>Feature sequence001 1919 48 gene locus_tag LOCUS_00010 1919 48 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788730.1 protein_id gnl|my_center|LOCUS_00010 3000 2044 gene locus_tag LOCUS_00020 3000 2044 CDS product UDP-GlcNAc--UDP-phosphate GlcNAc-1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816723.1 protein_id gnl|my_center|LOCUS_00020 3895 2993 gene locus_tag LOCUS_00030 3895 2993 CDS product nucleoside-diphosphate-sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786859.1 protein_id gnl|my_center|LOCUS_00030 5104 3956 gene locus_tag LOCUS_00040 5104 3956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 6442 5282 gene locus_tag LOCUS_00050 6442 5282 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048108.1 protein_id gnl|my_center|LOCUS_00050 7635 6439 gene locus_tag LOCUS_00060 7635 6439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 9071 7983 gene locus_tag LOCUS_00070 9071 7983 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202631.1 protein_id gnl|my_center|LOCUS_00070 11188 9071 gene locus_tag LOCUS_00080 11188 9071 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546064.1 protein_id gnl|my_center|LOCUS_00080 11961 11191 gene locus_tag LOCUS_00090 gene hisF2 11961 11191 CDS product putative imidazole glycerol phosphate synthase subunit hisF2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72139 protein_id gnl|my_center|LOCUS_00090 12574 11954 gene locus_tag LOCUS_00100 gene hisH2 12574 11954 CDS product imidazole glycerol phosphate synthase subunit HisH 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72138 protein_id gnl|my_center|LOCUS_00100 13707 12571 gene locus_tag LOCUS_00110 gene wbpG 13707 12571 CDS product LPS biosynthesis protein WbpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119728.1 protein_id gnl|my_center|LOCUS_00110 14898 13741 gene locus_tag LOCUS_00120 14898 13741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 15509 14895 gene locus_tag LOCUS_00130 15509 14895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 16032 15853 gene locus_tag LOCUS_00140 16032 15853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 16785 16195 gene locus_tag LOCUS_00150 16785 16195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00150 18131 16836 gene locus_tag LOCUS_00160 18131 16836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 19282 18128 gene locus_tag LOCUS_00170 19282 18128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 20155 19283 gene locus_tag LOCUS_00180 20155 19283 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992747.1 protein_id gnl|my_center|LOCUS_00180 21281 20157 gene locus_tag LOCUS_00190 21281 20157 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817161.1 protein_id gnl|my_center|LOCUS_00190 22319 21294 gene locus_tag LOCUS_00200 22319 21294 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202925.1 protein_id gnl|my_center|LOCUS_00200 23779 22319 gene locus_tag LOCUS_00210 23779 22319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039965.1 protein_id gnl|my_center|LOCUS_00210 25529 24273 gene locus_tag LOCUS_00220 gene wbpA 25529 24273 CDS product UDP-N-acetyl-d-glucosamine 6-dehydrogenase WbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073077.1 protein_id gnl|my_center|LOCUS_00220 26629 25592 gene locus_tag LOCUS_00230 26629 25592 CDS product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767812.1 protein_id gnl|my_center|LOCUS_00230 28935 26629 gene locus_tag LOCUS_00240 28935 26629 CDS product capsule polysaccharide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658985.1 protein_id gnl|my_center|LOCUS_00240 30610 29366 gene locus_tag LOCUS_00250 gene wbpA 30610 29366 CDS product UDP-N-acetyl-d-glucosamine 6-dehydrogenase WbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073077.1 protein_id gnl|my_center|LOCUS_00250 31742 30750 gene locus_tag LOCUS_00260 31742 30750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_00260 32551 31739 gene locus_tag LOCUS_00270 gene murQ 32551 31739 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXK5 protein_id gnl|my_center|LOCUS_00270 33924 32548 gene locus_tag LOCUS_00280 33924 32548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_00280 34609 34013 gene locus_tag LOCUS_00290 gene plsY 34609 34013 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RFY9 protein_id gnl|my_center|LOCUS_00290 36611 34755 gene locus_tag LOCUS_00300 36611 34755 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107693.1 protein_id gnl|my_center|LOCUS_00300 37649 36624 gene locus_tag LOCUS_00310 gene ruvB 37649 36624 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G3 protein_id gnl|my_center|LOCUS_00310 40418 37710 gene locus_tag LOCUS_00320 40418 37710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 40553 40996 gene locus_tag LOCUS_00330 40553 40996 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261977.1 protein_id gnl|my_center|LOCUS_00330 41062 41640 gene locus_tag LOCUS_00340 gene def 41062 41640 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E7 protein_id gnl|my_center|LOCUS_00340 41642 42424 gene locus_tag LOCUS_00350 41642 42424 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203148.1 protein_id gnl|my_center|LOCUS_00350 42503 43492 gene locus_tag LOCUS_00360 42503 43492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 44853 43489 gene locus_tag LOCUS_00370 44853 43489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 46281 45085 gene locus_tag LOCUS_00380 46281 45085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 47875 46382 gene locus_tag LOCUS_00390 47875 46382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964569.1 protein_id gnl|my_center|LOCUS_00390 48258 48004 gene locus_tag LOCUS_00400 48258 48004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787478.1 protein_id gnl|my_center|LOCUS_00400 49823 48318 gene locus_tag LOCUS_00410 gene atpD 49823 48318 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV9 protein_id gnl|my_center|LOCUS_00410 50425 50616 gene locus_tag LOCUS_00420 50425 50616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 51854 51312 gene locus_tag LOCUS_00430 51854 51312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 52929 52054 gene locus_tag LOCUS_00440 52929 52054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 53765 52926 gene locus_tag LOCUS_00450 53765 52926 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGZ8 protein_id gnl|my_center|LOCUS_00450 54788 53805 gene locus_tag LOCUS_00460 gene fjo19 54788 53805 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_00460 54960 55379 gene locus_tag LOCUS_00470 gene ndk 54960 55379 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAZ6 protein_id gnl|my_center|LOCUS_00470 55379 55789 gene locus_tag LOCUS_00480 55379 55789 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E5 protein_id gnl|my_center|LOCUS_00480 56826 55807 gene locus_tag LOCUS_00490 56826 55807 CDS product molybdenum cofactor biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_00490 57880 56861 gene locus_tag LOCUS_00500 gene ykfB 57880 56861 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121963.1 protein_id gnl|my_center|LOCUS_00500 58545 57877 gene locus_tag LOCUS_00510 gene lipB 58545 57877 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW1 protein_id gnl|my_center|LOCUS_00510 58652 59002 gene locus_tag LOCUS_00520 58652 59002 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ6 protein_id gnl|my_center|LOCUS_00520 59213 59860 gene locus_tag LOCUS_00530 59213 59860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 59921 61114 gene locus_tag LOCUS_00540 gene mraY 59921 61114 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H198 protein_id gnl|my_center|LOCUS_00540 61532 61975 gene locus_tag LOCUS_00550 gene rplM 61532 61975 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P27 protein_id gnl|my_center|LOCUS_00550 62001 62387 gene locus_tag LOCUS_00560 gene rpsI 62001 62387 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P28 protein_id gnl|my_center|LOCUS_00560 62539 63441 gene locus_tag LOCUS_00570 gene rpsB 62539 63441 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU2 protein_id gnl|my_center|LOCUS_00570 63528 64361 gene locus_tag LOCUS_00580 gene tsf 63528 64361 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU1 protein_id gnl|my_center|LOCUS_00580 64725 64411 gene locus_tag LOCUS_00590 64725 64411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962797.1 protein_id gnl|my_center|LOCUS_00590 64850 65803 gene locus_tag LOCUS_00600 64850 65803 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140702.1 protein_id gnl|my_center|LOCUS_00600 65831 66682 gene locus_tag LOCUS_00610 65831 66682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 66825 67541 gene locus_tag LOCUS_00620 66825 67541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 68212 67787 gene locus_tag LOCUS_00630 68212 67787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 69516 68479 gene locus_tag LOCUS_00640 69516 68479 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338487.1 protein_id gnl|my_center|LOCUS_00640 70285 69584 gene locus_tag LOCUS_00650 gene comB 70285 69584 CDS product putative 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZQ4 protein_id gnl|my_center|LOCUS_00650 71660 70308 gene locus_tag LOCUS_00660 71660 70308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 71862 72353 gene locus_tag LOCUS_00670 71862 72353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 72378 73043 gene locus_tag LOCUS_00680 72378 73043 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122936.1 protein_id gnl|my_center|LOCUS_00680 73164 73943 gene locus_tag LOCUS_00690 73164 73943 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_00690 74983 74777 gene locus_tag LOCUS_00700 74983 74777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 76169 75078 gene locus_tag LOCUS_00710 gene gfo 76169 75078 CDS product glucose-fructose oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036051.1 protein_id gnl|my_center|LOCUS_00710 76240 76698 gene locus_tag LOCUS_00720 76240 76698 CDS product ribosomal protein S6 modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660269.1 protein_id gnl|my_center|LOCUS_00720 76695 77570 gene locus_tag LOCUS_00730 gene rimK 76695 77570 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E743 protein_id gnl|my_center|LOCUS_00730 77574 78338 gene locus_tag LOCUS_00740 77574 78338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 78976 78335 gene locus_tag LOCUS_00750 gene arsC 78976 78335 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123107.1 protein_id gnl|my_center|LOCUS_00750 79817 78942 gene locus_tag LOCUS_00760 gene arsM 79817 78942 CDS product arsenite S-adenosylmethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405176.1 protein_id gnl|my_center|LOCUS_00760 80197 79871 gene locus_tag LOCUS_00770 80197 79871 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_00770 80363 81310 gene locus_tag LOCUS_00780 gene argF' 80363 81310 CDS product N-acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1E9 protein_id gnl|my_center|LOCUS_00780 82396 81389 gene locus_tag LOCUS_00790 82396 81389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267192.1 protein_id gnl|my_center|LOCUS_00790 82549 83265 gene locus_tag LOCUS_00800 82549 83265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 83434 85056 gene locus_tag LOCUS_00810 83434 85056 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633861.1 protein_id gnl|my_center|LOCUS_00810 86153 86575 gene locus_tag LOCUS_00820 86153 86575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 87561 86596 gene locus_tag LOCUS_00830 87561 86596 CDS product isoprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203421.1 protein_id gnl|my_center|LOCUS_00830 88897 87548 gene locus_tag LOCUS_00840 88897 87548 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897651.1 protein_id gnl|my_center|LOCUS_00840 88869 89315 gene locus_tag LOCUS_00850 gene crcB 88869 89315 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EER0 protein_id gnl|my_center|LOCUS_00850 91633 89375 gene locus_tag LOCUS_00860 91633 89375 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964459.1 protein_id gnl|my_center|LOCUS_00860 91952 92248 gene locus_tag LOCUS_00870 91952 92248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 92255 92605 gene locus_tag LOCUS_00880 92255 92605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 92663 93115 gene locus_tag LOCUS_00890 92663 93115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 93652 93128 gene locus_tag LOCUS_00900 93652 93128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 protein_id gnl|my_center|LOCUS_00900 93780 95645 gene locus_tag LOCUS_00910 gene mutL 93780 95645 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR1 protein_id gnl|my_center|LOCUS_00910 95661 96332 gene locus_tag LOCUS_00920 95661 96332 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963286.1 protein_id gnl|my_center|LOCUS_00920 96326 97264 gene locus_tag LOCUS_00930 96326 97264 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761931.1 protein_id gnl|my_center|LOCUS_00930 97375 99312 gene locus_tag LOCUS_00940 gene dxs 97375 99312 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0C2 protein_id gnl|my_center|LOCUS_00940 99381 100178 gene locus_tag LOCUS_00950 99381 100178 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065023.1 protein_id gnl|my_center|LOCUS_00950 100282 103236 gene locus_tag LOCUS_00960 100282 103236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941637.1 protein_id gnl|my_center|LOCUS_00960 106769 103308 gene locus_tag LOCUS_00970 gene pyc 106769 103308 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HEL7 protein_id gnl|my_center|LOCUS_00970 107579 106941 gene locus_tag LOCUS_00980 107579 106941 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946491.1 protein_id gnl|my_center|LOCUS_00980 108459 107572 gene locus_tag LOCUS_00990 108459 107572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 109250 108456 gene locus_tag LOCUS_01000 109250 108456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 109362 109775 gene locus_tag LOCUS_01010 109362 109775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 109772 110509 gene locus_tag LOCUS_01020 109772 110509 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760550.1 protein_id gnl|my_center|LOCUS_01020 112139 110484 gene locus_tag LOCUS_01030 112139 110484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 112500 113126 gene locus_tag LOCUS_01040 112500 113126 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356907.1 protein_id gnl|my_center|LOCUS_01040 113165 113641 gene locus_tag LOCUS_01050 113165 113641 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141249.1 protein_id gnl|my_center|LOCUS_01050 113638 113991 gene locus_tag LOCUS_01060 113638 113991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001172038.1 protein_id gnl|my_center|LOCUS_01060 113996 114439 gene locus_tag LOCUS_01070 113996 114439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704653.1 protein_id gnl|my_center|LOCUS_01070 114448 115782 gene locus_tag LOCUS_01080 114448 115782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 115830 116861 gene locus_tag LOCUS_01090 115830 116861 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263238.1 protein_id gnl|my_center|LOCUS_01090 116858 119899 gene locus_tag LOCUS_01100 gene acrB5 116858 119899 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920956.1 protein_id gnl|my_center|LOCUS_01100 121137 120034 gene locus_tag LOCUS_01110 121137 120034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 123406 121238 gene locus_tag LOCUS_01120 123406 121238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 123692 124519 gene locus_tag LOCUS_01130 123692 124519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 125310 124513 gene locus_tag LOCUS_01140 125310 124513 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258021.1 protein_id gnl|my_center|LOCUS_01140 126165 125311 gene locus_tag LOCUS_01150 126165 125311 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258021.1 protein_id gnl|my_center|LOCUS_01150 127041 126208 gene locus_tag LOCUS_01160 127041 126208 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122415.1 protein_id gnl|my_center|LOCUS_01160 127123 128586 gene locus_tag LOCUS_01170 127123 128586 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107930.1 protein_id gnl|my_center|LOCUS_01170 128639 129736 gene locus_tag LOCUS_01180 gene gcvT 128639 129736 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW3 protein_id gnl|my_center|LOCUS_01180 129840 130979 gene locus_tag LOCUS_01190 129840 130979 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_01190 131293 132216 gene locus_tag LOCUS_01200 131293 132216 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948300.1 protein_id gnl|my_center|LOCUS_01200 134302 132275 gene locus_tag LOCUS_01210 134302 132275 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640121.1 protein_id gnl|my_center|LOCUS_01210 134663 134370 gene locus_tag LOCUS_01220 134663 134370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 135282 136640 gene locus_tag LOCUS_01230 135282 136640 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107591.1 protein_id gnl|my_center|LOCUS_01230 136646 137815 gene locus_tag LOCUS_01240 136646 137815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 138203 138598 gene locus_tag LOCUS_01250 138203 138598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 138591 139568 gene locus_tag LOCUS_01260 138591 139568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 139652 140071 gene locus_tag LOCUS_01270 139652 140071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 140108 140308 gene locus_tag LOCUS_01280 140108 140308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 140292 140996 gene locus_tag LOCUS_01290 140292 140996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 141110 141643 gene locus_tag LOCUS_01300 141110 141643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 141858 141783 gene locus_tag LOCUS_t00010 141858 141783 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 143601 142141 gene locus_tag LOCUS_01310 gene uxaB 143601 142141 CDS product altronate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97L67 protein_id gnl|my_center|LOCUS_01310 143886 145850 gene locus_tag LOCUS_01320 143886 145850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 145869 146552 gene locus_tag LOCUS_01330 gene rprY 145869 146552 CDS product transcriptional regulatory protein RprY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AE24 protein_id gnl|my_center|LOCUS_01330 146702 147733 gene locus_tag LOCUS_01340 gene mreB 146702 147733 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_01340 147743 148600 gene locus_tag LOCUS_01350 147743 148600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 149129 150319 gene locus_tag LOCUS_01360 149129 150319 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962646.1 protein_id gnl|my_center|LOCUS_01360 150368 151777 gene locus_tag LOCUS_01370 150368 151777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 152604 151774 gene locus_tag LOCUS_01380 152604 151774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 152916 153341 gene locus_tag LOCUS_01390 152916 153341 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107328.1 protein_id gnl|my_center|LOCUS_01390 153506 155044 gene locus_tag LOCUS_01400 153506 155044 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_01400 157198 155120 gene locus_tag LOCUS_01410 157198 155120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 157450 158847 gene locus_tag LOCUS_01420 gene lpdA2 157450 158847 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI6 protein_id gnl|my_center|LOCUS_01420 159067 159354 gene locus_tag LOCUS_01430 159067 159354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 159434 161374 gene locus_tag LOCUS_01440 159434 161374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 161371 162084 gene locus_tag LOCUS_01450 161371 162084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120331.1 protein_id gnl|my_center|LOCUS_01450 162084 163412 gene locus_tag LOCUS_01460 162084 163412 CDS product DEAD/DEAH box family ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_01460 163494 164369 gene locus_tag LOCUS_01470 163494 164369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 165854 164379 gene locus_tag LOCUS_01480 165854 164379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 166057 166686 gene locus_tag LOCUS_01490 166057 166686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 166698 168860 gene locus_tag LOCUS_01500 166698 168860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 168888 169610 gene locus_tag LOCUS_01510 168888 169610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 169661 170623 gene locus_tag LOCUS_01520 169661 170623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 170613 170792 gene locus_tag LOCUS_01530 170613 170792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 170826 172643 gene locus_tag LOCUS_01540 170826 172643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 173223 172651 gene locus_tag LOCUS_01550 173223 172651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540486.1 protein_id gnl|my_center|LOCUS_01550 173276 173965 gene locus_tag LOCUS_01560 173276 173965 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722576.1 protein_id gnl|my_center|LOCUS_01560 174725 174129 gene locus_tag LOCUS_01570 174725 174129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 176499 174772 gene locus_tag LOCUS_01580 176499 174772 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080599.1 protein_id gnl|my_center|LOCUS_01580 177631 176600 gene locus_tag LOCUS_01590 177631 176600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 179253 178075 gene locus_tag LOCUS_01600 179253 178075 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229252.1 protein_id gnl|my_center|LOCUS_01600 181465 179489 gene locus_tag LOCUS_01610 181465 179489 CDS product UPF0313 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RL0 protein_id gnl|my_center|LOCUS_01610 181762 182820 gene locus_tag LOCUS_01620 181762 182820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 183483 183013 gene locus_tag LOCUS_01630 183483 183013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 185220 183559 gene locus_tag LOCUS_01640 185220 183559 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203676.1 protein_id gnl|my_center|LOCUS_01640 185388 186590 gene locus_tag LOCUS_01650 185388 186590 CDS product protein up-regulated by thyroid hormone- PQQ-dependent glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122629.1 protein_id gnl|my_center|LOCUS_01650 186735 189098 gene locus_tag LOCUS_01660 186735 189098 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964117.1 protein_id gnl|my_center|LOCUS_01660 190412 189138 gene locus_tag LOCUS_01670 gene gdhA 190412 189138 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S582 protein_id gnl|my_center|LOCUS_01670 190698 191861 gene locus_tag LOCUS_01680 gene dxr 190698 191861 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PY9 protein_id gnl|my_center|LOCUS_01680 191858 192583 gene locus_tag LOCUS_01690 191858 192583 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_01690 192750 192592 gene locus_tag LOCUS_01700 192750 192592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 194846 192924 gene locus_tag LOCUS_01710 194846 192924 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RM0 protein_id gnl|my_center|LOCUS_01710 >Feature sequence002 <1 1544 gene locus_tag LOCUS_01720 <1 1544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963475.1:SusC/RagA family TonB-linked outer membrane protein 1570 3012 gene locus_tag LOCUS_01730 1570 3012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963476.1 protein_id gnl|my_center|LOCUS_01730 3123 4397 gene locus_tag LOCUS_01740 3123 4397 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_01740 4433 5770 gene locus_tag LOCUS_01750 gene norM 4433 5770 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962730.1 protein_id gnl|my_center|LOCUS_01750 6351 5827 gene locus_tag LOCUS_01760 6351 5827 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724156.1 protein_id gnl|my_center|LOCUS_01760 7207 6431 gene locus_tag LOCUS_01770 7207 6431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 7521 8507 gene locus_tag LOCUS_01780 gene nrdB 7521 8507 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 protein_id gnl|my_center|LOCUS_01780 11138 8661 gene locus_tag LOCUS_01790 gene nrdA 11138 8661 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU5 protein_id gnl|my_center|LOCUS_01790 12226 11552 gene locus_tag LOCUS_01800 12226 11552 CDS product thiamine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963877.1 protein_id gnl|my_center|LOCUS_01800 12979 12326 gene locus_tag LOCUS_01810 12979 12326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 15518 13089 gene locus_tag LOCUS_01820 gene ftsK 15518 13089 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 protein_id gnl|my_center|LOCUS_01820 16006 19110 gene locus_tag LOCUS_01830 16006 19110 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202162.1 protein_id gnl|my_center|LOCUS_01830 19139 20698 gene locus_tag LOCUS_01840 19139 20698 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203622.1 protein_id gnl|my_center|LOCUS_01840 21047 21508 gene locus_tag LOCUS_01850 21047 21508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 21582 22094 gene locus_tag LOCUS_01860 21582 22094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 22423 24765 gene locus_tag LOCUS_01870 22423 24765 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_01870 24767 25672 gene locus_tag LOCUS_01880 24767 25672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 26478 25669 gene locus_tag LOCUS_01890 26478 25669 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZQ5 protein_id gnl|my_center|LOCUS_01890 26616 26852 gene locus_tag LOCUS_01900 gene acpP 26616 26852 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E6 protein_id gnl|my_center|LOCUS_01900 26937 28187 gene locus_tag LOCUS_01910 gene fabF 26937 28187 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW44 protein_id gnl|my_center|LOCUS_01910 28213 28953 gene locus_tag LOCUS_01920 28213 28953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 29558 28989 gene locus_tag LOCUS_01930 29558 28989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 31759 29621 gene locus_tag LOCUS_01940 31759 29621 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2B0 protein_id gnl|my_center|LOCUS_01940 32919 31912 gene locus_tag LOCUS_01950 gene gnl 32919 31912 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123882.1 protein_id gnl|my_center|LOCUS_01950 33054 33692 gene locus_tag LOCUS_01960 33054 33692 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203360.1 protein_id gnl|my_center|LOCUS_01960 34963 33689 gene locus_tag LOCUS_01970 34963 33689 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202792.1 protein_id gnl|my_center|LOCUS_01970 35261 35046 gene locus_tag LOCUS_01980 35261 35046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 35894 35397 gene locus_tag LOCUS_01990 35894 35397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 37195 35903 gene locus_tag LOCUS_02000 gene nuoN-1 37195 35903 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G95 protein_id gnl|my_center|LOCUS_02000 38779 37319 gene locus_tag LOCUS_02010 gene nuoM 38779 37319 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964309.1 protein_id gnl|my_center|LOCUS_02010 40730 38802 gene locus_tag LOCUS_02020 gene nuoL 40730 38802 CDS product NADH dehydrogenase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964310.1 protein_id gnl|my_center|LOCUS_02020 41073 40732 gene locus_tag LOCUS_02030 gene nuoK 41073 40732 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1Q3 protein_id gnl|my_center|LOCUS_02030 42022 41201 gene locus_tag LOCUS_02040 42022 41201 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 protein_id gnl|my_center|LOCUS_02040 42107 43165 gene locus_tag LOCUS_02050 42107 43165 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706171.1 protein_id gnl|my_center|LOCUS_02050 43453 43154 gene locus_tag LOCUS_02060 43453 43154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 43787 43446 gene locus_tag LOCUS_02070 43787 43446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 45401 43905 gene locus_tag LOCUS_02080 gene glpK 45401 43905 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJ21 protein_id gnl|my_center|LOCUS_02080 45547 45891 gene locus_tag LOCUS_02090 45547 45891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 49428 45955 gene locus_tag LOCUS_02100 49428 45955 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 protein_id gnl|my_center|LOCUS_02100 50575 49448 gene locus_tag LOCUS_02110 50575 49448 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964490.1 protein_id gnl|my_center|LOCUS_02110 51926 50595 gene locus_tag LOCUS_02120 51926 50595 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762063.1 protein_id gnl|my_center|LOCUS_02120 52518 51931 gene locus_tag LOCUS_02130 52518 51931 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108448.1 protein_id gnl|my_center|LOCUS_02130 52879 53931 gene locus_tag LOCUS_02140 gene pyrD 52879 53931 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L5 protein_id gnl|my_center|LOCUS_02140 53922 54647 gene locus_tag LOCUS_02150 gene menG 53922 54647 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A005 protein_id gnl|my_center|LOCUS_02150 54647 55414 gene locus_tag LOCUS_02160 54647 55414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 55641 55862 gene locus_tag LOCUS_02170 55641 55862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_02170 56680 56045 gene locus_tag LOCUS_02180 56680 56045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D8 protein_id gnl|my_center|LOCUS_02180 57275 56685 gene locus_tag LOCUS_02190 57275 56685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 58495 57338 gene locus_tag LOCUS_02200 gene leuA 58495 57338 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6L6 protein_id gnl|my_center|LOCUS_02200 58719 60176 gene locus_tag LOCUS_02210 58719 60176 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0P8 protein_id gnl|my_center|LOCUS_02210 60876 60229 gene locus_tag LOCUS_02220 gene udk 60876 60229 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S561 protein_id gnl|my_center|LOCUS_02220 61958 60924 gene locus_tag LOCUS_02230 gene ansA 61958 60924 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035484.1 protein_id gnl|my_center|LOCUS_02230 61994 62845 gene locus_tag LOCUS_02240 gene yeeZ 61994 62845 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261981.1 protein_id gnl|my_center|LOCUS_02240 63567 65975 gene locus_tag LOCUS_02250 63567 65975 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963833.1 protein_id gnl|my_center|LOCUS_02250 65982 67160 gene locus_tag LOCUS_02260 65982 67160 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 protein_id gnl|my_center|LOCUS_02260 70012 67223 gene locus_tag LOCUS_02270 70012 67223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 70409 71137 gene locus_tag LOCUS_02280 gene sdhC 70409 71137 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962272.1 protein_id gnl|my_center|LOCUS_02280 71159 73174 gene locus_tag LOCUS_02290 gene sdhA 71159 73174 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962273.1 protein_id gnl|my_center|LOCUS_02290 73182 73931 gene locus_tag LOCUS_02300 gene sdhB 73182 73931 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962275.1 protein_id gnl|my_center|LOCUS_02300 74455 74018 gene locus_tag LOCUS_02310 74455 74018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 75230 74709 gene locus_tag LOCUS_02320 gene idi 75230 74709 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963899.1 protein_id gnl|my_center|LOCUS_02320 75328 76170 gene locus_tag LOCUS_02330 gene hpaG 75328 76170 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122036.1 protein_id gnl|my_center|LOCUS_02330 76173 77732 gene locus_tag LOCUS_02340 76173 77732 CDS product 2,5-dioxovalerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038347.1 protein_id gnl|my_center|LOCUS_02340 77737 78525 gene locus_tag LOCUS_02350 77737 78525 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703669.1 protein_id gnl|my_center|LOCUS_02350 78525 78854 gene locus_tag LOCUS_02360 78525 78854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369371.1 protein_id gnl|my_center|LOCUS_02360 79247 78855 gene locus_tag LOCUS_02370 79247 78855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 80482 79250 gene locus_tag LOCUS_02380 80482 79250 CDS product molybdopterin containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463605.1 protein_id gnl|my_center|LOCUS_02380 81932 80475 gene locus_tag LOCUS_02390 81932 80475 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584022.1 protein_id gnl|my_center|LOCUS_02390 82163 81951 gene locus_tag LOCUS_02400 82163 81951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 82552 82166 gene locus_tag LOCUS_02410 82552 82166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 82812 82549 gene locus_tag LOCUS_02420 82812 82549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 83702 82860 gene locus_tag LOCUS_02430 83702 82860 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784230.1 protein_id gnl|my_center|LOCUS_02430 83766 85001 gene locus_tag LOCUS_02440 83766 85001 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796883.1 protein_id gnl|my_center|LOCUS_02440 85004 85585 gene locus_tag LOCUS_02450 85004 85585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 85826 85724 gene locus_tag LOCUS_r00010 85826 85724 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence003 2012 2434 gene locus_tag LOCUS_02460 2012 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 3403 2489 gene locus_tag LOCUS_02470 3403 2489 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963504.1 protein_id gnl|my_center|LOCUS_02470 4250 3405 gene locus_tag LOCUS_02480 4250 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 4322 5305 gene locus_tag LOCUS_02490 4322 5305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003607.1 protein_id gnl|my_center|LOCUS_02490 6171 5302 gene locus_tag LOCUS_02500 6171 5302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 7249 6230 gene locus_tag LOCUS_02510 7249 6230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120903.1 protein_id gnl|my_center|LOCUS_02510 7341 8129 gene locus_tag LOCUS_02520 7341 8129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206199.1 protein_id gnl|my_center|LOCUS_02520 8126 9100 gene locus_tag LOCUS_02530 8126 9100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031741.1 protein_id gnl|my_center|LOCUS_02530 9145 9645 gene locus_tag LOCUS_02540 9145 9645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 10270 10839 gene locus_tag LOCUS_02550 10270 10839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 10879 13665 gene locus_tag LOCUS_02560 10879 13665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 14174 13662 gene locus_tag LOCUS_02570 14174 13662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 14635 14171 gene locus_tag LOCUS_02580 14635 14171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 14749 15534 gene locus_tag LOCUS_02590 14749 15534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 18636 15559 gene locus_tag LOCUS_02600 gene dnaE 18636 15559 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9UPM5 protein_id gnl|my_center|LOCUS_02600 19386 18673 gene locus_tag LOCUS_02610 19386 18673 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67726 protein_id gnl|my_center|LOCUS_02610 19864 19463 gene locus_tag LOCUS_02620 19864 19463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 19982 20644 gene locus_tag LOCUS_02630 gene sirR 19982 20644 CDS product iron-dependent repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_02630 20700 21779 gene locus_tag LOCUS_02640 20700 21779 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761518.1 protein_id gnl|my_center|LOCUS_02640 21872 23080 gene locus_tag LOCUS_02650 21872 23080 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762697.1 protein_id gnl|my_center|LOCUS_02650 24155 23082 gene locus_tag LOCUS_02660 24155 23082 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228754.1 protein_id gnl|my_center|LOCUS_02660 24849 24157 gene locus_tag LOCUS_02670 gene mtgA 24849 24157 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6V1 protein_id gnl|my_center|LOCUS_02670 26061 24850 gene locus_tag LOCUS_02680 gene ribBA 26061 24850 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YT3 protein_id gnl|my_center|LOCUS_02680 26272 28458 gene locus_tag LOCUS_02690 26272 28458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 28510 28854 gene locus_tag LOCUS_02700 28510 28854 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJ43 protein_id gnl|my_center|LOCUS_02700 28861 29850 gene locus_tag LOCUS_02710 28861 29850 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963200.1 protein_id gnl|my_center|LOCUS_02710 29843 30418 gene locus_tag LOCUS_02720 gene coaE 29843 30418 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YY6 protein_id gnl|my_center|LOCUS_02720 31847 30408 gene locus_tag LOCUS_02730 gene dnaA 31847 30408 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW8 protein_id gnl|my_center|LOCUS_02730 32013 32267 gene locus_tag LOCUS_02740 32013 32267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 32400 32642 gene locus_tag LOCUS_02750 32400 32642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 32670 33716 gene locus_tag LOCUS_02760 gene atpB 32670 33716 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2E1 protein_id gnl|my_center|LOCUS_02760 33767 34030 gene locus_tag LOCUS_02770 33767 34030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 34109 34603 gene locus_tag LOCUS_02780 gene atpF 34109 34603 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D9 protein_id gnl|my_center|LOCUS_02780 34710 35243 gene locus_tag LOCUS_02790 gene atpH 34710 35243 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D8 protein_id gnl|my_center|LOCUS_02790 38007 35482 gene locus_tag LOCUS_02800 38007 35482 CDS product cytochrome c assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404869.1 protein_id gnl|my_center|LOCUS_02800 38190 39503 gene locus_tag LOCUS_02810 38190 39503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 39503 39955 gene locus_tag LOCUS_02820 39503 39955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 39994 41109 gene locus_tag LOCUS_02830 39994 41109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 41491 41114 gene locus_tag LOCUS_02840 gene groES-2 41491 41114 CDS product chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932256.1 protein_id gnl|my_center|LOCUS_02840 42590 41496 gene locus_tag LOCUS_02850 42590 41496 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120946.1 protein_id gnl|my_center|LOCUS_02850 42784 43824 gene locus_tag LOCUS_02860 42784 43824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 43877 44203 gene locus_tag LOCUS_02870 43877 44203 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962417.1 protein_id gnl|my_center|LOCUS_02870 44200 45150 gene locus_tag LOCUS_02880 44200 45150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 45183 45698 gene locus_tag LOCUS_02890 45183 45698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 protein_id gnl|my_center|LOCUS_02890 45748 47949 gene locus_tag LOCUS_02900 45748 47949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108745.1 protein_id gnl|my_center|LOCUS_02900 48022 48408 gene locus_tag LOCUS_02910 48022 48408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962738.1 protein_id gnl|my_center|LOCUS_02910 48535 49299 gene locus_tag LOCUS_02920 48535 49299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 49289 50356 gene locus_tag LOCUS_02930 49289 50356 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 protein_id gnl|my_center|LOCUS_02930 50356 51267 gene locus_tag LOCUS_02940 50356 51267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962741.1 protein_id gnl|my_center|LOCUS_02940 51466 51981 gene locus_tag LOCUS_02950 gene dfrA 51466 51981 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P11045 protein_id gnl|my_center|LOCUS_02950 52061 54400 gene locus_tag LOCUS_02960 52061 54400 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140323.1 protein_id gnl|my_center|LOCUS_02960 54407 55579 gene locus_tag LOCUS_02970 54407 55579 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203740.1 protein_id gnl|my_center|LOCUS_02970 55643 56380 gene locus_tag LOCUS_02980 55643 56380 CDS product polyprenol phosphate mannosyl transferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122067.1 protein_id gnl|my_center|LOCUS_02980 56413 58491 gene locus_tag LOCUS_02990 56413 58491 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963232.1 protein_id gnl|my_center|LOCUS_02990 59129 58524 gene locus_tag LOCUS_03000 59129 58524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 61640 59217 gene locus_tag LOCUS_03010 61640 59217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 61992 61663 gene locus_tag LOCUS_03020 61992 61663 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 protein_id gnl|my_center|LOCUS_03020 62896 63258 gene locus_tag LOCUS_03030 62896 63258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 64064 65158 gene locus_tag LOCUS_03040 gene gmd 64064 65158 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XYK3 protein_id gnl|my_center|LOCUS_03040 65597 66115 gene locus_tag LOCUS_03050 65597 66115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 66100 67755 gene locus_tag LOCUS_03060 66100 67755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 67800 68606 gene locus_tag LOCUS_03070 67800 68606 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963408.1 protein_id gnl|my_center|LOCUS_03070 69017 71431 gene locus_tag LOCUS_03080 69017 71431 CDS product tyrosine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107290.1 protein_id gnl|my_center|LOCUS_03080 72524 73177 gene locus_tag LOCUS_03090 72524 73177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 73196 73978 gene locus_tag LOCUS_03100 73196 73978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 >Feature sequence004 126 1133 gene locus_tag LOCUS_03110 126 1133 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_03110 2344 1130 gene locus_tag LOCUS_03120 gene queA 2344 1130 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0P8 protein_id gnl|my_center|LOCUS_03120 2779 2345 gene locus_tag LOCUS_03130 2779 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 2696 3463 gene locus_tag LOCUS_03140 2696 3463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 5490 3460 gene locus_tag LOCUS_03150 5490 3460 CDS product competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203504.1 protein_id gnl|my_center|LOCUS_03150 6376 5561 gene locus_tag LOCUS_03160 gene panB 6376 5561 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY12 protein_id gnl|my_center|LOCUS_03160 7611 6424 gene locus_tag LOCUS_03170 7611 6424 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964527.1 protein_id gnl|my_center|LOCUS_03170 8289 7621 gene locus_tag LOCUS_03180 8289 7621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964528.1 protein_id gnl|my_center|LOCUS_03180 10098 8440 gene locus_tag LOCUS_03190 10098 8440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108843.1 protein_id gnl|my_center|LOCUS_03190 10324 12309 gene locus_tag LOCUS_03200 gene ogt 10324 12309 CDS product O-GlcNAc transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_03200 13725 12313 gene locus_tag LOCUS_03210 13725 12313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 13964 14803 gene locus_tag LOCUS_03220 gene purU 13964 14803 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHV0 protein_id gnl|my_center|LOCUS_03220 15442 14813 gene locus_tag LOCUS_03230 15442 14813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 16749 15481 gene locus_tag LOCUS_03240 gene fucP 16749 15481 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120628.1 protein_id gnl|my_center|LOCUS_03240 16834 17499 gene locus_tag LOCUS_03250 16834 17499 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963856.1 protein_id gnl|my_center|LOCUS_03250 17496 18296 gene locus_tag LOCUS_03260 17496 18296 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963855.1 protein_id gnl|my_center|LOCUS_03260 18768 18265 gene locus_tag LOCUS_03270 18768 18265 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933248.1 protein_id gnl|my_center|LOCUS_03270 19967 18900 gene locus_tag LOCUS_03280 19967 18900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 20103 21335 gene locus_tag LOCUS_03290 20103 21335 CDS product cytochrome d ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047985.1 protein_id gnl|my_center|LOCUS_03290 22712 21369 gene locus_tag LOCUS_03300 22712 21369 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P22 protein_id gnl|my_center|LOCUS_03300 22771 23484 gene locus_tag LOCUS_03310 gene glpF 22771 23484 CDS product glycerol uptake facilitator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535419.1 protein_id gnl|my_center|LOCUS_03310 23585 24925 gene locus_tag LOCUS_03320 gene xylA 23585 24925 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9M2 protein_id gnl|my_center|LOCUS_03320 25380 25018 gene locus_tag LOCUS_03330 25380 25018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 27449 25548 gene locus_tag LOCUS_03340 27449 25548 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_03340 28627 27473 gene locus_tag LOCUS_03350 28627 27473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 29694 28681 gene locus_tag LOCUS_03360 29694 28681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 31803 29710 gene locus_tag LOCUS_03370 gene recG 31803 29710 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYD1 protein_id gnl|my_center|LOCUS_03370 31847 33640 gene locus_tag LOCUS_03380 31847 33640 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009293016.1 protein_id gnl|my_center|LOCUS_03380 33958 33629 gene locus_tag LOCUS_03390 33958 33629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 34964 34008 gene locus_tag LOCUS_03400 34964 34008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120245.1 protein_id gnl|my_center|LOCUS_03400 35044 37260 gene locus_tag LOCUS_03410 35044 37260 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814008.1 protein_id gnl|my_center|LOCUS_03410 38708 37257 gene locus_tag LOCUS_03420 gene murE 38708 37257 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZL7 protein_id gnl|my_center|LOCUS_03420 39570 38713 gene locus_tag LOCUS_03430 39570 38713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03430 40211 39492 gene locus_tag LOCUS_03440 40211 39492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03440 43538 40251 gene locus_tag LOCUS_03450 43538 40251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 46816 43535 gene locus_tag LOCUS_03460 46816 43535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 47396 46818 gene locus_tag LOCUS_03470 47396 46818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 48917 47424 gene