|LOCUS_41020 1804 1073 gene locus_tag LOCUS_41030 1804 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 >Feature sequence1203 >Feature sequence1204 1054 176 gene locus_tag LOCUS_41040 1054 176 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 protein_id gnl|my_center|LOCUS_41040 >Feature sequence1205 279 1169 gene locus_tag LOCUS_41050 gene ykuF 279 1169 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963270.1 protein_id gnl|my_center|LOCUS_41050 >Feature sequence1206 <1 1018 gene locus_tag LOCUS_41060 <1 1018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122518.1:sulfatase >Feature sequence1207 1369 605 gene locus_tag LOCUS_41070 1369 605 CDS product polyprenol phosphate mannosyl transferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122067.1 protein_id gnl|my_center|LOCUS_41070 >Feature sequence1208 123 815 gene locus_tag LOCUS_41080 gene cobB 123 815 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MN7 protein_id gnl|my_center|LOCUS_41080 819 1634 gene locus_tag LOCUS_41090 gene yvgN 819 1634 CDS product glyoxal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32210 protein_id gnl|my_center|LOCUS_41090 >Feature sequence1209 <1 688 gene locus_tag LOCUS_41100 <1 688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_444230.2:mercuric reductase <1785 693 gene locus_tag LOCUS_41110 <1785 693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963842.1:amino acid permease >Feature sequence1210 1196 480 gene locus_tag LOCUS_41120 1196 480 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZP8 protein_id gnl|my_center|LOCUS_41120 >Feature sequence1211 1 768 gene locus_tag LOCUS_41130 gene thiG 1 768 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS0 protein_id gnl|my_center|LOCUS_41130 >Feature sequence1212 81 1196 gene locus_tag LOCUS_41140 81 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 >Feature sequence1213 <1 1219 gene locus_tag LOCUS_41150 <1 1219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121181.1:L-sorbosone dehydrogenase >Feature sequence1214 <1 517 gene locus_tag LOCUS_41160 <1 517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H1Q6:NADH-quinone oxidoreductase subunit H 533 1126 gene locus_tag LOCUS_41170 gene nuoI 533 1126 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1Q5 protein_id gnl|my_center|LOCUS_41170 1184 1702 gene locus_tag LOCUS_41180 gene nuoJ 1184 1702 CDS product NADH dehydrogenase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964312.1 protein_id gnl|my_center|LOCUS_41180 >Feature sequence1215 >Feature sequence1216 688 1035 gene locus_tag LOCUS_41190 688 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 >Feature sequence1217 >Feature sequence1218 889 419 gene locus_tag LOCUS_41200 889 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41200 <1776 951 gene locus_tag LOCUS_41210 <1776 951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121095.1:choline-sulfatase >Feature sequence1219 1709 690 gene locus_tag LOCUS_41220 1709 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 >Feature sequence1220 866 591 gene locus_tag LOCUS_41230 866 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41230 >Feature sequence1221 <1771 574 gene locus_tag LOCUS_41240 <1771 574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037525.1:phosphoesterase >Feature sequence1222 518 1240 gene locus_tag LOCUS_41250 518 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 >Feature sequence1223 >Feature sequence1224 <1768 1185 gene locus_tag LOCUS_41260 <1768 1185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122595.1:cytochrome c >Feature sequence1225 508 185 gene locus_tag LOCUS_41270 508 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41270 >Feature sequence1226 989 306 gene locus_tag LOCUS_41280 989 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 1360 1022 gene locus_tag LOCUS_41290 1360 1022 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888587.1 protein_id gnl|my_center|LOCUS_41290 >Feature sequence1227 626 138 gene locus_tag LOCUS_41300 626 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785768.1 protein_id gnl|my_center|LOCUS_41300 1344 727 gene locus_tag LOCUS_41310 gene engB 1344 727 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UN4 protein_id gnl|my_center|LOCUS_41310 >Feature sequence1228 >Feature sequence1229 >Feature sequence1230 927 91 gene locus_tag LOCUS_41320 927 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064479.1 protein_id gnl|my_center|LOCUS_41320 1055 1390 gene locus_tag LOCUS_41330 1055 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 >Feature sequence1231 1576 593 gene locus_tag LOCUS_41340 1576 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41340 >Feature sequence1232 <1 931 gene locus_tag LOCUS_41350 <1 931 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388721.1:carbon monoxide dehydrogenase >Feature sequence1233 >Feature sequence1234 1689 322 gene locus_tag LOCUS_41360 1689 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 >Feature sequence1235 1743 790 gene locus_tag LOCUS_41370 1743 790 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764019.1 protein_id gnl|my_center|LOCUS_41370 >Feature sequence1236 >Feature sequence1237 <1739 930 gene locus_tag LOCUS_41380 <1739 930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H2H2:glutamine--tRNA ligase >Feature sequence1238 <1 573 gene locus_tag LOCUS_41390 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767699.1:glycosyl