locus_tag LOCUS_03480 48917 47424 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794975.1 protein_id gnl|my_center|LOCUS_03480 51959 48945 gene locus_tag LOCUS_03490 51959 48945 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403137.1 protein_id gnl|my_center|LOCUS_03490 52237 55200 gene locus_tag LOCUS_03500 52237 55200 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_03500 56480 55233 gene locus_tag LOCUS_03510 56480 55233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 58855 56477 gene locus_tag LOCUS_03520 58855 56477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 60278 58857 gene locus_tag LOCUS_03530 60278 58857 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403033.1 protein_id gnl|my_center|LOCUS_03530 61361 60279 gene locus_tag LOCUS_03540 61361 60279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 61753 61376 gene locus_tag LOCUS_03550 61753 61376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 64912 61778 gene locus_tag LOCUS_03560 64912 61778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 65287 64985 gene locus_tag LOCUS_03570 65287 64985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 65840 67291 gene locus_tag LOCUS_03580 gene pepA 65840 67291 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD74 protein_id gnl|my_center|LOCUS_03580 69433 67292 gene locus_tag LOCUS_03590 69433 67292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 70058 69573 gene locus_tag LOCUS_03600 gene ogt1 70058 69573 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN0 protein_id gnl|my_center|LOCUS_03600 70117 71415 gene locus_tag LOCUS_03610 gene murF 70117 71415 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF0 protein_id gnl|my_center|LOCUS_03610 <73527 71399 gene locus_tag LOCUS_03620 <73527 71399 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein >Feature sequence005 12354 11149 gene locus_tag LOCUS_03630 12354 11149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 12460 14187 gene locus_tag LOCUS_03640 gene ilvD5 12460 14187 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976013.1 protein_id gnl|my_center|LOCUS_03640 14276 15250 gene locus_tag LOCUS_03650 14276 15250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764326.1 protein_id gnl|my_center|LOCUS_03650 15333 16430 gene locus_tag LOCUS_03660 15333 16430 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0X6 protein_id gnl|my_center|LOCUS_03660 16476 16724 gene locus_tag LOCUS_03670 16476 16724 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403584.1 protein_id gnl|my_center|LOCUS_03670 16837 18609 gene locus_tag LOCUS_03680 16837 18609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 18613 19236 gene locus_tag LOCUS_03690 18613 19236 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108811.1 protein_id gnl|my_center|LOCUS_03690 19240 19932 gene locus_tag LOCUS_03700 19240 19932 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TX7 protein_id gnl|my_center|LOCUS_03700 19963 20922 gene locus_tag LOCUS_03710 19963 20922 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760322.1 protein_id gnl|my_center|LOCUS_03710 20999 21454 gene locus_tag LOCUS_03720 20999 21454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 21466 21999 gene locus_tag LOCUS_03730 21466 21999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 22137 22763 gene locus_tag LOCUS_03740 gene pyrE 22137 22763 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1D5 protein_id gnl|my_center|LOCUS_03740 22754 23566 gene locus_tag LOCUS_03750 22754 23566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948253.1 protein_id gnl|my_center|LOCUS_03750 24608 23559 gene locus_tag LOCUS_03760 24608 23559 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927167.1 protein_id gnl|my_center|LOCUS_03760 25139 24708 gene locus_tag LOCUS_03770 gene rpiB 25139 24708 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964575.1 protein_id gnl|my_center|LOCUS_03770 25222 25941 gene locus_tag LOCUS_03780 25222 25941 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX2 protein_id gnl|my_center|LOCUS_03780 27296 25938 gene locus_tag LOCUS_03790 27296 25938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 28246 27293 gene locus_tag LOCUS_03800 28246 27293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 31691 28347 gene locus_tag LOCUS_03810 31691 28347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 31835 32326 gene locus_tag LOCUS_03820 31835 32326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 33984 32323 gene locus_tag LOCUS_03830 33984 32323 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114249.1 protein_id gnl|my_center|LOCUS_03830 34095 35360 gene locus_tag LOCUS_03840 34095 35360 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963479.1 protein_id gnl|my_center|LOCUS_03840 36610 35357 gene locus_tag LOCUS_03850 36610 35357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963488.1 protein_id gnl|my_center|LOCUS_03850 36816 37517 gene locus_tag LOCUS_03860 36816 37517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 38867 37518 gene locus_tag LOCUS_03870 38867 37518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 39056 39454 gene locus_tag LOCUS_03880 39056 39454 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761924.1 protein_id gnl|my_center|LOCUS_03880 39464 40675 gene locus_tag LOCUS_03890 39464 40675 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797236.1 protein_id gnl|my_center|LOCUS_03890 40672 41145 gene locus_tag LOCUS_03900 40672 41145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 41142 43604 gene locus_tag LOCUS_03910 41142 43604 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057830.1 protein_id gnl|my_center|LOCUS_03910 43605 44615 gene locus_tag LOCUS_03920 43605 44615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 44653 46455 gene locus_tag LOCUS_03930 44653 46455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 47269 46517 gene locus_tag LOCUS_03940 47269 46517 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477173.1 protein_id gnl|my_center|LOCUS_03940 47540 49009 gene locus_tag LOCUS_03950 gene glyQS 47540 49009 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1P8 protein_id gnl|my_center|LOCUS_03950 49248 50129 gene locus_tag LOCUS_03960 49248 50129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 50307 51884 gene locus_tag LOCUS_03970 50307 51884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 52032 54590 gene locus_tag LOCUS_03980 52032 54590 CDS product glucan 1,4-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039175.1 protein_id gnl|my_center|LOCUS_03980 54708 55388 gene locus_tag LOCUS_03990 54708 55388 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFP4 protein_id gnl|my_center|LOCUS_03990 55381 55698 gene locus_tag LOCUS_04000 55381 55698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 55700 56206 gene locus_tag LOCUS_04010 55700 56206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 56308 56697 gene locus_tag LOCUS_04020 56308 56697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 56913 57743 gene locus_tag LOCUS_04030 56913 57743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 58120 59580 gene locus_tag LOCUS_04040 58120 59580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 59803 59630 gene locus_tag LOCUS_04050 59803 59630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 61909 59882 gene locus_tag LOCUS_04060 61909 59882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 62116 63246 gene locus_tag LOCUS_04070 62116 63246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 63252 63899 gene locus_tag LOCUS_04080 63252 63899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 63906 65048 gene locus_tag LOCUS_04090 63906 65048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 66329 65070 gene locus_tag LOCUS_04100 66329 65070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 66528 67181 gene locus_tag LOCUS_04110 66528 67181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 67211 68587 gene locus_tag LOCUS_04120 67211 68587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 69560 68700 gene locus_tag LOCUS_04130 69560 68700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 69969 70637 gene locus_tag LOCUS_04140 69969 70637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 70756 71583 gene locus_tag LOCUS_04150 70756 71583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 >Feature sequence006 <1 1885 gene locus_tag LOCUS_04160 <1 1885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392674.1:metallophosphoesterase 2723 1887 gene locus_tag LOCUS_04170 2723 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 3230 5185 gene locus_tag LOCUS_04180 gene gyrB 3230 5185 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX10 protein_id gnl|my_center|LOCUS_04180 5313 5921 gene locus_tag LOCUS_04190 5313 5921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 5984 7678 gene locus_tag LOCUS_04200 5984 7678 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527994.1 protein_id gnl|my_center|LOCUS_04200 9256 7772 gene locus_tag LOCUS_04210 9256 7772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 9826 9257 gene locus_tag LOCUS_04220 9826 9257 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_04220 10940 9909 gene locus_tag LOCUS_04230 gene ribD 10940 9909 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H164 protein_id gnl|my_center|LOCUS_04230 11227 10937 gene locus_tag LOCUS_04240 11227 10937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 13171 11357 gene locus_tag LOCUS_04250 13171 11357 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108480.1 protein_id gnl|my_center|LOCUS_04250 15000 13384 gene locus_tag LOCUS_04260 gene pnbA 15000 13384 CDS product para-nitrobenzyl esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37967 protein_id gnl|my_center|LOCUS_04260 16645 15008 gene locus_tag LOCUS_04270 16645 15008 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N41 protein_id gnl|my_center|LOCUS_04270 16719 17471 gene locus_tag LOCUS_04280 16719 17471 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 protein_id gnl|my_center|LOCUS_04280 18101 17499 gene locus_tag LOCUS_04290 18101 17499 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964392.1 protein_id gnl|my_center|LOCUS_04290 18345 18923 gene locus_tag LOCUS_04300 18345 18923 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108257.1 protein_id gnl|my_center|LOCUS_04300 19791 19435 gene locus_tag LOCUS_04310 19791 19435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 22259 19788 gene locus_tag LOCUS_04320 22259 19788 CDS product beta-lactam antibiotic acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454344.1 protein_id gnl|my_center|LOCUS_04320 22386 24614 gene locus_tag LOCUS_04330 22386 24614 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_04330 27039 24628 gene locus_tag LOCUS_04340 gene fecA 27039 24628 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963607.1 protein_id gnl|my_center|LOCUS_04340 28500 27118 gene locus_tag LOCUS_04350 28500 27118 CDS product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 protein_id gnl|my_center|LOCUS_04350 29872 28502 gene locus_tag LOCUS_04360 29872 28502 CDS product thiol oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963595.1 protein_id gnl|my_center|LOCUS_04360 31023 29881 gene locus_tag LOCUS_04370 31023 29881 CDS product lipoprotein precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963596.1 protein_id gnl|my_center|LOCUS_04370 32066 31047 gene locus_tag LOCUS_04380 32066 31047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 33166 32066 gene locus_tag LOCUS_04390 33166 32066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 34038 33529 gene locus_tag LOCUS_04400 34038 33529 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878337.1 protein_id gnl|my_center|LOCUS_04400 34364 34086 gene locus_tag LOCUS_04410 34364 34086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 34381 34638 gene locus_tag LOCUS_04420 34381 34638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 35015 35329 gene locus_tag LOCUS_04430 35015 35329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 36906 35326 gene locus_tag LOCUS_04440 36906 35326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 37102 38337 gene locus_tag LOCUS_04450 gene ispH 37102 38337 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404617.1 protein_id gnl|my_center|LOCUS_04450 38433 38627 gene locus_tag LOCUS_04460 38433 38627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 40002 38662 gene locus_tag LOCUS_04470 gene pyrC1 40002 38662 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW07 protein_id gnl|my_center|LOCUS_04470 41122 40007 gene locus_tag LOCUS_04480 41122 40007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 41870 41190 gene locus_tag LOCUS_04490 41870 41190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 41964 42431 gene locus_tag LOCUS_04500 41964 42431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963852.1 protein_id gnl|my_center|LOCUS_04500 42432 43091 gene locus_tag LOCUS_04510 42432 43091 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788686.1 protein_id gnl|my_center|LOCUS_04510 43088 43474 gene locus_tag LOCUS_04520 43088 43474 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688312.1 protein_id gnl|my_center|LOCUS_04520 44483 43464 gene locus_tag LOCUS_04530 44483 43464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 44706 45656 gene locus_tag LOCUS_04540 44706 45656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 46745 45720 gene locus_tag LOCUS_04550 46745 45720 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797516.1 protein_id gnl|my_center|LOCUS_04550 46838 47662 gene locus_tag LOCUS_04560 46838 47662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 47734 48732 gene locus_tag LOCUS_04570 gene yfnF 47734 48732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O06484 protein_id gnl|my_center|LOCUS_04570 48734 49990 gene locus_tag LOCUS_04580 48734 49990 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259615.1 protein_id gnl|my_center|LOCUS_04580 49987 50703 gene locus_tag LOCUS_04590 49987 50703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 50710 51681 gene locus_tag LOCUS_04600 50710 51681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 51683 52717 gene locus_tag LOCUS_04610 51683 52717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 54204 52714 gene locus_tag LOCUS_04620 gene cysS 54204 52714 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX80 protein_id gnl|my_center|LOCUS_04620 54327 54989 gene locus_tag LOCUS_04630 54327 54989 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963510.1 protein_id gnl|my_center|LOCUS_04630 >Feature sequence007 2536 3762 gene locus_tag LOCUS_04640 2536 3762 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963858.1 protein_id gnl|my_center|LOCUS_04640 4298 4693 gene locus_tag LOCUS_04650 4298 4693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 6191 4782 gene locus_tag LOCUS_04660 6191 4782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 7199 6429 gene locus_tag LOCUS_04670 7199 6429 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962746.1 protein_id gnl|my_center|LOCUS_04670 7559 7200 gene locus_tag LOCUS_04680 gene apaG 7559 7200 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962585.1 protein_id gnl|my_center|LOCUS_04680 7656 8321 gene locus_tag LOCUS_04690 gene ung2 7656 8321 CDS product uracil-DNA glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM3 protein_id gnl|my_center|LOCUS_04690 8325 9182 gene locus_tag LOCUS_04700 8325 9182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 10357 9233 gene locus_tag LOCUS_04710 10357 9233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 11156 10440 gene locus_tag LOCUS_04720 11156 10440 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783772.1 protein_id gnl|my_center|LOCUS_04720 12044 11178 gene locus_tag LOCUS_04730 12044 11178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 12964 12080 gene locus_tag LOCUS_04740 12964 12080 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760916.1 protein_id gnl|my_center|LOCUS_04740 13616 12969 gene locus_tag LOCUS_04750 13616 12969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 13667 14743 gene locus_tag LOCUS_04760 13667 14743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 17133 14794 gene locus_tag LOCUS_04770 17133 14794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 17470 17126 gene locus_tag LOCUS_04780 17470 17126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 17547 18869 gene locus_tag LOCUS_04790 17547 18869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 19086 19742 gene locus_tag LOCUS_04800 gene tal 19086 19742 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG9 protein_id gnl|my_center|LOCUS_04800 20253 19795 gene locus_tag LOCUS_04810 20253 19795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 20433 21107 gene locus_tag LOCUS_04820 gene ftsE 20433 21107 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_04820 21795 21091 gene locus_tag LOCUS_04830 21795 21091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 23339 21771 gene locus_tag LOCUS_04840 gene porX 23339 21771 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_04840 24050 23385 gene locus_tag LOCUS_04850 gene kdsB 24050 23385 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9S0 protein_id gnl|my_center|LOCUS_04850 24258 25166 gene locus_tag LOCUS_04860 24258 25166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 25220 25996 gene locus_tag LOCUS_04870 25220 25996 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962792.1 protein_id gnl|my_center|LOCUS_04870 26064 26939 gene locus_tag LOCUS_04880 26064 26939 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167549.1 protein_id gnl|my_center|LOCUS_04880 26960 27562 gene locus_tag LOCUS_04890 26960 27562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_04890 27605 28459 gene locus_tag LOCUS_04900 27605 28459 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964038.1 protein_id gnl|my_center|LOCUS_04900 28511 29389 gene locus_tag LOCUS_04910 28511 29389 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2U5 protein_id gnl|my_center|LOCUS_04910 29391 29702 gene locus_tag LOCUS_04920 29391 29702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 29708 30496 gene locus_tag LOCUS_04930 gene uppP 29708 30496 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H239 protein_id gnl|my_center|LOCUS_04930 30496 31191 gene locus_tag LOCUS_04940 gene truB 30496 31191 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H238 protein_id gnl|my_center|LOCUS_04940 31166 32092 gene locus_tag LOCUS_04950 gene ribF 31166 32092 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW76 protein_id gnl|my_center|LOCUS_04950 33162 32089 gene locus_tag LOCUS_04960 gene pheA 33162 32089 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858741.1 protein_id gnl|my_center|LOCUS_04960 34475 33171 gene locus_tag LOCUS_04970 gene gltP 34475 33171 CDS product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_04970 36400 34493 gene locus_tag LOCUS_04980 gene parE 36400 34493 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC8 protein_id gnl|my_center|LOCUS_04980 36551 38980 gene locus_tag LOCUS_04990 36551 38980 CDS product capsule polysaccharide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202522.1 protein_id gnl|my_center|LOCUS_04990 38990 40087 gene locus_tag LOCUS_05000 38990 40087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 40101 40934 gene locus_tag LOCUS_05010 gene xapG 40101 40934 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D15 protein_id gnl|my_center|LOCUS_05010 40936 42177 gene locus_tag LOCUS_05020 gene rfbB 40936 42177 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963401.1 protein_id gnl|my_center|LOCUS_05020 42235 43320 gene locus_tag LOCUS_05030 42235 43320 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965647.1 protein_id gnl|my_center|LOCUS_05030 43317 44489 gene locus_tag LOCUS_05040 43317 44489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 45051 44467 gene locus_tag LOCUS_05050 gene rnhB 45051 44467 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A293 protein_id gnl|my_center|LOCUS_05050 46629 45115 gene locus_tag LOCUS_05060 gene gltD 46629 45115 CDS product dihydropyrimidine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513713.1 protein_id gnl|my_center|LOCUS_05060 51219 46663 gene locus_tag LOCUS_05070 gene gltB 51219 46663 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262574.1 protein_id gnl|my_center|LOCUS_05070 52770 51514 gene locus_tag LOCUS_05080 52770 51514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 53803 52862 gene locus_tag LOCUS_05090 gene cysD 53803 52862 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYJ4 protein_id gnl|my_center|LOCUS_05090 54486 53812 gene locus_tag LOCUS_05100 gene cysH 54486 53812 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993603.1 protein_id gnl|my_center|LOCUS_05100 55370 54486 gene locus_tag LOCUS_05110 55370 54486 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUE5 protein_id gnl|my_center|LOCUS_05110 56130 55372 gene locus_tag LOCUS_05120 56130 55372 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496681.1 protein_id gnl|my_center|LOCUS_05120 >Feature sequence008 528 4325 gene locus_tag LOCUS_05130 528 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 6200 4329 gene locus_tag LOCUS_05140 6200 4329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 6461 7603 gene locus_tag LOCUS_05150 6461 7603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 7603 8361 gene locus_tag LOCUS_05160 7603 8361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 8435 8623 gene locus_tag LOCUS_05170 8435 8623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 8638 9690 gene locus_tag LOCUS_05180 8638 9690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 9840 10844 gene locus_tag LOCUS_05190 gene asd 9840 10844 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX07 protein_id gnl|my_center|LOCUS_05190 11262 10951 gene locus_tag LOCUS_05200 11262 10951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 13008 11338 gene locus_tag LOCUS_05210 13008 11338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 13217 14098 gene locus_tag LOCUS_05220 13217 14098 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347004.1 protein_id gnl|my_center|LOCUS_05220 14226 15524 gene locus_tag LOCUS_05230 14226 15524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 15804 16733 gene locus_tag LOCUS_05240 15804 16733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 16940 19102 gene locus_tag LOCUS_05250 16940 19102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 19436 20563 gene locus_tag LOCUS_05260 19436 20563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 20774 21355 gene locus_tag LOCUS_05270 20774 21355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 21637 21359 gene locus_tag LOCUS_05280 21637 21359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 22526 21756 gene locus_tag LOCUS_05290 22526 21756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038982.1 protein_id gnl|my_center|LOCUS_05290 23611 22625 gene locus_tag LOCUS_05300 gene mtnK 23611 22625 CDS product methylthioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HED2 protein_id gnl|my_center|LOCUS_05300 24056 23622 gene locus_tag LOCUS_05310 24056 23622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 24339 25436 gene locus_tag LOCUS_05320 24339 25436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 25448 26830 gene locus_tag LOCUS_05330 25448 26830 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120406.1 protein_id gnl|my_center|LOCUS_05330 26894 28246 gene locus_tag LOCUS_05340 26894 28246 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108896.1 protein_id gnl|my_center|LOCUS_05340 28304 29059 gene locus_tag LOCUS_05350 28304 29059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 29067 29897 gene locus_tag LOCUS_05360 29067 29897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 31480 29894 gene locus_tag LOCUS_05370 31480 29894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 31814 32698 gene locus_tag LOCUS_05380 31814 32698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 32711 33616 gene locus_tag LOCUS_05390 32711 33616 CDS product hydrolase TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368544.1 protein_id gnl|my_center|LOCUS_05390 33625 34518 gene locus_tag LOCUS_05400 33625 34518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123872.1 protein_id gnl|my_center|LOCUS_05400 34536 35714 gene locus_tag LOCUS_05410 gene aroB 34536 35714 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368549.1 protein_id gnl|my_center|LOCUS_05410 35695 36930 gene locus_tag LOCUS_05420 35695 36930 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368548.1 protein_id gnl|my_center|LOCUS_05420 36908 38272 gene locus_tag LOCUS_05430 36908 38272 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031019.1 protein_id gnl|my_center|LOCUS_05430 39664 38348 gene locus_tag LOCUS_05440 gene gluP 39664 38348 CDS product glucose/galactose MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038511.1 protein_id gnl|my_center|LOCUS_05440 40134 41351 gene locus_tag LOCUS_05450 40134 41351 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403371.1 protein_id gnl|my_center|LOCUS_05450 42172 41417 gene locus_tag LOCUS_05460 42172 41417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 42291 42497 gene locus_tag LOCUS_05470 42291 42497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 42658 42873 gene locus_tag LOCUS_05480 42658 42873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 42967 44475 gene locus_tag LOCUS_05490 42967 44475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 44506 45279 gene locus_tag LOCUS_05500 44506 45279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 45443 48190 gene locus_tag LOCUS_05510 45443 48190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 48174 48572 gene locus_tag LOCUS_05520 48174 48572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 50001 48649 gene locus_tag LOCUS_05530 50001 48649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096324.1 protein_id gnl|my_center|LOCUS_05530 51134 49998 gene locus_tag LOCUS_05540 51134 49998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368633.1 protein_id gnl|my_center|LOCUS_05540 53196 51166 gene locus_tag LOCUS_05550 53196 51166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207299.1 protein_id gnl|my_center|LOCUS_05550 54356 53409 gene locus_tag LOCUS_05560 gene hindVM 54356 53409 CDS product modification methylase HindV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45000 protein_id gnl|my_center|LOCUS_05560 55444 54353 gene locus_tag LOCUS_05570 gene hindVRP 55444 54353 CDS product putative type-2 restriction enzyme HindVP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44999 protein_id gnl|my_center|LOCUS_05570 >Feature sequence009 298 2658 gene locus_tag LOCUS_05580 gene hsdR 298 2658 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819015.1 protein_id gnl|my_center|LOCUS_05580 2658 4094 gene locus_tag LOCUS_05590 2658 4094 CDS product restriction endonuclease EcoEI subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001540814.1 protein_id gnl|my_center|LOCUS_05590 4095 5828 gene locus_tag LOCUS_05600 4095 5828 CDS product HsdS polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105648.1 protein_id gnl|my_center|LOCUS_05600 5832 6563 gene locus_tag LOCUS_05610 5832 6563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 6819 7139 gene locus_tag LOCUS_05620 6819 7139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 7147 7878 gene locus_tag LOCUS_05630 7147 7878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 8162 8887 gene locus_tag LOCUS_05640 8162 8887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485360.1 protein_id gnl|my_center|LOCUS_05640 8884 9867 gene locus_tag LOCUS_05650 8884 9867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202383.1 protein_id gnl|my_center|LOCUS_05650 10906 9938 gene locus_tag LOCUS_05660 10906 9938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107178.1 protein_id gnl|my_center|LOCUS_05660 12033 10969 gene locus_tag LOCUS_05670 12033 10969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 12223 12041 gene locus_tag LOCUS_05680 12223 12041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 13706 12816 gene locus_tag LOCUS_05690 13706 12816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 14916 13696 gene locus_tag LOCUS_05700 14916 13696 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362019.1 protein_id gnl|my_center|LOCUS_05700 15434 16222 gene locus_tag LOCUS_05710 15434 16222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 16752 17426 gene locus_tag LOCUS_05720 16752 17426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 17879 19180 gene locus_tag LOCUS_05730 17879 19180 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963825.1 protein_id gnl|my_center|LOCUS_05730 19905 19189 gene locus_tag LOCUS_05740 19905 19189 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYY2 protein_id gnl|my_center|LOCUS_05740 20478 19945 gene locus_tag LOCUS_05750 20478 19945 CDS product DNA damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963000.1 protein_id gnl|my_center|LOCUS_05750 20692 21291 gene locus_tag LOCUS_05760 20692 21291 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932332.1 protein_id gnl|my_center|LOCUS_05760 21317 21622 gene locus_tag LOCUS_05770 21317 21622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 21701 22300 gene locus_tag LOCUS_05780 gene gmk 21701 22300 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI8 protein_id gnl|my_center|LOCUS_05780 23022 22297 gene locus_tag LOCUS_05790 23022 22297 CDS product UPF0271 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BQ3 protein_id gnl|my_center|LOCUS_05790 23893 23024 gene locus_tag LOCUS_05800 23893 23024 CDS product KipI antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382227.1 protein_id gnl|my_center|LOCUS_05800 24732 24073 gene locus_tag LOCUS_05810 24732 24073 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249288.1 protein_id gnl|my_center|LOCUS_05810 26761 24722 gene locus_tag LOCUS_05820 gene yyaL 26761 24722 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964202.1 protein_id gnl|my_center|LOCUS_05820 28319 26754 gene locus_tag LOCUS_05830 28319 26754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 28438 28893 gene locus_tag LOCUS_05840 28438 28893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 28896 30371 gene locus_tag LOCUS_05850 28896 30371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 31046 30450 gene locus_tag LOCUS_05860 31046 30450 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917951.1 protein_id gnl|my_center|LOCUS_05860 31445 31179 gene locus_tag LOCUS_05870 gene rpmA 31445 31179 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XL7 protein_id gnl|my_center|LOCUS_05870 31817 31506 gene locus_tag LOCUS_05880 31817 31506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 32568 31927 gene locus_tag LOCUS_05890 32568 31927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963792.1 protein_id gnl|my_center|LOCUS_05890 33114 32587 gene locus_tag LOCUS_05900 33114 32587 CDS product putative 5'(3')-deoxyribonucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CTG7 protein_id gnl|my_center|LOCUS_05900 34711 33500 gene locus_tag LOCUS_05910 34711 33500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 34986 34717 gene locus_tag LOCUS_05920 34986 34717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 35602 35027 gene locus_tag LOCUS_05930 35602 35027 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A749 protein_id gnl|my_center|LOCUS_05930 35692 36150 gene locus_tag LOCUS_05940 35692 36150 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_05940 36147 37334 gene locus_tag LOCUS_05950 36147 37334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 37394 37711 gene locus_tag LOCUS_05960 37394 37711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920128.1 protein_id gnl|my_center|LOCUS_05960 37708 39009 gene locus_tag LOCUS_05970 37708 39009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 39099 40301 gene locus_tag LOCUS_05980 39099 40301 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107265.1 protein_id gnl|my_center|LOCUS_05980 40363 41286 gene locus_tag LOCUS_05990 gene pyrB 40363 41286 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I8 protein_id gnl|my_center|LOCUS_05990 41286 41795 gene locus_tag LOCUS_06000 41286 41795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 41792 42286 gene locus_tag LOCUS_06010 41792 42286 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A668 protein_id gnl|my_center|LOCUS_06010 42294 43817 gene locus_tag LOCUS_06020 42294 43817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 44041 43808 gene locus_tag LOCUS_06030 44041 43808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632579.1 protein_id gnl|my_center|LOCUS_06030 44446 44066 gene locus_tag LOCUS_06040 44446 44066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 44567 45853 gene locus_tag LOCUS_06050 44567 45853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 45860 46912 gene locus_tag LOCUS_06060 45860 46912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 47700 46909 gene locus_tag LOCUS_06070 gene rsmA 47700 46909 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR5 protein_id gnl|my_center|LOCUS_06070 47773 50973 gene locus_tag LOCUS_06080 47773 50973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 >Feature sequence010 1634 513 gene locus_tag LOCUS_06090 1634 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 2614 1757 gene locus_tag LOCUS_06100 2614 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203200.1 protein_id gnl|my_center|LOCUS_06100 3525 2821 gene locus_tag LOCUS_06110 3525 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 4463 3525 gene locus_tag LOCUS_06120 gene fcl 4463 3525 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FI1 protein_id gnl|my_center|LOCUS_06120 4555 5541 gene locus_tag LOCUS_06130 4555 5541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 8181 5596 gene locus_tag LOCUS_06140 8181 5596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 10557 8209 gene locus_tag LOCUS_06150 gene rnr 10557 8209 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2G8 protein_id gnl|my_center|LOCUS_06150 10714 11775 gene locus_tag LOCUS_06160 gene paaE 10714 11775 CDS product flavodoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964555.1 protein_id gnl|my_center|LOCUS_06160 12509 11820 gene locus_tag LOCUS_06170 12509 11820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 12786 13259 gene locus_tag LOCUS_06180 12786 13259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 14169 13261 gene locus_tag LOCUS_06190 14169 13261 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403550.1 protein_id gnl|my_center|LOCUS_06190 14893 14297 gene locus_tag LOCUS_06200 gene engB 14893 14297 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UN4 protein_id gnl|my_center|LOCUS_06200 15312 14893 gene locus_tag LOCUS_06210 15312 14893 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054512.1 protein_id gnl|my_center|LOCUS_06210 17132 15321 gene locus_tag LOCUS_06220 17132 15321 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962990.1 protein_id gnl|my_center|LOCUS_06220 18111 17134 gene locus_tag LOCUS_06230 18111 17134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 19185 18193 gene locus_tag LOCUS_06240 19185 18193 CDS product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703041.1 protein_id gnl|my_center|LOCUS_06240 21051 19234 gene locus_tag LOCUS_06250 21051 19234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 23439 21220 gene locus_tag LOCUS_06260 23439 21220 CDS product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481838.1 protein_id gnl|my_center|LOCUS_06260 26770 23585 gene locus_tag LOCUS_06270 26770 23585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 26893 27945 gene locus_tag LOCUS_06280 26893 27945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919309.1 protein_id gnl|my_center|LOCUS_06280 27935 29002 gene locus_tag LOCUS_06290 27935 29002 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791384.1 protein_id gnl|my_center|LOCUS_06290 29565 28999 gene locus_tag LOCUS_06300 gene pabA 29565 28999 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962676.1 protein_id gnl|my_center|LOCUS_06300 30062 29583 gene locus_tag LOCUS_06310 30062 29583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 31494 30067 gene locus_tag LOCUS_06320 gene trpE 31494 30067 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962677.1 protein_id gnl|my_center|LOCUS_06320 32350 31736 gene locus_tag LOCUS_06330 gene sodA 32350 31736 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW03 protein_id gnl|my_center|LOCUS_06330 32868 32410 gene locus_tag LOCUS_06340 gene tadA 32868 32410 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB8 protein_id gnl|my_center|LOCUS_06340 32957 33808 gene locus_tag LOCUS_06350 32957 33808 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786213.1 protein_id gnl|my_center|LOCUS_06350 33879 34154 gene locus_tag LOCUS_06360 33879 34154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 34736 34155 gene locus_tag LOCUS_06370 34736 34155 CDS product putative cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48636 protein_id gnl|my_center|LOCUS_06370 34833 35945 gene locus_tag LOCUS_06380 34833 35945 CDS product glucose-fructose oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919107.1 protein_id gnl|my_center|LOCUS_06380 36527 36030 gene locus_tag LOCUS_06390 36527 36030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 36734 37627 gene locus_tag LOCUS_06400 36734 37627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 37896 37633 gene locus_tag LOCUS_06410 37896 37633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 38247 39095 gene locus_tag LOCUS_06420 38247 39095 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764311.1 protein_id gnl|my_center|LOCUS_06420 39129 39644 gene locus_tag LOCUS_06430 39129 39644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919508.1 protein_id gnl|my_center|LOCUS_06430 39698 41404 gene locus_tag LOCUS_06440 39698 41404 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919507.1 protein_id gnl|my_center|LOCUS_06440 42034 41834 gene locus_tag LOCUS_06450 42034 41834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 42262 42744 gene locus_tag LOCUS_06460 gene moaC 42262 42744 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBW9 protein_id gnl|my_center|LOCUS_06460 42836 43123 gene locus_tag LOCUS_06470 42836 43123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 43427 43131 gene locus_tag LOCUS_06480 43427 43131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 43641 43417 gene locus_tag LOCUS_06490 43641 43417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 43701 44795 gene locus_tag LOCUS_06500 43701 44795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 45240 44785 gene locus_tag LOCUS_06510 gene moaE 45240 44785 CDS product molybdopterin synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31705 protein_id gnl|my_center|LOCUS_06510 45466 45224 gene locus_tag LOCUS_06520 45466 45224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 45774 45469 gene locus_tag LOCUS_06530 45774 45469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 46085 45843 gene locus_tag LOCUS_06540 gene moaD 46085 45843 CDS product molybdopterin converting factor small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_213755.1 protein_id gnl|my_center|LOCUS_06540 46832 46104 gene locus_tag LOCUS_06550 46832 46104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 47230 46874 gene locus_tag LOCUS_06560 47230 46874 CDS product molybdenum transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356595.1 protein_id gnl|my_center|LOCUS_06560 47950 47261 gene locus_tag LOCUS_06570 47950 47261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 49287 48163 gene locus_tag LOCUS_06580 49287 48163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256669.1 protein_id gnl|my_center|LOCUS_06580 50189 49284 gene locus_tag LOCUS_06590 50189 49284 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256872.1 protein_id gnl|my_center|LOCUS_06590 51119 50271 gene locus_tag LOCUS_06600 51119 50271 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259304.1 protein_id gnl|my_center|LOCUS_06600 <51720 51160 gene locus_tag LOCUS_06610 <51720 51160 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388721.1:carbon monoxide dehydrogenase >Feature sequence011 2493 3536 gene locus_tag LOCUS_06620 2493 3536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 4415 3537 gene locus_tag LOCUS_06630 gene miaA1 4415 3537 CDS product tRNA dimethylallyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A018 protein_id gnl|my_center|LOCUS_06630 4483 5112 gene locus_tag LOCUS_06640 4483 5112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 5160 5900 gene locus_tag LOCUS_06650 gene ste14 5160 5900 CDS product lipid A Kdo2 1-phosphate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173879.1 protein_id gnl|my_center|LOCUS_06650 7747 5897 gene locus_tag LOCUS_06660 7747 5897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 8650 7904 gene locus_tag LOCUS_06670 8650 7904 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_06670 9624 8647 gene locus_tag LOCUS_06680 9624 8647 CDS product carbohydrate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53WD3 protein_id gnl|my_center|LOCUS_06680 10132 9680 gene locus_tag LOCUS_06690 10132 9680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 11218 10241 gene locus_tag LOCUS_06700 11218 10241 CDS product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108502.1 protein_id gnl|my_center|LOCUS_06700 11340 11564 gene locus_tag LOCUS_06710 11340 11564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06710 11592 12182 gene locus_tag LOCUS_06720 11592 12182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06720 12237 12749 gene locus_tag LOCUS_06730 12237 12749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 14519 12753 gene locus_tag LOCUS_06740 gene argS 14519 12753 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3X5 protein_id gnl|my_center|LOCUS_06740 14675 15547 gene locus_tag LOCUS_06750 14675 15547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_810921.2 protein_id gnl|my_center|LOCUS_06750 15731 18838 gene locus_tag LOCUS_06760 15731 18838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 18921 19466 gene locus_tag LOCUS_06770 18921 19466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208071.1 protein_id gnl|my_center|LOCUS_06770 19838 19470 gene locus_tag LOCUS_06780 19838 19470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962264.1 protein_id gnl|my_center|LOCUS_06780 19983 20969 gene locus_tag LOCUS_06790 19983 20969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 21859 20966 gene locus_tag LOCUS_06800 21859 20966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 23496 22360 gene locus_tag LOCUS_06810 23496 22360 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1ML43 protein_id gnl|my_center|LOCUS_06810 24419 23523 gene locus_tag LOCUS_06820 gene prpB 24419 23523 CDS product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1ML42 protein_id gnl|my_center|LOCUS_06820 25924 24416 gene locus_tag LOCUS_06830 25924 24416 CDS product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390071.1 protein_id gnl|my_center|LOCUS_06830 26643 26005 gene locus_tag LOCUS_06840 26643 26005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 28520 26643 gene locus_tag LOCUS_06850 28520 26643 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963092.1 protein_id gnl|my_center|LOCUS_06850 30457 28559 gene locus_tag LOCUS_06860 gene acsA 30457 28559 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 protein_id gnl|my_center|LOCUS_06860 33367 30605 gene locus_tag LOCUS_06870 33367 30605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 35297 33600 gene locus_tag LOCUS_06880 35297 33600 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262768.1 protein_id gnl|my_center|LOCUS_06880 35559 35299 gene locus_tag LOCUS_06890 35559 35299 CDS product RNA polymerase subunit sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933465.1 protein_id gnl|my_center|LOCUS_06890 37700 35694 gene locus_tag LOCUS_06900 37700 35694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 41392 39191 gene locus_tag LOCUS_06910 gene dpp4 41392 39191 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118275.1 protein_id gnl|my_center|LOCUS_06910 41534 42667 gene locus_tag LOCUS_06920 gene pntAA 41534 42667 CDS product NAD(P) transhydrogenase subunit alpha part 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSB2 protein_id gnl|my_center|LOCUS_06920 42751 43038 gene locus_tag LOCUS_06930 42751 43038 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325302.1 protein_id gnl|my_center|LOCUS_06930 43143 44528 gene locus_tag LOCUS_06940 gene pntB 43143 44528 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL03 protein_id gnl|my_center|LOCUS_06940 44707 46407 gene locus_tag LOCUS_06950 44707 46407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 46772 47374 gene locus_tag LOCUS_06960 46772 47374 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0Q0 protein_id gnl|my_center|LOCUS_06960 50550 47377 gene locus_tag LOCUS_06970 50550 47377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 >Feature sequence012 2439 1162 gene locus_tag LOCUS_06980 2439 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 3063 2503 gene locus_tag LOCUS_06990 3063 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 3751 3098 gene locus_tag LOCUS_07000 3751 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 4497 4045 gene locus_tag LOCUS_07010 4497 4045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 5008 4526 gene locus_tag LOCUS_07020 5008 4526 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023518.1 protein_id gnl|my_center|LOCUS_07020 5497 5012 gene locus_tag LOCUS_07030 5497 5012 CDS product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367985.1 protein_id gnl|my_center|LOCUS_07030 5814 5494 gene locus_tag LOCUS_07040 5814 5494 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098837.1 protein_id gnl|my_center|LOCUS_07040 6032 7354 gene locus_tag LOCUS_07050 6032 7354 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943755.1 protein_id gnl|my_center|LOCUS_07050 7386 8186 gene locus_tag LOCUS_07060 7386 8186 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X2I9 protein_id gnl|my_center|LOCUS_07060 8323 9456 gene locus_tag LOCUS_07070 8323 9456 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_07070 12086 9489 gene locus_tag LOCUS_07080 12086 9489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 13036 12083 gene locus_tag LOCUS_07090 13036 12083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 13525 13043 gene locus_tag LOCUS_07100 13525 13043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 14697 13528 gene locus_tag LOCUS_07110 14697 13528 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529507.1 protein_id gnl|my_center|LOCUS_07110 15616 14729 gene