hydrolase family 43 >Feature sequence1239 >Feature sequence1240 504 1217 gene locus_tag LOCUS_41400 504 1217 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120554.1 protein_id gnl|my_center|LOCUS_41400 >Feature sequence1241 299 919 gene locus_tag LOCUS_41410 299 919 CDS product putative 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NH09 protein_id gnl|my_center|LOCUS_41410 >Feature sequence1242 1723 689 gene locus_tag LOCUS_41420 1723 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 >Feature sequence1243 1294 506 gene locus_tag LOCUS_41430 1294 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030973.1 protein_id gnl|my_center|LOCUS_41430 1722 1444 gene locus_tag LOCUS_41440 1722 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 >Feature sequence1244 <1 1122 gene locus_tag LOCUS_41450 <1 1122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203190.1:thiol:disulfide interchange protein >Feature sequence1245 1088 462 gene locus_tag LOCUS_41460 1088 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016982.1 protein_id gnl|my_center|LOCUS_41460 >Feature sequence1246 >Feature sequence1247 53 595 gene locus_tag LOCUS_41470 gene ilvH 53 595 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962616.1 protein_id gnl|my_center|LOCUS_41470 >Feature sequence1248 1713 769 gene locus_tag LOCUS_41480 1713 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 >Feature sequence1249 >Feature sequence1250 <1 1259 gene locus_tag LOCUS_41490 <1 1259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89YW6:chaperone protein DnaK 1419 1634 gene locus_tag LOCUS_41500 1419 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 >Feature sequence1251 1710 1117 gene locus_tag LOCUS_41510 1710 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 >Feature sequence1252 >Feature sequence1253 <1706 1036 gene locus_tag LOCUS_41520 <1706 1036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964385.1:ATPase >Feature sequence1254 550 227 gene locus_tag LOCUS_41530 550 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964062.1 protein_id gnl|my_center|LOCUS_41530 >Feature sequence1255 521 1303 gene locus_tag LOCUS_41540 521 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41540 >Feature sequence1256 599 1120 gene locus_tag LOCUS_41550 599 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41550 >Feature sequence1257 >Feature sequence1258 >Feature sequence1259 >Feature sequence1260 >Feature sequence1261 1218 118 gene locus_tag LOCUS_41560 1218 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 >Feature sequence1262 988 374 gene locus_tag LOCUS_41570 988 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 1609 1043 gene locus_tag LOCUS_41580 1609 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41580 >Feature sequence1263 >Feature sequence1264 1119 736 gene locus_tag LOCUS_41590 1119 736 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005931903.1 protein_id gnl|my_center|LOCUS_41590 >Feature sequence1265 >Feature sequence1266 <1 725 gene locus_tag LOCUS_41600 <1 725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107644.1:sensor histidine kinase >Feature sequence1267 88 1296 gene locus_tag LOCUS_41610 88 1296 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884008.1 protein_id gnl|my_center|LOCUS_41610 >Feature sequence1268 >Feature sequence1269 <1 1183 gene locus_tag LOCUS_41620 <1 1183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963567.1:phytoene dehydrogenase >Feature sequence1270 138 1433 gene locus_tag LOCUS_41630 gene pepP 138 1433 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_41630 >Feature sequence1271 >Feature sequence1272 1 372 gene locus_tag LOCUS_41640 1 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 >Feature sequence1273 <1672 876 gene locus_tag LOCUS_41650 <1672 876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919382.1:MFS transporter >Feature sequence1274 1360 347 gene locus_tag LOCUS_41660 1360 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 >Feature sequence1275 <1 643 gene locus_tag LOCUS_41670 <1 643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WDL2:hydroxypyruvate isomerase 844 1365 gene locus_tag LOCUS_41680 844 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 >Feature sequence1276 123 998 gene locus_tag LOCUS_41690 gene fabD 123 998 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWP6 protein_id gnl|my_center|LOCUS_41690 1065 1136 gene locus_tag LOCUS_t00250 1065 1136 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1277 >Feature sequence1278 <1 1434 gene locus_tag LOCUS_41700 <1 1434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767197.1:glycosyl hydrolase family 43 >Feature sequence1279 >Feature sequence1280 <1 517 gene locus_tag LOCUS_41710 <1 517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336969.1:D-amino acid aminotransferase 517 1491 gene locus_tag LOCUS_41720 517 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41720 >Feature sequence1281 >Feature sequence1282 368 1243 gene locus_tag LOCUS_41730 368 1243 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105232.1 protein_id gnl|my_center|LOCUS_41730 >Feature sequence1283 3 752 gene locus_tag LOCUS_41740 3 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41740 >Feature sequence1284 >Feature sequence1285 <1 560 gene locus_tag LOCUS_41750 <1 560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107156.1:thiol:disulfide