locus_tag LOCUS_07120 15616 14729 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529508.1 protein_id gnl|my_center|LOCUS_07120 16654 15701 gene locus_tag LOCUS_07130 16654 15701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326116.1 protein_id gnl|my_center|LOCUS_07130 19810 16700 gene locus_tag LOCUS_07140 19810 16700 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122060.1 protein_id gnl|my_center|LOCUS_07140 20053 20772 gene locus_tag LOCUS_07150 20053 20772 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933083.1 protein_id gnl|my_center|LOCUS_07150 20772 21104 gene locus_tag LOCUS_07160 20772 21104 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I3A6 protein_id gnl|my_center|LOCUS_07160 21104 22171 gene locus_tag LOCUS_07170 21104 22171 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272562.1 protein_id gnl|my_center|LOCUS_07170 23076 22453 gene locus_tag LOCUS_07180 23076 22453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 24133 23333 gene locus_tag LOCUS_07190 24133 23333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 25067 25903 gene locus_tag LOCUS_07200 25067 25903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 26011 27558 gene locus_tag LOCUS_07210 26011 27558 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UMR7 protein_id gnl|my_center|LOCUS_07210 27548 28099 gene locus_tag LOCUS_07220 gene ctaE 27548 28099 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142159.1 protein_id gnl|my_center|LOCUS_07220 28096 28926 gene locus_tag LOCUS_07230 28096 28926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 28916 29119 gene locus_tag LOCUS_07240 28916 29119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 29112 29624 gene locus_tag LOCUS_07250 gene qcrA 29112 29624 CDS product menaquinol-cytochrome C reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290423.1 protein_id gnl|my_center|LOCUS_07250 29608 31008 gene locus_tag LOCUS_07260 29608 31008 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CM4 protein_id gnl|my_center|LOCUS_07260 32801 31050 gene locus_tag LOCUS_07270 32801 31050 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117992.1 protein_id gnl|my_center|LOCUS_07270 32941 36087 gene locus_tag LOCUS_07280 32941 36087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 37324 36092 gene locus_tag LOCUS_07290 gene yjhB 37324 36092 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021355.1 protein_id gnl|my_center|LOCUS_07290 37425 37712 gene locus_tag LOCUS_07300 37425 37712 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025680.1 protein_id gnl|my_center|LOCUS_07300 37722 38378 gene locus_tag LOCUS_07310 gene yqfA 37722 38378 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250274.1 protein_id gnl|my_center|LOCUS_07310 38809 38387 gene locus_tag LOCUS_07320 38809 38387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 39440 38802 gene locus_tag LOCUS_07330 39440 38802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 39776 40468 gene locus_tag LOCUS_07340 39776 40468 CDS product oxacillin-hydrolyzing class D beta-lactamase OXA-50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099707.1 protein_id gnl|my_center|LOCUS_07340 41433 40522 gene locus_tag LOCUS_07350 41433 40522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 44412 41827 gene locus_tag LOCUS_07360 44412 41827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 44763 44425 gene locus_tag LOCUS_07370 44763 44425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 45651 44890 gene locus_tag LOCUS_07380 45651 44890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 47681 45651 gene locus_tag LOCUS_07390 47681 45651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 48484 48005 gene locus_tag LOCUS_07400 48484 48005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 49198 48566 gene locus_tag LOCUS_07410 49198 48566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 >Feature sequence013 3431 5635 gene locus_tag LOCUS_07420 3431 5635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 5635 5856 gene locus_tag LOCUS_07430 5635 5856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 5909 6202 gene locus_tag LOCUS_07440 5909 6202 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_07440 6199 6555 gene locus_tag LOCUS_07450 6199 6555 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963359.1 protein_id gnl|my_center|LOCUS_07450 7090 6566 gene locus_tag LOCUS_07460 7090 6566 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987006.1 protein_id gnl|my_center|LOCUS_07460 8166 7087 gene locus_tag LOCUS_07470 8166 7087 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202465.1 protein_id gnl|my_center|LOCUS_07470 9106 8150 gene locus_tag LOCUS_07480 9106 8150 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868293.1 protein_id gnl|my_center|LOCUS_07480 9861 9088 gene locus_tag LOCUS_07490 9861 9088 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107730.1 protein_id gnl|my_center|LOCUS_07490 10841 9858 gene locus_tag LOCUS_07500 10841 9858 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202022.1 protein_id gnl|my_center|LOCUS_07500 11439 10909 gene locus_tag LOCUS_07510 11439 10909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 13023 11497 gene locus_tag LOCUS_07520 gene pcd 13023 11497 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 protein_id gnl|my_center|LOCUS_07520 13930 13007 gene locus_tag LOCUS_07530 13930 13007 CDS product DUF1338 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256553.1 protein_id gnl|my_center|LOCUS_07530 15007 13949 gene locus_tag LOCUS_07540 15007 13949 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528745.1 protein_id gnl|my_center|LOCUS_07540 16140 15118 gene locus_tag LOCUS_07550 16140 15118 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704826.1 protein_id gnl|my_center|LOCUS_07550 16549 17115 gene locus_tag LOCUS_07560 16549 17115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 17380 18828 gene locus_tag LOCUS_07570 17380 18828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 18840 20306 gene locus_tag LOCUS_07580 18840 20306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 21818 20373 gene locus_tag LOCUS_07590 21818 20373 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_07590 22021 24339 gene locus_tag LOCUS_07600 22021 24339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 24352 25311 gene locus_tag LOCUS_07610 24352 25311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 25311 25928 gene locus_tag LOCUS_07620 25311 25928 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283365.1 protein_id gnl|my_center|LOCUS_07620 27677 26151 gene locus_tag LOCUS_07630 27677 26151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 28287 27880 gene locus_tag LOCUS_07640 28287 27880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 28463 31558 gene locus_tag LOCUS_07650 28463 31558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 32218 31568 gene locus_tag LOCUS_07660 32218 31568 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456472.1 protein_id gnl|my_center|LOCUS_07660 34140 32218 gene locus_tag LOCUS_07670 34140 32218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 34646 34284 gene locus_tag LOCUS_07680 34646 34284 CDS product penicillinase repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257725.1 protein_id gnl|my_center|LOCUS_07680 34795 36525 gene locus_tag LOCUS_07690 34795 36525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 37145 36522 gene locus_tag LOCUS_07700 37145 36522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 37209 37535 gene locus_tag LOCUS_07710 gene sufA 37209 37535 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_07710 37601 37801 gene locus_tag LOCUS_07720 37601 37801 CDS product PspC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767912.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07720 38071 37865 gene locus_tag LOCUS_07730 38071 37865 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816072.1 protein_id gnl|my_center|LOCUS_07730 39320 38292 gene locus_tag LOCUS_07740 39320 38292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 39989 39441 gene locus_tag LOCUS_07750 39989 39441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 41393 40116 gene locus_tag LOCUS_07760 41393 40116 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225007.1 protein_id gnl|my_center|LOCUS_07760 42396 41443 gene locus_tag LOCUS_07770 42396 41443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 42992 42525 gene locus_tag LOCUS_07780 42992 42525 CDS product TspO/MBR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024098.1 protein_id gnl|my_center|LOCUS_07780 44220 43027 gene locus_tag LOCUS_07790 44220 43027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261739.1 protein_id gnl|my_center|LOCUS_07790 44924 44238 gene locus_tag LOCUS_07800 44924 44238 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261737.1 protein_id gnl|my_center|LOCUS_07800 46169 44955 gene locus_tag LOCUS_07810 46169 44955 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261736.1 protein_id gnl|my_center|LOCUS_07810 >Feature sequence014 1777 803 gene locus_tag LOCUS_07820 gene fmt 1777 803 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PD6 protein_id gnl|my_center|LOCUS_07820 2068 2541 gene locus_tag LOCUS_07830 gene greA 2068 2541 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4N4 protein_id gnl|my_center|LOCUS_07830 2545 2934 gene locus_tag LOCUS_07840 2545 2934 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964456.1 protein_id gnl|my_center|LOCUS_07840 2998 3201 gene locus_tag LOCUS_07850 2998 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 4198 3209 gene locus_tag LOCUS_07860 gene gpsA 4198 3209 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY6 protein_id gnl|my_center|LOCUS_07860 5635 4268 gene locus_tag LOCUS_07870 5635 4268 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_07870 7117 5657 gene locus_tag LOCUS_07880 7117 5657 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964214.1 protein_id gnl|my_center|LOCUS_07880 7303 8568 gene locus_tag LOCUS_07890 7303 8568 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086520.1 protein_id gnl|my_center|LOCUS_07890 8682 9941 gene locus_tag LOCUS_07900 8682 9941 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086520.1 protein_id gnl|my_center|LOCUS_07900 10255 13416 gene locus_tag LOCUS_07910 10255 13416 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766148.1 protein_id gnl|my_center|LOCUS_07910 13436 14998 gene locus_tag LOCUS_07920 13436 14998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403146.1 protein_id gnl|my_center|LOCUS_07920 15156 16562 gene locus_tag LOCUS_07930 15156 16562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 16581 17147 gene locus_tag LOCUS_07940 16581 17147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 17164 19281 gene locus_tag LOCUS_07950 17164 19281 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767036.1 protein_id gnl|my_center|LOCUS_07950 19507 19286 gene locus_tag LOCUS_07960 19507 19286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 19778 20128 gene locus_tag LOCUS_07970 19778 20128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 20145 20816 gene locus_tag LOCUS_07980 20145 20816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 20803 21609 gene locus_tag LOCUS_07990 20803 21609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 21729 22205 gene locus_tag LOCUS_08000 21729 22205 CDS product UPF0311 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89CF5 protein_id gnl|my_center|LOCUS_08000 22190 23095 gene locus_tag LOCUS_08010 22190 23095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 23211 23981 gene locus_tag LOCUS_08020 gene fad 23211 23981 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090568.1 protein_id gnl|my_center|LOCUS_08020 24020 25792 gene locus_tag LOCUS_08030 24020 25792 CDS product feruloyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090569.1 protein_id gnl|my_center|LOCUS_08030 25796 26215 gene locus_tag LOCUS_08040 25796 26215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 26266 27033 gene locus_tag LOCUS_08050 26266 27033 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102518.1 protein_id gnl|my_center|LOCUS_08050 27035 28768 gene locus_tag LOCUS_08060 27035 28768 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266447.1 protein_id gnl|my_center|LOCUS_08060 28785 29906 gene locus_tag LOCUS_08070 28785 29906 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887198.1 protein_id gnl|my_center|LOCUS_08070 30000 31106 gene locus_tag LOCUS_08080 30000 31106 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705310.1 protein_id gnl|my_center|LOCUS_08080 31221 31574 gene locus_tag LOCUS_08090 31221 31574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 31667 32539 gene locus_tag LOCUS_08100 31667 32539 CDS product 4-hydroxyphenyl-beta-ketoacyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971611.1 protein_id gnl|my_center|LOCUS_08100 32536 33465 gene locus_tag LOCUS_08110 32536 33465 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121449.1 protein_id gnl|my_center|LOCUS_08110 33587 34423 gene locus_tag LOCUS_08120 33587 34423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 34568 35539 gene locus_tag LOCUS_08130 34568 35539 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404739.1 protein_id gnl|my_center|LOCUS_08130 35543 36838 gene locus_tag LOCUS_08140 gene citN 35543 36838 CDS product citrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880459.1 protein_id gnl|my_center|LOCUS_08140 36842 38149 gene locus_tag LOCUS_08150 36842 38149 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389228.1 protein_id gnl|my_center|LOCUS_08150 38339 38638 gene locus_tag LOCUS_08160 38339 38638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389227.1 protein_id gnl|my_center|LOCUS_08160 38728 40689 gene locus_tag LOCUS_08170 38728 40689 CDS product acetoacetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259232.1 protein_id gnl|my_center|LOCUS_08170 40815 42113 gene locus_tag LOCUS_08180 40815 42113 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112297.1 protein_id gnl|my_center|LOCUS_08180 43161 42445 gene locus_tag LOCUS_08190 43161 42445 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EM74 protein_id gnl|my_center|LOCUS_08190 43889 43164 gene locus_tag LOCUS_08200 43889 43164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 44762 44022 gene locus_tag LOCUS_08210 44762 44022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 <45941 44902 gene locus_tag LOCUS_08220 <45941 44902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119180.1:oxidoreductase >Feature sequence015 <1 733 gene locus_tag LOCUS_08230 <1 733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q02139:dihydroxy-acid dehydratase 742 2484 gene locus_tag LOCUS_08240 gene ilvB 742 2484 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT6 protein_id gnl|my_center|LOCUS_08240 2486 3031 gene locus_tag LOCUS_08250 gene ilvH 2486 3031 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962616.1 protein_id gnl|my_center|LOCUS_08250 3170 4213 gene locus_tag LOCUS_08260 3170 4213 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108126.1 protein_id gnl|my_center|LOCUS_08260 4292 5539 gene locus_tag LOCUS_08270 gene ilvA 4292 5539 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGL1 protein_id gnl|my_center|LOCUS_08270 7094 5595 gene locus_tag LOCUS_08280 7094 5595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784672.1 protein_id gnl|my_center|LOCUS_08280 10177 7109 gene locus_tag LOCUS_08290 10177 7109 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108195.1 protein_id gnl|my_center|LOCUS_08290 11341 10652 gene locus_tag LOCUS_08300 11341 10652 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_08300 11864 11406 gene locus_tag LOCUS_08310 11864 11406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228619.1 protein_id gnl|my_center|LOCUS_08310 12076 11864 gene locus_tag LOCUS_08320 12076 11864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 13082 12096 gene locus_tag LOCUS_08330 13082 12096 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403438.1 protein_id gnl|my_center|LOCUS_08330 13235 14581 gene locus_tag LOCUS_08340 13235 14581 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVS7 protein_id gnl|my_center|LOCUS_08340 14584 15090 gene locus_tag LOCUS_08350 14584 15090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 15229 15708 gene locus_tag LOCUS_08360 15229 15708 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963832.1 protein_id gnl|my_center|LOCUS_08360 15742 16185 gene locus_tag LOCUS_08370 15742 16185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 17830 16187 gene locus_tag LOCUS_08380 17830 16187 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108599.1 protein_id gnl|my_center|LOCUS_08380 18356 17895 gene locus_tag LOCUS_08390 18356 17895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 19445 18477 gene locus_tag LOCUS_08400 gene nadA 19445 18477 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NP65 protein_id gnl|my_center|LOCUS_08400 20372 19452 gene locus_tag LOCUS_08410 20372 19452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 20482 22098 gene locus_tag LOCUS_08420 gene treA 20482 22098 CDS product periplasmic trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FU73 protein_id gnl|my_center|LOCUS_08420 22598 22104 gene locus_tag LOCUS_08430 22598 22104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 22793 23185 gene locus_tag LOCUS_08440 22793 23185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 23900 23196 gene locus_tag LOCUS_08450 23900 23196 CDS product clavaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545430.1 protein_id gnl|my_center|LOCUS_08450 24063 24794 gene locus_tag LOCUS_08460 24063 24794 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791870.1 protein_id gnl|my_center|LOCUS_08460 24796 25542 gene locus_tag LOCUS_08470 24796 25542 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791872.1 protein_id gnl|my_center|LOCUS_08470 25590 25760 gene locus_tag LOCUS_08480 25590 25760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 25757 25963 gene locus_tag LOCUS_08490 25757 25963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 26224 26012 gene locus_tag LOCUS_08500 26224 26012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 26954 26463 gene locus_tag LOCUS_08510 26954 26463 CDS product HybD peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459789.1 protein_id gnl|my_center|LOCUS_08510 27702 26947 gene locus_tag LOCUS_08520 gene hyaC2 27702 26947 CDS product Ni/Fe-hydrogenase 1 b-type cytochrome subunit HyaC2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_455947.1 protein_id gnl|my_center|LOCUS_08520 29451 27715 gene locus_tag LOCUS_08530 29451 27715 CDS product hydrogenase 2 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944569.1 protein_id gnl|my_center|LOCUS_08530 30594 29476 gene locus_tag LOCUS_08540 gene hupS 30594 29476 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338265.1 protein_id gnl|my_center|LOCUS_08540 30755 30970 gene locus_tag LOCUS_08550 30755 30970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 30963 31304 gene locus_tag LOCUS_08560 gene hypA 30963 31304 CDS product putative hydrogenase nickel incorporation protein HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZSP1 protein_id gnl|my_center|LOCUS_08560 31319 32047 gene locus_tag LOCUS_08570 gene hypB 31319 32047 CDS product hydrogenase accessory protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933458.1 protein_id gnl|my_center|LOCUS_08570 32058 32315 gene locus_tag LOCUS_08580 32058 32315 CDS product hydrogenase assembly protein HypC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878866.1 protein_id gnl|my_center|LOCUS_08580 32602 32862 gene locus_tag LOCUS_08590 32602 32862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 33431 32949 gene locus_tag LOCUS_08600 33431 32949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943062.1 protein_id gnl|my_center|LOCUS_08600 33761 33453 gene locus_tag LOCUS_08610 33761 33453 CDS product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459007.1 protein_id gnl|my_center|LOCUS_08610 35019 33784 gene locus_tag LOCUS_08620 35019 33784 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461847.1 protein_id gnl|my_center|LOCUS_08620 36572 35178 gene locus_tag LOCUS_08630 36572 35178 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_08630 38170 36656 gene locus_tag LOCUS_08640 gene purH 38170 36656 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NT9 protein_id gnl|my_center|LOCUS_08640 38410 40188 gene locus_tag LOCUS_08650 38410 40188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 40261 41559 gene locus_tag LOCUS_08660 40261 41559 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787725.1 protein_id gnl|my_center|LOCUS_08660 42318 41563 gene locus_tag LOCUS_08670 42318 41563 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991075.1 protein_id gnl|my_center|LOCUS_08670 44479 42368 gene locus_tag LOCUS_08680 gene aguA 44479 42368 CDS product xylan alpha-1,2-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3G9 protein_id gnl|my_center|LOCUS_08680 45700 44501 gene locus_tag LOCUS_08690 gene uxuA 45700 44501 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NV92 protein_id gnl|my_center|LOCUS_08690 >Feature sequence016 1718 1897 gene locus_tag LOCUS_08700 1718 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 2197 1844 gene locus_tag LOCUS_08710 2197 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 2684 2262 gene locus_tag LOCUS_08720 2684 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 2647 3864 gene locus_tag LOCUS_08730 2647 3864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 3929 4924 gene locus_tag LOCUS_08740 gene trpD 3929 4924 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ4 protein_id gnl|my_center|LOCUS_08740 5059 5877 gene locus_tag LOCUS_08750 5059 5877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 6467 5874 gene locus_tag LOCUS_08760 6467 5874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 7513 6497 gene locus_tag LOCUS_08770 gene murB 7513 6497 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVY7 protein_id gnl|my_center|LOCUS_08770 7560 8498 gene locus_tag LOCUS_08780 gene hprA 7560 8498 CDS product glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679304.1 protein_id gnl|my_center|LOCUS_08780 8667 9869 gene locus_tag LOCUS_08790 8667 9869 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_08790 11337 10357 gene locus_tag LOCUS_08800 11337 10357 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461492.1 protein_id gnl|my_center|LOCUS_08800 12568 11444 gene locus_tag LOCUS_08810 gene iscS 12568 11444 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SN1 protein_id gnl|my_center|LOCUS_08810 17986 12716 gene locus_tag LOCUS_08820 17986 12716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 18673 18017 gene locus_tag LOCUS_08830 gene psd 18673 18017 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_08830 18776 21325 gene locus_tag LOCUS_08840 18776 21325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 21450 22187 gene locus_tag LOCUS_08850 21450 22187 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_08850 22796 22188 gene locus_tag LOCUS_08860 22796 22188 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405245.1 protein_id gnl|my_center|LOCUS_08860 24119 22881 gene locus_tag LOCUS_08870 24119 22881 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428415.1 protein_id gnl|my_center|LOCUS_08870 25656 24124 gene locus_tag LOCUS_08880 gene gntK 25656 24124 CDS product gluconate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254941.1 protein_id gnl|my_center|LOCUS_08880 26416 25649 gene locus_tag LOCUS_08890 26416 25649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 26700 29828 gene locus_tag LOCUS_08900 26700 29828 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766148.1 protein_id gnl|my_center|LOCUS_08900 29841 31361 gene locus_tag LOCUS_08910 29841 31361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403146.1 protein_id gnl|my_center|LOCUS_08910 31510 32436 gene locus_tag LOCUS_08920 31510 32436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 32475 33974 gene locus_tag LOCUS_08930 32475 33974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902283.1 protein_id gnl|my_center|LOCUS_08930 34068 34988 gene locus_tag LOCUS_08940 34068 34988 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486810.1 protein_id gnl|my_center|LOCUS_08940 35409 35050 gene locus_tag LOCUS_08950 35409 35050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 35598 35897 gene locus_tag LOCUS_08960 35598 35897 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K5 protein_id gnl|my_center|LOCUS_08960 35975 36934 gene locus_tag LOCUS_08970 35975 36934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 37047 37817 gene locus_tag LOCUS_08980 37047 37817 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941989.1 protein_id gnl|my_center|LOCUS_08980 37814 38578 gene locus_tag LOCUS_08990 37814 38578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 40060 38573 gene locus_tag LOCUS_09000 40060 38573 CDS product DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674224.1 protein_id gnl|my_center|LOCUS_09000 40589 40080 gene locus_tag LOCUS_09010 40589 40080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 40763 41383 gene locus_tag LOCUS_09020 40763 41383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 41630 42145 gene locus_tag LOCUS_09030 41630 42145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 42191 43891 gene locus_tag LOCUS_09040 42191 43891 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919507.1 protein_id gnl|my_center|LOCUS_09040 44037 44930 gene locus_tag LOCUS_09050 44037 44930 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919502.1 protein_id gnl|my_center|LOCUS_09050 >Feature sequence017 650 967 gene locus_tag LOCUS_09060 650 967 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067287.1 protein_id gnl|my_center|LOCUS_09060 969 1439 gene locus_tag LOCUS_09070 969 1439 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023518.1 protein_id gnl|my_center|LOCUS_09070 1432 1815 gene locus_tag LOCUS_09080 1432 1815 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122416.1 protein_id gnl|my_center|LOCUS_09080 1808 2401 gene locus_tag LOCUS_09090 gene ydeI 1808 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96666 protein_id gnl|my_center|LOCUS_09090 2429 3049 gene locus_tag LOCUS_09100 gene ydeI 2429 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96666 protein_id gnl|my_center|LOCUS_09100 4369 3083 gene locus_tag LOCUS_09110 4369 3083 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 protein_id gnl|my_center|LOCUS_09110 4735 5685 gene locus_tag LOCUS_09120 4735 5685 CDS product serine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337402.1 protein_id gnl|my_center|LOCUS_09120 7209 5770 gene locus_tag LOCUS_09130 7209 5770 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963081.1 protein_id gnl|my_center|LOCUS_09130 10453 7199 gene locus_tag LOCUS_09140 10453 7199 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963080.1 protein_id gnl|my_center|LOCUS_09140 11642 10482 gene locus_tag LOCUS_09150 11642 10482 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963079.1 protein_id gnl|my_center|LOCUS_09150 12141 11731 gene locus_tag LOCUS_09160 12141 11731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 12464 13450 gene locus_tag LOCUS_09170 12464 13450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 13488 14303 gene locus_tag LOCUS_09180 13488 14303 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796397.1 protein_id gnl|my_center|LOCUS_09180 15231 14368 gene locus_tag LOCUS_09190 gene tatC 15231 14368 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ5 protein_id gnl|my_center|LOCUS_09190 16602 15319 gene locus_tag LOCUS_09200 gene glyA 16602 15319 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXG2 protein_id gnl|my_center|LOCUS_09200 17233 16712 gene locus_tag LOCUS_09210 17233 16712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964064.1 protein_id gnl|my_center|LOCUS_09210 17473 18558 gene locus_tag LOCUS_09220 17473 18558 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867962.1 protein_id gnl|my_center|LOCUS_09220 18668 18913 gene locus_tag LOCUS_09230 gene rpmE2 18668 18913 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5U9 protein_id gnl|my_center|LOCUS_09230 19829 18927 gene locus_tag LOCUS_09240 19829 18927 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962773.1 protein_id gnl|my_center|LOCUS_09240 20541 19864 gene locus_tag LOCUS_09250 20541 19864 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108960.1 protein_id gnl|my_center|LOCUS_09250 20896 21093 gene locus_tag LOCUS_09260 20896 21093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 21102 21923 gene locus_tag LOCUS_09270 21102 21923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 22047 22925 gene locus_tag LOCUS_09280 22047 22925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 23829 22954 gene locus_tag LOCUS_09290 gene rsgA 23829 22954 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YJ1 protein_id gnl|my_center|LOCUS_09290 25422 24334 gene locus_tag LOCUS_09300 25422 24334 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546142.1 protein_id gnl|my_center|LOCUS_09300 27426 25483 gene locus_tag LOCUS_09310 gene kup 27426 25483 CDS product putative potassium transport system protein kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXA1 protein_id gnl|my_center|LOCUS_09310 27585 28370 gene locus_tag LOCUS_09320 27585 28370 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186957.1 protein_id gnl|my_center|LOCUS_09320 29734 28367 gene locus_tag LOCUS_09330 29734 28367 CDS product starvation-sensing protein RspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690934.1 protein_id gnl|my_center|LOCUS_09330 30113 29802 gene locus_tag LOCUS_09340 30113 29802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 30478 30110 gene locus_tag LOCUS_09350 30478 30110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837198.1 protein_id gnl|my_center|LOCUS_09350 30968 30564 gene locus_tag LOCUS_09360 30968 30564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 31513 31031 gene locus_tag LOCUS_09370 31513 31031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704591.1 protein_id gnl|my_center|LOCUS_09370 31947 31516 gene locus_tag LOCUS_09380 31947 31516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 32412 31957 gene locus_tag LOCUS_09390 32412 31957 CDS product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070933.1 protein_id gnl|my_center|LOCUS_09390 32879 32427 gene locus_tag LOCUS_09400 32879 32427 CDS product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070933.1 protein_id gnl|my_center|LOCUS_09400 33204 32881 gene locus_tag LOCUS_09410 33204 32881 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098837.1 protein_id gnl|my_center|LOCUS_09410 34494 33295 gene locus_tag LOCUS_09420 34494 33295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 34881 34561 gene locus_tag LOCUS_09430 34881 34561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 35110 37977 gene locus_tag LOCUS_09440 35110 37977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 38059 39453 gene locus_tag LOCUS_09450 38059 39453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 39450 40829 gene locus_tag LOCUS_09460 39450 40829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 40832 42169 gene locus_tag LOCUS_09470 40832 42169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 42196 42516 gene locus_tag LOCUS_09480 42196 42516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 43220 42552 gene locus_tag LOCUS_09490 43220 42552 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932742.1 protein_id gnl|my_center|LOCUS_09490 44078 43299 gene locus_tag LOCUS_09500 44078 43299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 >Feature sequence018 <1 727 gene locus_tag LOCUS_09510 <1 727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962850.1:collagen-binding protein 733 1641 gene locus_tag LOCUS_09520 733 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 1683 2525 gene locus_tag LOCUS_09530 gene menB 1683 2525 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWW1 protein_id gnl|my_center|LOCUS_09530 3345 2536 gene locus_tag LOCUS_09540 3345 2536 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287963.1 protein_id gnl|my_center|LOCUS_09540 3812 3411 gene locus_tag LOCUS_09550 3812 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 5176 3809 gene locus_tag LOCUS_09560 5176 3809 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947312.1 protein_id gnl|my_center|LOCUS_09560 5323 6180 gene locus_tag LOCUS_09570 5323 6180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 6182 6973 gene locus_tag LOCUS_09580 6182 6973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089666.1 protein_id gnl|my_center|LOCUS_09580 7748 7008 gene locus_tag LOCUS_09590 gene accD 7748 7008 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG2 protein_id gnl|my_center|LOCUS_09590 9157 8015 gene locus_tag LOCUS_09600 9157 8015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 11003 9237 gene locus_tag LOCUS_09610 11003 9237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 13033 11435 gene locus_tag LOCUS_09620 13033 11435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 14925 13030 gene locus_tag LOCUS_09630 gene mnmG 14925 13030 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVK0 protein_id gnl|my_center|LOCUS_09630 18326 15033 gene locus_tag LOCUS_09640 18326 15033 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962182.1 protein_id gnl|my_center|LOCUS_09640 19101 18337 gene locus_tag LOCUS_09650 gene xth 19101 18337 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962243.1 protein_id gnl|my_center|LOCUS_09650 19477 19112 gene locus_tag LOCUS_09660 19477 19112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 protein_id gnl|my_center|LOCUS_09660 19490 20176 gene locus_tag LOCUS_09670 19490 20176 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108487.1 protein_id gnl|my_center|LOCUS_09670 21494 20244 gene locus_tag LOCUS_09680 21494 20244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 24896 21543 gene locus_tag LOCUS_09690 gene mfd 24896 21543 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW35 protein_id gnl|my_center|LOCUS_09690 27414 25039 gene locus_tag LOCUS_09700 27414 25039 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_09700 29391 27769 gene locus_tag LOCUS_09710 29391 27769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 30429 29545 gene locus_tag LOCUS_09720 30429 29545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142150.1 protein_id gnl|my_center|LOCUS_09720 30685 31242 gene locus_tag LOCUS_09730 gene msrA 30685 31242 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBS2 protein_id gnl|my_center|LOCUS_09730 32889 31252 gene locus_tag LOCUS_09740 32889 31252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 34448 32889 gene locus_tag LOCUS_09750 34448 32889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 35699 34512 gene locus_tag LOCUS_09760 gene anmK 35699 34512 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q184N9 protein_id gnl|my_center|LOCUS_09760 37137 35815 gene locus_tag LOCUS_09770 37137 35815 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_09770 37351 37425 gene locus_tag LOCUS_t00020 37351 37425 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 37649 37918 gene locus_tag LOCUS_09780 37649 37918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 37921 38202 gene locus_tag LOCUS_09790 37921 38202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 38906 38199 gene locus_tag LOCUS_09800 38906 38199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 38992 39633 gene locus_tag LOCUS_09810 38992 39633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 39856 40494 gene locus_tag LOCUS_09820 39856 40494 CDS product resolvase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087771.1 protein_id gnl|my_center|LOCUS_09820 40521 40709 gene locus_tag LOCUS_09830 40521 40709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 40762 41997 gene locus_tag LOCUS_09840 40762 41997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 42056 42526 gene locus_tag LOCUS_09850 42056 42526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 >Feature sequence019 <1 1994 gene locus_tag LOCUS_09860 <1 1994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A451:primosomal protein N' 2377 1997 gene locus_tag LOCUS_09870 2377 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362013.1 protein_id gnl|my_center|LOCUS_09870 3947 2463 gene locus_tag LOCUS_09880 3947 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 4515 3940 gene locus_tag LOCUS_09890 4515 3940 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_09890 4749 5387 gene locus_tag LOCUS_09900 4749 5387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 6672 5449 gene locus_tag LOCUS_09910 6672 5449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 6746 7660 gene locus_tag LOCUS_09920 gene rsmH 6746 7660 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZL4 protein_id gnl|my_center|LOCUS_09920 7796 8167 gene locus_tag LOCUS_09930 7796 8167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 8174 10267 gene locus_tag LOCUS_09940 8174 10267 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769220.1 protein_id gnl|my_center|LOCUS_09940 11130 10264 gene locus_tag LOCUS_09950 11130 10264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 11254 12471 gene locus_tag LOCUS_09960 11254 12471 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962998.1 protein_id gnl|my_center|LOCUS_09960 12475 13245 gene locus_tag LOCUS_09970 12475 13245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 14387 13242 gene locus_tag LOCUS_09980 gene dacB 14387 13242 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072373.1 protein_id gnl|my_center|LOCUS_09980 15206 14520 gene locus_tag LOCUS_09990 15206 14520 CDS product polyketide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337754.1 protein_id gnl|my_center|LOCUS_09990 15273 16829 gene locus_tag LOCUS_10000 15273 16829 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031534.1 protein_id gnl|my_center|LOCUS_10000 17715 16819 gene locus_tag LOCUS_10010 gene lpqP 17715 16819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403421.1 protein_id gnl|my_center|LOCUS_10010 19035 17833 gene locus_tag LOCUS_10020 gene aspC1 19035 17833 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ0 protein_id gnl|my_center|LOCUS_10020 20042 19386 gene locus_tag LOCUS_10030 20042 19386 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392490.1 protein_id gnl|my_center|LOCUS_10030 20155 20310 gene locus_tag LOCUS_10040 20155 20310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 20454 21521 gene locus_tag LOCUS_10050 20454 21521 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107797.1 protein_id gnl|my_center|LOCUS_10050 21562 22317 gene locus_tag LOCUS_10060 21562 22317 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817185.1 protein_id gnl|my_center|LOCUS_10060 25354 22310 gene locus_tag LOCUS_10070 25354 22310 CDS product lantibiotic dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026974.1 protein_id gnl|my_center|LOCUS_10070 25518 26186 gene locus_tag LOCUS_10080 25518 26186 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW2 protein_id gnl|my_center|LOCUS_10080 26479 28722 gene locus_tag LOCUS_10090 26479 28722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 28808 29575 gene locus_tag LOCUS_10100 gene tpiA 28808 29575 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P83 protein_id gnl|my_center|LOCUS_10100 30954 29827 gene locus_tag LOCUS_10110 30954 29827 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_10110 32619 31126 gene locus_tag LOCUS_10120 32619 31126 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123415.1 protein_id gnl|my_center|LOCUS_10120 35282 32619 gene locus_tag LOCUS_10130 35282 32619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 35458 38049 gene locus_tag LOCUS_10140 35458 38049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 38084 40525 gene locus_tag LOCUS_10150 38084 40525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 41437 40643 gene locus_tag LOCUS_10160 41437 40643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 42257 41424 gene locus_tag LOCUS_10170 42257 41424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 42597 42262 gene locus_tag LOCUS_10180 42597 42262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 >Feature sequence020 747 3866 gene locus_tag LOCUS_10190 747 3866 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766148.1 protein_id gnl|my_center|LOCUS_10190 3881 5425 gene locus_tag LOCUS_10200 3881 5425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403146.1 protein_id gnl|my_center|LOCUS_10200 5651 7147 gene locus_tag LOCUS_10210 5651 7147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 7176 7661 gene locus_tag LOCUS_10220 7176 7661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332434.1 protein_id gnl|my_center|LOCUS_10220 7697 8767 gene locus_tag LOCUS_10230 7697 8767 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228754.1 protein_id gnl|my_center|LOCUS_10230 10633 9065 gene locus_tag LOCUS_10240 10633 9065 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962666.1 protein_id gnl|my_center|LOCUS_10240 11757 10642 gene locus_tag LOCUS_10250 11757 10642 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962667.1 protein_id gnl|my_center|LOCUS_10250 13107 11776 gene locus_tag LOCUS_10260 13107 11776 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962668.1 protein_id gnl|my_center|LOCUS_10260 13723 13100 gene locus_tag LOCUS_10270 13723 13100 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962669.1 protein_id gnl|my_center|LOCUS_10270 14536 13910 gene locus_tag LOCUS_10280 14536 13910 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962874.1 protein_id gnl|my_center|LOCUS_10280 14677 14877 gene locus_tag LOCUS_10290 14677 14877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 14891 16552 gene locus_tag LOCUS_10300 14891 16552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 18394 16856 gene locus_tag LOCUS_10310 gene lnt 18394 16856 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_10310 19017 18400 gene locus_tag LOCUS_10320 19017 18400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 20323 19022 gene locus_tag LOCUS_10330 20323 19022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 20957 20571 gene locus_tag LOCUS_10340 20957 20571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 23816 21039 gene locus_tag LOCUS_10350 23816 21039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 24744 23938 gene locus_tag LOCUS_10360 24744 23938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 25145 24801 gene locus_tag LOCUS_10370 25145 24801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 25811 25305 gene locus_tag LOCUS_10380 25811 25305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 26317 26643 gene locus_tag LOCUS_10390 26317 26643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 26646 32606 gene locus_tag LOCUS_10400 26646 32606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 33206 32775 gene locus_tag LOCUS_10410 33206 32775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 34093 33278 gene locus_tag LOCUS_10420 34093 33278 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202553.1 protein_id gnl|my_center|LOCUS_10420 35185 34247 gene locus_tag LOCUS_10430 35185 34247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 35256 36041 gene locus_tag LOCUS_10440 35256 36041 CDS product D-arabino 3-hexulose 6-phosphate aldehyde lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120388.1 protein_id gnl|my_center|LOCUS_10440 36274 36714 gene locus_tag LOCUS_10450 36274 36714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 36818 37843 gene locus_tag LOCUS_10460 36818 37843 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120389.1 protein_id gnl|my_center|LOCUS_10460 37866 38795 gene locus_tag LOCUS_10470 37866 38795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 38808 39605 gene locus_tag LOCUS_10480 38808 39605 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958120.1 protein_id gnl|my_center|LOCUS_10480 39916 40800 gene locus_tag LOCUS_10490 39916 40800 CDS product myo-inositol catabolism protein IolH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120390.1 protein_id gnl|my_center|LOCUS_10490 40979 40797 gene locus_tag LOCUS_10500 40979 40797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 >Feature sequence021 <1 902 gene locus_tag LOCUS_10510 <1 902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071266.1:rhomboid family intramembrane serine protease 967 1758 gene locus_tag LOCUS_10520 967 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 1949 3349 gene locus_tag LOCUS_10530 1949 3349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390122.1 protein_id gnl|my_center|LOCUS_10530 3611 4558 gene locus_tag LOCUS_10540 3611 4558 CDS product ring canal kelch-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639451.2 protein_id gnl|my_center|LOCUS_10540 4599 5306 gene locus_tag LOCUS_10550 4599 5306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 5514 8447 gene locus_tag LOCUS_10560 5514 8447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 8587 10080 gene locus_tag LOCUS_10570 8587 10080 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767373.1 protein_id gnl|my_center|LOCUS_10570 10189 10797 gene locus_tag LOCUS_10580 10189 10797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 12103 10802 gene locus_tag LOCUS_10590 12103 10802 CDS product PA-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256802.1 protein_id gnl|my_center|LOCUS_10590 12693 12190 gene locus_tag LOCUS_10600 12693 12190 CDS product damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532473.1 protein_id gnl|my_center|LOCUS_10600 13148 12744 gene locus_tag LOCUS_10610 13148 12744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 14016 13237 gene locus_tag LOCUS_10620 14016 13237 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072060.1 protein_id gnl|my_center|LOCUS_10620 14288 14079 gene locus_tag LOCUS_10630 14288 14079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 15223 14579 gene locus_tag LOCUS_10640 15223 14579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 16988 15495 gene locus_tag LOCUS_10650 gene gltX 16988 15495 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A455 protein_id gnl|my_center|LOCUS_10650 17167 18606 gene locus_tag LOCUS_10660 gene arsA 17167 18606 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_10660 18760 19470 gene locus_tag LOCUS_10670 18760 19470 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888106.1 protein_id gnl|my_center|LOCUS_10670 19515 20294 gene locus_tag LOCUS_10680 19515 20294 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971313.1 protein_id gnl|my_center|LOCUS_10680 20406 20966 gene locus_tag LOCUS_10690 20406 20966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962853.1 