interchange protein DsbD note possible pseudo, internal stop codon 585 893 gene locus_tag LOCUS_41760 585 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 <1651 1038 gene locus_tag LOCUS_41770 <1651 1038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011402854.1:peptidase M48 >Feature sequence1286 <1 684 gene locus_tag LOCUS_41780 <1 684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9L4F0:UV DNA damage endonuclease 835 1377 gene locus_tag LOCUS_41790 835 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 >Feature sequence1287 1062 1544 gene locus_tag LOCUS_41800 1062 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 >Feature sequence1288 230 1390 gene locus_tag LOCUS_41810 230 1390 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390788.1 protein_id gnl|my_center|LOCUS_41810 >Feature sequence1289 1 402 gene locus_tag LOCUS_41820 1 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 >Feature sequence1290 >Feature sequence1291 >Feature sequence1292 102 893 gene locus_tag LOCUS_41830 102 893 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096623.1 protein_id gnl|my_center|LOCUS_41830 >Feature sequence1293 866 444 gene locus_tag LOCUS_41840 866 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 >Feature sequence1294 <1 1489 gene locus_tag LOCUS_41850 <1 1489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072899.1:lambda phage type II DNA modification methyltransferase >Feature sequence1295 >Feature sequence1296 400 969 gene locus_tag LOCUS_41860 400 969 CDS product maltose O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002026426.1 protein_id gnl|my_center|LOCUS_41860 1127 1585 gene locus_tag LOCUS_41870 1127 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41870 >Feature sequence1297 <1621 260 gene locus_tag LOCUS_41880 <1621 260 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXI6:dihydrolipoyl dehydrogenase >Feature sequence1298 >Feature sequence1299 >Feature sequence1300 243 926 gene locus_tag LOCUS_41890 243 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41890 928 1251 gene locus_tag LOCUS_41900 928 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41900 >Feature sequence1301 416 1081 gene locus_tag LOCUS_41910 416 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407619.1 protein_id gnl|my_center|LOCUS_41910 >Feature sequence1302 350 742 gene locus_tag LOCUS_41920 350 742 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723119.1 protein_id gnl|my_center|LOCUS_41920 >Feature sequence1303 831 328 gene locus_tag LOCUS_41930 831 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 >Feature sequence1304 >Feature sequence1305 >Feature sequence1306 >Feature sequence1307 >Feature sequence1308 >Feature sequence1309 <1 806 gene locus_tag LOCUS_41940 <1 806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UNZ8:glutamine synthetase 1457 897 gene locus_tag LOCUS_41950 1457 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 >Feature sequence1310 >Feature sequence1311 >Feature sequence1312 >Feature sequence1313 382 161 gene locus_tag LOCUS_41960 382 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41960 738 932 gene locus_tag LOCUS_41970 738 932 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_41970 <1586 1016 gene locus_tag LOCUS_41980 <1586 1016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A5W4:lysine--tRNA ligase >Feature sequence1314 169 1173 gene locus_tag LOCUS_41990 169 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 1199 1438 gene locus_tag LOCUS_42000 1199 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42000 >Feature sequence1315 <1 720 gene locus_tag LOCUS_42010 <1 720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962802.1:acyl-CoA reductase 1403 792 gene locus_tag LOCUS_42020 1403 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42020 >Feature sequence1316 326 201 gene locus_tag LOCUS_42030 326 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42030 1241 501 gene locus_tag LOCUS_42040 1241 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_42040 >Feature sequence1317 <1 1285 gene locus_tag LOCUS_42050 <1 1285 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404072.1:peptidase S9 >Feature sequence1318 1572 673 gene locus_tag LOCUS_42060 1572 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42060 >Feature sequence1319 80 790 gene locus_tag LOCUS_42070 80 790 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A165 protein_id gnl|my_center|LOCUS_42070 >Feature sequence1320 105 296 gene locus_tag LOCUS_42080 105 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42080 884 444 gene locus_tag LOCUS_42090 884 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42090 <1564 951 gene locus_tag LOCUS_42100 <1564 951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035402.1:xylanase >Feature sequence1321 >Feature sequence1322 >Feature sequence1323 <1559 667 gene locus_tag LOCUS_42110 <1559 667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0L5:dihydroorotate dehydrogenase (quinone) >Feature sequence1324 757 206 gene locus_tag LOCUS_42120 757 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 1371 988 gene locus_tag LOCUS_42130 1371 988 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262045.1 protein_id gnl|my_center|LOCUS_42130 >Feature sequence1325 113 1273 gene locus_tag LOCUS_42140 113 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 >Feature sequence1326 387 7 gene locus_tag