protein_id gnl|my_center|LOCUS_10690 21422 21243 gene locus_tag LOCUS_10700 21422 21243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 21409 22950 gene locus_tag LOCUS_10710 21409 22950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 23090 24106 gene locus_tag LOCUS_10720 23090 24106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 24125 24850 gene locus_tag LOCUS_10730 24125 24850 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632821.1 protein_id gnl|my_center|LOCUS_10730 25382 24831 gene locus_tag LOCUS_10740 25382 24831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 25553 26056 gene locus_tag LOCUS_10750 25553 26056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 26069 27943 gene locus_tag LOCUS_10760 26069 27943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 28089 28658 gene locus_tag LOCUS_10770 28089 28658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 30874 28697 gene locus_tag LOCUS_10780 30874 28697 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108019.1 protein_id gnl|my_center|LOCUS_10780 31449 31075 gene locus_tag LOCUS_10790 31449 31075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_10790 31972 31649 gene locus_tag LOCUS_10800 31972 31649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 32716 32171 gene locus_tag LOCUS_10810 32716 32171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 33951 32791 gene locus_tag LOCUS_10820 33951 32791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 34140 35441 gene locus_tag LOCUS_10830 34140 35441 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021346.1 protein_id gnl|my_center|LOCUS_10830 35534 36718 gene locus_tag LOCUS_10840 35534 36718 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028742.1 protein_id gnl|my_center|LOCUS_10840 36881 38428 gene locus_tag LOCUS_10850 36881 38428 CDS product microcystin degradation protein MlrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030661.1 protein_id gnl|my_center|LOCUS_10850 38570 39250 gene locus_tag LOCUS_10860 38570 39250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 39433 40215 gene locus_tag LOCUS_10870 39433 40215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 >Feature sequence022 <1 1140 gene locus_tag LOCUS_10880 <1 1140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141168.1:glucosidase 3777 1165 gene locus_tag LOCUS_10890 gene mutS 3777 1165 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MG7 protein_id gnl|my_center|LOCUS_10890 5752 4223 gene locus_tag LOCUS_10900 5752 4223 CDS product flotillin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764424.1 protein_id gnl|my_center|LOCUS_10900 6321 5755 gene locus_tag LOCUS_10910 6321 5755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 7247 6399 gene locus_tag LOCUS_10920 gene axeA 7247 6399 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120225.1 protein_id gnl|my_center|LOCUS_10920 7584 7312 gene locus_tag LOCUS_10930 7584 7312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 9081 7777 gene locus_tag LOCUS_10940 gene murA 9081 7777 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H153 protein_id gnl|my_center|LOCUS_10940 9770 9102 gene locus_tag LOCUS_10950 9770 9102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790584.1 protein_id gnl|my_center|LOCUS_10950 10049 11458 gene locus_tag LOCUS_10960 gene yngK 10049 11458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635991.1 protein_id gnl|my_center|LOCUS_10960 11462 11986 gene locus_tag LOCUS_10970 11462 11986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168663.1 protein_id gnl|my_center|LOCUS_10970 12312 11983 gene locus_tag LOCUS_10980 12312 11983 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZQ7 protein_id gnl|my_center|LOCUS_10980 12833 12414 gene locus_tag LOCUS_10990 12833 12414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 13882 12968 gene locus_tag LOCUS_11000 13882 12968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 protein_id gnl|my_center|LOCUS_11000 14315 13875 gene locus_tag LOCUS_11010 14315 13875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 14531 14899 gene locus_tag LOCUS_11020 14531 14899 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962695.1 protein_id gnl|my_center|LOCUS_11020 15576 14944 gene locus_tag LOCUS_11030 15576 14944 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042729.1 protein_id gnl|my_center|LOCUS_11030 16898 15678 gene locus_tag LOCUS_11040 16898 15678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 18832 17066 gene locus_tag LOCUS_11050 18832 17066 CDS product xenobiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963545.1 protein_id gnl|my_center|LOCUS_11050 20221 18929 gene locus_tag LOCUS_11060 gene hemL 20221 18929 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1S3 protein_id gnl|my_center|LOCUS_11060 21912 20245 gene locus_tag LOCUS_11070 21912 20245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 23821 21971 gene locus_tag LOCUS_11080 gene yidC 23821 21971 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA76 protein_id gnl|my_center|LOCUS_11080 24686 23931 gene locus_tag LOCUS_11090 gene fabG2 24686 23931 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707219.1 protein_id gnl|my_center|LOCUS_11090 25532 24690 gene locus_tag LOCUS_11100 25532 24690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 25658 26194 gene locus_tag LOCUS_11110 gene hslV 25658 26194 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD62 protein_id gnl|my_center|LOCUS_11110 27315 26191 gene locus_tag LOCUS_11120 gene hisB 27315 26191 CDS product histidine biosynthesis bifunctional protein HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABA7 protein_id gnl|my_center|LOCUS_11120 27396 28055 gene locus_tag LOCUS_11130 27396 28055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 28398 30101 gene locus_tag LOCUS_11140 28398 30101 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437464.1 protein_id gnl|my_center|LOCUS_11140 30616 30137 gene locus_tag LOCUS_11150 gene coaD 30616 30137 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3C0 protein_id gnl|my_center|LOCUS_11150 32010 30649 gene locus_tag LOCUS_11160 32010 30649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 32672 32007 gene locus_tag LOCUS_11170 32672 32007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 32806 33720 gene locus_tag LOCUS_11180 32806 33720 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704730.1 protein_id gnl|my_center|LOCUS_11180 33720 34337 gene locus_tag LOCUS_11190 33720 34337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 35849 34347 gene locus_tag LOCUS_11200 gene pafA 35849 34347 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_11200 37080 36106 gene locus_tag LOCUS_11210 37080 36106 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_11210 37237 38145 gene locus_tag LOCUS_11220 37237 38145 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767761.1 protein_id gnl|my_center|LOCUS_11220 39921 38149 gene locus_tag LOCUS_11230 39921 38149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 >Feature sequence023 555 1745 gene locus_tag LOCUS_11240 555 1745 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403681.1 protein_id gnl|my_center|LOCUS_11240 2218 1739 gene locus_tag LOCUS_11250 2218 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 2421 2218 gene locus_tag LOCUS_11260 2421 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 3263 2451 gene locus_tag LOCUS_11270 3263 2451 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XQ4 protein_id gnl|my_center|LOCUS_11270 3490 3416 gene locus_tag LOCUS_t00030 3490 3416 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 3637 4413 gene locus_tag LOCUS_11280 3637 4413 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584118.1 protein_id gnl|my_center|LOCUS_11280 4440 5297 gene locus_tag LOCUS_11290 4440 5297 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887194.1 protein_id gnl|my_center|LOCUS_11290 5403 6536 gene locus_tag LOCUS_11300 5403 6536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157499.1 protein_id gnl|my_center|LOCUS_11300 6628 8106 gene locus_tag LOCUS_11310 6628 8106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 8106 9137 gene locus_tag LOCUS_11320 8106 9137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 9191 9892 gene locus_tag LOCUS_11330 9191 9892 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405039.1 protein_id gnl|my_center|LOCUS_11330 9885 11339 gene locus_tag LOCUS_11340 9885 11339 CDS product glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405140.1 protein_id gnl|my_center|LOCUS_11340 11714 11331 gene locus_tag LOCUS_11350 11714 11331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 12049 11711 gene locus_tag LOCUS_11360 12049 11711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198632.1 protein_id gnl|my_center|LOCUS_11360 12660 12055 gene locus_tag LOCUS_11370 gene hisIE 12660 12055 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY74 protein_id gnl|my_center|LOCUS_11370 12774 12847 gene locus_tag LOCUS_t00040 12774 12847 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 12903 12989 gene locus_tag LOCUS_t00050 12903 12989 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13781 13029 gene locus_tag LOCUS_11380 13781 13029 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766271.1 protein_id gnl|my_center|LOCUS_11380 14994 13867 gene locus_tag LOCUS_11390 gene argD 14994 13867 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YZ6 protein_id gnl|my_center|LOCUS_11390 15996 15028 gene locus_tag LOCUS_11400 gene argC 15996 15028 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1A7 protein_id gnl|my_center|LOCUS_11400 16284 17111 gene locus_tag LOCUS_11410 gene lgt 16284 17111 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3W5 protein_id gnl|my_center|LOCUS_11410 18445 17108 gene locus_tag LOCUS_11420 18445 17108 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256439.1 protein_id gnl|my_center|LOCUS_11420 19560 18442 gene locus_tag LOCUS_11430 19560 18442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 20593 19592 gene locus_tag LOCUS_11440 20593 19592 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202930.1 protein_id gnl|my_center|LOCUS_11440 21233 20595 gene locus_tag LOCUS_11450 21233 20595 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775527.1 protein_id gnl|my_center|LOCUS_11450 22234 21254 gene locus_tag LOCUS_11460 gene fabH 22234 21254 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120566.1 protein_id gnl|my_center|LOCUS_11460 23290 22238 gene locus_tag LOCUS_11470 23290 22238 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202154.1 protein_id gnl|my_center|LOCUS_11470 23525 23295 gene locus_tag LOCUS_11480 23525 23295 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775528.1 protein_id gnl|my_center|LOCUS_11480 25545 23593 gene locus_tag LOCUS_11490 25545 23593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 26886 25609 gene locus_tag LOCUS_11500 26886 25609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 27034 27852 gene locus_tag LOCUS_11510 27034 27852 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583718.1 protein_id gnl|my_center|LOCUS_11510 29423 27849 gene locus_tag LOCUS_11520 gene dagA 29423 27849 CDS product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122885.1 protein_id gnl|my_center|LOCUS_11520 30959 29508 gene locus_tag LOCUS_11530 30959 29508 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796334.1 protein_id gnl|my_center|LOCUS_11530 32150 31089 gene locus_tag LOCUS_11540 32150 31089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 33389 32289 gene locus_tag LOCUS_11550 gene gmd 33389 32289 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XYK3 protein_id gnl|my_center|LOCUS_11550 33957 33421 gene locus_tag LOCUS_11560 33957 33421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 34128 36176 gene locus_tag LOCUS_11570 34128 36176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 36238 37605 gene locus_tag LOCUS_11580 36238 37605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403008.1 protein_id gnl|my_center|LOCUS_11580 >Feature sequence024 233 616 gene locus_tag LOCUS_11590 233 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817730.1 protein_id gnl|my_center|LOCUS_11590 1234 674 gene locus_tag LOCUS_11600 1234 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073213.1 protein_id gnl|my_center|LOCUS_11600 2387 1359 gene locus_tag LOCUS_11610 gene aroB 2387 1359 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A1 protein_id gnl|my_center|LOCUS_11610 3194 2421 gene locus_tag LOCUS_11620 3194 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 3132 3764 gene locus_tag LOCUS_11630 3132 3764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 3818 4858 gene locus_tag LOCUS_11640 gene dinB2 3818 4858 CDS product DNA polymerase IV 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJK7 protein_id gnl|my_center|LOCUS_11640 6047 4860 gene locus_tag LOCUS_11650 6047 4860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 7429 6254 gene locus_tag LOCUS_11660 7429 6254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 8010 7426 gene locus_tag LOCUS_11670 8010 7426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 9971 8178 gene locus_tag LOCUS_11680 gene malL 9971 8178 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415207.1 protein_id gnl|my_center|LOCUS_11680 11350 10013 gene locus_tag LOCUS_11690 11350 10013 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_11690 12690 11374 gene locus_tag LOCUS_11700 12690 11374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767657.1 protein_id gnl|my_center|LOCUS_11700 12877 13740 gene locus_tag LOCUS_11710 12877 13740 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119308.1 protein_id gnl|my_center|LOCUS_11710 14178 13795 gene locus_tag LOCUS_11720 14178 13795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 14567 17293 gene locus_tag LOCUS_11730 14567 17293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 17593 17871 gene locus_tag LOCUS_11740 17593 17871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 17873 21289 gene locus_tag LOCUS_11750 17873 21289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 22353 21295 gene locus_tag LOCUS_11760 22353 21295 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107426.1 protein_id gnl|my_center|LOCUS_11760 23139 22663 gene locus_tag LOCUS_11770 23139 22663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44014 protein_id gnl|my_center|LOCUS_11770 23752 23261 gene locus_tag LOCUS_11780 23752 23261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11780 25306 23753 gene locus_tag LOCUS_11790 gene metG 25306 23753 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ2 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11790 26372 25584 gene locus_tag LOCUS_11800 26372 25584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 26935 26369 gene locus_tag LOCUS_11810 26935 26369 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528490.1 protein_id gnl|my_center|LOCUS_11810 27575 27021 gene locus_tag LOCUS_11820 27575 27021 CDS product fasciclin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816758.1 protein_id gnl|my_center|LOCUS_11820 27760 29346 gene locus_tag LOCUS_11830 gene pckA2 27760 29346 CDS product phosphoenolpyruvate carboxykinase [ATP] 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S008 protein_id gnl|my_center|LOCUS_11830 29421 29783 gene locus_tag LOCUS_11840 29421 29783 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227750.1 protein_id gnl|my_center|LOCUS_11840 32243 29790 gene locus_tag LOCUS_11850 32243 29790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 33164 32367 gene locus_tag LOCUS_11860 33164 32367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 34038 33175 gene locus_tag LOCUS_11870 34038 33175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 34824 34063 gene locus_tag LOCUS_11880 34824 34063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 35343 34825 gene locus_tag LOCUS_11890 35343 34825 CDS product sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393343.1 protein_id gnl|my_center|LOCUS_11890 35541 36617 gene locus_tag LOCUS_11900 35541 36617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 36690 37586 gene locus_tag LOCUS_11910 36690 37586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 >Feature sequence025 2245 1019 gene locus_tag LOCUS_11920 2245 1019 CDS product L-sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142438.1 protein_id gnl|my_center|LOCUS_11920 2547 2807 gene locus_tag LOCUS_11930 2547 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 2811 4091 gene locus_tag LOCUS_11940 2811 4091 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879270.1 protein_id gnl|my_center|LOCUS_11940 4466 5422 gene locus_tag LOCUS_11950 4466 5422 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F8B3 protein_id gnl|my_center|LOCUS_11950 5391 5981 gene locus_tag LOCUS_11960 5391 5981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 6740 5982 gene locus_tag LOCUS_11970 6740 5982 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXJ8 protein_id gnl|my_center|LOCUS_11970 6834 7613 gene locus_tag LOCUS_11980 6834 7613 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790405.1 protein_id gnl|my_center|LOCUS_11980 7610 8980 gene locus_tag LOCUS_11990 7610 8980 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121485.1 protein_id gnl|my_center|LOCUS_11990 8953 9624 gene locus_tag LOCUS_12000 8953 9624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121484.1 protein_id gnl|my_center|LOCUS_12000 9657 9893 gene locus_tag LOCUS_12010 9657 9893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 9875 10180 gene locus_tag LOCUS_12020 9875 10180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 10243 12213 gene locus_tag LOCUS_12030 10243 12213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767027.1 protein_id gnl|my_center|LOCUS_12030 12256 12984 gene locus_tag LOCUS_12040 12256 12984 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_12040 13445 15760 gene locus_tag LOCUS_12050 13445 15760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107570.1 protein_id gnl|my_center|LOCUS_12050 15831 17456 gene locus_tag LOCUS_12060 15831 17456 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640593.1 protein_id gnl|my_center|LOCUS_12060 17472 19004 gene locus_tag LOCUS_12070 17472 19004 CDS product beta-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992104.1 protein_id gnl|my_center|LOCUS_12070 19012 20682 gene locus_tag LOCUS_12080 gene xynB2 19012 20682 CDS product beta-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920215.1 protein_id gnl|my_center|LOCUS_12080 20688 23036 gene locus_tag LOCUS_12090 20688 23036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 23097 24215 gene locus_tag LOCUS_12100 23097 24215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295249.1 protein_id gnl|my_center|LOCUS_12100 24311 25750 gene locus_tag LOCUS_12110 24311 25750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 25801 26952 gene locus_tag LOCUS_12120 25801 26952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001346611.1 protein_id gnl|my_center|LOCUS_12120 26965 28038 gene locus_tag LOCUS_12130 gene yieL 26965 28038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005052068.1 protein_id gnl|my_center|LOCUS_12130 28063 29163 gene locus_tag LOCUS_12140 28063 29163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703911.1 protein_id gnl|my_center|LOCUS_12140 29249 30154 gene locus_tag LOCUS_12150 29249 30154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 30222 31091 gene locus_tag LOCUS_12160 30222 31091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 31098 33023 gene locus_tag LOCUS_12170 31098 33023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 33028 35358 gene locus_tag LOCUS_12180 33028 35358 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107211.1 protein_id gnl|my_center|LOCUS_12180 35386 37395 gene locus_tag LOCUS_12190 35386 37395 CDS product alpha-L-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107222.1 protein_id gnl|my_center|LOCUS_12190 >Feature sequence026 8446 9792 gene locus_tag LOCUS_12200 gene argH 8446 9792 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z15 protein_id gnl|my_center|LOCUS_12200 11349 9841 gene locus_tag LOCUS_12210 11349 9841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 11556 12488 gene locus_tag LOCUS_12220 11556 12488 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 protein_id gnl|my_center|LOCUS_12220 15434 12516 gene locus_tag LOCUS_12230 15434 12516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 15597 16382 gene locus_tag LOCUS_12240 15597 16382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 16442 17389 gene locus_tag LOCUS_12250 16442 17389 CDS product mammalian cell entry protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759761.1 protein_id gnl|my_center|LOCUS_12250 18227 17565 gene locus_tag LOCUS_12260 18227 17565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 18967 18224 gene locus_tag LOCUS_12270 18967 18224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 19296 18964 gene locus_tag LOCUS_12280 gene ywzG 19296 18964 CDS product putative DNA-binding protein YwzG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C0H3S6 protein_id gnl|my_center|LOCUS_12280 20254 19406 gene locus_tag LOCUS_12290 20254 19406 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962641.1 protein_id gnl|my_center|LOCUS_12290 20777 23929 gene locus_tag LOCUS_12300 20777 23929 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_12300 23949 25418 gene locus_tag LOCUS_12310 23949 25418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_12310 25446 25913 gene locus_tag LOCUS_12320 25446 25913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 25954 27138 gene locus_tag LOCUS_12330 gene hisC 25954 27138 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RL44 protein_id gnl|my_center|LOCUS_12330 27223 28320 gene locus_tag LOCUS_12340 27223 28320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 28436 30151 gene locus_tag LOCUS_12350 gene lysS 28436 30151 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM9 protein_id gnl|my_center|LOCUS_12350 30249 30707 gene locus_tag LOCUS_12360 30249 30707 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794261.1 protein_id gnl|my_center|LOCUS_12360 30718 31806 gene locus_tag LOCUS_12370 gene fabH2 30718 31806 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ1 protein_id gnl|my_center|LOCUS_12370 31820 32596 gene locus_tag LOCUS_12380 31820 32596 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461288.1 protein_id gnl|my_center|LOCUS_12380 32680 32982 gene locus_tag LOCUS_12390 32680 32982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 33076 34977 gene locus_tag LOCUS_12400 33076 34977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 35062 35628 gene locus_tag LOCUS_12410 35062 35628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 35644 37401 gene locus_tag LOCUS_12420 gene arsA 35644 37401 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121660.1 protein_id gnl|my_center|LOCUS_12420 >Feature sequence027 166 1095 gene locus_tag LOCUS_12430 gene nuoD 166 1095 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEC0 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12430 1932 1099 gene locus_tag LOCUS_12440 1932 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 2258 3073 gene locus_tag LOCUS_12450 2258 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 3297 7115 gene locus_tag LOCUS_12460 3297 7115 CDS product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203101.1 protein_id gnl|my_center|LOCUS_12460 7456 8037 gene locus_tag LOCUS_12470 7456 8037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 8785 8150 gene locus_tag LOCUS_12480 8785 8150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 9746 10855 gene locus_tag LOCUS_12490 9746 10855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 10873 11550 gene locus_tag LOCUS_12500 10873 11550 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083605.1 protein_id gnl|my_center|LOCUS_12500 11684 13660 gene locus_tag LOCUS_12510 gene kup 11684 13660 CDS product putative potassium transport system protein kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXA1 protein_id gnl|my_center|LOCUS_12510 14307 14660 gene locus_tag LOCUS_12520 14307 14660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 15409 14762 gene locus_tag LOCUS_12530 15409 14762 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820119.1 protein_id gnl|my_center|LOCUS_12530 16314 15508 gene locus_tag LOCUS_12540 16314 15508 CDS product tributyrin esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355660.1 protein_id gnl|my_center|LOCUS_12540 17430 16324 gene locus_tag LOCUS_12550 17430 16324 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891558.1 protein_id gnl|my_center|LOCUS_12550 18233 17427 gene locus_tag LOCUS_12560 18233 17427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 18374 19219 gene locus_tag LOCUS_12570 18374 19219 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973725.1 protein_id gnl|my_center|LOCUS_12570 20849 19341 gene locus_tag LOCUS_12580 20849 19341 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122845.1 protein_id gnl|my_center|LOCUS_12580 22660 21017 gene locus_tag LOCUS_12590 22660 21017 CDS product protein-xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123507.1 protein_id gnl|my_center|LOCUS_12590 26777 22797 gene locus_tag LOCUS_12600 26777 22797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 27207 26851 gene locus_tag LOCUS_12610 27207 26851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 27416 29302 gene locus_tag LOCUS_12620 27416 29302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 29299 29913 gene locus_tag LOCUS_12630 gene vraR 29299 29913 CDS product two-component response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153535.1 protein_id gnl|my_center|LOCUS_12630 32666 30090 gene locus_tag LOCUS_12640 32666 30090 CDS product glycosyl hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109131.1 protein_id gnl|my_center|LOCUS_12640 33267 32842 gene locus_tag LOCUS_12650 33267 32842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 33330 33956 gene locus_tag LOCUS_12660 33330 33956 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461976.1 protein_id gnl|my_center|LOCUS_12660 34075 34416 gene locus_tag LOCUS_12670 34075 34416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 34413 36824 gene locus_tag LOCUS_12680 34413 36824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 <38100 36814 gene locus_tag LOCUS_12690 <38100 36814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q6HLB6:sensor histidine kinase >Feature sequence028 291 1436 gene locus_tag LOCUS_12700 gene porV 291 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_12700 1991 1488 gene locus_tag LOCUS_12710 1991 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 2733 1996 gene locus_tag LOCUS_12720 gene lptB 2733 1996 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_12720 4531 2801 gene locus_tag LOCUS_12730 4531 2801 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203525.1 protein_id gnl|my_center|LOCUS_12730 4780 5817 gene locus_tag LOCUS_12740 4780 5817 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703897.1 protein_id gnl|my_center|LOCUS_12740 7044 5872 gene locus_tag LOCUS_12750 7044 5872 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0D5 protein_id gnl|my_center|LOCUS_12750 8642 7188 gene locus_tag LOCUS_12760 8642 7188 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786996.1 protein_id gnl|my_center|LOCUS_12760 8847 10241 gene locus_tag LOCUS_12770 gene nqrA 8847 10241 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K7 protein_id gnl|my_center|LOCUS_12770 10269 11426 gene locus_tag LOCUS_12780 gene nqrB 10269 11426 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64US0 protein_id gnl|my_center|LOCUS_12780 11419 12126 gene locus_tag LOCUS_12790 gene nqrC 11419 12126 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR9 protein_id gnl|my_center|LOCUS_12790 12128 12793 gene locus_tag LOCUS_12800 gene nqrD 12128 12793 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR8 protein_id gnl|my_center|LOCUS_12800 12816 13430 gene locus_tag LOCUS_12810 gene nqrE 12816 13430 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6X2 protein_id gnl|my_center|LOCUS_12810 13436 14740 gene locus_tag LOCUS_12820 gene nqrF 13436 14740 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS0 protein_id gnl|my_center|LOCUS_12820 14733 15734 gene locus_tag LOCUS_12830 14733 15734 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHD2 protein_id gnl|my_center|LOCUS_12830 15925 15737 gene locus_tag LOCUS_12840 15925 15737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 16028 16477 gene locus_tag LOCUS_12850 16028 16477 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121094.1 protein_id gnl|my_center|LOCUS_12850 16505 17014 gene locus_tag LOCUS_12860 gene sixA 16505 17014 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 protein_id gnl|my_center|LOCUS_12860 17728 17222 gene locus_tag LOCUS_12870 17728 17222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 20290 17933 gene locus_tag LOCUS_12880 gene mrcA 20290 17933 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_12880 21392 20382 gene locus_tag LOCUS_12890 gene tsaD 21392 20382 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H010 protein_id gnl|my_center|LOCUS_12890 21430 26118 gene locus_tag LOCUS_12900 21430 26118 CDS product DUF490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107519.1 protein_id gnl|my_center|LOCUS_12900 28348 26126 gene locus_tag LOCUS_12910 28348 26126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 28790 28434 gene locus_tag LOCUS_12920 28790 28434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 29483 28956 gene locus_tag LOCUS_12930 29483 28956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 30926 29682 gene locus_tag LOCUS_12940 gene rocD 30926 29682 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_12940 31050 31499 gene locus_tag LOCUS_12950 31050 31499 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790644.1 protein_id gnl|my_center|LOCUS_12950 31561 32703 gene locus_tag LOCUS_12960 31561 32703 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962867.1 protein_id gnl|my_center|LOCUS_12960 32766 35033 gene locus_tag LOCUS_12970 32766 35033 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814149.1 protein_id gnl|my_center|LOCUS_12970 35528 35016 gene locus_tag LOCUS_12980 35528 35016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 35698 36915 gene locus_tag LOCUS_12990 35698 36915 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HZD9 protein_id gnl|my_center|LOCUS_12990 37076 37555 gene locus_tag LOCUS_13000 37076 37555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 >Feature sequence029 360 713 gene locus_tag LOCUS_13010 gene rplS 360 713 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YK97 protein_id gnl|my_center|LOCUS_13010 823 1605 gene locus_tag LOCUS_13020 gene dapF 823 1605 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX5 protein_id gnl|my_center|LOCUS_13020 1830 3452 gene locus_tag LOCUS_13030 gene rho 1830 3452 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXJ7 protein_id gnl|my_center|LOCUS_13030 3641 4156 gene locus_tag LOCUS_13040 3641 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 4262 4804 gene locus_tag LOCUS_13050 4262 4804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 4885 5403 gene locus_tag LOCUS_13060 gene kdsC 4885 5403 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963541.1 protein_id gnl|my_center|LOCUS_13060 6341 5436 gene locus_tag LOCUS_13070 6341 5436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 6511 7176 gene locus_tag LOCUS_13080 6511 7176 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3H8 protein_id gnl|my_center|LOCUS_13080 7207 9264 gene locus_tag LOCUS_13090 gene prc 7207 9264 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104769.1 protein_id gnl|my_center|LOCUS_13090 10033 9308 gene locus_tag LOCUS_13100 10033 9308 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_13100 11088 10030 gene locus_tag LOCUS_13110 11088 10030 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763424.1 protein_id gnl|my_center|LOCUS_13110 11391 13889 gene locus_tag LOCUS_13120 11391 13889 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784143.1 protein_id gnl|my_center|LOCUS_13120 13971 14411 gene locus_tag LOCUS_13130 13971 14411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 14671 15297 gene locus_tag LOCUS_13140 14671 15297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 16243 15299 gene locus_tag LOCUS_13150 16243 15299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 16363 17007 gene locus_tag LOCUS_13160 gene upp 16363 17007 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964558.1 protein_id gnl|my_center|LOCUS_13160 18307 17054 gene locus_tag LOCUS_13170 18307 17054 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYN3 protein_id gnl|my_center|LOCUS_13170 18535 19794 gene locus_tag LOCUS_13180 gene yjhB 18535 19794 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021355.1 protein_id gnl|my_center|LOCUS_13180 21216 19942 gene locus_tag LOCUS_13190 21216 19942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 22161 21301 gene locus_tag LOCUS_13200 22161 21301 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767385.1 protein_id gnl|my_center|LOCUS_13200 22286 23065 gene locus_tag LOCUS_13210 22286 23065 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878702.1 protein_id gnl|my_center|LOCUS_13210 23031 23972 gene locus_tag LOCUS_13220 gene glcK 23031 23972 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391706.1 protein_id gnl|my_center|LOCUS_13220 23969 24775 gene locus_tag LOCUS_13230 23969 24775 CDS product UPF0309 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K3V1 protein_id gnl|my_center|LOCUS_13230 24779 25798 gene locus_tag LOCUS_13240 24779 25798 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978349.1 protein_id gnl|my_center|LOCUS_13240 25802 26644 gene locus_tag LOCUS_13250 25802 26644 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066690.1 protein_id gnl|my_center|LOCUS_13250 26655 27569 gene locus_tag LOCUS_13260 26655 27569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 27575 28777 gene locus_tag LOCUS_13270 27575 28777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 28939 30915 gene locus_tag LOCUS_13280 28939 30915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 30923 32842 gene locus_tag LOCUS_13290 30923 32842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 33018 33317 gene locus_tag LOCUS_13300 33018 33317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 34019 33405 gene locus_tag LOCUS_13310 34019 33405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 35418 34096 gene locus_tag LOCUS_13320 35418 34096 CDS product rRNA cytosine-C5-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108106.1 protein_id gnl|my_center|LOCUS_13320 35965 35444 gene locus_tag LOCUS_13330 35965 35444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704518.1 protein_id gnl|my_center|LOCUS_13330 36052 36609 gene locus_tag LOCUS_13340 36052 36609 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958122.1 protein_id gnl|my_center|LOCUS_13340 <37302 36627 gene locus_tag LOCUS_13350 <37302 36627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005799206.1:DNA polymerase III subunit delta >Feature sequence030 4103 924 gene locus_tag LOCUS_13360 4103 924 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_13360 4523 5290 gene locus_tag LOCUS_13370 4523 5290 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 protein_id gnl|my_center|LOCUS_13370 5350 6753 gene locus_tag LOCUS_13380 gene cry 5350 6753 CDS product cryptochrome DASH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMD1 protein_id gnl|my_center|LOCUS_13380 6874 7467 gene locus_tag LOCUS_13390 6874 7467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764419.1 protein_id gnl|my_center|LOCUS_13390 7479 7916 gene locus_tag LOCUS_13400 7479 7916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_13400 7913 8740 gene locus_tag LOCUS_13410 7913 8740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 9852 8746 gene locus_tag LOCUS_13420 9852 8746 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948681.1 protein_id gnl|my_center|LOCUS_13420 9930 10517 gene locus_tag LOCUS_13430 9930 10517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_13430 10568 11449 gene locus_tag LOCUS_13440 10568 11449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 13115 11679 gene locus_tag LOCUS_13450 13115 11679 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFU0 protein_id gnl|my_center|LOCUS_13450 13843 13112 gene locus_tag LOCUS_13460 13843 13112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 15234 13843 gene locus_tag LOCUS_13470 15234 13843 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792018.1 protein_id gnl|my_center|LOCUS_13470 16563 15241 gene locus_tag LOCUS_13480 gene rpoN 16563 15241 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964339.1 protein_id gnl|my_center|LOCUS_13480 16779 18146 gene locus_tag LOCUS_13490 16779 18146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 18150 18563 gene locus_tag LOCUS_13500 18150 18563 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642733.1 protein_id gnl|my_center|LOCUS_13500 19561 18620 gene locus_tag LOCUS_13510 19561 18620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 19768 20718 gene locus_tag LOCUS_13520 19768 20718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 21260 20781 gene locus_tag LOCUS_13530 21260 20781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 21464 22303 gene locus_tag LOCUS_13540 21464 22303 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784850.1 protein_id gnl|my_center|LOCUS_13540 22310 23164 gene locus_tag LOCUS_13550 22310 23164 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775476.1 protein_id gnl|my_center|LOCUS_13550 23180 24637 gene locus_tag LOCUS_13560 gene dnaB 23180 24637 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX96 protein_id gnl|my_center|LOCUS_13560 25430 24639 gene locus_tag LOCUS_13570 25430 24639 CDS product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355976.1 protein_id gnl|my_center|LOCUS_13570 25750 26298 gene locus_tag LOCUS_13580 25750 26298 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_13580 26285 26875 gene locus_tag LOCUS_13590 26285 26875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 26887 27969 gene locus_tag LOCUS_13600 26887 27969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 28473 28856 gene locus_tag LOCUS_13610 28473 28856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 28869 29165 gene locus_tag LOCUS_13620 28869 29165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 29782 29162 gene locus_tag LOCUS_13630 gene tdk 29782 29162 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5G4 protein_id gnl|my_center|LOCUS_13630 29876 31003 gene locus_tag LOCUS_13640 29876 31003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 31202 32011 gene locus_tag LOCUS_13650 31202 32011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 32008 34026 gene locus_tag LOCUS_13660 32008 34026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108682.1 protein_id gnl|my_center|LOCUS_13660 34149 35561 gene locus_tag LOCUS_13670 34149 35561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 <36392 35612 gene locus_tag LOCUS_13680 <36392 35612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120545.1:aminopeptidase >Feature sequence031 462 13 gene locus_tag LOCUS_13690 462 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 595 840 gene locus_tag LOCUS_13700 595 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 850 1086 gene locus_tag LOCUS_13710 850 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 1773 1057 gene locus_tag LOCUS_13720 1773 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 2241 1906 gene locus_tag LOCUS_13730 2241 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 3156 2362 gene locus_tag LOCUS_13740 3156 2362 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143074.1 protein_id gnl|my_center|LOCUS_13740 4290 3163 gene locus_tag LOCUS_13750 4290 3163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 5102 4287 gene locus_tag LOCUS_13760 5102 4287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 5625 5080 gene locus_tag LOCUS_13770 5625 5080 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_13770 6445 5699 gene locus_tag LOCUS_13780 6445 5699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 6589 7569 gene locus_tag LOCUS_13790 gene pdhB 6589 7569 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 protein_id gnl|my_center|LOCUS_13790 7672 8742 gene locus_tag LOCUS_13800 gene idh 7672 8742 CDS product myo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119305.1 protein_id gnl|my_center|LOCUS_13800 8812 9273 gene locus_tag LOCUS_13810 8812 9273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 9293 9856 gene locus_tag LOCUS_13820 9293 9856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 10359 9928 gene locus_tag LOCUS_13830 10359 9928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043223.1 protein_id gnl|my_center|LOCUS_13830 10916 10356 gene locus_tag LOCUS_13840 gene lpxF 10916 10356 CDS product lipid A 4'-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6M3 protein_id gnl|my_center|LOCUS_13840 11893 10916 gene locus_tag LOCUS_13850 gene trpS 11893 10916 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964337.1 protein_id gnl|my_center|LOCUS_13850 11950 12615 gene locus_tag LOCUS_13860 11950 12615 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209109.1 protein_id gnl|my_center|LOCUS_13860 13358 12669 gene locus_tag LOCUS_13870 gene cobB 13358 12669 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3H9 protein_id gnl|my_center|LOCUS_13870 13775 13362 gene locus_tag LOCUS_13880 13775 13362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 16369 13898 gene locus_tag LOCUS_13890 gene topA 16369 13898 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H115 protein_id gnl|my_center|LOCUS_13890 16706 18991 gene locus_tag LOCUS_13900 gene acnA 16706 18991 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963302.1 protein_id gnl|my_center|LOCUS_13900 20430 19093 gene locus_tag LOCUS_13910 20430 19093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 20946 20602 gene locus_tag LOCUS_13920 20946 20602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 21088 22038 gene locus_tag LOCUS_13930 21088 22038 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202793.1 protein_id gnl|my_center|LOCUS_13930 22041 22679 gene locus_tag LOCUS_13940 gene rplY 22041 22679 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVZ1 protein_id gnl|my_center|LOCUS_13940 22824 23675 gene locus_tag LOCUS_13950 22824 23675 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203172.1 protein_id gnl|my_center|LOCUS_13950 23688 24797 gene locus_tag LOCUS_13960 23688 24797 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766215.1 protein_id gnl|my_center|LOCUS_13960 27921 25078 gene locus_tag LOCUS_13970 27921 25078 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403216.1 protein_id gnl|my_center|LOCUS_13970 29376 27979 gene locus_tag LOCUS_13980 29376 27979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 31315 29927 gene locus_tag LOCUS_13990 31315 29927 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816066.1 protein_id gnl|my_center|LOCUS_13990 32015 31458 gene locus_tag LOCUS_14000 32015 31458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 32191 32562 gene locus_tag LOCUS_14010 32191 32562 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_14010 32644 34353 gene locus_tag LOCUS_14020 32644 34353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 34541 35266 gene locus_tag LOCUS_14030 34541 35266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 >Feature sequence032 <1 1114 gene locus_tag LOCUS_14040 <1 1114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682237.1:MATE family efflux transporter 3924 1171 gene locus_tag LOCUS_14050 3924 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 4014 5909 gene locus_tag LOCUS_14060 4014 5909 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203526.1 protein_id gnl|my_center|LOCUS_14060 5964 6275 gene locus_tag LOCUS_14070 5964 6275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 6259 7011 gene locus_tag LOCUS_14080 gene pcrB 6259 7011 CDS product geranylgeranylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW30 protein_id gnl|my_center|LOCUS_14080 7011 7451 gene locus_tag LOCUS_14090 gene folK 7011 7451 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545434.1 protein_id gnl|my_center|LOCUS_14090 7573 7974 gene locus_tag LOCUS_14100 7573 7974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 8765 7971 gene locus_tag LOCUS_14110 gene thyA 8765 7971 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FR98 protein_id gnl|my_center|LOCUS_14110 9321 8902 gene locus_tag LOCUS_14120 9321 8902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085219.1 protein_id gnl|my_center|LOCUS_14120 10503 9334 gene locus_tag LOCUS_14130 gene metZ 10503 9334 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YI7 protein_id gnl|my_center|LOCUS_14130 11043 10546 gene locus_tag LOCUS_14140 11043 10546 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070530.1 protein_id gnl|my_center|LOCUS_14140 12172 11114 gene locus_tag LOCUS_14150 12172 11114 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403700.1 protein_id gnl|my_center|LOCUS_14150 12866 12234 gene locus_tag LOCUS_14160 12866 12234 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791331.1 protein_id gnl|my_center|LOCUS_14160 13832 12879 gene locus_tag LOCUS_14170 gene accA 13832 12879 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX95 protein_id gnl|my_center|LOCUS_14170 15251 13842 gene locus_tag LOCUS_14180 15251 13842 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392701.1 protein_id gnl|my_center|LOCUS_14180 15320 16756 gene locus_tag LOCUS_14190 15320 16756 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408519.1 protein_id gnl|my_center|LOCUS_14190 16789 18312 gene locus_tag LOCUS_14200 16789 18312 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZJ4 protein_id gnl|my_center|LOCUS_14200 18423 21797 gene locus_tag LOCUS_14210 gene putA 18423 21797 CDS product bifunctional protein PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P8B5 protein_id gnl|my_center|LOCUS_14210 22415 21786 gene locus_tag LOCUS_14220 22415 21786 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022240.1 protein_id gnl|my_center|LOCUS_14220 22588 23331 gene locus_tag LOCUS_14230 22588 23331 CDS product polyphosphate glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887469.1 protein_id gnl|my_center|LOCUS_14230 23850 23326 gene locus_tag LOCUS_14240 23850 23326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 24353 23847 gene locus_tag LOCUS_14250 24353 23847 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258700.1 protein_id gnl|my_center|LOCUS_14250 24736 24407 gene locus_tag LOCUS_14260 24736 