LOCUS_42150 gene gcvH 387 7 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64N36 protein_id gnl|my_center|LOCUS_42150 >Feature sequence1327 >Feature sequence1328 <1 886 gene locus_tag LOCUS_42160 <1 886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107735.1:capsule polysaccharide transporter >Feature sequence1329 >Feature sequence1330 143 982 gene locus_tag LOCUS_42170 143 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 >Feature sequence1331 1056 490 gene locus_tag LOCUS_42180 1056 490 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259761.1 protein_id gnl|my_center|LOCUS_42180 >Feature sequence1332 >Feature sequence1333 <1 606 gene locus_tag LOCUS_42190 <1 606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918393.1:salicylate hydroxylase >Feature sequence1334 >Feature sequence1335 <1 1419 gene locus_tag LOCUS_42200 <1 1419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113025.1:dehydrogenase >Feature sequence1336 <1 1053 gene locus_tag LOCUS_42210 <1 1053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008659317.1:ABC transporter permease >Feature sequence1337 <1536 942 gene locus_tag LOCUS_42220 <1536 942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002288121.1:beta-phosphoglucomutase >Feature sequence1338 >Feature sequence1339 <1 505 gene locus_tag LOCUS_42230 <1 505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004527789.1:molybdopterin containing oxidoreductase 1040 567 gene locus_tag LOCUS_42240 1040 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42240 >Feature sequence1340 >Feature sequence1341 <1 1020 gene locus_tag LOCUS_42250 <1 1020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P80859:6-phosphogluconate dehydrogenase, NADP(+)-dependent, decarboxylating >Feature sequence1342 1173 235 gene locus_tag LOCUS_42260 gene plsX 1173 235 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0Y4 protein_id gnl|my_center|LOCUS_42260 1498 1304 gene locus_tag LOCUS_42270 gene rpmF 1498 1304 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H261 protein_id gnl|my_center|LOCUS_42270 >Feature sequence1343 >Feature sequence1344 534 1217 gene locus_tag LOCUS_42280 534 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 >Feature sequence1345 <1 1464 gene locus_tag LOCUS_42290 <1 1464 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GW65:UvrABC system protein C >Feature sequence1346 1137 19 gene locus_tag LOCUS_42300 gene uxuA 1137 19 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974020.1 protein_id gnl|my_center|LOCUS_42300 1516 1178 gene locus_tag LOCUS_42310 1516 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 >Feature sequence1347 <1 910 gene locus_tag LOCUS_42320 <1 910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011102176.1:alpha-L-rhamnosidase 1353 949 gene locus_tag LOCUS_42330 1353 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42330 >Feature sequence1348 >Feature sequence1349 >Feature sequence1350 >Feature sequence1351 >Feature sequence1352 >Feature sequence1353 >Feature sequence1354 378 929 gene locus_tag LOCUS_42340 378 929 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795958.1 protein_id gnl|my_center|LOCUS_42340 >Feature sequence1355 >Feature sequence1356 1082 708 gene locus_tag LOCUS_42350 1082 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_42350 1307 1128 gene locus_tag LOCUS_42360 1307 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42360 >Feature sequence1357 <1501 641 gene locus_tag LOCUS_42370 <1501 641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122595.1:cytochrome c >Feature sequence1358 355 825 gene locus_tag LOCUS_42380 gene coaD 355 825 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q831P9 protein_id gnl|my_center|LOCUS_42380 1225 815 gene locus_tag LOCUS_42390 1225 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362013.1 protein_id gnl|my_center|LOCUS_42390 >Feature sequence1359 <1497 990 gene locus_tag LOCUS_42400 <1497 990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to D1B9V1:peptide chain release factor 1 >Feature sequence1360 369 947 gene locus_tag LOCUS_42410 gene msrA 369 947 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBS2 protein_id gnl|my_center|LOCUS_42410 <1495 952 gene locus_tag LOCUS_42420 <1495 952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226198.1:oxidoreductase >Feature sequence1361 <1494 496 gene locus_tag LOCUS_42430 <1494 496 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121087.1:sulfatase >Feature sequence1362 280 792 gene locus_tag LOCUS_42440 280 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 1483 875 gene locus_tag LOCUS_42450 1483 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141761.1 protein_id gnl|my_center|LOCUS_42450 >Feature sequence1363 <1481 613 gene locus_tag LOCUS_42460 <1481 613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038198.1:glucose dehydrogenase >Feature sequence1364 1480 1136 gene locus_tag LOCUS_42470 1480 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42470 >Feature sequence1365 <1 743 gene locus_tag LOCUS_42480 <1 743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005797186.1:DNA-binding response regulator >Feature sequence1366 <1 1424 gene locus_tag LOCUS_42490 <1 1424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920215.1:beta-xylosidase >Feature sequence1367 >Feature sequence1368 >Feature sequence1369 >Feature sequence1370 474 749 gene locus_tag LOCUS_42500 474 