24407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 24912 26063 gene locus_tag LOCUS_14270 24912 26063 CDS product D-aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404668.1 protein_id gnl|my_center|LOCUS_14270 26170 27813 gene locus_tag LOCUS_14280 26170 27813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871155.1 protein_id gnl|my_center|LOCUS_14280 28394 28059 gene locus_tag LOCUS_14290 28394 28059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 29358 28801 gene locus_tag LOCUS_14300 29358 28801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 30866 29583 gene locus_tag LOCUS_14310 gene eno 30866 29583 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ69 protein_id gnl|my_center|LOCUS_14310 31092 31685 gene locus_tag LOCUS_14320 gene ruvA 31092 31685 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G0 protein_id gnl|my_center|LOCUS_14320 >Feature sequence033 1934 2386 gene locus_tag LOCUS_14330 1934 2386 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088399.1 protein_id gnl|my_center|LOCUS_14330 2367 2690 gene locus_tag LOCUS_14340 2367 2690 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098837.1 protein_id gnl|my_center|LOCUS_14340 2687 3313 gene locus_tag LOCUS_14350 2687 3313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 3400 3864 gene locus_tag LOCUS_14360 3400 3864 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621142.1 protein_id gnl|my_center|LOCUS_14360 5328 3892 gene locus_tag LOCUS_14370 5328 3892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_14370 8487 5341 gene locus_tag LOCUS_14380 8487 5341 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_14380 8896 9900 gene locus_tag LOCUS_14390 8896 9900 CDS product multidrug DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471147.1 protein_id gnl|my_center|LOCUS_14390 9903 10811 gene locus_tag LOCUS_14400 gene rbsK 9903 10811 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A401 protein_id gnl|my_center|LOCUS_14400 10818 12149 gene locus_tag LOCUS_14410 10818 12149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 13575 12139 gene locus_tag LOCUS_14420 13575 12139 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121095.1 protein_id gnl|my_center|LOCUS_14420 14824 13622 gene locus_tag LOCUS_14430 14824 13622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 17463 14821 gene locus_tag LOCUS_14440 17463 14821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 17718 18455 gene locus_tag LOCUS_14450 17718 18455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140602.1 protein_id gnl|my_center|LOCUS_14450 21742 18452 gene locus_tag LOCUS_14460 21742 18452 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390311.1 protein_id gnl|my_center|LOCUS_14460 22037 23497 gene locus_tag LOCUS_14470 22037 23497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142067.1 protein_id gnl|my_center|LOCUS_14470 23504 24430 gene locus_tag LOCUS_14480 23504 24430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141477.1 protein_id gnl|my_center|LOCUS_14480 24979 24434 gene locus_tag LOCUS_14490 24979 24434 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100931.1 protein_id gnl|my_center|LOCUS_14490 25672 25046 gene locus_tag LOCUS_14500 25672 25046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 25767 28199 gene locus_tag LOCUS_14510 25767 28199 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202406.1 protein_id gnl|my_center|LOCUS_14510 28970 28239 gene locus_tag LOCUS_14520 gene dltE 28970 28239 CDS product putative oxidoreductase DltE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39577 protein_id gnl|my_center|LOCUS_14520 29289 28954 gene locus_tag LOCUS_14530 29289 28954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 29927 29352 gene locus_tag LOCUS_14540 29927 29352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 31117 29978 gene locus_tag LOCUS_14550 31117 29978 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104266.1 protein_id gnl|my_center|LOCUS_14550 31774 31127 gene locus_tag LOCUS_14560 31774 31127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 32847 31876 gene locus_tag LOCUS_14570 32847 31876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 34272 33013 gene locus_tag LOCUS_14580 34272 33013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 >Feature sequence034 <1 5038 gene locus_tag LOCUS_14590 <1 5038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085890.1:sensor histidine kinase 5042 7246 gene locus_tag LOCUS_14600 5042 7246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 7274 8608 gene locus_tag LOCUS_14610 7274 8608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 8611 8997 gene locus_tag LOCUS_14620 8611 8997 CDS product two-component response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_769503.2 protein_id gnl|my_center|LOCUS_14620 8994 10049 gene locus_tag LOCUS_14630 8994 10049 CDS product adenylate/guanylate cyclase domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085648.1 protein_id gnl|my_center|LOCUS_14630 10633 10031 gene locus_tag LOCUS_14640 10633 10031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 11517 10636 gene locus_tag LOCUS_14650 11517 10636 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963796.1 protein_id gnl|my_center|LOCUS_14650 12755 11616 gene locus_tag LOCUS_14660 12755 11616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 12854 13729 gene locus_tag LOCUS_14670 12854 13729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 13738 14343 gene locus_tag LOCUS_14680 13738 14343 CDS product dimethyladenosine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948175.1 protein_id gnl|my_center|LOCUS_14680 14432 15484 gene locus_tag LOCUS_14690 14432 15484 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071194.1 protein_id gnl|my_center|LOCUS_14690 15742 15668 gene locus_tag LOCUS_t00060 15742 15668 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 16100 15795 gene locus_tag LOCUS_14700 16100 15795 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813222.1 protein_id gnl|my_center|LOCUS_14700 16621 16097 gene locus_tag LOCUS_14710 16621 16097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 17795 16614 gene locus_tag LOCUS_14720 17795 16614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 18198 18794 gene locus_tag LOCUS_14730 18198 18794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 19145 18804 gene locus_tag LOCUS_14740 19145 18804 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966217.1 protein_id gnl|my_center|LOCUS_14740 19282 20229 gene locus_tag LOCUS_14750 19282 20229 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722809.1 protein_id gnl|my_center|LOCUS_14750 21006 20272 gene locus_tag LOCUS_14760 21006 20272 CDS product DUF1275 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537627.1 protein_id gnl|my_center|LOCUS_14760 21178 22983 gene locus_tag LOCUS_14770 21178 22983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 22995 23618 gene locus_tag LOCUS_14780 22995 23618 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964039.1 protein_id gnl|my_center|LOCUS_14780 26101 23627 gene locus_tag LOCUS_14790 26101 23627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 27719 26181 gene locus_tag LOCUS_14800 27719 26181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 30310 27749 gene locus_tag LOCUS_14810 30310 27749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 31887 30307 gene locus_tag LOCUS_14820 31887 30307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 32621 31986 gene locus_tag LOCUS_14830 32621 31986 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941342.1 protein_id gnl|my_center|LOCUS_14830 >Feature sequence035 1564 1142 gene locus_tag LOCUS_14840 1564 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 2373 1588 gene locus_tag LOCUS_14850 gene scdA 2373 1588 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941513.1 protein_id gnl|my_center|LOCUS_14850 2494 2904 gene locus_tag LOCUS_14860 2494 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 2929 4929 gene locus_tag LOCUS_14870 gene nosZ 2929 4929 CDS product nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403087.1 protein_id gnl|my_center|LOCUS_14870 5081 5656 gene locus_tag LOCUS_14880 5081 5656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808194.1 protein_id gnl|my_center|LOCUS_14880 5653 6066 gene locus_tag LOCUS_14890 5653 6066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 6051 7283 gene locus_tag LOCUS_14900 gene nosD 6051 7283 CDS product NosD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403089.1 protein_id gnl|my_center|LOCUS_14900 7280 8017 gene locus_tag LOCUS_14910 7280 8017 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475593.1 protein_id gnl|my_center|LOCUS_14910 8014 9090 gene locus_tag LOCUS_14920 8014 9090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 9087 9854 gene locus_tag LOCUS_14930 gene nosY 9087 9854 CDS product membrane protein NosY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYK9 protein_id gnl|my_center|LOCUS_14930 9872 10417 gene locus_tag LOCUS_14940 9872 10417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 10482 10820 gene locus_tag LOCUS_14950 10482 10820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 10860 13091 gene locus_tag LOCUS_14960 gene oprC 10860 13091 CDS product copper transporter porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119294.1 protein_id gnl|my_center|LOCUS_14960 14649 13324 gene locus_tag LOCUS_14970 gene crnA 14649 13324 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_14970 15973 14690 gene locus_tag LOCUS_14980 15973 14690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201988.1 protein_id gnl|my_center|LOCUS_14980 17758 16331 gene locus_tag LOCUS_14990 17758 16331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 21299 17769 gene locus_tag LOCUS_15000 21299 17769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 22044 21292 gene locus_tag LOCUS_15010 22044 21292 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496681.1 protein_id gnl|my_center|LOCUS_15010 22250 24787 gene locus_tag LOCUS_15020 gene nasB 22250 24787 CDS product nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207014.1 protein_id gnl|my_center|LOCUS_15020 24845 25189 gene locus_tag LOCUS_15030 gene nirD-2 24845 25189 CDS product nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197730.1 protein_id gnl|my_center|LOCUS_15030 25250 26674 gene locus_tag LOCUS_15040 25250 26674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 26682 27344 gene locus_tag LOCUS_15050 26682 27344 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461604.1 protein_id gnl|my_center|LOCUS_15050 27686 27408 gene locus_tag LOCUS_15060 27686 27408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 28439 28768 gene locus_tag LOCUS_15070 28439 28768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 30363 29068 gene locus_tag LOCUS_15080 30363 29068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 31124 30603 gene locus_tag LOCUS_15090 31124 30603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 >Feature sequence036 936 391 gene locus_tag LOCUS_15100 936 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 2408 1035 gene locus_tag LOCUS_15110 2408 1035 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765564.1 protein_id gnl|my_center|LOCUS_15110 3103 2405 gene locus_tag LOCUS_15120 3103 2405 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783816.1 protein_id gnl|my_center|LOCUS_15120 3469 3227 gene locus_tag LOCUS_15130 3469 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 4037 3432 gene locus_tag LOCUS_15140 4037 3432 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_15140 4337 6079 gene locus_tag LOCUS_15150 4337 6079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 7386 6076 gene locus_tag LOCUS_15160 gene rimO 7386 6076 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF6 protein_id gnl|my_center|LOCUS_15160 12278 7455 gene locus_tag LOCUS_15170 12278 7455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 13101 12268 gene locus_tag LOCUS_15180 gene prmA 13101 12268 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963788.1 protein_id gnl|my_center|LOCUS_15180 13803 13105 gene locus_tag LOCUS_15190 13803 13105 CDS product noncanonical pyrimidine nucleotidase, YjjG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963481.1 protein_id gnl|my_center|LOCUS_15190 14111 13806 gene locus_tag LOCUS_15200 14111 13806 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522937.1 protein_id gnl|my_center|LOCUS_15200 14862 14101 gene locus_tag LOCUS_15210 gene aroE 14862 14101 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963879.1 protein_id gnl|my_center|LOCUS_15210 15515 14865 gene locus_tag LOCUS_15220 gene dedA 15515 14865 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000404330.1 protein_id gnl|my_center|LOCUS_15220 16361 15537 gene locus_tag LOCUS_15230 16361 15537 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402811.1 protein_id gnl|my_center|LOCUS_15230 18007 16679 gene locus_tag LOCUS_15240 gene suc1 18007 16679 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038455.1 protein_id gnl|my_center|LOCUS_15240 18641 18009 gene locus_tag LOCUS_15250 18641 18009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 19813 18644 gene locus_tag LOCUS_15260 19813 18644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 20087 21094 gene locus_tag LOCUS_15270 gene ccpA 20087 21094 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888871.1 protein_id gnl|my_center|LOCUS_15270 21162 22559 gene locus_tag LOCUS_15280 21162 22559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 22572 23111 gene locus_tag LOCUS_15290 22572 23111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 24127 23105 gene locus_tag LOCUS_15300 gene hemH 24127 23105 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYE7 protein_id gnl|my_center|LOCUS_15300 24744 24124 gene locus_tag LOCUS_15310 24744 24124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 24950 25093 gene locus_tag LOCUS_15320 24950 25093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 26982 25090 gene locus_tag LOCUS_15330 gene purF 26982 25090 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_15330 27216 27935 gene locus_tag LOCUS_15340 27216 27935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 27950 28819 gene locus_tag LOCUS_15350 27950 28819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 28863 30341 gene locus_tag LOCUS_15360 28863 30341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 30341 31849 gene locus_tag LOCUS_15370 30341 31849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 >Feature sequence037 1280 2341 gene locus_tag LOCUS_15380 1280 2341 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201948.1 protein_id gnl|my_center|LOCUS_15380 2720 2331 gene locus_tag LOCUS_15390 2720 2331 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723119.1 protein_id gnl|my_center|LOCUS_15390 3894 2722 gene locus_tag LOCUS_15400 3894 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124068.1 protein_id gnl|my_center|LOCUS_15400 4719 3970 gene locus_tag LOCUS_15410 gene deoC 4719 3970 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPT7 protein_id gnl|my_center|LOCUS_15410 5980 4931 gene locus_tag LOCUS_15420 5980 4931 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202554.1 protein_id gnl|my_center|LOCUS_15420 7779 6043 gene locus_tag LOCUS_15430 7779 6043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_15430 10762 7844 gene locus_tag LOCUS_15440 10762 7844 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403137.1 protein_id gnl|my_center|LOCUS_15440 11186 12952 gene locus_tag LOCUS_15450 11186 12952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 14048 13068 gene locus_tag LOCUS_15460 14048 13068 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528598.1 protein_id gnl|my_center|LOCUS_15460 14664 14041 gene locus_tag LOCUS_15470 14664 14041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 17547 14731 gene locus_tag LOCUS_15480 17547 14731 CDS product glycosyl hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109131.1 protein_id gnl|my_center|LOCUS_15480 18144 17620 gene locus_tag LOCUS_15490 18144 17620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 19264 18236 gene locus_tag LOCUS_15500 19264 18236 CDS product amino acid lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461701.1 protein_id gnl|my_center|LOCUS_15500 19692 19369 gene locus_tag LOCUS_15510 gene yqjZ 19692 19369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54563 protein_id gnl|my_center|LOCUS_15510 20692 19778 gene locus_tag LOCUS_15520 20692 19778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 23833 20708 gene locus_tag LOCUS_15530 23833 20708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 25143 24292 gene locus_tag LOCUS_15540 25143 24292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 25314 26792 gene locus_tag LOCUS_15550 25314 26792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 26853 28568 gene locus_tag LOCUS_15560 26853 28568 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919507.1 protein_id gnl|my_center|LOCUS_15560 28709 29494 gene locus_tag LOCUS_15570 28709 29494 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788251.1 protein_id gnl|my_center|LOCUS_15570 30251 29556 gene locus_tag LOCUS_15580 30251 29556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 31007 30390 gene locus_tag LOCUS_15590 31007 30390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 31318 31052 gene locus_tag LOCUS_15600 31318 31052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 >Feature sequence038 3513 1804 gene locus_tag LOCUS_15610 3513 1804 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789258.1 protein_id gnl|my_center|LOCUS_15610 3712 4086 gene locus_tag LOCUS_15620 3712 4086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 4320 4934 gene locus_tag LOCUS_15630 4320 4934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15630 4958 5263 gene locus_tag LOCUS_15640 4958 5263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 5276 5770 gene locus_tag LOCUS_15650 gene ybaD 5276 5770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905115.1 protein_id gnl|my_center|LOCUS_15650 6961 5840 gene locus_tag LOCUS_15660 6961 5840 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533426.1 protein_id gnl|my_center|LOCUS_15660 7450 7010 gene locus_tag LOCUS_15670 7450 7010 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393272.1 protein_id gnl|my_center|LOCUS_15670 7529 7981 gene locus_tag LOCUS_15680 7529 7981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 7983 8342 gene locus_tag LOCUS_15690 7983 8342 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462150.1 protein_id gnl|my_center|LOCUS_15690 8414 9262 gene locus_tag LOCUS_15700 gene ada 8414 9262 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020273.1 protein_id gnl|my_center|LOCUS_15700 9249 9986 gene locus_tag LOCUS_15710 9249 9986 CDS product prolyl 4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085746.1 protein_id gnl|my_center|LOCUS_15710 10195 10476 gene locus_tag LOCUS_15720 10195 10476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 10452 11060 gene locus_tag LOCUS_15730 10452 11060 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114795.1 protein_id gnl|my_center|LOCUS_15730 11729 11304 gene locus_tag LOCUS_15740 11729 11304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003029036.1 protein_id gnl|my_center|LOCUS_15740 11951 11739 gene locus_tag LOCUS_15750 11951 11739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 12058 12633 gene locus_tag LOCUS_15760 12058 12633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_15760 12741 12914 gene locus_tag LOCUS_15770 12741 12914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 12908 13900 gene locus_tag LOCUS_15780 12908 13900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 13977 14399 gene locus_tag LOCUS_15790 13977 14399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 14460 14885 gene locus_tag LOCUS_15800 14460 14885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071181.1 protein_id gnl|my_center|LOCUS_15800 14882 15334 gene locus_tag LOCUS_15810 14882 15334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 15346 15816 gene locus_tag LOCUS_15820 15346 15816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 15877 16944 gene locus_tag LOCUS_15830 15877 16944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027021.1 protein_id gnl|my_center|LOCUS_15830 17033 19195 gene locus_tag LOCUS_15840 17033 19195 CDS product molybdopterin containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527789.1 protein_id gnl|my_center|LOCUS_15840 19631 20668 gene locus_tag LOCUS_15850 19631 20668 CDS product disease resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122674.1 protein_id gnl|my_center|LOCUS_15850 20898 21647 gene locus_tag LOCUS_15860 20898 21647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 21806 22363 gene locus_tag LOCUS_15870 21806 22363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 23783 22488 gene locus_tag LOCUS_15880 23783 22488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 24594 23932 gene locus_tag LOCUS_15890 24594 23932 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761529.1 protein_id gnl|my_center|LOCUS_15890 27298 24875 gene locus_tag LOCUS_15900 27298 24875 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_15900 28998 27679 gene locus_tag LOCUS_15910 28998 27679 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798159.1 protein_id gnl|my_center|LOCUS_15910 29186 29470 gene locus_tag LOCUS_15920 29186 29470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 29632 30906 gene locus_tag LOCUS_15930 29632 30906 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119680.1 protein_id gnl|my_center|LOCUS_15930 >Feature sequence039 389 1549 gene locus_tag LOCUS_15940 389 1549 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355946.1 protein_id gnl|my_center|LOCUS_15940 1562 2764 gene locus_tag LOCUS_15950 1562 2764 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768487.1 protein_id gnl|my_center|LOCUS_15950 2776 3633 gene locus_tag LOCUS_15960 2776 3633 CDS product glycosyl transferase family A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202688.1 protein_id gnl|my_center|LOCUS_15960 3795 4250 gene locus_tag LOCUS_15970 3795 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 5478 4243 gene locus_tag LOCUS_15980 5478 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 6767 5598 gene locus_tag LOCUS_15990 6767 5598 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765881.1 protein_id gnl|my_center|LOCUS_15990 7708 6770 gene locus_tag LOCUS_16000 7708 6770 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202693.1 protein_id gnl|my_center|LOCUS_16000 9153 7705 gene locus_tag LOCUS_16010 9153 7705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 10475 9150 gene locus_tag LOCUS_16020 10475 9150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 12558 10477 gene locus_tag LOCUS_16030 12558 10477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 13322 12558 gene locus_tag LOCUS_16040 13322 12558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 14517 13315 gene locus_tag LOCUS_16050 14517 13315 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765042.1 protein_id gnl|my_center|LOCUS_16050 14909 14514 gene locus_tag LOCUS_16060 14909 14514 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763087.1 protein_id gnl|my_center|LOCUS_16060 17541 15169 gene locus_tag LOCUS_16070 17541 15169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 19051 17543 gene locus_tag LOCUS_16080 19051 17543 CDS product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480302.1 protein_id gnl|my_center|LOCUS_16080 20856 19054 gene locus_tag LOCUS_16090 20856 19054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106392.1 protein_id gnl|my_center|LOCUS_16090 22323 21148 gene locus_tag LOCUS_16100 22323 21148 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764417.1 protein_id gnl|my_center|LOCUS_16100 23506 22406 gene locus_tag LOCUS_16110 23506 22406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 24859 23567 gene locus_tag LOCUS_16120 24859 23567 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107678.1 protein_id gnl|my_center|LOCUS_16120 25223 24930 gene locus_tag LOCUS_16130 25223 24930 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 protein_id gnl|my_center|LOCUS_16130 25838 25227 gene locus_tag LOCUS_16140 25838 25227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107677.1 protein_id gnl|my_center|LOCUS_16140 26200 25835 gene locus_tag LOCUS_16150 26200 25835 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794207.1 protein_id gnl|my_center|LOCUS_16150 26747 26187 gene locus_tag LOCUS_16160 26747 26187 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680079.1 protein_id gnl|my_center|LOCUS_16160 27070 27585 gene locus_tag LOCUS_16170 27070 27585 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964526.1 protein_id gnl|my_center|LOCUS_16170 27809 27881 gene locus_tag LOCUS_t00070 27809 27881 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 28770 27820 gene locus_tag LOCUS_16180 28770 27820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 29976 29287 gene locus_tag LOCUS_16190 29976 29287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 30495 30007 gene locus_tag LOCUS_16200 30495 30007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 >Feature sequence040 160 762 gene locus_tag LOCUS_16210 160 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 956 1957 gene locus_tag LOCUS_16220 956 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121884.1 protein_id gnl|my_center|LOCUS_16220 1957 2850 gene locus_tag LOCUS_16230 1957 2850 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761948.1 protein_id gnl|my_center|LOCUS_16230 2850 4292 gene locus_tag LOCUS_16240 2850 4292 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108495.1 protein_id gnl|my_center|LOCUS_16240 4485 5147 gene locus_tag LOCUS_16250 4485 5147 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457314.1 protein_id gnl|my_center|LOCUS_16250 5161 5718 gene locus_tag LOCUS_16260 5161 5718 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_16260 7490 5856 gene locus_tag LOCUS_16270 7490 5856 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962719.1 protein_id gnl|my_center|LOCUS_16270 7642 8649 gene locus_tag LOCUS_16280 7642 8649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 8628 9338 gene locus_tag LOCUS_16290 8628 9338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 9363 10508 gene locus_tag LOCUS_16300 9363 10508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256451.1 protein_id gnl|my_center|LOCUS_16300 10531 11169 gene locus_tag LOCUS_16310 gene ppa 10531 11169 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B0B8Z8 protein_id gnl|my_center|LOCUS_16310 11173 12132 gene locus_tag LOCUS_16320 11173 12132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123438.1 protein_id gnl|my_center|LOCUS_16320 12129 13058 gene locus_tag LOCUS_16330 12129 13058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 13555 13148 gene locus_tag LOCUS_16340 13555 13148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 14012 15325 gene locus_tag LOCUS_16350 14012 15325 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118593.1 protein_id gnl|my_center|LOCUS_16350 16374 15379 gene locus_tag LOCUS_16360 16374 15379 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_16360 16488 16838 gene locus_tag LOCUS_16370 gene fdx1 16488 16838 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_16370 19588 17252 gene locus_tag LOCUS_16380 19588 17252 CDS product ethanolamine ammonia lyase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709186.1 protein_id gnl|my_center|LOCUS_16380 19950 21281 gene locus_tag LOCUS_16390 19950 21281 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM12 protein_id gnl|my_center|LOCUS_16390 22898 21333 gene locus_tag LOCUS_16400 22898 21333 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791107.1 protein_id gnl|my_center|LOCUS_16400 24265 22994 gene locus_tag LOCUS_16410 24265 22994 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_16410 25486 24461 gene locus_tag LOCUS_16420 gene glnII 25486 24461 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNZ8 protein_id gnl|my_center|LOCUS_16420 27383 25650 gene locus_tag LOCUS_16430 27383 25650 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108021.1 protein_id gnl|my_center|LOCUS_16430 27653 28186 gene locus_tag LOCUS_16440 27653 28186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 28186 28869 gene locus_tag LOCUS_16450 28186 28869 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XK1 protein_id gnl|my_center|LOCUS_16450 28874 29533 gene locus_tag LOCUS_16460 28874 29533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963730.1 protein_id gnl|my_center|LOCUS_16460 30307 29588 gene locus_tag LOCUS_16470 30307 29588 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405245.1 protein_id gnl|my_center|LOCUS_16470 <31342 30398 gene locus_tag LOCUS_16480 <31342 30398 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001087134.1:solute:sodium symporter family transporter >Feature sequence041 192 833 gene locus_tag LOCUS_16490 192 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870259.1 protein_id gnl|my_center|LOCUS_16490 827 1786 gene locus_tag LOCUS_16500 827 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 1794 2081 gene locus_tag LOCUS_16510 1794 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 2165 5728 gene locus_tag LOCUS_16520 2165 5728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 6416 5835 gene locus_tag LOCUS_16530 6416 5835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 8743 6476 gene locus_tag LOCUS_16540 8743 6476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 9551 8832 gene locus_tag LOCUS_16550 gene algR 9551 8832 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403194.1 protein_id gnl|my_center|LOCUS_16550 10618 9548 gene locus_tag LOCUS_16560 10618 9548 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403193.1 protein_id gnl|my_center|LOCUS_16560 11314 11051 gene locus_tag LOCUS_16570 11314 11051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 11857 11567 gene locus_tag LOCUS_16580 11857 11567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 12121 11912 gene locus_tag LOCUS_16590 12121 11912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 12749 12255 gene locus_tag LOCUS_16600 12749 12255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 13370 13077 gene locus_tag LOCUS_16610 13370 13077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 14359 13898 gene locus_tag LOCUS_16620 14359 13898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962524.1 protein_id gnl|my_center|LOCUS_16620 14631 16946 gene locus_tag LOCUS_16630 14631 16946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 17152 18012 gene locus_tag LOCUS_16640 17152 18012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 18168 18488 gene locus_tag LOCUS_16650 18168 18488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 18926 18507 gene locus_tag LOCUS_16660 18926 18507 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167645.1 protein_id gnl|my_center|LOCUS_16660 19844 19101 gene locus_tag LOCUS_16670 19844 19101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 20900 19974 gene locus_tag LOCUS_16680 20900 19974 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409743.1 protein_id gnl|my_center|LOCUS_16680 22007 20925 gene locus_tag LOCUS_16690 22007 20925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 23617 22109 gene locus_tag LOCUS_16700 23617 22109 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963170.1 protein_id gnl|my_center|LOCUS_16700 25376 23625 gene locus_tag LOCUS_16710 25376 23625 CDS product pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789735.1 protein_id gnl|my_center|LOCUS_16710 26526 25582 gene locus_tag LOCUS_16720 26526 25582 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119413.1 protein_id gnl|my_center|LOCUS_16720 27419 26796 gene locus_tag LOCUS_16730 27419 26796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 28086 27508 gene locus_tag LOCUS_16740 28086 27508 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_16740 29215 28712 gene locus_tag LOCUS_16750 29215 28712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 29666 29220 gene locus_tag LOCUS_16760 gene marR 29666 29220 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230242.1 protein_id gnl|my_center|LOCUS_16760 30301 29852 gene locus_tag LOCUS_16770 30301 29852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 <31005 30427 gene locus_tag LOCUS_16780 <31005 30427 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227429.1:dehydrogenase >Feature sequence042 250 2055 gene locus_tag LOCUS_16790 250 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 2693 2052 gene locus_tag LOCUS_16800 2693 2052 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458063.1 protein_id gnl|my_center|LOCUS_16800 3019 4116 gene locus_tag LOCUS_16810 3019 4116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 4171 6078 gene locus_tag LOCUS_16820 4171 6078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 9060 6223 gene locus_tag LOCUS_16830 9060 6223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 10260 9157 gene locus_tag LOCUS_16840 10260 9157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 10577 10257 gene locus_tag LOCUS_16850 10577 10257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 11552 10599 gene locus_tag LOCUS_16860 11552 10599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 13076 11703 gene locus_tag LOCUS_16870 13076 11703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 14461 13073 gene locus_tag LOCUS_16880 14461 13073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 16104 14488 gene locus_tag LOCUS_16890 16104 14488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 16681 16208 gene locus_tag LOCUS_16900 16681 16208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 17653 17207 gene locus_tag LOCUS_16910 17653 17207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 18110 18760 gene locus_tag LOCUS_16920 gene citB 18110 18760 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805069.1 protein_id gnl|my_center|LOCUS_16920 18747 20531 gene locus_tag LOCUS_16930 18747 20531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 21165 20560 gene locus_tag LOCUS_16940 21165 20560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 21818 22753 gene locus_tag LOCUS_16950 21818 22753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 22768 23532 gene locus_tag LOCUS_16960 22768 23532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 23848 26658 gene locus_tag LOCUS_16970 gene parC 23848 26658 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962810.1 protein_id gnl|my_center|LOCUS_16970 26674 28578 gene locus_tag LOCUS_16980 26674 28578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 29547 28924 gene locus_tag LOCUS_16990 29547 28924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875754.1 protein_id gnl|my_center|LOCUS_16990 >Feature sequence043 294 73 gene locus_tag LOCUS_17000 294 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 954 766 gene locus_tag LOCUS_17010 954 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 1359 967 gene locus_tag LOCUS_17020 1359 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17020 2489 1935 gene locus_tag LOCUS_17030 2489 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143443.1 protein_id gnl|my_center|LOCUS_17030 2725 2555 gene locus_tag LOCUS_17040 2725 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 3874 3029 gene locus_tag LOCUS_17050 3874 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 4811 3849 gene locus_tag LOCUS_17060 4811 3849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009935873.1 protein_id gnl|my_center|LOCUS_17060 6601 5828 gene locus_tag LOCUS_17070 6601 5828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 6999 6598 gene locus_tag LOCUS_17080 6999 6598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 7598 6996 gene locus_tag LOCUS_17090 7598 6996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 7657 8730 gene locus_tag LOCUS_17100 7657 8730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 8745 9230 gene locus_tag LOCUS_17110 8745 9230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 9234 10109 gene locus_tag LOCUS_17120 9234 10109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 10112 11911 gene locus_tag LOCUS_17130 10112 11911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 12169 12333 gene locus_tag LOCUS_17140 12169 12333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 12974 12411 gene locus_tag LOCUS_17150 12974 12411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 13553 14824 gene locus_tag LOCUS_17160 13553 14824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 14846 18040 gene locus_tag LOCUS_17170 14846 18040 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107855.1 protein_id gnl|my_center|LOCUS_17170 18091 19353 gene locus_tag LOCUS_17180 18091 19353 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107856.1 protein_id gnl|my_center|LOCUS_17180 19669 19406 gene locus_tag LOCUS_17190 19669 19406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 20210 19776 gene locus_tag LOCUS_17200 20210 19776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 21291 20359 gene locus_tag LOCUS_17210 21291 20359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 21457 22725 gene locus_tag LOCUS_17220 gene glyA1 21457 22725 CDS product 2-amino-3-ketobutyrate CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546431.1 protein_id gnl|my_center|LOCUS_17220 22730 23374 gene locus_tag LOCUS_17230 22730 23374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 23456 24655 gene locus_tag LOCUS_17240 23456 24655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 26735 24711 gene locus_tag LOCUS_17250 26735 24711 CDS product 7-beta-(4-carbaxybutanamido)cephalosporanic acid acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403897.1 protein_id gnl|my_center|LOCUS_17250 27476 26814 gene locus_tag LOCUS_17260 27476 26814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 28341 28009 gene locus_tag LOCUS_17270 28341 28009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 <30654 28405 gene locus_tag LOCUS_17280 <30654 28405 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein >Feature sequence044 2244 490 gene locus_tag LOCUS_17290 2244 490 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 protein_id gnl|my_center|LOCUS_17290 2358 2840 gene locus_tag LOCUS_17300 gene recX 2358 2840 CDS product recombinase RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964333.1 protein_id gnl|my_center|LOCUS_17300 2910 3509 gene locus_tag LOCUS_17310 2910 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 4270 3506 gene locus_tag LOCUS_17320 4270 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 6081 4477 gene locus_tag LOCUS_17330 gene yidK 6081 4477 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422351.1 protein_id gnl|my_center|LOCUS_17330 6228 6815 gene locus_tag LOCUS_17340 6228 6815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812610.1 protein_id gnl|my_center|LOCUS_17340 7565 6822 gene locus_tag LOCUS_17350 7565 6822 CDS product malonate transporter MadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084016.1 protein_id gnl|my_center|LOCUS_17350 7930 7562 gene locus_tag LOCUS_17360 7930 7562 CDS product malonate transporter MadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112671.1 protein_id gnl|my_center|LOCUS_17360 9401 7932 gene locus_tag LOCUS_17370 9401 7932 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141122.1 protein_id gnl|my_center|LOCUS_17370 9545 9618 gene locus_tag LOCUS_t00080 9545 9618 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 9825 10271 gene locus_tag LOCUS_17380 9825 10271 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765470.1 protein_id gnl|my_center|LOCUS_17380 10382 11272 gene locus_tag LOCUS_17390 gene era 10382 11272 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H104 protein_id gnl|my_center|LOCUS_17390 11323 12219 gene locus_tag LOCUS_17400 11323 12219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 12336 13646 gene locus_tag LOCUS_17410 gene der 12336 13646 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H103 protein_id gnl|my_center|LOCUS_17410 13897 13682 gene locus_tag LOCUS_17420 13897 13682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 13877 14602 gene locus_tag LOCUS_17430 13877 14602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 17823 14596 gene locus_tag LOCUS_17440 17823 14596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 17947 18945 gene locus_tag LOCUS_17450 17947 18945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 18997 20832 gene locus_tag LOCUS_17460 gene msbA 18997 20832 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036606.1 protein_id gnl|my_center|LOCUS_17460 20960 21412 gene locus_tag LOCUS_17470 20960 21412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 21469 22347 gene locus_tag LOCUS_17480 21469 22347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_17480 22420 23307 gene locus_tag LOCUS_17490 gene rlmF 22420 23307 CDS product ribosomal RNA large subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRM2 protein_id gnl|my_center|LOCUS_17490 24887 23883 gene locus_tag LOCUS_17500 24887 23883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 26750 24927 gene locus_tag LOCUS_17510 26750 24927 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108810.1 protein_id gnl|my_center|LOCUS_17510 26919 27896 gene locus_tag LOCUS_17520 26919 27896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767375.1 protein_id gnl|my_center|LOCUS_17520 27898 30255 gene locus_tag LOCUS_17530 27898 30255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 >Feature sequence045 761 3382 gene locus_tag LOCUS_17540 gene clpB 761 3382 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0F9 protein_id gnl|my_center|LOCUS_17540 4297 3578 gene locus_tag LOCUS_17550 4297 3578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 4634 7285 gene locus_tag LOCUS_17560 4634 7285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 7308 8822 gene locus_tag LOCUS_17570 7308 8822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 9484 8939 gene locus_tag LOCUS_17580 9484 8939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 9588 10976 gene locus_tag LOCUS_17590 9588 10976 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118019.1 protein_id gnl|my_center|LOCUS_17590 11344 11499 gene locus_tag LOCUS_17600 11344 11499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 11576 11791 gene locus_tag LOCUS_17610 11576 11791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087471.1 protein_id gnl|my_center|LOCUS_17610 11795 12130 gene locus_tag LOCUS_17620 11795 12130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 12134 13312 gene locus_tag LOCUS_17630 12134 13312 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_17630 13440 14771 gene locus_tag LOCUS_17640 13440 14771 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788731.1 protein_id gnl|my_center|LOCUS_17640 15786 14746 gene locus_tag LOCUS_17650 15786 14746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 17162 15816 gene locus_tag LOCUS_17660 gene hemN 17162 15816 CDS product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYS7 protein_id gnl|my_center|LOCUS_17660 17853 17251 gene locus_tag LOCUS_17670 gene folA 17853 17251 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226992.1 protein_id gnl|my_center|LOCUS_17670 19346 17952 gene locus_tag LOCUS_17680 19346 17952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 20105 19470 gene locus_tag LOCUS_17690 20105 19470 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_17690 21935 20157 gene locus_tag LOCUS_17700 21935 20157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 23035 22148 gene locus_tag LOCUS_17710 23035 22148 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118048.1 protein_id gnl|my_center|LOCUS_17710 23670 23329 gene locus_tag LOCUS_17720 23670 23329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 24560 23679 gene locus_tag LOCUS_17730 gene modC 24560 23679 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002816233.1 protein_id gnl|my_center|LOCUS_17730 25081 24551 gene locus_tag LOCUS_17740 25081 24551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 25244 25026 gene locus_tag LOCUS_17750 25244 25026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 25623 25219 gene locus_tag LOCUS_17760 25623 25219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 26290 25616 gene locus_tag LOCUS_17770 26290 25616 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798928.1 protein_id gnl|my_center|LOCUS_17770 26930 26457 gene locus_tag LOCUS_17780 26930 26457 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224554.1 protein_id gnl|my_center|LOCUS_17780 27074 27493 gene locus_tag LOCUS_17790 gene aroQ 27074 27493 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H157 protein_id gnl|my_center|LOCUS_17790 28130 27519 gene locus_tag LOCUS_17800 28130 27519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 28559 28137 gene locus_tag LOCUS_17810 28559 28137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 29284 28571 gene locus_tag LOCUS_17820 29284 28571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 >Feature sequence046 791 2716 gene locus_tag LOCUS_17830 791 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 3174 2713 gene locus_tag LOCUS_17840 3174 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113784.1 protein_id gnl|my_center|LOCUS_17840 3635 3177 gene locus_tag LOCUS_17850 3635 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 4542 3625 gene locus_tag LOCUS_17860 4542 3625 CDS product peptidase S66 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962239.1 protein_id gnl|my_center|LOCUS_17860 5329 4628 gene locus_tag LOCUS_17870 5329 4628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 6009 5326 gene locus_tag LOCUS_17880 6009 5326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 7069 6113 gene locus_tag LOCUS_17890 gene irk 7069 6113 CDS product inward rectifier potassium channel Irk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964090.1 protein_id gnl|my_center|LOCUS_17890 7466 7164 gene locus_tag LOCUS_17900 7466 7164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405456.1 protein_id gnl|my_center|LOCUS_17900 7854 7576 gene locus_tag LOCUS_17910 7854 7576 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931759.1 protein_id gnl|my_center|LOCUS_17910 8307 7879 gene locus_tag LOCUS_17920 8307 7879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 8639 8310 gene locus_tag LOCUS_17930 8639 8310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 9804 8698 gene locus_tag LOCUS_17940 9804 8698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 9933 11405 gene locus_tag LOCUS_17950 9933 11405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039143.1 protein_id gnl|my_center|LOCUS_17950 12474 11371 gene locus_tag LOCUS_17960 gene nagA 12474 11371 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32445 