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 749 1006 gene locus_tag LOCUS_42510 749 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 1013 1276 gene locus_tag LOCUS_42520 1013 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 >Feature sequence1371 586 164 gene locus_tag LOCUS_42530 586 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42530 <1469 687 gene locus_tag LOCUS_42540 <1469 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005796113.1:mannan endo-1,4-beta-mannosidase >Feature sequence1372 <1 1217 gene locus_tag LOCUS_42550 <1 1217 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404493.1:peptidase M20 >Feature sequence1373 393 1373 gene locus_tag LOCUS_42560 393 1373 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816316.1 protein_id gnl|my_center|LOCUS_42560 >Feature sequence1374 <1 668 gene locus_tag LOCUS_42570 <1 668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021483.1:response regulator >Feature sequence1375 450 875 gene locus_tag LOCUS_42580 450 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42580 >Feature sequence1376 1145 294 gene locus_tag LOCUS_42590 1145 294 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229553.1 protein_id gnl|my_center|LOCUS_42590 >Feature sequence1377 >Feature sequence1378 853 326 gene locus_tag LOCUS_42600 853 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42600 1095 919 gene locus_tag LOCUS_42610 1095 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42610 1441 1079 gene locus_tag LOCUS_42620 1441 1079 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021317.1 protein_id gnl|my_center|LOCUS_42620 >Feature sequence1379 698 168 gene locus_tag LOCUS_42630 gene ftnA 698 168 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0H6 protein_id gnl|my_center|LOCUS_42630 1161 817 gene locus_tag LOCUS_42640 1161 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963891.1 protein_id gnl|my_center|LOCUS_42640 >Feature sequence1380 103 1443 gene locus_tag LOCUS_42650 103 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42650 >Feature sequence1381 >Feature sequence1382 <1 795 gene locus_tag LOCUS_42660 <1 795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005803349.1:cation efflux system protein >Feature sequence1383 >Feature sequence1384 >Feature sequence1385 >Feature sequence1386 >Feature sequence1387 >Feature sequence1388 >Feature sequence1389 <1437 912 gene locus_tag LOCUS_42670 <1437 912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964510.1:endonuclease >Feature sequence1390 >Feature sequence1391 1270 443 gene locus_tag LOCUS_42680 1270 443 CDS product chitooligosaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123674.1 protein_id gnl|my_center|LOCUS_42680 >Feature sequence1392 >Feature sequence1393 749 1033 gene locus_tag LOCUS_42690 749 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42690 >Feature sequence1394 204 884 gene locus_tag LOCUS_42700 204 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42700 >Feature sequence1395 392 817 gene locus_tag LOCUS_42710 392 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42710 >Feature sequence1396 915 484 gene locus_tag LOCUS_42720 915 484 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942466.1 protein_id gnl|my_center|LOCUS_42720 >Feature sequence1397 >Feature sequence1398 >Feature sequence1399 308 934 gene locus_tag LOCUS_42730 308 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_42730 >Feature sequence1400 >Feature sequence1401 <1 1143 gene locus_tag LOCUS_42740 <1 1143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202110.1:zinc-dependent metalloproteinase lipoprotein, BF0631 family >Feature sequence1402 >Feature sequence1403 >Feature sequence1404 1365 1075 gene locus_tag LOCUS_42750 1365 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42750 >Feature sequence1405 <1402 591 gene locus_tag LOCUS_42760 <1402 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121424.1:transporter >Feature sequence1406 534 247 gene locus_tag LOCUS_42770 534 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42770 >Feature sequence1407 443 1087 gene locus_tag LOCUS_42780 gene upp 443 1087 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964558.1 protein_id gnl|my_center|LOCUS_42780 >Feature sequence1408 >Feature sequence1409 >Feature sequence1410 679 176 gene locus_tag LOCUS_42790 679 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42790 >Feature sequence1411 538 254 gene locus_tag LOCUS_42800 538 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42800 714 508 gene locus_tag LOCUS_42810 714 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42810 1189 779 gene locus_tag LOCUS_42820 1189 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42820 >Feature sequence1412 <1385 334 gene locus_tag LOCUS_42830 <1385 334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767780.1:glycan metabolism protein RagB >Feature sequence1413 95 835 gene locus_tag LOCUS_42840 95 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42840 >Feature sequence1414 <1 603 gene locus_tag LOCUS_42850 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008759882.1:phosphohydrolase >Feature sequence1415 1262 459 gene locus_tag LOCUS_42860 1262 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 >Feature sequence1416 3 539 gene locus_tag LOCUS_42870 3 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42870 >Feature sequence1417 <1369 111 gene locus_tag LOCUS_42880 <1369 111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8CMP4:serine-aspartate repeat-containing protein F >Feature sequence1418 875 1354 gene locus_tag LOCUS_42890 875 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42890 >Feature sequence1419 >Feature sequence1420 >Feature sequence1421 <1366 754 gene locus_tag LOCUS_42900 <1366 754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011201967.1:heparinase >Feature sequence1422 806 231 gene locus_tag LOCUS_42910 806 231 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019252.1 protein_id gnl|my_center|LOCUS_42910 >Feature sequence1423 818 105 gene locus_tag LOCUS_42920 818 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42920 >Feature sequence1424 >Feature sequence1425 73 663 gene locus_tag LOCUS_42930 73 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 <1356 750 gene locus_tag LOCUS_42940 <1356 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202543.1:beta-N-acetylhexosaminidase >Feature sequence1426 <1 892 gene locus_tag LOCUS_42950 <1 892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765042.1:glycosyl transferase 1353 901 gene locus_tag LOCUS_42960 1353 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42960 >Feature sequence1427 >Feature sequence1428 >Feature sequence1429 >Feature sequence1430 <1 897 gene locus_tag LOCUS_42970 <1 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948955.1:membrane protein >Feature sequence1431 62 1303 gene locus_tag LOCUS_42980 62 1303 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761338.1 protein_id gnl|my_center|LOCUS_42980 >Feature sequence1432 >Feature sequence1433 >Feature sequence1434 <1325 539 gene locus_tag LOCUS_42990 <1325 539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A9M2:xylose isomerase >Feature sequence1435 >Feature sequence1436 >Feature sequence1437 509 916 gene locus_tag LOCUS_43000 509 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43000 >Feature sequence1438 5 1285 gene locus_tag LOCUS_43010 5 1285 CDS product tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203295.1 protein_id gnl|my_center|LOCUS_43010 >Feature sequence1439 >Feature sequence1440 >Feature sequence1441 >Feature sequence1442 <1 1103 gene locus_tag LOCUS_43020 <1 1103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919381.1:glucose dehydrogenase >Feature sequence1443 >Feature sequence1444 37 384 gene locus_tag LOCUS_43030 37 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 537 875 gene locus_tag LOCUS_43040 537 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43040 >Feature sequence1445 >Feature sequence1446 >Feature sequence1447 106 588 gene locus_tag LOCUS_43050 106 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43050 >Feature sequence1448 >Feature sequence1449 >Feature sequence1450 >Feature sequence1451 607 380 gene locus_tag LOCUS_43060 607 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43060 <1283 703 gene locus_tag LOCUS_43070 <1283 703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404915.1:heme exporter protein C >Feature sequence1452 >Feature sequence1453 938 294 gene locus_tag LOCUS_43080 938 294 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765472.1 protein_id gnl|my_center|LOCUS_43080 >Feature sequence1454 1276 179 gene locus_tag LOCUS_43090 1276 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43090 >Feature sequence1455 <1275 417 gene locus_tag LOCUS_43100 <1275 417 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121682.1:5-oxoprolinase >Feature sequence1456 >Feature sequence1457 >Feature sequence1458 <1273 364 gene locus_tag LOCUS_43110 <1273 364 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001831597.1:glycerate kinase >Feature sequence1459 >Feature sequence1460 >Feature sequence1461 >Feature sequence1462 >Feature sequence1463 >Feature sequence1464 1204 293 gene locus_tag LOCUS_43120 1204 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576382.1 protein_id gnl|my_center|LOCUS_43120 >Feature sequence1465 <1 897 gene locus_tag LOCUS_43130 <1 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765756.1:anti-sigma factor >Feature sequence1466 >Feature sequence1467 >Feature sequence1468 <1257 291 gene locus_tag LOCUS_43140 <1257 291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118653.1:iduronate-2-sulfatase >Feature sequence1469 >Feature sequence1470 >Feature sequence1471 1022 15 gene locus_tag LOCUS_43150 1022 15 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005822162.1 protein_id gnl|my_center|LOCUS_43150 >Feature sequence1472 >Feature sequence1473 799 65 gene locus_tag LOCUS_43160 799 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140602.1 protein_id gnl|my_center|LOCUS_43160 1250 888 gene locus_tag LOCUS_43170 1250 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43170 >Feature sequence1474 >Feature sequence1475 <1 630 gene locus_tag LOCUS_43180 <1 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H188:ribulose-phosphate 3-epimerase >Feature sequence1476 <1246 637 gene locus_tag LOCUS_43190 <1246 637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143962.1:ligand-gated channel >Feature sequence1477 >Feature sequence1478 349 669 gene locus_tag LOCUS_43200 349 669 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887716.1 protein_id gnl|my_center|LOCUS_43200 >Feature sequence1479 >Feature sequence1480 >Feature sequence1481 >Feature sequence1482 951 406 gene locus_tag LOCUS_43210 951 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43210 >Feature sequence1483 1054 161 gene locus_tag LOCUS_43220 gene dapA 1054 161 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9C0 protein_id gnl|my_center|LOCUS_43220 >Feature sequence1484 236 946 gene locus_tag LOCUS_43230 236 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43230 >Feature sequence1485 466 116 gene locus_tag LOCUS_43240 466 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43240 >Feature sequence1486 >Feature sequence1487 <1 535 gene locus_tag LOCUS_43250 <1 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010992183.1:membrane protein >Feature sequence1488 >Feature sequence1489 <1 759 gene locus_tag LOCUS_43260 <1 759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791020.1:phosphoglucomutase >Feature sequence1490 <1 714 gene locus_tag LOCUS_43270 <1 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767373.1:arylsulfatase >Feature sequence1491 110 457 gene locus_tag LOCUS_43280 110 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43280 776 1144 gene locus_tag LOCUS_43290 776 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43290 >Feature sequence1492 >Feature sequence1493 824 1030 gene locus_tag LOCUS_43300 824 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43300 >Feature sequence1494 >Feature sequence1495 >Feature sequence1496 >Feature sequence1497 >Feature sequence1498 >Feature sequence1499 460 594 gene locus_tag LOCUS_43310 460 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43310 >Feature sequence1500 >Feature sequence1501 >Feature sequence1502 >Feature sequence1503 >Feature sequence1504 >Feature sequence1505 >Feature sequence1506 <1184 639 gene locus_tag LOCUS_43320 <1184 639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8RIA5:ADP-L-glycero-D-manno-heptose-6-epimerase >Feature sequence1507 >Feature sequence1508 <1183 396 gene locus_tag LOCUS_43330 <1183 396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117959.1:glycosyl hydrolase >Feature sequence1509 483 1004 gene locus_tag LOCUS_43340 gene ndhJ 483 1004 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEC1 protein_id gnl|my_center|LOCUS_43340 >Feature sequence1510 302 580 gene locus_tag LOCUS_43350 302 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43350 797 648 gene locus_tag LOCUS_43360 797 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43360 >Feature sequence1511 45 1064 gene locus_tag LOCUS_43370 45 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_43370 >Feature sequence1512 >Feature sequence1513 >Feature sequence1514 >Feature sequence1515 >Feature sequence1516 <1 645 gene locus_tag LOCUS_43380 <1 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74BU2:type III pantothenate kinase >Feature sequence1517 <1 857 gene locus_tag LOCUS_43390 <1 857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119735.1:zinc-type alcohol dehydrogenase >Feature sequence1518 >Feature sequence1519 <1 1076 gene locus_tag LOCUS_43400 <1 1076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005789284.1:anti-sigma factor >Feature sequence1520 <1 939 gene locus_tag LOCUS_43410 <1 939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120441.1:PhoPQ-activated pathogenicity protein >Feature sequence1521 84 824 gene locus_tag LOCUS_43420 84 824 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388934.1 protein_id gnl|my_center|LOCUS_43420 >Feature sequence1522 157 327 gene locus_tag LOCUS_43430 157 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 >Feature sequence1523 >Feature sequence1524 >Feature sequence1525 635 447 gene locus_tag LOCUS_43440 635 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43440 >Feature sequence1526 1003 929 gene locus_tag LOCUS_t00260 1003 929 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1527 >Feature sequence1528 >Feature sequence1529 >Feature sequence1530 465 905 gene locus_tag LOCUS_43450 465 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43450 >Feature sequence1531 <1148 178 gene locus_tag LOCUS_43460 <1148 178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038867.1:N-acyl-L-amino acid amidohydrolase >Feature sequence1532 >Feature sequence1533 >Feature sequence1534 503 1042 gene locus_tag LOCUS_43470 gene folA2 503 1042 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297192.1 protein_id gnl|my_center|LOCUS_43470 >Feature sequence1535 <1145 443 gene locus_tag LOCUS_43480 <1145 443 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000925728.1:C4-dicarboxylate ABC transporter >Feature sequence1536 >Feature sequence1537 >Feature sequence1538 <1128 308 gene locus_tag LOCUS_43490 <1128 308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963997.1:exopolyphosphatase >Feature sequence1539 >Feature sequence1540 548 219 gene locus_tag LOCUS_43500 548 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43500 >Feature sequence1541 >Feature sequence1542 962 417 gene locus_tag LOCUS_43510 962 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43510 >Feature sequence1543 <1 994 gene locus_tag LOCUS_43520 <1 994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202701.1:histidine kinase >Feature sequence1544 <1 544 gene locus_tag LOCUS_43530 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403240.1:formamidopyrimidine-DNA glycosylase 574 849 gene locus_tag LOCUS_43540 574 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 >Feature sequence1545 >Feature sequence1546 >Feature