protein_id gnl|my_center|LOCUS_17960 12606 13097 gene locus_tag LOCUS_17970 12606 13097 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788990.1 protein_id gnl|my_center|LOCUS_17970 13100 13711 gene locus_tag LOCUS_17980 13100 13711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 13715 13918 gene locus_tag LOCUS_17990 13715 13918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 15228 13912 gene locus_tag LOCUS_18000 15228 13912 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767711.1 protein_id gnl|my_center|LOCUS_18000 15543 15965 gene locus_tag LOCUS_18010 15543 15965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 16695 16033 gene locus_tag LOCUS_18020 gene yniC 16695 16033 CDS product 2-deoxyglucose-6-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070789.1 protein_id gnl|my_center|LOCUS_18020 18502 16721 gene locus_tag LOCUS_18030 18502 16721 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962696.1 protein_id gnl|my_center|LOCUS_18030 19797 18499 gene locus_tag LOCUS_18040 gene ndh 19797 18499 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964035.1 protein_id gnl|my_center|LOCUS_18040 20948 19800 gene locus_tag LOCUS_18050 20948 19800 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962921.1 protein_id gnl|my_center|LOCUS_18050 21080 21928 gene locus_tag LOCUS_18060 21080 21928 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963542.1 protein_id gnl|my_center|LOCUS_18060 21960 22532 gene locus_tag LOCUS_18070 gene purN 21960 22532 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E5 protein_id gnl|my_center|LOCUS_18070 25963 22577 gene locus_tag LOCUS_18080 gene gdhP 25963 22577 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118605.1 protein_id gnl|my_center|LOCUS_18080 26159 27487 gene locus_tag LOCUS_18090 26159 27487 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_18090 28016 27546 gene locus_tag LOCUS_18100 28016 27546 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816623.1 protein_id gnl|my_center|LOCUS_18100 >Feature sequence047 442 218 gene locus_tag LOCUS_18110 442 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 1655 435 gene locus_tag LOCUS_18120 1655 435 CDS product collagenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761719.1 protein_id gnl|my_center|LOCUS_18120 2528 1836 gene locus_tag LOCUS_18130 2528 1836 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009901.1 protein_id gnl|my_center|LOCUS_18130 2730 3137 gene locus_tag LOCUS_18140 gene rpsL 2730 3137 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A472 protein_id gnl|my_center|LOCUS_18140 3250 3717 gene locus_tag LOCUS_18150 gene rpsG 3250 3717 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA2 protein_id gnl|my_center|LOCUS_18150 5312 4032 gene locus_tag LOCUS_18160 5312 4032 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123366.1 protein_id gnl|my_center|LOCUS_18160 6012 5419 gene locus_tag LOCUS_18170 6012 5419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 6563 6159 gene locus_tag LOCUS_18180 6563 6159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 6787 7872 gene locus_tag LOCUS_18190 6787 7872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 8546 7869 gene locus_tag LOCUS_18200 8546 7869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 9170 8547 gene locus_tag LOCUS_18210 gene rsmG 9170 8547 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8M2 protein_id gnl|my_center|LOCUS_18210 10378 9173 gene locus_tag LOCUS_18220 10378 9173 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963583.1 protein_id gnl|my_center|LOCUS_18220 10466 11596 gene locus_tag LOCUS_18230 gene tgt 10466 11596 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TX9 protein_id gnl|my_center|LOCUS_18230 11805 11880 gene locus_tag LOCUS_t00090 11805 11880 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 12201 12770 gene locus_tag LOCUS_18240 12201 12770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 12805 13080 gene locus_tag LOCUS_18250 12805 13080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 13397 13609 gene locus_tag LOCUS_18260 13397 13609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 13606 13902 gene locus_tag LOCUS_18270 13606 13902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 16865 13896 gene locus_tag LOCUS_18280 16865 13896 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263395.1 protein_id gnl|my_center|LOCUS_18280 17553 16855 gene locus_tag LOCUS_18290 17553 16855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 18062 17550 gene locus_tag LOCUS_18300 18062 17550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 18788 18213 gene locus_tag LOCUS_18310 18788 18213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 19991 18810 gene locus_tag LOCUS_18320 19991 18810 CDS product type I restriction-modification system specificity subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263394.1 protein_id gnl|my_center|LOCUS_18320 21456 19993 gene locus_tag LOCUS_18330 21456 19993 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263393.1 protein_id gnl|my_center|LOCUS_18330 21714 21490 gene locus_tag LOCUS_18340 21714 21490 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681617.1 protein_id gnl|my_center|LOCUS_18340 22446 21826 gene locus_tag LOCUS_18350 22446 21826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 23924 22449 gene locus_tag LOCUS_18360 gene hsdM 23924 22449 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263391.1 protein_id gnl|my_center|LOCUS_18360 24493 26157 gene locus_tag LOCUS_18370 24493 26157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 28408 26258 gene locus_tag LOCUS_18380 28408 26258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 >Feature sequence048 <1 2046 gene locus_tag LOCUS_18390 <1 2046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64U07:isoleucine--tRNA ligase 2048 2416 gene locus_tag LOCUS_18400 2048 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 2670 2413 gene locus_tag LOCUS_18410 gene relE 2670 2413 CDS product toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769718.1 protein_id gnl|my_center|LOCUS_18410 2921 2667 gene locus_tag LOCUS_18420 2921 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 3093 3536 gene locus_tag LOCUS_18430 gene yjgF 3093 3536 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962909.1 protein_id gnl|my_center|LOCUS_18430 3579 3860 gene locus_tag LOCUS_18440 3579 3860 CDS product UPF0345 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KK62 protein_id gnl|my_center|LOCUS_18440 3955 5346 gene locus_tag LOCUS_18450 3955 5346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 5391 5912 gene locus_tag LOCUS_18460 5391 5912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 5959 6741 gene locus_tag LOCUS_18470 gene dltE 5959 6741 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123022.1 protein_id gnl|my_center|LOCUS_18470 6734 7867 gene locus_tag LOCUS_18480 6734 7867 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037063.1 protein_id gnl|my_center|LOCUS_18480 8071 8322 gene locus_tag LOCUS_18490 8071 8322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 8682 8374 gene locus_tag LOCUS_18500 8682 8374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 9250 8726 gene locus_tag LOCUS_18510 9250 8726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963023.1 protein_id gnl|my_center|LOCUS_18510 9312 9581 gene locus_tag LOCUS_18520 9312 9581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 9639 13352 gene locus_tag LOCUS_18530 9639 13352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 13909 13349 gene locus_tag LOCUS_18540 13909 13349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 14082 14723 gene locus_tag LOCUS_18550 14082 14723 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787229.1 protein_id gnl|my_center|LOCUS_18550 14720 15397 gene locus_tag LOCUS_18560 14720 15397 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784737.1 protein_id gnl|my_center|LOCUS_18560 16136 15399 gene locus_tag LOCUS_18570 16136 15399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 17750 16335 gene locus_tag LOCUS_18580 17750 16335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 17970 18590 gene locus_tag LOCUS_18590 17970 18590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 19561 18587 gene locus_tag LOCUS_18600 gene pfkA 19561 18587 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PU0 protein_id gnl|my_center|LOCUS_18600 19977 21995 gene locus_tag LOCUS_18610 19977 21995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 22960 22310 gene locus_tag LOCUS_18620 22960 22310 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392490.1 protein_id gnl|my_center|LOCUS_18620 23740 22964 gene locus_tag LOCUS_18630 23740 22964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 24405 23740 gene locus_tag LOCUS_18640 24405 23740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 25010 24405 gene locus_tag LOCUS_18650 25010 24405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 25154 25834 gene locus_tag LOCUS_18660 25154 25834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 25851 27311 gene locus_tag LOCUS_18670 25851 27311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 >Feature sequence049 501 1661 gene locus_tag LOCUS_18680 501 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120602.1 protein_id gnl|my_center|LOCUS_18680 1872 3608 gene locus_tag LOCUS_18690 1872 3608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 6470 3882 gene locus_tag LOCUS_18700 6470 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 7622 6525 gene locus_tag LOCUS_18710 7622 6525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 7960 7634 gene locus_tag LOCUS_18720 7960 7634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 8126 8782 gene locus_tag LOCUS_18730 8126 8782 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887630.1 protein_id gnl|my_center|LOCUS_18730 9501 8986 gene locus_tag LOCUS_18740 9501 8986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 9983 9642 gene locus_tag LOCUS_18750 9983 9642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 10277 9990 gene locus_tag LOCUS_18760 10277 9990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 10602 10267 gene locus_tag LOCUS_18770 10602 10267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 12088 10661 gene locus_tag LOCUS_18780 12088 10661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 13426 12131 gene locus_tag LOCUS_18790 13426 12131 CDS product cephalosporin deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108337.1 protein_id gnl|my_center|LOCUS_18790 13950 13507 gene locus_tag LOCUS_18800 13950 13507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 14437 13976 gene locus_tag LOCUS_18810 14437 13976 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096684.1 protein_id gnl|my_center|LOCUS_18810 16091 14439 gene locus_tag LOCUS_18820 16091 14439 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963720.1 protein_id gnl|my_center|LOCUS_18820 16351 17232 gene locus_tag LOCUS_18830 16351 17232 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760939.1 protein_id gnl|my_center|LOCUS_18830 18387 17266 gene locus_tag LOCUS_18840 18387 17266 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202951.1 protein_id gnl|my_center|LOCUS_18840 19611 18505 gene locus_tag LOCUS_18850 19611 18505 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T01 protein_id gnl|my_center|LOCUS_18850 20524 19784 gene locus_tag LOCUS_18860 20524 19784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 21443 20517 gene locus_tag LOCUS_18870 21443 20517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 22469 21492 gene locus_tag LOCUS_18880 22469 21492 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788227.1 protein_id gnl|my_center|LOCUS_18880 23848 22586 gene locus_tag LOCUS_18890 23848 22586 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788229.1 protein_id gnl|my_center|LOCUS_18890 24456 23845 gene locus_tag LOCUS_18900 24456 23845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 24636 25178 gene locus_tag LOCUS_18910 24636 25178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 25239 26063 gene locus_tag LOCUS_18920 25239 26063 CDS product phytanoyl-CoA dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892805.1 protein_id gnl|my_center|LOCUS_18920 26195 27274 gene locus_tag LOCUS_18930 26195 27274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 27635 27249 gene locus_tag LOCUS_18940 27635 27249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 27944 27660 gene locus_tag LOCUS_18950 27944 27660 CDS product phage DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202809.1 protein_id gnl|my_center|LOCUS_18950 28247 27948 gene locus_tag LOCUS_18960 28247 27948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44190 protein_id gnl|my_center|LOCUS_18960 >Feature sequence050 513 175 gene locus_tag LOCUS_18970 513 175 CDS product type III effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263557.1 protein_id gnl|my_center|LOCUS_18970 1018 515 gene locus_tag LOCUS_18980 gene tpx 1018 515 CDS product putative thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZY8 protein_id gnl|my_center|LOCUS_18980 2317 1070 gene locus_tag LOCUS_18990 2317 1070 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108036.1 protein_id gnl|my_center|LOCUS_18990 4095 2614 gene locus_tag LOCUS_19000 4095 2614 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765651.1 protein_id gnl|my_center|LOCUS_19000 5397 4252 gene locus_tag LOCUS_19010 5397 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 5969 5484 gene locus_tag LOCUS_19020 gene ispF 5969 5484 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886L7 protein_id gnl|my_center|LOCUS_19020 6558 6019 gene locus_tag LOCUS_19030 6558 6019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 6677 7915 gene locus_tag LOCUS_19040 6677 7915 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766931.1 protein_id gnl|my_center|LOCUS_19040 7940 9475 gene locus_tag LOCUS_19050 gene gpmI 7940 9475 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1H2 protein_id gnl|my_center|LOCUS_19050 9713 11122 gene locus_tag LOCUS_19060 9713 11122 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89QV2 protein_id gnl|my_center|LOCUS_19060 11107 12072 gene locus_tag LOCUS_19070 11107 12072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812250.1 protein_id gnl|my_center|LOCUS_19070 12683 12081 gene locus_tag LOCUS_19080 12683 12081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 12792 15224 gene locus_tag LOCUS_19090 12792 15224 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 protein_id gnl|my_center|LOCUS_19090 15279 15950 gene locus_tag LOCUS_19100 15279 15950 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107439.1 protein_id gnl|my_center|LOCUS_19100 16144 17058 gene locus_tag LOCUS_19110 16144 17058 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_19110 19155 17128 gene locus_tag LOCUS_19120 gene uvrB 19155 17128 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY25 protein_id gnl|my_center|LOCUS_19120 19322 20104 gene locus_tag LOCUS_19130 19322 20104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 20128 21441 gene locus_tag LOCUS_19140 20128 21441 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122113.1 protein_id gnl|my_center|LOCUS_19140 22656 21442 gene locus_tag LOCUS_19150 22656 21442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 23352 22726 gene locus_tag LOCUS_19160 23352 22726 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966689.1 protein_id gnl|my_center|LOCUS_19160 24292 23423 gene locus_tag LOCUS_19170 24292 23423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 24341 25045 gene locus_tag LOCUS_19180 24341 25045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 26329 25046 gene locus_tag LOCUS_19190 26329 25046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 26429 27475 gene locus_tag LOCUS_19200 gene rlmN 26429 27475 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B8 protein_id gnl|my_center|LOCUS_19200 >Feature sequence051 1 1062 gene locus_tag LOCUS_19210 gene thiL 1 1062 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QN4 protein_id gnl|my_center|LOCUS_19210 1080 2156 gene locus_tag LOCUS_19220 1080 2156 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202994.1 protein_id gnl|my_center|LOCUS_19220 2153 5155 gene locus_tag LOCUS_19230 2153 5155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 5157 5429 gene locus_tag LOCUS_19240 5157 5429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454560.1 protein_id gnl|my_center|LOCUS_19240 5431 6849 gene locus_tag LOCUS_19250 5431 6849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 8178 6826 gene locus_tag LOCUS_19260 8178 6826 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889560.1 protein_id gnl|my_center|LOCUS_19260 8408 8884 gene locus_tag LOCUS_19270 8408 8884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 9055 10155 gene locus_tag LOCUS_19280 9055 10155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 10383 12593 gene locus_tag LOCUS_19290 gene fecA 10383 12593 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963607.1 protein_id gnl|my_center|LOCUS_19290 12683 13171 gene locus_tag LOCUS_19300 12683 13171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 14373 13174 gene locus_tag LOCUS_19310 14373 13174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_19310 14335 14721 gene locus_tag LOCUS_19320 14335 14721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 14749 15987 gene locus_tag LOCUS_19330 14749 15987 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964122.1 protein_id gnl|my_center|LOCUS_19330 16055 16139 gene locus_tag LOCUS_t00100 16055 16139 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 17683 16475 gene locus_tag LOCUS_19340 17683 16475 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708166.1 protein_id gnl|my_center|LOCUS_19340 19008 17785 gene locus_tag LOCUS_19350 19008 17785 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118454.1 protein_id gnl|my_center|LOCUS_19350 20586 19150 gene locus_tag LOCUS_19360 20586 19150 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404493.1 protein_id gnl|my_center|LOCUS_19360 22078 20663 gene locus_tag LOCUS_19370 gene sdaA 22078 20663 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963040.1 protein_id gnl|my_center|LOCUS_19370 23282 22635 gene locus_tag LOCUS_19380 23282 22635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 24425 24276 gene locus_tag LOCUS_19390 24425 24276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 26179 24773 gene locus_tag LOCUS_19400 26179 24773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 >Feature sequence052 1181 609 gene locus_tag LOCUS_19410 1181 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 1219 1929 gene locus_tag LOCUS_19420 1219 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932971.1 protein_id gnl|my_center|LOCUS_19420 2069 3151 gene locus_tag LOCUS_19430 gene fba 2069 3151 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44429 protein_id gnl|my_center|LOCUS_19430 3736 4104 gene locus_tag LOCUS_19440 3736 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 4252 5571 gene locus_tag LOCUS_19450 gene ffh 4252 5571 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RB9 protein_id gnl|my_center|LOCUS_19450 6545 5622 gene locus_tag LOCUS_19460 6545 5622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140563.1 protein_id gnl|my_center|LOCUS_19460 7774 6644 gene locus_tag LOCUS_19470 7774 6644 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109241.1 protein_id gnl|my_center|LOCUS_19470 8464 7781 gene locus_tag LOCUS_19480 8464 7781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122952.1 protein_id gnl|my_center|LOCUS_19480 9337 8516 gene locus_tag LOCUS_19490 9337 8516 CDS product glyoxal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547977.1 protein_id gnl|my_center|LOCUS_19490 10657 9398 gene locus_tag LOCUS_19500 gene hemA 10657 9398 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93ST4 protein_id gnl|my_center|LOCUS_19500 10853 12067 gene locus_tag LOCUS_19510 gene porY 10853 12067 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_19510 12503 12069 gene locus_tag LOCUS_19520 12503 12069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 12657 13724 gene locus_tag LOCUS_19530 12657 13724 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962301.1 protein_id gnl|my_center|LOCUS_19530 13805 17683 gene locus_tag LOCUS_19540 13805 17683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 18704 17631 gene locus_tag LOCUS_19550 18704 17631 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225756.1 protein_id gnl|my_center|LOCUS_19550 18820 19560 gene locus_tag LOCUS_19560 18820 19560 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 protein_id gnl|my_center|LOCUS_19560 20241 19564 gene locus_tag LOCUS_19570 20241 19564 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345410.1 protein_id gnl|my_center|LOCUS_19570 20466 21179 gene locus_tag LOCUS_19580 20466 21179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404658.1 protein_id gnl|my_center|LOCUS_19580 21231 21857 gene locus_tag LOCUS_19590 21231 21857 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356161.1 protein_id gnl|my_center|LOCUS_19590 21906 22463 gene locus_tag LOCUS_19600 21906 22463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 22494 23030 gene locus_tag LOCUS_19610 22494 23030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963697.1 protein_id gnl|my_center|LOCUS_19610 24143 23043 gene locus_tag LOCUS_19620 24143 23043 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440662.1 protein_id gnl|my_center|LOCUS_19620 25765 24299 gene locus_tag LOCUS_19630 gene guaB 25765 24299 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NW5 protein_id gnl|my_center|LOCUS_19630 26270 25851 gene locus_tag LOCUS_19640 26270 25851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 <27278 26267 gene locus_tag LOCUS_19650 <27278 26267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405065.1:serpin >Feature sequence053 873 2408 gene locus_tag LOCUS_19660 873 2408 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037766.1 protein_id gnl|my_center|LOCUS_19660 4703 2967 gene locus_tag LOCUS_19670 4703 2967 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039194.1 protein_id gnl|my_center|LOCUS_19670 6111 5011 gene locus_tag LOCUS_19680 6111 5011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 7723 6203 gene locus_tag LOCUS_19690 7723 6203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119389.1 protein_id gnl|my_center|LOCUS_19690 8065 8805 gene locus_tag LOCUS_19700 8065 8805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_232567.2 protein_id gnl|my_center|LOCUS_19700 8805 9251 gene locus_tag LOCUS_19710 8805 9251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 9268 9696 gene locus_tag LOCUS_19720 9268 9696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 9741 12071 gene locus_tag LOCUS_19730 9741 12071 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109205.1 protein_id gnl|my_center|LOCUS_19730 12378 13085 gene locus_tag LOCUS_19740 12378 13085 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870305.1 protein_id gnl|my_center|LOCUS_19740 13123 14073 gene locus_tag LOCUS_19750 13123 14073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 14075 15214 gene locus_tag LOCUS_19760 14075 15214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 15227 16564 gene locus_tag LOCUS_19770 15227 16564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 17848 16589 gene locus_tag LOCUS_19780 17848 16589 CDS product exopolygalacturonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109139.1 protein_id gnl|my_center|LOCUS_19780 18049 18990 gene locus_tag LOCUS_19790 18049 18990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 19258 19034 gene locus_tag LOCUS_19800 19258 19034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 19368 21089 gene locus_tag LOCUS_19810 19368 21089 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919507.1 protein_id gnl|my_center|LOCUS_19810 21282 21875 gene locus_tag LOCUS_19820 21282 21875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919508.1 protein_id gnl|my_center|LOCUS_19820 22135 24078 gene locus_tag LOCUS_19830 22135 24078 CDS product amylosucrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258398.1 protein_id gnl|my_center|LOCUS_19830 25318 24086 gene locus_tag LOCUS_19840 25318 24086 CDS product flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085289.1 protein_id gnl|my_center|LOCUS_19840 26533 25322 gene locus_tag LOCUS_19850 gene paaJ 26533 25322 CDS product 3-oxoadipyl-CoA/3-oxo-5,6-dehydrosuberyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C7L2 protein_id gnl|my_center|LOCUS_19850 >Feature sequence054 201 1418 gene locus_tag LOCUS_19860 201 1418 CDS product tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203295.1 protein_id gnl|my_center|LOCUS_19860 1430 2335 gene locus_tag LOCUS_19870 1430 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 2943 3233 gene locus_tag LOCUS_19880 2943 3233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 3244 4335 gene locus_tag LOCUS_19890 3244 4335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 4482 6458 gene locus_tag LOCUS_19900 4482 6458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 6464 6793 gene locus_tag LOCUS_19910 6464 6793 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321975.1 protein_id gnl|my_center|LOCUS_19910 6813 8666 gene locus_tag LOCUS_19920 6813 8666 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942009.1 protein_id gnl|my_center|LOCUS_19920 8663 9541 gene locus_tag LOCUS_19930 8663 9541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 9552 10352 gene locus_tag LOCUS_19940 9552 10352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 12140 11094 gene locus_tag LOCUS_19950 12140 11094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 14154 12142 gene locus_tag LOCUS_19960 14154 12142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 14928 14854 gene locus_tag LOCUS_t00110 14928 14854 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 15078 16070 gene locus_tag LOCUS_19970 15078 16070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765598.1 protein_id gnl|my_center|LOCUS_19970 16063 16797 gene locus_tag LOCUS_19980 gene cutC 16063 16797 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6Q4 protein_id gnl|my_center|LOCUS_19980 17406 16804 gene locus_tag LOCUS_19990 17406 16804 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963973.1 protein_id gnl|my_center|LOCUS_19990 17518 18099 gene locus_tag LOCUS_20000 17518 18099 CDS product putative 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NH09 protein_id gnl|my_center|LOCUS_20000 18124 19512 gene locus_tag LOCUS_20010 18124 19512 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108334.1 protein_id gnl|my_center|LOCUS_20010 19513 19824 gene locus_tag LOCUS_20020 19513 19824 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122463.1 protein_id gnl|my_center|LOCUS_20020 20215 19826 gene locus_tag LOCUS_20030 20215 19826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 20317 20733 gene locus_tag LOCUS_20040 20317 20733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553163.1 protein_id gnl|my_center|LOCUS_20040 21749 20751 gene locus_tag LOCUS_20050 gene adhP 21749 20751 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053082.1 protein_id gnl|my_center|LOCUS_20050 22624 21752 gene locus_tag LOCUS_20060 gene cysM 22624 21752 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIE1 protein_id gnl|my_center|LOCUS_20060 23437 22628 gene locus_tag LOCUS_20070 23437 22628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 25917 23527 gene locus_tag LOCUS_20080 25917 23527 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_20080 >Feature sequence055 1854 988 gene locus_tag LOCUS_20090 1854 988 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966313.1 protein_id gnl|my_center|LOCUS_20090 2081 2386 gene locus_tag LOCUS_20100 gene rpsJ 2081 2386 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA0 protein_id gnl|my_center|LOCUS_20100 4916 2445 gene locus_tag LOCUS_20110 gene lon 4916 2445 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A8 protein_id gnl|my_center|LOCUS_20110 5814 5056 gene locus_tag LOCUS_20120 gene hisF 5814 5056 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGW2 protein_id gnl|my_center|LOCUS_20120 6267 5821 gene locus_tag LOCUS_20130 6267 5821 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704723.1 protein_id gnl|my_center|LOCUS_20130 6995 6267 gene locus_tag LOCUS_20140 gene hisA 6995 6267 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY76 protein_id gnl|my_center|LOCUS_20140 7611 7003 gene locus_tag LOCUS_20150 gene hisH 7611 7003 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY77 protein_id gnl|my_center|LOCUS_20150 8458 7985 gene locus_tag LOCUS_20160 8458 7985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 9354 8605 gene locus_tag LOCUS_20170 9354 8605 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_20170 10078 9356 gene locus_tag LOCUS_20180 10078 9356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 12252 10492 gene locus_tag LOCUS_20190 12252 10492 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786230.1 protein_id gnl|my_center|LOCUS_20190 12573 14534 gene locus_tag LOCUS_20200 12573 14534 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931557.1 protein_id gnl|my_center|LOCUS_20200 14623 15270 gene locus_tag LOCUS_20210 14623 15270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 16633 15260 gene locus_tag LOCUS_20220 16633 15260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 16759 18726 gene locus_tag LOCUS_20230 gene dnaG 16759 18726 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P92 protein_id gnl|my_center|LOCUS_20230 19382 18723 gene locus_tag LOCUS_20240 19382 18723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 19659 22193 gene locus_tag LOCUS_20250 19659 22193 CDS product glutaminyl-tRNA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405453.1 protein_id gnl|my_center|LOCUS_20250 22272 24911 gene locus_tag LOCUS_20260 22272 24911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 25369 24908 gene locus_tag LOCUS_20270 gene ssb 25369 24908 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63XJ3 protein_id gnl|my_center|LOCUS_20270 26439 25375 gene locus_tag LOCUS_20280 gene mutY 26439 25375 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963777.1 protein_id gnl|my_center|LOCUS_20280 >Feature sequence056 1776 2201 gene locus_tag LOCUS_20290 1776 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 2185 2376 gene locus_tag LOCUS_20300 2185 2376 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879124.1 protein_id gnl|my_center|LOCUS_20300 3022 2549 gene locus_tag LOCUS_20310 3022 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 4928 3183 gene locus_tag LOCUS_20320 4928 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 5960 5157 gene locus_tag LOCUS_20330 5960 5157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 6717 6157 gene locus_tag LOCUS_20340 6717 6157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 8640 7345 gene locus_tag LOCUS_20350 8640 7345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119919.1 protein_id gnl|my_center|LOCUS_20350 9536 8637 gene locus_tag LOCUS_20360 9536 8637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 9712 10443 gene locus_tag LOCUS_20370 9712 10443 CDS product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81AW2 protein_id gnl|my_center|LOCUS_20370 10535 11671 gene locus_tag LOCUS_20380 10535 11671 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023149.1 protein_id gnl|my_center|LOCUS_20380 11821 13944 gene locus_tag LOCUS_20390 11821 13944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 13958 14146 gene locus_tag LOCUS_20400 13958 14146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 14207 14623 gene locus_tag LOCUS_20410 14207 14623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 14689 15954 gene locus_tag LOCUS_20420 14689 15954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 16061 17104 gene locus_tag LOCUS_20430 16061 17104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 18803 17367 gene locus_tag LOCUS_20440 18803 17367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_20440 20815 18803 gene locus_tag LOCUS_20450 20815 18803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 22442 21075 gene locus_tag LOCUS_20460 22442 21075 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119046.1 protein_id gnl|my_center|LOCUS_20460 23262 22480 gene locus_tag LOCUS_20470 23262 22480 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405245.1 protein_id gnl|my_center|LOCUS_20470 23511 24437 gene locus_tag LOCUS_20480 23511 24437 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479611.1 protein_id gnl|my_center|LOCUS_20480 24614 26161 gene locus_tag LOCUS_20490 24614 26161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 >Feature sequence057 263 1339 gene locus_tag LOCUS_20500 gene aroC 263 1339 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PP7 protein_id gnl|my_center|LOCUS_20500 1910 1395 gene locus_tag LOCUS_20510 gene pyrR2 1910 1395 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963563.1 protein_id gnl|my_center|LOCUS_20510 2048 2428 gene locus_tag LOCUS_20520 2048 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 2526 3017 gene locus_tag LOCUS_20530 2526 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 3203 3021 gene locus_tag LOCUS_20540 3203 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 3479 3943 gene locus_tag LOCUS_20550 3479 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404629.1 protein_id gnl|my_center|LOCUS_20550 3948 5327 gene locus_tag LOCUS_20560 3948 5327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 5324 5755 gene locus_tag LOCUS_20570 5324 5755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 9206 5745 gene locus_tag LOCUS_20580 9206 5745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 9515 10963 gene locus_tag LOCUS_20590 9515 10963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332558.1 protein_id gnl|my_center|LOCUS_20590 10973 12520 gene locus_tag LOCUS_20600 10973 12520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 12663 13016 gene locus_tag LOCUS_20610 12663 13016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 13745 13053 gene locus_tag LOCUS_20620 13745 13053 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790587.1 protein_id gnl|my_center|LOCUS_20620 15394 13745 gene locus_tag LOCUS_20630 15394 13745 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_20630 15827 15453 gene locus_tag LOCUS_20640 gene rnpA 15827 15453 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H257 protein_id gnl|my_center|LOCUS_20640 16139 17563 gene locus_tag LOCUS_20650 16139 17563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 17752 18561 gene locus_tag LOCUS_20660 17752 18561 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962288.1 protein_id gnl|my_center|LOCUS_20660 18566 19909 gene locus_tag LOCUS_20670 18566 19909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 20009 21847 gene locus_tag LOCUS_20680 gene glmS 20009 21847 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV6 protein_id gnl|my_center|LOCUS_20680 21851 22762 gene locus_tag LOCUS_20690 gene yedA 21851 22762 CDS product putative inner membrane transporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AA72 protein_id gnl|my_center|LOCUS_20690 22752 23600 gene locus_tag LOCUS_20700 gene panC 22752 23600 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XM3 protein_id gnl|my_center|LOCUS_20700 23656 24003 gene locus_tag LOCUS_20710 gene ytxJ 23656 24003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181889.1 protein_id gnl|my_center|LOCUS_20710 24609 23986 gene locus_tag LOCUS_20720 24609 23986 CDS product siderophore biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107823.1 protein_id gnl|my_center|LOCUS_20720 24653 25561 gene locus_tag LOCUS_20730 24653 25561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056340.1 protein_id gnl|my_center|LOCUS_20730 >Feature sequence058 1117 2535 gene locus_tag LOCUS_20740 1117 2535 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_20740 2551 4092 gene locus_tag LOCUS_20750 2551 4092 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_20750 4579 4181 gene locus_tag LOCUS_20760 4579 4181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 5701 4967 gene locus_tag LOCUS_20770 5701 4967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 8180 5817 gene locus_tag LOCUS_20780 8180 5817 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_20780 8747 8388 gene locus_tag LOCUS_20790 8747 8388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 9441 8989 gene locus_tag LOCUS_20800 9441 8989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 12067 10037 gene locus_tag LOCUS_20810 12067 10037 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107156.1 protein_id gnl|my_center|LOCUS_20810 12677 12240 gene locus_tag LOCUS_20820 12677 12240 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q819C5 protein_id gnl|my_center|LOCUS_20820 14390 12753 gene locus_tag LOCUS_20830 14390 12753 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557282.1 protein_id gnl|my_center|LOCUS_20830 14590 15471 gene locus_tag LOCUS_20840 gene fabD 14590 15471 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWP6 protein_id gnl|my_center|LOCUS_20840 15589 15660 gene locus_tag LOCUS_t00120 15589 15660 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 15756 17294 gene locus_tag LOCUS_20850 15756 17294 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482406.1 protein_id gnl|my_center|LOCUS_20850 17959 17291 gene locus_tag LOCUS_20860 17959 17291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 18132 19508 gene locus_tag LOCUS_20870 18132 19508 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201931.1 protein_id gnl|my_center|LOCUS_20870 19558 20034 gene locus_tag LOCUS_20880 19558 20034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 protein_id gnl|my_center|LOCUS_20880 21137 20031 gene locus_tag LOCUS_20890 21137 20031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 21720 21226 gene locus_tag LOCUS_20900 21720 21226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 22963 21710 gene locus_tag LOCUS_20910 gene fjo17 22963 21710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962204.1 protein_id gnl|my_center|LOCUS_20910 24549 23260 gene locus_tag LOCUS_20920 gene purD 24549 23260 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2F2 protein_id gnl|my_center|LOCUS_20920 >Feature sequence059 785 237 gene locus_tag LOCUS_20930 785 237 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705037.1 protein_id gnl|my_center|LOCUS_20930 1534 875 gene locus_tag LOCUS_20940 1534 875 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511395.1 protein_id gnl|my_center|LOCUS_20940 2161 4131 gene locus_tag LOCUS_20950 2161 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 4128 4826 gene locus_tag LOCUS_20960 gene lytT 4128 4826 CDS product sensory transduction protein LytT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94514 protein_id gnl|my_center|LOCUS_20960 5044 6264 gene locus_tag LOCUS_20970 5044 6264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 6351 6677 gene locus_tag LOCUS_20980 6351 6677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 6935 9967 gene locus_tag LOCUS_20990 6935 9967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 9987 10439 gene locus_tag LOCUS_21000 9987 10439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 10619 10488 gene locus_tag LOCUS_21010 10619 10488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 11989 10922 gene locus_tag LOCUS_21020 11989 10922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 12355 12017 gene locus_tag LOCUS_21030 12355 12017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 14530 12533 gene locus_tag LOCUS_21040 14530 12533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 16706 14769 gene locus_tag LOCUS_21050 16706 14769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 18439 16946 gene locus_tag LOCUS_21060 18439 16946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140647.1 protein_id gnl|my_center|LOCUS_21060 18399 18548 gene locus_tag LOCUS_21070 18399 18548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 18881 18672 gene locus_tag LOCUS_21080 18881 18672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 19591 18968 gene locus_tag LOCUS_21090 19591 18968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 21310 19604 gene locus_tag LOCUS_21100 21310 19604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 21971 21426 gene locus_tag LOCUS_21110 21971 21426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 22876 21968 gene locus_tag LOCUS_21120 22876 21968 CDS product protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_21120 24039 22885 gene locus_tag LOCUS_21130 24039 22885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 25740 24058 gene locus_tag LOCUS_21140 25740 24058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 >Feature sequence060 160 88 gene locus_tag LOCUS_t00130 160 88 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 295 222 gene locus_tag LOCUS_t00140 295 222 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 393 308 gene locus_tag LOCUS_t00150 393 308 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1551 544 gene locus_tag LOCUS_21150 1551 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 2472 1600 gene locus_tag LOCUS_21160 2472 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 3050 2487 gene locus_tag LOCUS_21170 3050 2487 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_21170 3256 3711 gene locus_tag LOCUS_21180 3256 3711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 3849 4514 gene locus_tag LOCUS_21190 3849 4514 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085103.1 protein_id gnl|my_center|LOCUS_21190 4694 4500 gene locus_tag LOCUS_21200 4694 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 5850 4705 gene locus_tag LOCUS_21210 5850 4705 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114990.1 protein_id gnl|my_center|LOCUS_21210 6543 5983 gene locus_tag LOCUS_21220 6543 5983 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738964.1 protein_id gnl|my_center|LOCUS_21220 7515 6556 gene locus_tag LOCUS_21230 7515 6556 CDS product flavonol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 protein_id gnl|my_center|LOCUS_21230 8213 7599 gene locus_tag LOCUS_21240 gene recR 8213 7599 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8T6 protein_id gnl|my_center|LOCUS_21240 8516 8223 gene locus_tag LOCUS_21250 8516 8223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 8598 10067 gene locus_tag LOCUS_21260 8598 10067 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963433.1 protein_id gnl|my_center|LOCUS_21260 11310 10057 gene locus_tag LOCUS_21270 11310 10057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 11422 11886 gene locus_tag LOCUS_21280 11422 11886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 11883 12395 gene locus_tag LOCUS_21290 gene nuoB 11883 12395 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEC2 protein_id gnl|my_center|LOCUS_21290 12706 12398 gene locus_tag LOCUS_21300 12706 12398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 12905 13507 gene locus_tag LOCUS_21310 12905 13507 CDS product RNA polymerase sigma factor SigX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406744.1 protein_id gnl|my_center|LOCUS_21310 13509 13706 gene locus_tag LOCUS_21320 13509 13706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 13706 14533 gene locus_tag LOCUS_21330 13706 14533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 14554 15465 gene locus_tag LOCUS_21340 14554 15465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_21340 15496 15903 gene locus_tag LOCUS_21350 gene mscL 15496 15903 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K46 protein_id gnl|my_center|LOCUS_21350 16228 17265 gene locus_tag LOCUS_21360 16228 17265 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403335.1 protein_id gnl|my_center|LOCUS_21360 17262 18368 gene locus_tag LOCUS_21370 gene murG 17262 18368 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZM1 protein_id gnl|my_center|LOCUS_21370 18365 19141 gene locus_tag LOCUS_21380 18365 19141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 19143 19904 gene locus_tag LOCUS_21390 19143 19904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 19923 21281 gene locus_tag LOCUS_21400 gene ftsA 19923 21281 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPH0 protein_id gnl|my_center|LOCUS_21400 21314 22657 gene locus_tag LOCUS_21410 21314 22657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 24840 22735 gene locus_tag LOCUS_21420 gene fusA 24840 22735 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA1 protein_id gnl|my_center|LOCUS_21420 >Feature sequence061 <1 1836 gene locus_tag LOCUS_21430 <1 1836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119332.1:RNA-binding protein 2252 5182 gene locus_tag LOCUS_21440 2252 5182 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_21440 5204 6886 gene locus_tag LOCUS_21450 5204 6886 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108167.1 protein_id gnl|my_center|LOCUS_21450 7029 7703 gene locus_tag LOCUS_21460 7029 7703 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765779.1 protein_id gnl|my_center|LOCUS_21460 7714 9063 gene locus_tag LOCUS_21470 7714 9063 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765564.1 protein_id gnl|my_center|LOCUS_21470 9451 12477 gene locus_tag LOCUS_21480 9451 12477 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_21480 12464 14170 gene locus_tag LOCUS_21490 12464 14170 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108167.1 protein_id gnl|my_center|LOCUS_21490 15217 14444 gene locus_tag LOCUS_21500 15217 14444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 16029 15214 gene locus_tag LOCUS_21510 gene cdd4 16029 15214 CDS product bacitracin ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860908.1 protein_id gnl|my_center|LOCUS_21510 18348 16441 gene locus_tag LOCUS_21520 18348 16441 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764318.1 protein_id gnl|my_center|LOCUS_21520 19752 18466 gene locus_tag LOCUS_21530 19752 18466 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085582.1 protein_id gnl|my_center|LOCUS_21530 19877 20677 gene locus_tag LOCUS_21540 19877 20677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 22202 20814 gene locus_tag LOCUS_21550 22202 20814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582791.1 protein_id gnl|my_center|LOCUS_21550 22883 22272 gene locus_tag LOCUS_21560 22883 22272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 23944 22916 gene locus_tag LOCUS_21570 23944 22916 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T4 protein_id gnl|my_center|LOCUS_21570 24003 24938 gene locus_tag LOCUS_21580 24003 24938 CDS product CAAX protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404461.1 protein_id gnl|my_center|LOCUS_21580 >Feature sequence062 