sequence1547 >Feature sequence1548 365 742 gene locus_tag LOCUS_43550 gene crcB1 365 742 CDS product putative fluoride ion transporter CrcB 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07590 protein_id gnl|my_center|LOCUS_43550 >Feature sequence1549 >Feature sequence1550 >Feature sequence1551 >Feature sequence1552 >Feature sequence1553 3 158 gene locus_tag LOCUS_43560 3 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 205 885 gene locus_tag LOCUS_43570 205 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43570 >Feature sequence1554 >Feature sequence1555 >Feature sequence1556 <1 672 gene locus_tag LOCUS_43580 <1 672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007330234.1:ATPase AAA >Feature sequence1557 <1096 11 gene locus_tag LOCUS_43590 <1096 11 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002117292.1:MFS transporter >Feature sequence1558 >Feature sequence1559 >Feature sequence1560 <1 551 gene locus_tag LOCUS_43600 <1 551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118046.1:rhamnosidase >Feature sequence1561 1084 605 gene locus_tag LOCUS_43610 1084 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_43610 >Feature sequence1562 >Feature sequence1563 >Feature sequence1564 >Feature sequence1565 >Feature sequence1566 <1076 101 gene locus_tag LOCUS_43620 <1076 101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403426.1:histidine kinase >Feature sequence1567 661 371 gene locus_tag LOCUS_43630 661 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43630 1067 717 gene locus_tag LOCUS_43640 1067 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43640 >Feature sequence1568 148 750 gene locus_tag LOCUS_43650 148 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973791.1 protein_id gnl|my_center|LOCUS_43650 >Feature sequence1569 <1 628 gene locus_tag LOCUS_43660 <1 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H1G2:epoxyqueuosine reductase >Feature sequence1570 >Feature sequence1571 >Feature sequence1572 >Feature sequence1573 166 441 gene locus_tag LOCUS_43670 166 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43670 438 845 gene locus_tag LOCUS_43680 438 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 >Feature sequence1574 >Feature sequence1575 937 11 gene locus_tag LOCUS_43690 937 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43690 >Feature sequence1576 >Feature sequence1577 >Feature sequence1578 >Feature sequence1579 >Feature sequence1580 >Feature sequence1581 793 275 gene locus_tag LOCUS_43700 793 275 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964526.1 protein_id gnl|my_center|LOCUS_43700 >Feature sequence1582 <1044 443 gene locus_tag LOCUS_43710 <1044 443 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942321.1:ATPase >Feature sequence1583 480 361 gene locus_tag LOCUS_43720 480 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 >Feature sequence1584 910 188 gene locus_tag LOCUS_43730 910 188 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680560.1 protein_id gnl|my_center|LOCUS_43730 >Feature sequence1585 >Feature sequence1586 507 28 gene locus_tag LOCUS_43740 507 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43740 <1039 497 gene locus_tag LOCUS_43750 <1039 497 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011815235.1:IS256 family transposase >Feature sequence1587 >Feature sequence1588 >Feature sequence1589 >Feature sequence1590 <1034 233 gene locus_tag LOCUS_43760 <1034 233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005785433.1:glycan metabolism protein RagB >Feature sequence1591 <1 767 gene locus_tag LOCUS_43770 <1 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005813448.1:TonB-dependent receptor >Feature sequence1592 >Feature sequence1593 <1021 224 gene locus_tag LOCUS_43780 <1021 224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259459.1:FkbM family methyltransferase >Feature sequence1594 716 408 gene locus_tag LOCUS_43790 716 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43790 >Feature sequence1595 <1019 444 gene locus_tag LOCUS_43800 <1019 444 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002208625.1:acyl-CoA thioesterase II >Feature sequence1596 >Feature sequence1597 599 102 gene locus_tag LOCUS_43810 599 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43810 >Feature sequence1598 <1 1000 gene locus_tag LOCUS_43820 <1 1000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405413.1:UDP-glucose 6-dehydrogenase >Feature sequence1599 >Feature sequence1600 <1015 424 gene locus_tag LOCUS_43830 <1015 424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545078.1:ATPase >Feature sequence1601 <1015 459 gene locus_tag LOCUS_43840 <1015 459 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107591.1:integrase >Feature sequence1602 <1 654 gene locus_tag LOCUS_43850 <1 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64Z19:release factor glutamine methyltransferase >Feature sequence1603 >Feature sequence1604 >Feature sequence1605 >Feature sequence1606 530 153 gene locus_tag LOCUS_43860 530 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43860 >Feature sequence1607 >Feature sequence1608 1005 22 gene locus_tag LOCUS_43870 1005 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43870 >Feature sequence1609 >Feature sequence1610 >Feature sequence1611 >Feature sequence1612 1000 764 gene locus_tag LOCUS_43880 1000 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43880