2591 4870 gene locus_tag LOCUS_21590 2591 4870 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 protein_id gnl|my_center|LOCUS_21590 5061 4927 gene locus_tag LOCUS_21600 5061 4927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 5772 5140 gene locus_tag LOCUS_21610 5772 5140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 5932 6894 gene locus_tag LOCUS_21620 gene metF 5932 6894 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0T1 protein_id gnl|my_center|LOCUS_21620 7413 6955 gene locus_tag LOCUS_21630 7413 6955 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KB93 protein_id gnl|my_center|LOCUS_21630 8906 7434 gene locus_tag LOCUS_21640 gene proS 8906 7434 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A988 protein_id gnl|my_center|LOCUS_21640 9110 10456 gene locus_tag LOCUS_21650 9110 10456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 10567 12078 gene locus_tag LOCUS_21660 10567 12078 CDS product hemin receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795092.1 protein_id gnl|my_center|LOCUS_21660 12675 12157 gene locus_tag LOCUS_21670 gene aroK 12675 12157 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I323 protein_id gnl|my_center|LOCUS_21670 13820 12693 gene locus_tag LOCUS_21680 13820 12693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791116.1 protein_id gnl|my_center|LOCUS_21680 14347 13817 gene locus_tag LOCUS_21690 14347 13817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 protein_id gnl|my_center|LOCUS_21690 14463 15302 gene locus_tag LOCUS_21700 gene folP 14463 15302 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH8 protein_id gnl|my_center|LOCUS_21700 15408 17531 gene locus_tag LOCUS_21710 15408 17531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 17607 18725 gene locus_tag LOCUS_21720 gene atoB 17607 18725 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225240.1 protein_id gnl|my_center|LOCUS_21720 18722 20029 gene locus_tag LOCUS_21730 18722 20029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 20064 21977 gene locus_tag LOCUS_21740 20064 21977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 22028 22438 gene locus_tag LOCUS_21750 22028 22438 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYU6 protein_id gnl|my_center|LOCUS_21750 22440 23540 gene locus_tag LOCUS_21760 gene lpxB 22440 23540 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_21760 23544 24032 gene locus_tag LOCUS_21770 23544 24032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 >Feature sequence063 46 330 gene locus_tag LOCUS_21780 46 330 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762277.1 protein_id gnl|my_center|LOCUS_21780 343 1155 gene locus_tag LOCUS_21790 343 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 1486 3039 gene locus_tag LOCUS_21800 gene cafA 1486 3039 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963779.1 protein_id gnl|my_center|LOCUS_21800 4149 3082 gene locus_tag LOCUS_21810 4149 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 4791 4363 gene locus_tag LOCUS_21820 4791 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 6279 5047 gene locus_tag LOCUS_21830 6279 5047 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783728.1 protein_id gnl|my_center|LOCUS_21830 6354 7097 gene locus_tag LOCUS_21840 6354 7097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 7512 7165 gene locus_tag LOCUS_21850 7512 7165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 7800 8819 gene locus_tag LOCUS_21860 gene pheS 7800 8819 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A756 protein_id gnl|my_center|LOCUS_21860 8827 11115 gene locus_tag LOCUS_21870 8827 11115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 11609 11082 gene locus_tag LOCUS_21880 11609 11082 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_21880 11723 13084 gene locus_tag LOCUS_21890 11723 13084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 13478 14374 gene locus_tag LOCUS_21900 13478 14374 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_21900 14492 16051 gene locus_tag LOCUS_21910 14492 16051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 16183 19413 gene locus_tag LOCUS_21920 16183 19413 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107964.1 protein_id gnl|my_center|LOCUS_21920 19425 21146 gene locus_tag LOCUS_21930 19425 21146 CDS product glycan metabolism protein RagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767780.1 protein_id gnl|my_center|LOCUS_21930 21771 23114 gene locus_tag LOCUS_21940 21771 23114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 >Feature sequence064 <1 814 gene locus_tag LOCUS_21950 <1 814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A6K0:purine nucleoside phosphorylase 995 1465 gene locus_tag LOCUS_21960 995 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 2350 1523 gene locus_tag LOCUS_21970 2350 1523 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258943.1 protein_id gnl|my_center|LOCUS_21970 4334 2433 gene locus_tag LOCUS_21980 4334 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 5106 4768 gene locus_tag LOCUS_21990 5106 4768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538054.1 protein_id gnl|my_center|LOCUS_21990 6047 5202 gene locus_tag LOCUS_22000 6047 5202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 6421 6975 gene locus_tag LOCUS_22010 6421 6975 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_22010 6972 8279 gene locus_tag LOCUS_22020 6972 8279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 8375 8875 gene locus_tag LOCUS_22030 8375 8875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 8888 9517 gene locus_tag LOCUS_22040 8888 9517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 9528 10076 gene locus_tag LOCUS_22050 9528 10076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404781.1 protein_id gnl|my_center|LOCUS_22050 11076 10153 gene locus_tag LOCUS_22060 11076 10153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 12710 11094 gene locus_tag LOCUS_22070 12710 11094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 13572 12763 gene locus_tag LOCUS_22080 gene gldL 13572 12763 CDS product gliding motility protein GldL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964074.1 protein_id gnl|my_center|LOCUS_22080 14746 13661 gene locus_tag LOCUS_22090 14746 13661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 15906 14992 gene locus_tag LOCUS_22100 15906 14992 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_22100 16854 16057 gene locus_tag LOCUS_22110 16854 16057 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_22110 18051 16900 gene locus_tag LOCUS_22120 18051 16900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 18532 18083 gene locus_tag LOCUS_22130 gene mgsA 18532 18083 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E059 protein_id gnl|my_center|LOCUS_22130 18638 20140 gene locus_tag LOCUS_22140 18638 20140 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_22140 20518 20144 gene locus_tag LOCUS_22150 20518 20144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 20648 21577 gene locus_tag LOCUS_22160 20648 21577 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766770.1 protein_id gnl|my_center|LOCUS_22160 21767 21692 gene locus_tag LOCUS_t00160 21767 21692 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 <24732 21827 gene locus_tag LOCUS_22170 <24732 21827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962917.1:beta-N-acetylglucosaminidase >Feature sequence065 <1 1917 gene locus_tag LOCUS_22180 <1 1917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein 3142 1958 gene locus_tag LOCUS_22190 3142 1958 CDS product lycopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257690.1 protein_id gnl|my_center|LOCUS_22190 4012 3143 gene locus_tag LOCUS_22200 gene lipA 4012 3143 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZL9 protein_id gnl|my_center|LOCUS_22200 4785 4012 gene locus_tag LOCUS_22210 4785 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 4954 5823 gene locus_tag LOCUS_22220 gene xerC 4954 5823 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MR6 protein_id gnl|my_center|LOCUS_22220 6542 5820 gene locus_tag LOCUS_22230 6542 5820 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962331.1 protein_id gnl|my_center|LOCUS_22230 7087 6539 gene locus_tag LOCUS_22240 7087 6539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 8400 7147 gene locus_tag LOCUS_22250 gene clpX 8400 7147 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A128 protein_id gnl|my_center|LOCUS_22250 9142 8471 gene locus_tag LOCUS_22260 gene clpP 9142 8471 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C3 protein_id gnl|my_center|LOCUS_22260 10604 9261 gene locus_tag LOCUS_22270 10604 9261 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791866.1 protein_id gnl|my_center|LOCUS_22270 10755 10673 gene locus_tag LOCUS_t00170 10755 10673 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10937 13198 gene locus_tag LOCUS_22280 gene relA 10937 13198 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 protein_id gnl|my_center|LOCUS_22280 13266 13775 gene locus_tag LOCUS_22290 13266 13775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 13853 14317 gene locus_tag LOCUS_22300 13853 14317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 14356 15627 gene locus_tag LOCUS_22310 gene purA 14356 15627 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U4 protein_id gnl|my_center|LOCUS_22310 15631 16218 gene locus_tag LOCUS_22320 15631 16218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 16840 16226 gene locus_tag LOCUS_22330 16840 16226 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764144.1 protein_id gnl|my_center|LOCUS_22330 16937 18427 gene locus_tag LOCUS_22340 16937 18427 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767922.1 protein_id gnl|my_center|LOCUS_22340 18509 19015 gene locus_tag LOCUS_22350 18509 19015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 19255 19094 gene locus_tag LOCUS_22360 19255 19094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 19420 19262 gene locus_tag LOCUS_22370 19420 19262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 19748 20245 gene locus_tag LOCUS_22380 19748 20245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 20246 20464 gene locus_tag LOCUS_22390 20246 20464 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223905.1 protein_id gnl|my_center|LOCUS_22390 20474 21163 gene locus_tag LOCUS_22400 20474 21163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510899.1 protein_id gnl|my_center|LOCUS_22400 21301 23466 gene locus_tag LOCUS_22410 21301 23466 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963765.1 protein_id gnl|my_center|LOCUS_22410 >Feature sequence066 1725 199 gene locus_tag LOCUS_22420 1725 199 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N41 protein_id gnl|my_center|LOCUS_22420 2779 1793 gene locus_tag LOCUS_22430 gene ybfQ 2779 1793 CDS product UPF0176 protein YbfQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31457 protein_id gnl|my_center|LOCUS_22430 2886 3515 gene locus_tag LOCUS_22440 2886 3515 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_22440 3611 4120 gene locus_tag LOCUS_22450 3611 4120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22450 4187 6592 gene locus_tag LOCUS_22460 4187 6592 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783669.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22460 6715 7257 gene locus_tag LOCUS_22470 6715 7257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 7250 9556 gene locus_tag LOCUS_22480 7250 9556 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203288.1 protein_id gnl|my_center|LOCUS_22480 10974 9817 gene locus_tag LOCUS_22490 gene dnaJ 10974 9817 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8C3 protein_id gnl|my_center|LOCUS_22490 11594 11052 gene locus_tag LOCUS_22500 gene grpE 11594 11052 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8C4 protein_id gnl|my_center|LOCUS_22500 12148 11759 gene locus_tag LOCUS_22510 12148 11759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 12280 13230 gene locus_tag LOCUS_22520 gene queG 12280 13230 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G2 protein_id gnl|my_center|LOCUS_22520 14569 13199 gene locus_tag LOCUS_22530 14569 13199 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765778.1 protein_id gnl|my_center|LOCUS_22530 15291 14599 gene locus_tag LOCUS_22540 15291 14599 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765779.1 protein_id gnl|my_center|LOCUS_22540 16976 15291 gene locus_tag LOCUS_22550 16976 15291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 19270 17102 gene locus_tag LOCUS_22560 gene sprE 19270 17102 CDS product gliding motility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964554.1 protein_id gnl|my_center|LOCUS_22560 20118 19333 gene locus_tag LOCUS_22570 20118 19333 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768801.1 protein_id gnl|my_center|LOCUS_22570 21759 20119 gene locus_tag LOCUS_22580 21759 20119 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799138.1 protein_id gnl|my_center|LOCUS_22580 22586 21756 gene locus_tag LOCUS_22590 22586 21756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 23443 22595 gene locus_tag LOCUS_22600 23443 22595 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_22600 <24266 23545 gene locus_tag LOCUS_22610 <24266 23545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259724.1:pyridine nucleotide-disulfide oxidoreductase >Feature sequence067 625 3534 gene locus_tag LOCUS_22620 625 3534 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203621.1 protein_id gnl|my_center|LOCUS_22620 3558 5072 gene locus_tag LOCUS_22630 3558 5072 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203622.1 protein_id gnl|my_center|LOCUS_22630 5159 8521 gene locus_tag LOCUS_22640 5159 8521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 9534 8518 gene locus_tag LOCUS_22650 9534 8518 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_22650 11001 9646 gene locus_tag LOCUS_22660 11001 9646 CDS product bifunctional D-altronate/D-mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_709762.1 protein_id gnl|my_center|LOCUS_22660 12601 11057 gene locus_tag LOCUS_22670 12601 11057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403146.1 protein_id gnl|my_center|LOCUS_22670 15748 12614 gene locus_tag LOCUS_22680 15748 12614 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766148.1 protein_id gnl|my_center|LOCUS_22680 17475 17296 gene locus_tag LOCUS_22690 17475 17296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 18529 17801 gene locus_tag LOCUS_22700 18529 17801 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143172.1 protein_id gnl|my_center|LOCUS_22700 20030 18540 gene locus_tag LOCUS_22710 gene zwf 20030 18540 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLF3 protein_id gnl|my_center|LOCUS_22710 20676 20233 gene locus_tag LOCUS_22720 20676 20233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 21474 20866 gene locus_tag LOCUS_22730 gene ychE 21474 20866 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E276 protein_id gnl|my_center|LOCUS_22730 21989 21471 gene locus_tag LOCUS_22740 21989 21471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 22159 22977 gene locus_tag LOCUS_22750 22159 22977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 23092 23844 gene locus_tag LOCUS_22760 23092 23844 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120647.1 protein_id gnl|my_center|LOCUS_22760 >Feature sequence068 1305 73 gene locus_tag LOCUS_22770 1305 73 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482600.1 protein_id gnl|my_center|LOCUS_22770 1783 1361 gene locus_tag LOCUS_22780 1783 1361 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963834.1 protein_id gnl|my_center|LOCUS_22780 2522 1824 gene locus_tag LOCUS_22790 2522 1824 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 protein_id gnl|my_center|LOCUS_22790 3187 2603 gene locus_tag LOCUS_22800 3187 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 3524 4318 gene locus_tag LOCUS_22810 gene lpxH 3524 4318 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_22810 4926 4321 gene locus_tag LOCUS_22820 4926 4321 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140612.1 protein_id gnl|my_center|LOCUS_22820 6895 5030 gene locus_tag LOCUS_22830 6895 5030 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107811.1 protein_id gnl|my_center|LOCUS_22830 7979 7014 gene locus_tag LOCUS_22840 7979 7014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 8630 7983 gene locus_tag LOCUS_22850 8630 7983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368615.1 protein_id gnl|my_center|LOCUS_22850 9886 8783 gene locus_tag LOCUS_22860 9886 8783 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957826.1 protein_id gnl|my_center|LOCUS_22860 11040 10033 gene locus_tag LOCUS_22870 11040 10033 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937445.1 protein_id gnl|my_center|LOCUS_22870 11543 11037 gene locus_tag LOCUS_22880 11543 11037 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81E04 protein_id gnl|my_center|LOCUS_22880 13846 11540 gene locus_tag LOCUS_22890 13846 11540 CDS product acyl-CoA oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404446.1 protein_id gnl|my_center|LOCUS_22890 14544 13909 gene locus_tag LOCUS_22900 14544 13909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 15189 14572 gene locus_tag LOCUS_22910 15189 14572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 15503 15186 gene locus_tag LOCUS_22920 15503 15186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 15655 16251 gene locus_tag LOCUS_22930 15655 16251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 16251 16484 gene locus_tag LOCUS_22940 16251 16484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 16474 17307 gene locus_tag LOCUS_22950 16474 17307 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YA2 protein_id gnl|my_center|LOCUS_22950 17307 18005 gene locus_tag LOCUS_22960 17307 18005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 18618 18097 gene locus_tag LOCUS_22970 18618 18097 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 protein_id gnl|my_center|LOCUS_22970 19115 18621 gene locus_tag LOCUS_22980 19115 18621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 19666 19115 gene locus_tag LOCUS_22990 gene nuoJ 19666 19115 CDS product NADH dehydrogenase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964312.1 protein_id gnl|my_center|LOCUS_22990 20236 19670 gene locus_tag LOCUS_23000 gene nuoI 20236 19670 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1Q5 protein_id gnl|my_center|LOCUS_23000 21380 20238 gene locus_tag LOCUS_23010 gene nuoH 21380 20238 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1Q6 protein_id gnl|my_center|LOCUS_23010 22472 21390 gene locus_tag LOCUS_23020 gene nuoG 22472 21390 CDS product NADH dehydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964315.1 protein_id gnl|my_center|LOCUS_23020 23648 22473 gene locus_tag LOCUS_23030 23648 22473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 >Feature sequence069 <1 1632 gene locus_tag LOCUS_23040 <1 1632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383264.1:GlcNAc-PI de-N-acetylase 1871 1689 gene locus_tag LOCUS_23050 1871 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 1896 2570 gene locus_tag LOCUS_23060 1896 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 2571 3233 gene locus_tag LOCUS_23070 2571 3233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 3237 4181 gene locus_tag LOCUS_23080 gene purC 3237 4181 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A004 protein_id gnl|my_center|LOCUS_23080 4188 5426 gene locus_tag LOCUS_23090 4188 5426 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090913.1 protein_id gnl|my_center|LOCUS_23090 5426 5905 gene locus_tag LOCUS_23100 5426 5905 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788959.1 protein_id gnl|my_center|LOCUS_23100 7790 5973 gene locus_tag LOCUS_23110 7790 5973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 9629 7977 gene locus_tag LOCUS_23120 gene pgi 9629 7977 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L81 protein_id gnl|my_center|LOCUS_23120 10466 9666 gene locus_tag LOCUS_23130 10466 9666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 11267 10632 gene locus_tag LOCUS_23140 11267 10632 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186345.1 protein_id gnl|my_center|LOCUS_23140 11398 12033 gene locus_tag LOCUS_23150 gene lolD 11398 12033 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57066 protein_id gnl|my_center|LOCUS_23150 12105 13202 gene locus_tag LOCUS_23160 12105 13202 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883908.1 protein_id gnl|my_center|LOCUS_23160 13205 13648 gene locus_tag LOCUS_23170 13205 13648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 13730 14239 gene locus_tag LOCUS_23180 13730 14239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 15426 14236 gene locus_tag LOCUS_23190 15426 14236 CDS product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403533.1 protein_id gnl|my_center|LOCUS_23190 15547 17418 gene locus_tag LOCUS_23200 15547 17418 CDS product 6-phosphogluconate dehydrogenase, decarboxylating inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64V77 protein_id gnl|my_center|LOCUS_23200 17518 17603 gene locus_tag LOCUS_t00180 17518 17603 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 17884 17723 gene locus_tag LOCUS_23210 17884 17723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 18859 17891 gene locus_tag LOCUS_23220 18859 17891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 20925 18895 gene locus_tag LOCUS_23230 20925 18895 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776044.1 protein_id gnl|my_center|LOCUS_23230 21395 21619 gene locus_tag LOCUS_23240 21395 21619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 21597 22526 gene locus_tag LOCUS_23250 21597 22526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 >Feature sequence070 704 1459 gene locus_tag LOCUS_23260 704 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 2444 1542 gene locus_tag LOCUS_23270 2444 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962731.1 protein_id gnl|my_center|LOCUS_23270 3068 2562 gene locus_tag LOCUS_23280 3068 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 3246 4073 gene locus_tag LOCUS_23290 3246 4073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 4547 4191 gene locus_tag LOCUS_23300 4547 4191 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067705.1 protein_id gnl|my_center|LOCUS_23300 4662 5909 gene locus_tag LOCUS_23310 4662 5909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 7046 5973 gene locus_tag LOCUS_23320 gene xsa 7046 5973 CDS product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039191.1 protein_id gnl|my_center|LOCUS_23320 7178 7561 gene locus_tag LOCUS_23330 7178 7561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 7612 10005 gene locus_tag LOCUS_23340 gene pac 7612 10005 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964303.1 protein_id gnl|my_center|LOCUS_23340 10108 11310 gene locus_tag LOCUS_23350 10108 11310 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Y26 protein_id gnl|my_center|LOCUS_23350 11334 14531 gene locus_tag LOCUS_23360 11334 14531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 14895 14515 gene locus_tag LOCUS_23370 14895 14515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 16250 14901 gene locus_tag LOCUS_23380 16250 14901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 16394 16792 gene locus_tag LOCUS_23390 16394 16792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 19651 16778 gene locus_tag LOCUS_23400 19651 16778 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA87 protein_id gnl|my_center|LOCUS_23400 19948 19724 gene locus_tag LOCUS_23410 19948 19724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707213.1 protein_id gnl|my_center|LOCUS_23410 20684 19956 gene locus_tag LOCUS_23420 20684 19956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 21075 21425 gene locus_tag LOCUS_23430 21075 21425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788752.1 protein_id gnl|my_center|LOCUS_23430 21524 21706 gene locus_tag LOCUS_23440 gene rpmG 21524 21706 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9A0 protein_id gnl|my_center|LOCUS_23440 21734 21889 gene locus_tag LOCUS_23450 21734 21889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 21924 22379 gene locus_tag LOCUS_23460 21924 22379 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207371.1 protein_id gnl|my_center|LOCUS_23460 22439 23398 gene locus_tag LOCUS_23470 gene ftsY 22439 23398 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TK4 protein_id gnl|my_center|LOCUS_23470 >Feature sequence071 484 651 gene locus_tag LOCUS_23480 484 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 638 1009 gene locus_tag LOCUS_23490 638 1009 CDS product motility twitching protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392206.1 protein_id gnl|my_center|LOCUS_23490 1122 2603 gene locus_tag LOCUS_23500 gene araA 1122 2603 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FNR7 protein_id gnl|my_center|LOCUS_23500 2607 3197 gene locus_tag LOCUS_23510 2607 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 3304 4386 gene locus_tag LOCUS_23520 3304 4386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108152.1 protein_id gnl|my_center|LOCUS_23520 4395 5093 gene locus_tag LOCUS_23530 gene araD 4395 5093 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766123.1 protein_id gnl|my_center|LOCUS_23530 5164 5571 gene locus_tag LOCUS_23540 5164 5571 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962361.1 protein_id gnl|my_center|LOCUS_23540 6771 5581 gene locus_tag LOCUS_23550 6771 5581 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083543.1 protein_id gnl|my_center|LOCUS_23550 6888 7178 gene locus_tag LOCUS_23560 6888 7178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 7305 7502 gene locus_tag LOCUS_23570 7305 7502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 8819 7506 gene locus_tag LOCUS_23580 gene tyrS 8819 7506 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2S5 protein_id gnl|my_center|LOCUS_23580 9514 8879 gene locus_tag LOCUS_23590 9514 8879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 9802 11196 gene locus_tag LOCUS_23600 gene leuC 9802 11196 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6L7 protein_id gnl|my_center|LOCUS_23600 11306 11647 gene locus_tag LOCUS_23610 11306 11647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_23610 11700 12296 gene locus_tag LOCUS_23620 11700 12296 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763198.1 protein_id gnl|my_center|LOCUS_23620 12414 13913 gene locus_tag LOCUS_23630 12414 13913 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789843.1 protein_id gnl|my_center|LOCUS_23630 14005 15069 gene locus_tag LOCUS_23640 gene leuB 14005 15069 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6M0 protein_id gnl|my_center|LOCUS_23640 15468 15193 gene locus_tag LOCUS_23650 15468 15193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 16800 15676 gene locus_tag LOCUS_23660 gene dnaN 16800 15676 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYK6 protein_id gnl|my_center|LOCUS_23660 18552 16894 gene locus_tag LOCUS_23670 gene gldG 18552 16894 CDS product gliding motility-associated ABC transporter substrate-binding protein GldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963229.1 protein_id gnl|my_center|LOCUS_23670 18617 19105 gene locus_tag LOCUS_23680 18617 19105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 19133 19600 gene locus_tag LOCUS_23690 19133 19600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 20184 19603 gene locus_tag LOCUS_23700 20184 19603 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L2 protein_id gnl|my_center|LOCUS_23700 20208 20522 gene locus_tag LOCUS_23710 20208 20522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 21854 20781 gene locus_tag LOCUS_23720 gene prfA 21854 20781 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XW5 protein_id gnl|my_center|LOCUS_23720 22545 21895 gene locus_tag LOCUS_23730 22545 21895 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_23730 22738 23217 gene locus_tag LOCUS_23740 22738 23217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 >Feature sequence072 2078 153 gene locus_tag LOCUS_23750 2078 153 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964069.1 protein_id gnl|my_center|LOCUS_23750 2260 2964 gene locus_tag LOCUS_23760 2260 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 4478 3159 gene locus_tag LOCUS_23770 4478 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789122.1 protein_id gnl|my_center|LOCUS_23770 7742 4482 gene locus_tag LOCUS_23780 7742 4482 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813423.1 protein_id gnl|my_center|LOCUS_23780 7962 9401 gene locus_tag LOCUS_23790 gene miaB 7962 9401 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H119 protein_id gnl|my_center|LOCUS_23790 9402 10724 gene locus_tag LOCUS_23800 9402 10724 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785466.1 protein_id gnl|my_center|LOCUS_23800 10876 11295 gene locus_tag LOCUS_23810 10876 11295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 11289 11657 gene locus_tag LOCUS_23820 11289 11657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 11756 12100 gene locus_tag LOCUS_23830 11756 12100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 12598 12176 gene locus_tag LOCUS_23840 12598 12176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 12808 13083 gene locus_tag LOCUS_23850 gene groS 12808 13083 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H124 protein_id gnl|my_center|LOCUS_23850 13129 14757 gene locus_tag LOCUS_23860 gene groL 13129 14757 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H125 protein_id gnl|my_center|LOCUS_23860 14842 15666 gene locus_tag LOCUS_23870 14842 15666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 15833 17464 gene locus_tag LOCUS_23880 gene pyrG 15833 17464 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U1 protein_id gnl|my_center|LOCUS_23880 17601 20183 gene locus_tag LOCUS_23890 17601 20183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 20248 21582 gene locus_tag LOCUS_23900 20248 21582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 23493 21583 gene locus_tag LOCUS_23910 23493 21583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 >Feature sequence073 <1 501 gene locus_tag LOCUS_23920 <1 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403494.1:multidrug resistance protein 494 1798 gene locus_tag LOCUS_23930 494 1798 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784703.1 protein_id gnl|my_center|LOCUS_23930 1816 2409 gene locus_tag LOCUS_23940 gene nadD 1816 2409 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY8 protein_id gnl|my_center|LOCUS_23940 3161 2400 gene locus_tag LOCUS_23950 gene coaX 3161 2400 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BU2 protein_id gnl|my_center|LOCUS_23950 3362 3898 gene locus_tag LOCUS_23960 3362 3898 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964470.1 protein_id gnl|my_center|LOCUS_23960 3916 4101 gene locus_tag LOCUS_23970 gene rpmF 3916 4101 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H261 protein_id gnl|my_center|LOCUS_23970 4147 5088 gene locus_tag LOCUS_23980 gene plsX 4147 5088 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S6I5 protein_id gnl|my_center|LOCUS_23980 5085 6107 gene locus_tag LOCUS_23990 gene fabH 5085 6107 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NV1 protein_id gnl|my_center|LOCUS_23990 6136 6705 gene locus_tag LOCUS_24000 gene efp 6136 6705 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY96 protein_id gnl|my_center|LOCUS_24000 6796 7269 gene locus_tag LOCUS_24010 gene accB 6796 7269 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_24010 7300 8643 gene locus_tag LOCUS_24020 gene accC 7300 8643 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_24020 8884 11130 gene locus_tag LOCUS_24030 gene uvrD 8884 11130 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXZ5 protein_id gnl|my_center|LOCUS_24030 11180 11422 gene locus_tag LOCUS_24040 11180 11422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 11419 11844 gene locus_tag LOCUS_24050 11419 11844 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666459.1 protein_id gnl|my_center|LOCUS_24050 12223 11873 gene locus_tag LOCUS_24060 12223 11873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721726.1 protein_id gnl|my_center|LOCUS_24060 13574 12351 gene locus_tag LOCUS_24070 13574 12351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088729.1 protein_id gnl|my_center|LOCUS_24070 14170 13592 gene locus_tag LOCUS_24080 gene gmhA 14170 13592 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9S6 protein_id gnl|my_center|LOCUS_24080 15191 14157 gene locus_tag LOCUS_24090 15191 14157 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766012.1 protein_id gnl|my_center|LOCUS_24090 15359 17785 gene locus_tag LOCUS_24100 15359 17785 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107841.1 protein_id gnl|my_center|LOCUS_24100 17912 18766 gene locus_tag LOCUS_24110 17912 18766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_24110 18817 21723 gene locus_tag LOCUS_24120 18817 21723 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121470.1 protein_id gnl|my_center|LOCUS_24120 >Feature sequence074 3242 708 gene locus_tag LOCUS_24130 3242 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 8430 3421 gene locus_tag LOCUS_24140 8430 3421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 9171 8845 gene locus_tag LOCUS_24150 9171 8845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 9307 9936 gene locus_tag LOCUS_24160 gene gacA 9307 9936 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419913.1 protein_id gnl|my_center|LOCUS_24160 9943 12999 gene locus_tag LOCUS_24170 9943 12999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 14124 13000 gene locus_tag LOCUS_24180 gene uxuA 14124 13000 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E0M8 protein_id gnl|my_center|LOCUS_24180 14335 15651 gene locus_tag LOCUS_24190 14335 15651 CDS product glucose/galactose MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762539.1 protein_id gnl|my_center|LOCUS_24190 15759 16760 gene locus_tag LOCUS_24200 15759 16760 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121134.1 protein_id gnl|my_center|LOCUS_24200 17940 16747 gene locus_tag LOCUS_24210 17940 16747 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1S1 protein_id gnl|my_center|LOCUS_24210 18705 17941 gene locus_tag LOCUS_24220 18705 17941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 19693 18668 gene locus_tag LOCUS_24230 gene hpaIIM 19693 18668 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1V6 protein_id gnl|my_center|LOCUS_24230 20554 19820 gene locus_tag LOCUS_24240 gene nagB 20554 19820 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_864370.2 protein_id gnl|my_center|LOCUS_24240 21671 20556 gene locus_tag LOCUS_24250 gene nagX 21671 20556 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_24250 21934 21707 gene locus_tag LOCUS_24260 21934 21707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 >Feature sequence075 796 969 gene locus_tag LOCUS_24270 796 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 1343 978 gene locus_tag LOCUS_24280 1343 978 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259124.1 protein_id gnl|my_center|LOCUS_24280 1480 2922 gene locus_tag LOCUS_24290 1480 2922 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337079.1 protein_id gnl|my_center|LOCUS_24290 3677 2958 gene locus_tag LOCUS_24300 3677 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 3811 6051 gene locus_tag LOCUS_24310 3811 6051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 6724 6041 gene locus_tag LOCUS_24320 6724 6041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 6857 7798 gene locus_tag LOCUS_24330 6857 7798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405471.1 protein_id gnl|my_center|LOCUS_24330 7928 8503 gene locus_tag LOCUS_24340 7928 8503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 9978 8542 gene locus_tag LOCUS_24350 9978 8542 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P23 protein_id gnl|my_center|LOCUS_24350 10288 11202 gene locus_tag LOCUS_24360 10288 11202 CDS product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811759.1 protein_id gnl|my_center|LOCUS_24360 11204 11635 gene locus_tag LOCUS_24370 11204 11635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 12177 11788 gene locus_tag LOCUS_24380 12177 11788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 12255 12485 gene locus_tag LOCUS_24390 12255 12485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 12665 13459 gene locus_tag LOCUS_24400 12665 13459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 14063 13533 gene locus_tag LOCUS_24410 14063 13533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 14282 15613 gene locus_tag LOCUS_24420 14282 15613 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086363.1 protein_id gnl|my_center|LOCUS_24420 15897 17021 gene locus_tag LOCUS_24430 15897 17021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 17075 18739 gene locus_tag LOCUS_24440 17075 18739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539063.1 protein_id gnl|my_center|LOCUS_24440 19493 18822 gene locus_tag LOCUS_24450 19493 18822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 19708 20145 gene locus_tag LOCUS_24460 19708 20145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 20339 21646 gene locus_tag LOCUS_24470 20339 21646 CDS product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131758.1 protein_id gnl|my_center|LOCUS_24470 >Feature sequence076 291 845 gene locus_tag LOCUS_24480 gene infC 291 845 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAP1 protein_id gnl|my_center|LOCUS_24480 1316 963 gene locus_tag LOCUS_24490 1316 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788198.1 protein_id gnl|my_center|LOCUS_24490 2286 1384 gene locus_tag LOCUS_24500 gene bamD 2286 1384 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963942.1 protein_id gnl|my_center|LOCUS_24500 2947 2369 gene locus_tag LOCUS_24510 2947 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 4841 3105 gene locus_tag LOCUS_24520 4841 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963882.1 protein_id gnl|my_center|LOCUS_24520 4905 6245 gene locus_tag LOCUS_24530 gene tilS 4905 6245 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H020 protein_id gnl|my_center|LOCUS_24530 6431 8665 gene locus_tag LOCUS_24540 6431 8665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 8840 10495 gene locus_tag LOCUS_24550 gene recN 8840 10495 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N3 protein_id gnl|my_center|LOCUS_24550 10497 10907 gene locus_tag LOCUS_24560 10497 10907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 10897 11541 gene locus_tag LOCUS_24570 10897 11541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 11528 11926 gene locus_tag LOCUS_24580 11528 11926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 12508 11933 gene locus_tag LOCUS_24590 12508 11933 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202251.1 protein_id gnl|my_center|LOCUS_24590 13803 12508 gene locus_tag LOCUS_24600 13803 12508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 14509 13775 gene locus_tag LOCUS_24610 gene coaX 14509 13775 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZL1 protein_id gnl|my_center|LOCUS_24610 15829 14594 gene locus_tag LOCUS_24620 15829 14594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 16130 17344 gene locus_tag LOCUS_24630 16130 17344 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067002.1 protein_id gnl|my_center|LOCUS_24630 17455 17766 gene locus_tag LOCUS_24640 17455 17766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 17825 18970 gene locus_tag LOCUS_24650 17825 18970 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097689.1 protein_id gnl|my_center|LOCUS_24650 19017 20069 gene locus_tag LOCUS_24660 19017 20069 CDS product AP endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973787.1 protein_id gnl|my_center|LOCUS_24660 20553 20891 gene locus_tag LOCUS_24670 20553 20891 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932186.1 protein_id gnl|my_center|LOCUS_24670 >Feature sequence077 <1 736 gene locus_tag LOCUS_24680 <1 736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861612.1:fibronectin-binding protein A 1194 733 gene locus_tag LOCUS_24690 1194 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 1371 4214 gene locus_tag LOCUS_24700 gene carB 1371 4214 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H128 protein_id gnl|my_center|LOCUS_24700 5922 4459 gene locus_tag LOCUS_24710 5922 4459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 6937 6377 gene locus_tag LOCUS_24720 6937 6377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 7444 7169 gene locus_tag LOCUS_24730 7444 7169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 8772 7624 gene locus_tag LOCUS_24740 8772 7624 CDS product D-amino-acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038761.1 protein_id gnl|my_center|LOCUS_24740 8885 9394 gene locus_tag LOCUS_24750 8885 9394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 9517 10890 gene locus_tag LOCUS_24760 9517 10890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 10887 12332 gene locus_tag LOCUS_24770 10887 12332 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118296.1 protein_id gnl|my_center|LOCUS_24770 12391 13161 gene locus_tag LOCUS_24780 gene fabG 12391 13161 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970553.1 protein_id gnl|my_center|LOCUS_24780 13938 13207 gene locus_tag LOCUS_24790 13938 13207 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767469.1 protein_id gnl|my_center|LOCUS_24790 15707 13935 gene locus_tag LOCUS_24800 15707 13935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 15886 17112 gene locus_tag LOCUS_24810 15886 17112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265931.1 protein_id gnl|my_center|LOCUS_24810 17210 19711 gene locus_tag LOCUS_24820 17210 19711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 19739 20815 gene locus_tag LOCUS_24830 19739 20815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 20909 21655 gene locus_tag LOCUS_24840 20909 21655 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121235.1 protein_id gnl|my_center|LOCUS_24840 >Feature sequence078 2384 1140 gene locus_tag LOCUS_24850 gene bfmBB 2384 1140 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX72 protein_id gnl|my_center|LOCUS_24850 3656 2403 gene locus_tag LOCUS_24860 3656 2403 CDS product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI7 protein_id gnl|my_center|LOCUS_24860 3768 4484 gene locus_tag LOCUS_24870 3768 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964041.1 protein_id gnl|my_center|LOCUS_24870 4575 7466 gene locus_tag LOCUS_24880 4575 7466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 7459 8103 gene locus_tag LOCUS_24890 7459 8103 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259074.1 protein_id gnl|my_center|LOCUS_24890 8164 9066 gene locus_tag LOCUS_24900 8164 9066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 9134 9490 gene locus_tag LOCUS_24910 gene gldC 9134 9490 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_24910 9883 9491 gene locus_tag LOCUS_24920 9883 9491 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090087.1 protein_id gnl|my_center|LOCUS_24920 10456 9887 gene locus_tag LOCUS_24930 10456 9887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 10829 10473 gene locus_tag LOCUS_24940 10829 10473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764003.1 protein_id gnl|my_center|LOCUS_24940 11028 10831 gene locus_tag LOCUS_24950 11028 10831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 12930 11047 gene locus_tag LOCUS_24960 gene ispG 12930 11047 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64N34 protein_id gnl|my_center|LOCUS_24960 13095 13715 gene locus_tag LOCUS_24970 gene queE 13095 13715 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1N2 protein_id gnl|my_center|LOCUS_24970 13819 14025 gene locus_tag LOCUS_24980 13819 14025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 14796 14089 gene locus_tag LOCUS_24990 14796 14089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 14946 15416 gene locus_tag LOCUS_25000 14946 15416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 16435 15476 gene locus_tag LOCUS_25010 16435 15476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119943.1 protein_id gnl|my_center|LOCUS_25010 16641 17501 gene locus_tag LOCUS_25020 16641 17501 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261101.1 protein_id gnl|my_center|LOCUS_25020 17524 18315 gene locus_tag LOCUS_25030 17524 18315 CDS product putative ABC transporter permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZE51 protein_id gnl|my_center|LOCUS_25030 18322 19089 gene locus_tag LOCUS_25040 18322 19089 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_25040 19100 20137 gene locus_tag LOCUS_25050 19100 20137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 20141 20932 gene locus_tag LOCUS_25060 20141 20932 CDS product glucose-1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141114.1 protein_id gnl|my_center|LOCUS_25060 21657 21289 gene locus_tag LOCUS_25070 21657 21289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 >Feature sequence079 85 330 gene locus_tag LOCUS_25080 85 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25080 991 332 gene locus_tag LOCUS_25090 991 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 1058 1306 gene locus_tag LOCUS_25100 1058 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112513.1 protein_id gnl|my_center|LOCUS_25100 2617 1292 gene locus_tag LOCUS_25110 gene xylE 2617 1292 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122710.1 protein_id gnl|my_center|LOCUS_25110 3963 2692 gene locus_tag LOCUS_25120 3963 2692 CDS product 4-hydroxybutyrate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211395.1 protein_id gnl|my_center|LOCUS_25120 4494 4081 gene locus_tag LOCUS_25130 4494 4081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 6116 4494 gene locus_tag LOCUS_25140 6116 4494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 protein_id gnl|my_center|LOCUS_25140 6615 6145 gene locus_tag LOCUS_25150 6615 6145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 7852 6941 gene locus_tag LOCUS_25160 7852 6941 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361996.1 protein_id gnl|my_center|LOCUS_25160 8694 8194 gene locus_tag LOCUS_25170 8694 8194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 9673 8687 gene locus_tag LOCUS_25180 9673 8687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 9825 10859 gene locus_tag LOCUS_25190 9825 10859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 11031 11603 gene locus_tag LOCUS_25200 11031 11603 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_25200 11624 13015 gene locus_tag LOCUS_25210 11624 13015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 13074 13493 gene locus_tag LOCUS_25220 13074 13493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 13549 14448 gene locus_tag LOCUS_25230 13549 14448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576382.1 protein_id gnl|my_center|LOCUS_25230 14464 15021 gene locus_tag LOCUS_25240 14464 15021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577498.1 protein_id gnl|my_center|LOCUS_25240 15024 15815 gene locus_tag LOCUS_25250 15024 15815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 15837 16277 gene locus_tag LOCUS_25260 15837 16277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 16409 20647 gene locus_tag LOCUS_25270 16409 20647 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963036.1 protein_id gnl|my_center|LOCUS_25270 20659 21822 gene locus_tag LOCUS_25280 20659 21822 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963037.1 protein_id gnl|my_center|LOCUS_25280 >Feature sequence080 992 333 gene locus_tag LOCUS_25290 992 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 1980 1045 gene locus_tag LOCUS_25300 1980 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963436.1 protein_id gnl|my_center|LOCUS_25300 3410 1980 gene locus_tag LOCUS_25310 gene arcA 3410 1980 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129417.1 protein_id gnl|my_center|LOCUS_25310 3679 4446 gene locus_tag LOCUS_25320 3679 4446 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783928.1 protein_id gnl|my_center|LOCUS_25320 4463 5770 gene locus_tag LOCUS_25330 gene sufD 4463 5770 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964480.1 protein_id gnl|my_center|LOCUS_25330 5967 6161 gene locus_tag LOCUS_25340 5967 6161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 6164 6502 gene locus_tag LOCUS_25350 6164 6502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 6994 6506 gene locus_tag LOCUS_25360 gene yncA 6994 6506 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963787.1 protein_id gnl|my_center|LOCUS_25360 8396 6984 gene locus_tag LOCUS_25370 8396 6984 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879805.1 protein_id gnl|my_center|LOCUS_25370 9065 8397 gene locus_tag LOCUS_25380 9065 8397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 9575 9069 gene locus_tag LOCUS_25390 9575 9069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424650.1 protein_id gnl|my_center|LOCUS_25390 9708 10952 gene locus_tag LOCUS_25400 9708 10952 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKV3 protein_id gnl|my_center|LOCUS_25400 10993 11421 gene locus_tag LOCUS_25410 10993 11421 CDS product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763578.1 protein_id gnl|my_center|LOCUS_25410 11418 11729 gene locus_tag LOCUS_25420 11418 11729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 11761 12186 gene locus_tag LOCUS_25430 gene yqiW 11761 12186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_25430 13352 12231 gene locus_tag LOCUS_25440 13352 12231 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962384.1 protein_id gnl|my_center|LOCUS_25440 14167 13352 gene locus_tag LOCUS_25450 14167 13352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 15372 14278 gene locus_tag LOCUS_25460 15372 14278 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962424.1 protein_id gnl|my_center|LOCUS_25460 15563 16234 gene locus_tag LOCUS_25470 gene lspA 15563 16234 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64U05 protein_id gnl|my_center|LOCUS_25470 16237 16494 gene locus_tag LOCUS_25480 16237 16494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 17156 16575 gene locus_tag LOCUS_25490 17156 16575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 17647 17168 gene locus_tag LOCUS_25500 gene purE 17647 17168 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC3 protein_id gnl|my_center|LOCUS_25500 18782 17652 gene locus_tag LOCUS_25510 gene purK 18782 17652 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC2 protein_id gnl|my_center|LOCUS_25510 >Feature sequence081 <1 625 gene locus_tag LOCUS_25520 <1 625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202327.1:DNA primase 687 1106 gene locus_tag LOCUS_25530 687 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 1244 1534 gene locus_tag LOCUS_25540 1244 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 2401 1589 gene locus_tag LOCUS_25550 2401 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 2788 3024 gene locus_tag LOCUS_25560 2788 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 5192 3882 gene locus_tag LOCUS_25570 5192 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 5789 7174 gene locus_tag LOCUS_25580 5789 7174 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107591.1 protein_id gnl|my_center|LOCUS_25580 11457 7393 gene locus_tag LOCUS_25590 11457 7393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 12027 11497 gene locus_tag LOCUS_25600 12027 11497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 12830 12633 gene locus_tag LOCUS_25610 12830 12633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 14205 12787 gene locus_tag LOCUS_25620 14205 12787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 18623 14211 gene locus_tag LOCUS_25630 18623 14211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25630 18733 18936 gene locus_tag LOCUS_25640 18733 18936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 >Feature sequence082 598 1668 gene locus_tag LOCUS_25650 598 1668 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107708.1 protein_id gnl|my_center|LOCUS_25650 1634 2371 gene locus_tag LOCUS_25660 1634 2371 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107985.1 protein_id gnl|my_center|LOCUS_25660 2756 2352 gene locus_tag LOCUS_25670 gene yuxK 2756 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40761 protein_id gnl|my_center|LOCUS_25670 3181 2759 gene locus_tag LOCUS_25680 3181 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 3899 3216 gene locus_tag LOCUS_25690 3899 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 4665 3889 gene locus_tag LOCUS_25700 4665 3889 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDL2 protein_id gnl|my_center|LOCUS_25700 5313 4945 gene locus_tag LOCUS_25710 gene yjgF 5313 4945 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962909.1 protein_id gnl|my_center|LOCUS_25710 5366 5980 gene locus_tag LOCUS_25720 5366 5980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_25720 6807 5977 gene locus_tag LOCUS_25730 6807 5977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 7413 6850 gene locus_tag LOCUS_25740 7413 6850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 7945 7511 gene locus_tag LOCUS_25750 7945 7511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 9757 8276 gene locus_tag LOCUS_25760 9757 8276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107406.1 protein_id gnl|my_center|LOCUS_25760 9945 11120 gene locus_tag LOCUS_25770 gene proA 9945 11120 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1E8 protein_id gnl|my_center|LOCUS_25770 11121 11564 gene locus_tag LOCUS_25780 11121 11564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 11565 12308 gene locus_tag LOCUS_25790 11565 12308 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118862.1 protein_id gnl|my_center|LOCUS_25790 12305 13069 gene locus_tag LOCUS_25800 12305 13069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 13072 13920 gene locus_tag LOCUS_25810 13072 13920 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942624.1 protein_id gnl|my_center|LOCUS_25810 14010 14969 gene locus_tag LOCUS_25820 14010 14969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 15028 15810 gene locus_tag LOCUS_25830 15028 15810 CDS product endo-1,3-1,4-beta glucanase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265727.1 protein_id gnl|my_center|LOCUS_25830 15890 16735 gene locus_tag LOCUS_25840 gene prmC 15890 16735 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1D7 protein_id gnl|my_center|LOCUS_25840 16777 17751 gene locus_tag LOCUS_25850 16777 17751 CDS product magnesium chelatase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_25850 18772 17735 gene locus_tag LOCUS_25860 18772 17735 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070727.1 protein_id gnl|my_center|LOCUS_25860 19012 19554 gene locus_tag LOCUS_25870 19012 19554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 21029 19551 gene locus_tag LOCUS_25880 21029 19551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203259.1 protein_id gnl|my_center|LOCUS_25880 21459 21010 gene locus_tag LOCUS_25890 21459 21010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 >Feature sequence083 2312 942 gene locus_tag LOCUS_25900 2312 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582791.1 protein_id gnl|my_center|LOCUS_25900 3118 2894 gene locus_tag LOCUS_25910 3118 2894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 3925 3125 gene locus_tag LOCUS_25920 3925 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 4040 4870 gene locus_tag LOCUS_25930 4040 4870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 5055 6923 gene locus_tag LOCUS_25940 5055 6923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 7125 8018 gene locus_tag LOCUS_25950 7125 8018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 8325 8624 gene locus_tag LOCUS_25960 8325 8624 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201973.1 protein_id gnl|my_center|LOCUS_25960 9838 8918 gene locus_tag LOCUS_25970 9838 8918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 9949 11169 gene locus_tag LOCUS_25980 9949 11169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 12332 11178 gene locus_tag LOCUS_25990 12332 11178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703911.1 protein_id gnl|my_center|LOCUS_25990 13779 12559 gene locus_tag LOCUS_26000 13779 12559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 16054 13820 gene locus_tag LOCUS_26010 16054 13820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 16578 17651 gene locus_tag LOCUS_26020 16578 17651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 17653 18726 gene locus_tag LOCUS_26030 17653 18726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 19168 18743 gene locus_tag LOCUS_26040 19168 18743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 19253 19561 gene locus_tag LOCUS_26050 19253 19561 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948267.1 protein_id gnl|my_center|LOCUS_26050 19922 20437 gene locus_tag LOCUS_26060 19922 20437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26060 21477 20527 gene locus_tag LOCUS_26070 21477 20527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 >Feature sequence084 334 4092 gene locus_tag LOCUS_26080 gene metH 334 4092 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Q2 protein_id gnl|my_center|LOCUS_26080 5072 4134 gene locus_tag LOCUS_26090 5072 4134 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_26090 5130 6212 gene locus_tag LOCUS_26100 gene pdxA 5130 6212 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H263 protein_id gnl|my_center|LOCUS_26100 7074 6193 gene locus_tag LOCUS_26110 7074 6193 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964234.1 protein_id gnl|my_center|LOCUS_26110 8118 7150 gene locus_tag LOCUS_26120 8118 7150 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962479.1 protein_id gnl|my_center|LOCUS_26120 8822 8343 gene locus_tag LOCUS_26130 8822 8343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 8913 11027 gene locus_tag LOCUS_26140 8913 11027 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202602.1 protein_id gnl|my_center|LOCUS_26140 11125 13437 gene locus_tag LOCUS_26150 11125 13437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 13626 13700 gene locus_tag LOCUS_t00190 13626 13700 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 13760 14059 gene locus_tag LOCUS_26160 13760 14059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 14202 14501 gene locus_tag LOCUS_26170 14202 14501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 16250 14601 gene locus_tag LOCUS_26180 16250 14601 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5P4 protein_id gnl|my_center|LOCUS_26180 17771 16389 gene locus_tag LOCUS_26190 17771 16389 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090693.1 protein_id gnl|my_center|LOCUS_26190 18667 17792 gene locus_tag LOCUS_26200 18667 17792 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962779.1 protein_id gnl|my_center|LOCUS_26200 18737 19114 gene locus_tag LOCUS_26210 18737 19114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 19815 19108 gene locus_tag LOCUS_26220 19815 19108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 >Feature sequence085 886 50 gene locus_tag LOCUS_26230 886 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230326.1 protein_id gnl|my_center|LOCUS_26230 1371 1009 gene locus_tag LOCUS_26240 1371 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 4279 2873 gene locus_tag LOCUS_26250 4279 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 5197 4481 gene locus_tag LOCUS_26260 5197 4481 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798966.1 protein_id gnl|my_center|LOCUS_26260 6170 5187 gene locus_tag LOCUS_26270 6170 5187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 6386 8818 gene locus_tag LOCUS_26280 6386 8818 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963986.1 protein_id gnl|my_center|LOCUS_26280 9115 11517 gene locus_tag LOCUS_26290 9115 11517 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_26290 11647 14082 gene locus_tag LOCUS_26300 11647 14082 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_26300 14203 16572 gene locus_tag LOCUS_26310 14203 16572 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_26310 16697 19066 gene locus_tag LOCUS_26320 16697 19066 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_26320 19256 19546 gene locus_tag LOCUS_26330 19256 19546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 20259 19555 gene locus_tag LOCUS_26340 20259 19555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121844.1 protein_id gnl|my_center|LOCUS_26340 >Feature sequence086 237 1226 gene locus_tag LOCUS_26350 237 1226 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962339.1 protein_id gnl|my_center|LOCUS_26350 1417 2994 gene locus_tag LOCUS_26360 gene atpA 1417 2994 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D7 protein_id gnl|my_center|LOCUS_26360 3058 3939 gene locus_tag LOCUS_26370 gene atpG 3058 3939 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D6 protein_id gnl|my_center|LOCUS_26370 4176 5102 gene locus_tag LOCUS_26380 gene prfB 4176 5102 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY00 protein_id gnl|my_center|LOCUS_26380 5170 7446 gene locus_tag LOCUS_26390 5170 7446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 7943 7443 gene locus_tag LOCUS_26400 7943 7443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_26400 8947 8153 gene locus_tag LOCUS_26410 8947 8153 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_26410 9731 9084 gene locus_tag LOCUS_26420 9731 9084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108715.1 protein_id gnl|my_center|LOCUS_26420 11562 9721 gene locus_tag LOCUS_26430 11562 9721 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963061.1 protein_id gnl|my_center|LOCUS_26430 11873 13354 gene locus_tag LOCUS_26440 gene bshC 11873 13354 CDS product putative cysteine ligase BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG1 protein_id gnl|my_center|LOCUS_26440 13932 13363 gene locus_tag LOCUS_26450 13932 13363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 14737 13985 gene locus_tag LOCUS_26460 14737 13985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 15572 14730 gene locus_tag LOCUS_26470 gene mvaB 15572 14730 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 protein_id gnl|my_center|LOCUS_26470 17031 15847 gene locus_tag LOCUS_26480 17031 15847 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_26480 17136 18725 gene locus_tag LOCUS_26490 17136 18725 CDS product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 protein_id gnl|my_center|LOCUS_26490 20399 19083 gene locus_tag LOCUS_26500 gene ahcY 20399 19083 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW32 protein_id gnl|my_center|LOCUS_26500 >Feature sequence087 2236 2637 gene locus_tag LOCUS_26510 2236 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 3158 2688 gene locus_tag LOCUS_26520 3158 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 3702 3148 gene locus_tag LOCUS_26530 3702 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 4293 3742 gene locus_tag LOCUS_26540 4293 3742 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760019.1 protein_id gnl|my_center|LOCUS_26540 5312 4356 gene locus_tag LOCUS_26550 gene tktC 5312 4356 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_26550 6296 5334 gene locus_tag LOCUS_26560 gene tktA 6296 5334 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 protein_id gnl|my_center|LOCUS_26560 6784 6338 gene locus_tag LOCUS_26570 6784 6338 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785789.1 protein_id gnl|my_center|LOCUS_26570 8684 6786 gene locus_tag LOCUS_26580 8684 6786 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963281.1 protein_id gnl|my_center|LOCUS_26580 9289 8681 gene locus_tag LOCUS_26590 9289 8681 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_26590 9559 10272 gene locus_tag LOCUS_26600 9559 10272 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_26600 10551 11177 gene locus_tag LOCUS_26610 10551 11177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 12060 11212 gene locus_tag LOCUS_26620 12060 11212 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933671.1 protein_id gnl|my_center|LOCUS_26620 13370 12057 gene locus_tag LOCUS_26630 13370 12057 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762895.1 protein_id gnl|my_center|LOCUS_26630 14692 13481 gene locus_tag LOCUS_26640 gene sucC 14692 13481 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY30 protein_id gnl|my_center|LOCUS_26640 14813 15463 gene locus_tag LOCUS_26650 gene lolD 14813 15463 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z80 protein_id gnl|my_center|LOCUS_26650 15478 16245 gene locus_tag LOCUS_26660 15478 16245 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036538.1 protein_id gnl|my_center|LOCUS_26660 16936 16418 gene locus_tag LOCUS_26670 16936 16418 CDS product putative metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HI24 protein_id gnl|my_center|LOCUS_26670 17740 16940 gene locus_tag LOCUS_26680 17740 16940 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546263.1 protein_id gnl|my_center|LOCUS_26680 18882 17728 gene locus_tag LOCUS_26690 18882 17728 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764530.1 protein_id gnl|my_center|LOCUS_26690 <20617 18932 gene locus_tag LOCUS_26700 <20617 18932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931885.1:ATP-dependent Clp protease ClpC >Feature sequence088 4148 1782 gene locus_tag LOCUS_26710 4148 1782 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_26710 4497 4946 gene locus_tag LOCUS_26720 4497 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 5332 4952 gene locus_tag LOCUS_26730 5332 4952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 5723 5370 gene locus_tag LOCUS_26740 5723 5370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 6154 7233 gene locus_tag LOCUS_26750 6154 7233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202047.1 protein_id gnl|my_center|LOCUS_26750 7507 7725 gene locus_tag LOCUS_26760 7507 7725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 8201 8839 gene locus_tag LOCUS_26770 8201 8839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 9282 9908 gene locus_tag LOCUS_26780 9282 9908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 9948 10214 gene locus_tag LOCUS_26790 9948 10214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 10521 11402 gene locus_tag LOCUS_26800 10521 11402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919108.1 protein_id gnl|my_center|LOCUS_26800 11443 11703 gene locus_tag LOCUS_26810 11443 11703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 11761 12621 gene locus_tag LOCUS_26820 11761 12621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918966.1 protein_id gnl|my_center|LOCUS_26820 12744 13103 gene locus_tag LOCUS_26830 12744 13103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 13100 13525 gene locus_tag LOCUS_26840 13100 13525 CDS product UPF0310 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A3CKK8 protein_id gnl|my_center|LOCUS_26840 13530 13991 gene locus_tag LOCUS_26850 13530 13991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 14427 14065 gene locus_tag LOCUS_26860 14427 14065 CDS product heavy metal-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963783.1 protein_id gnl|my_center|LOCUS_26860 14534 15412 gene locus_tag LOCUS_26870 14534 15412 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227801.1 protein_id gnl|my_center|LOCUS_26870 15755 16873 gene locus_tag LOCUS_26880 15755 16873 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704685.1 protein_id gnl|my_center|LOCUS_26880 17372 17938 gene locus_tag LOCUS_26890 17372 17938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 18394 18750 gene locus_tag LOCUS_26900 18394 18750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 18803 19156 gene locus_tag LOCUS_26910 18803 19156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 19252 20094 gene locus_tag LOCUS_26920 19252 20094 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295301.1 protein_id gnl|my_center|LOCUS_26920 >Feature sequence089 489 1532 gene locus_tag LOCUS_26930 gene pepL 489 1532 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FHS3 protein_id gnl|my_center|LOCUS_26930 1643 2224 gene locus_tag LOCUS_26940 1643 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 2845 2393 gene locus_tag LOCUS_26950 2845 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 3657 2947 gene locus_tag LOCUS_26960 3657 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 5955 3997 gene locus_tag LOCUS_26970 5955 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 6605 6198 gene locus_tag LOCUS_26980 6605 6198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 7383 6928 gene locus_tag LOCUS_26990 7383 6928 CDS product restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963199.1 protein_id gnl|my_center|LOCUS_26990 7411 8187 gene locus_tag LOCUS_27000 7411 8187 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761555.1 protein_id gnl|my_center|LOCUS_27000 8633 8184 gene locus_tag LOCUS_27010 8633 8184 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962472.1 protein_id gnl|my_center|LOCUS_27010 9749 8715 gene locus_tag LOCUS_27020 9749 8715 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD3 protein_id gnl|my_center|LOCUS_27020 10051 10797 gene locus_tag LOCUS_27030 10051 10797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 10839 11729 gene locus_tag LOCUS_27040 gene acdS 10839 11729 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963338.1 protein_id gnl|my_center|LOCUS_27040 11789 12037 gene locus_tag LOCUS_27050 11789 12037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 12044 12544 gene locus_tag LOCUS_27060 12044 12544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 13926 12541 gene locus_tag LOCUS_27070 gene hslU 13926 12541 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S217 protein_id gnl|my_center|LOCUS_27070 15977 14079 gene locus_tag LOCUS_27080 15977 14079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 19061 16212 gene locus_tag LOCUS_27090 19061 16212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 <20174 19206 gene locus_tag LOCUS_27100 <20174 19206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein >Feature sequence090 1204 524 gene locus_tag LOCUS_27110 gene phoP 1204 524 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_27110 2100 1237 gene locus_tag LOCUS_27120 2100 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 2182 3270 gene locus_tag LOCUS_27130 gene perM 2182 3270 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720964.1 protein_id gnl|my_center|LOCUS_27130 4754 3267 gene locus_tag LOCUS_27140 4754 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783832.1 protein_id gnl|my_center|LOCUS_27140 5728 4835 gene locus_tag LOCUS_27150 gene glpQ 5728 4835 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403347.1 protein_id gnl|my_center|LOCUS_27150 5824 7251 gene locus_tag LOCUS_27160 gene asnS 5824 7251 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T2 protein_id gnl|my_center|LOCUS_27160 7277 8365 gene locus_tag LOCUS_27170 gene nuoH 7277 8365 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEB9 protein_id gnl|my_center|LOCUS_27170 8378 8935 gene locus_tag LOCUS_27180 8378 8935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 8932 9963 gene locus_tag LOCUS_27190 gene proB 8932 9963 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHU2 protein_id gnl|my_center|LOCUS_27190 9965 10219 gene locus_tag LOCUS_27200 9965 10219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213369.1 protein_id gnl|my_center|LOCUS_27200 10913 10260 gene locus_tag LOCUS_27210 10913 10260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 10978 12453 gene locus_tag LOCUS_27220 10978 12453 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144406.1 protein_id gnl|my_center|LOCUS_27220 12713 13996 gene locus_tag LOCUS_27230 gene gltA 12713 13996 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ68 protein_id gnl|my_center|LOCUS_27230 14464 14129 gene locus_tag LOCUS_27240 14464 14129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 14691 15599 gene locus_tag LOCUS_27250 gene natA 14691 15599 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_27250 15608 16948 gene locus_tag LOCUS_27260 gene natB 15608 16948 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_27260 17719 16955 gene locus_tag LOCUS_27270 gene phnP 17719 16955 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 protein_id gnl|my_center|LOCUS_27270 18110 17736 gene locus_tag LOCUS_27280 18110 17736 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065974.1 protein_id gnl|my_center|LOCUS_27280 >Feature sequence091 <1 591 gene locus_tag LOCUS_27290 <1 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KFP0:1,4-dihydroxy-2-naphthoate octaprenyltransferase 666 2000 gene locus_tag LOCUS_27300 666 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 2007 2576 gene locus_tag LOCUS_27310 2007 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 3346 2624 gene locus_tag LOCUS_27320 3346 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 3796 3350 gene locus_tag LOCUS_27330 3796 3350 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965831.1 protein_id gnl|my_center|LOCUS_27330 3905 6340 gene locus_tag LOCUS_27340 3905 6340 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 protein_id gnl|my_center|LOCUS_27340 6442 6636 gene locus_tag LOCUS_27350 gene rpsU 6442 6636 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI7 protein_id gnl|my_center|LOCUS_27350 6726 7604 gene locus_tag LOCUS_27360 gene xerC 6726 7604 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI8 protein_id gnl|my_center|LOCUS_27360 7683 9662 gene locus_tag LOCUS_27370 7683 9662 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963992.1 protein_id gnl|my_center|LOCUS_27370 10427 9699 gene locus_tag LOCUS_27380 10427 9699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 10554 11150 gene locus_tag LOCUS_27390 10554 11150 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766886.1 protein_id gnl|my_center|LOCUS_27390 11147 12103 gene locus_tag LOCUS_27400 11147 12103 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203440.1 protein_id gnl|my_center|LOCUS_27400 12153 13964 gene locus_tag LOCUS_27410 12153 13964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 14805 13969 gene locus_tag LOCUS_27420 14805 13969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 14901 15917 gene locus_tag LOCUS_27430 14901 15917 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788150.1 protein_id gnl|my_center|LOCUS_27430 16041 17093 gene locus_tag LOCUS_27440 gene rfbB 16041 17093 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFL8 protein_id gnl|my_center|LOCUS_27440 17124 17984 gene locus_tag LOCUS_27450 gene rmlA 17124 17984 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A3CNQ3 protein_id gnl|my_center|LOCUS_27450 18520 17993 gene locus_tag LOCUS_27460 18520 17993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 18727 19170 gene locus_tag LOCUS_27470 18727 19170 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963486.1 protein_id gnl|my_center|LOCUS_27470 >Feature sequence092 1728 1072 gene locus_tag LOCUS_27480 1728 1072 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931708.1 protein_id gnl|my_center|LOCUS_27480 2618 1941 gene locus_tag LOCUS_27490 2618 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 3894 3010 gene locus_tag LOCUS_27500 3894 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 4154 6988 gene locus_tag LOCUS_27510 gene uvrA1 4154 6988 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYM2 protein_id gnl|my_center|LOCUS_27510 7051 7446 gene locus_tag LOCUS_27520 7051 7446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 7478 8038 gene locus_tag LOCUS_27530 7478 8038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 8170 8991 gene locus_tag LOCUS_27540 8170 8991 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122505.1 protein_id gnl|my_center|LOCUS_27540 10061 9000 gene locus_tag LOCUS_27550 10061 9000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 12424 10061 gene locus_tag LOCUS_27560 12424 10061 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_27560 13306 12566 gene locus_tag LOCUS_27570 13306 12566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 13448 14470 gene locus_tag LOCUS_27580 13448 14470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 14564 16996 gene locus_tag LOCUS_27590 gene ccoI 14564 16996 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963291.1 protein_id gnl|my_center|LOCUS_27590 17002 17160 gene locus_tag LOCUS_27600 17002 17160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 17272 17685 gene locus_tag LOCUS_27610 17272 17685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 >Feature sequence093 626 553 gene locus_tag LOCUS_t00200 626 553 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 841 1437 gene locus_tag LOCUS_27620 841 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 1479 1563 gene locus_tag LOCUS_t00210 1479 1563 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3103 1598 gene locus_tag LOCUS_27630 3103 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 3209 3757 gene locus_tag LOCUS_27640 3209 3757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 3764 4066 gene locus_tag LOCUS_27650 3764 4066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 5907 4063 gene locus_tag LOCUS_27660 5907 4063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963329.1 protein_id gnl|my_center|LOCUS_27660 6933 5932 gene locus_tag LOCUS_27670 gene lpxK 6933 5932 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM3 protein_id gnl|my_center|LOCUS_27670 7003 8109 gene locus_tag LOCUS_27680 gene menC 7003 8109 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWY1 protein_id gnl|my_center|LOCUS_27680 8980 8072 gene locus_tag LOCUS_27690 gene hemF 8980 8072 CDS product coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN4 protein_id gnl|my_center|LOCUS_27690 9112 10161 gene locus_tag LOCUS_27700 gene hisC 9112 10161 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABA8 protein_id gnl|my_center|LOCUS_27700 10158 11441 gene locus_tag LOCUS_27710 10158 11441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 11567 11493 gene locus_tag LOCUS_t00220 11567 11493 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 14750 11613 gene locus_tag LOCUS_27720 14750 11613 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405100.1 protein_id gnl|my_center|LOCUS_27720 15215 14766 gene locus_tag LOCUS_27730 15215 14766 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682242.1 protein_id gnl|my_center|LOCUS_27730 16615 15224 gene locus_tag LOCUS_27740 16615 15224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 17703 16612 gene locus_tag LOCUS_27750 17703 16612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 18322 17690 gene locus_tag LOCUS_27760 18322 17690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 >Feature sequence094 1297 902 gene locus_tag LOCUS_27770 1297 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 1636 1454 gene locus_tag LOCUS_27780 1636 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 2158 1685 gene locus_tag LOCUS_27790 2158 1685 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265864.1 protein_id gnl|my_center|LOCUS_27790 2822 2202 gene locus_tag LOCUS_27800 2822 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 3557 2850 gene locus_tag LOCUS_27810 3557 2850 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403125.1 protein_id gnl|my_center|LOCUS_27810 3850 4041 gene locus_tag LOCUS_27820 3850 4041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 4171 4443 gene locus_tag LOCUS_27830 4171 4443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 4517 4861 gene locus_tag LOCUS_27840 4517 4861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 4848 5393 gene locus_tag LOCUS_27850 4848 5393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 6757 5390 gene locus_tag LOCUS_27860 6757 5390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 6986 8428 gene locus_tag LOCUS_27870 gene rpoN 6986 8428 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964339.1 protein_id gnl|my_center|LOCUS_27870 8468 9955 gene locus_tag LOCUS_27880 8468 9955 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762735.1 protein_id gnl|my_center|LOCUS_27880 9952 11415 gene locus_tag LOCUS_27890 9952 11415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 11425 12852 gene locus_tag LOCUS_27900 gene hydH 11425 12852 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UEQ7 protein_id gnl|my_center|LOCUS_27900 12934 13884 gene locus_tag LOCUS_27910 12934 13884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 13889 14887 gene locus_tag LOCUS_27920 13889 14887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 15492 15034 gene locus_tag LOCUS_27930 15492 15034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 >Feature sequence095 948 325 gene locus_tag LOCUS_27940 948 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 2550 1063 gene locus_tag LOCUS_27950 gene rpoN 2550 1063 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964339.1 protein_id gnl|my_center|LOCUS_27950 4018 2810 gene locus_tag LOCUS_27960 gene menF 4018 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962818.1 protein_id gnl|my_center|LOCUS_27960 4459 4034 gene locus_tag LOCUS_27970 4459 4034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 4643 4461 gene locus_tag LOCUS_27980 4643 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 5324 4644 gene locus_tag LOCUS_27990 5324 4644 CDS product heme exporter protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404915.1 protein_id gnl|my_center|LOCUS_27990 6002 5340 gene locus_tag LOCUS_28000 6002 5340 CDS product cytochrome C biogenesis protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404914.1 protein_id gnl|my_center|LOCUS_28000 6905 6081 gene locus_tag LOCUS_28010 6905 6081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919506.1 protein_id gnl|my_center|LOCUS_28010 7227 10334 gene locus_tag LOCUS_28020 7227 10334 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791675.1 protein_id gnl|my_center|LOCUS_28020 10348 12204 gene locus_tag LOCUS_28030 10348 12204 CDS product carbohydrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107216.1 protein_id gnl|my_center|LOCUS_28030 12279 15581 gene locus_tag LOCUS_28040 12279 15581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 16640 15636 gene locus_tag LOCUS_28050 16640 15636 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_28050 16989 18167 gene locus_tag LOCUS_28060 16989 18167 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VS5 protein_id gnl|my_center|LOCUS_28060 >Feature sequence096 500 1108 gene locus_tag LOCUS_28070 500 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28070 1105 1896 gene locus_tag LOCUS_28080 1105 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28080 1909 2589 gene locus_tag LOCUS_28090 1909 2589 CDS product UPF0173 metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HCR8 protein_id gnl|my_center|LOCUS_28090 2586 4118 gene locus_tag LOCUS_28100 2586 4118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 4096 4647 gene locus_tag LOCUS_28110 4096 4647 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460612.1 protein_id gnl|my_center|LOCUS_28110 4644 5156 gene locus_tag LOCUS_28120 gene yyaP 4644 5156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37508 protein_id gnl|my_center|LOCUS_28120 5455 6198 gene locus_tag LOCUS_28130 5455 6198 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405048.1 protein_id gnl|my_center|LOCUS_28130 6388 8010 gene locus_tag LOCUS_28140 6388 8010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 8027 9859 gene locus_tag LOCUS_28150 8027 9859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 11058 9871 gene locus_tag LOCUS_28160 gene kbl 11058 9871 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW00 protein_id gnl|my_center|LOCUS_28160 12022 11051 gene locus_tag LOCUS_28170 gene ltd 12022 11051 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_28170 12182 12643 gene locus_tag LOCUS_28180 12182 12643 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963844.1 protein_id gnl|my_center|LOCUS_28180 13173 12640 gene locus_tag LOCUS_28190 13173 12640 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029605.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28190 14679 13345 gene locus_tag LOCUS_28200 14679 13345 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029014.1 protein_id gnl|my_center|LOCUS_28200 15077 15613 gene locus_tag LOCUS_28210 15077 15613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 15653 16132 gene locus_tag LOCUS_28220 15653 16132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816368.1 protein_id gnl|my_center|LOCUS_28220 16136 16342 gene locus_tag LOCUS_28230 16136 16342 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108348.1 protein_id gnl|my_center|LOCUS_28230 16737 16378 gene locus_tag LOCUS_28240 16737 16378 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356348.1 protein_id gnl|my_center|LOCUS_28240 16845 17474 gene locus_tag LOCUS_28250 16845 17474 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973894.1 protein_id gnl|my_center|LOCUS_28250 <18290 17529 gene locus_tag LOCUS_28260 <18290 17529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108848.1:glutaminase >Feature sequence097 1648 980 gene locus_tag LOCUS_28270 1648 980 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788379.1 protein_id gnl|my_center|LOCUS_28270 2779 1739 gene locus_tag LOCUS_28280 2779 1739 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763049.1 protein_id gnl|my_center|LOCUS_28280 4212 2812 gene locus_tag LOCUS_28290 gene uxaC 4212 2812 CDS product uronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9J2 protein_id gnl|my_center|LOCUS_28290 5933 4284 gene locus_tag LOCUS_28300 5933 4284 CDS product dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085758.1 protein_id gnl|my_center|LOCUS_28300 6419 6087 gene locus_tag LOCUS_28310 6419 6087 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467181.1 protein_id gnl|my_center|LOCUS_28310 7441 6410 gene locus_tag LOCUS_28320 7441 6410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 8751 7552 gene locus_tag LOCUS_28330 8751 7552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703911.1 protein_id gnl|my_center|LOCUS_28330 9242 8877 gene locus_tag LOCUS_28340 9242 8877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 10105 9452 gene locus_tag LOCUS_28350 10105 9452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 15242 10245 gene locus_tag LOCUS_28360 15242 10245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 16336 15791 gene locus_tag LOCUS_28370 gene wecD 16336 15791 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704154.1 protein_id gnl|my_center|LOCUS_28370 16859 16449 gene locus_tag LOCUS_28380 16859 16449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 16971 17906 gene locus_tag LOCUS_28390 16971 17906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 >Feature sequence098 2267 18 gene locus_tag LOCUS_28400 2267 18 CDS product maltose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965973.1 protein_id gnl|my_center|LOCUS_28400 2948 2298 gene locus_tag LOCUS_28410 2948 2298 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257887.1 protein_id gnl|my_center|LOCUS_28410 4824 2941 gene locus_tag LOCUS_28420 4824 2941 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405126.1 protein_id gnl|my_center|LOCUS_28420 4995 6731 gene locus_tag LOCUS_28430 4995 6731 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765636.1 protein_id gnl|my_center|LOCUS_28430 6793 7197 gene locus_tag LOCUS_28440 6793 7197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_28440 7289 8638 gene locus_tag LOCUS_28450 7289 8638 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814920.1 protein_id gnl|my_center|LOCUS_28450 9040 9621 gene locus_tag LOCUS_28460 9040 9621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 11387 9687 gene locus_tag LOCUS_28470 11387 9687 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403563.1 protein_id gnl|my_center|LOCUS_28470 14118 11521 gene locus_tag LOCUS_28480 gene hppA1 14118 11521 CDS product putative K(+)-stimulated pyrophosphate-energized sodium pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIS7 protein_id gnl|my_center|LOCUS_28480 16991 14223 gene locus_tag LOCUS_28490 16991 14223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 >Feature sequence099 <1 611 gene locus_tag LOCUS_28500 <1 611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108544.1:glycosyl transferase 1330 617 gene locus_tag LOCUS_28510 1330 617 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_28510 2569 1337 gene locus_tag LOCUS_28520 2569 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 3510 2575 gene locus_tag LOCUS_28530 gene trxB1 3510 2575 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962776.1 protein_id gnl|my_center|LOCUS_28530 5580 3688 gene locus_tag LOCUS_28540 5580 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 5674 6216 gene locus_tag LOCUS_28550 5674 6216 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143033.1 protein_id gnl|my_center|LOCUS_28550 6228 6497 gene locus_tag LOCUS_28560 6228 6497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 6948 6499 gene locus_tag LOCUS_28570 gene crtZ 6948 6499 CDS product beta-carotene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_28570 7854 7018 gene locus_tag LOCUS_28580 gene crtB 7854 7018 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_28580 9317 7851 gene locus_tag LOCUS_28590 gene crtI 9317 7851 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963567.1 protein_id gnl|my_center|LOCUS_28590 10668 9568 gene locus_tag LOCUS_28600 10668 9568 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WA0 protein_id gnl|my_center|LOCUS_28600 10869 11321 gene locus_tag LOCUS_28610 10869 11321 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266276.1 protein_id gnl|my_center|LOCUS_28610 11901 11314 gene locus_tag LOCUS_28620 11901 11314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 11972 12559 gene locus_tag LOCUS_28630 gene ribE 11972 12559 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_28630 12635 13405 gene locus_tag LOCUS_28640 12635 13405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 13410 13715 gene locus_tag LOCUS_28650 gene pspE 13410 13715 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187969.1 protein_id gnl|my_center|LOCUS_28650 14207 13755 gene locus_tag LOCUS_28660 gene dtd 14207 13755 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q833H9 protein_id gnl|my_center|LOCUS_28660 15556 14204 gene locus_tag LOCUS_28670 gene mgtE 15556 14204 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR4 protein_id gnl|my_center|LOCUS_28670 16864 15725 gene locus_tag LOCUS_28680 16864 15725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 <17848 17325 gene locus_tag LOCUS_28690 <17848 17325 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8AAC1:ammonium transporter >Feature sequence100 <1 2304 gene locus_tag LOCUS_28700 <1 2304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008659317.1:ABC transporter permease 2418 4844 gene locus_tag LOCUS_28710 2418 4844 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_28710 5224 7623 gene locus_tag LOCUS_28720 5224 7623 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_28720 7709 10168 gene locus_tag LOCUS_28730 7709 10168 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_28730 10313 12706 gene locus_tag LOCUS_28740 10313 12706 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_28740 12855 15221 gene locus_tag LOCUS_28750 12855 15221 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_28750 15425 17821 gene locus_tag LOCUS_28760 15425 17821 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_28760 >Feature sequence101 1507 329 gene locus_tag LOCUS_28770 1507 329 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_28770 3175 1616 gene locus_tag LOCUS_28780 3175 1616 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403341.1 protein_id gnl|my_center|LOCUS_28780 4781 3390 gene locus_tag LOCUS_28790 4781 3390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 5923 4847 gene locus_tag LOCUS_28800 5923 4847 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767146.1 protein_id gnl|my_center|LOCUS_28800 6011 6415 gene locus_tag LOCUS_28810 6011 6415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 7181 6399 gene locus_tag LOCUS_28820 gene argB 7181 6399 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2B0 protein_id gnl|my_center|LOCUS_28820 8824 7187 gene locus_tag LOCUS_28830 gene ade 8824 7187 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI0 protein_id gnl|my_center|LOCUS_28830 11458 8984 gene locus_tag LOCUS_28840 11458 8984 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784143.1 protein_id gnl|my_center|LOCUS_28840 11831 13420 gene locus_tag LOCUS_28850 gene prfC 11831 13420 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE72 protein_id gnl|my_center|LOCUS_28850 13821 13417 gene locus_tag LOCUS_28860 13821 13417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 15068 13860 gene locus_tag LOCUS_28870 gene ald 15068 13860 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_28870 15517 15050 gene locus_tag LOCUS_28880 15517 15050 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784762.1 protein_id gnl|my_center|LOCUS_28880 15642 17477 gene locus_tag LOCUS_28890 15642 17477 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792058.1 protein_id gnl|my_center|LOCUS_28890 >Feature sequence102 2421 4406 gene locus_tag LOCUS_28900 2421 4406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 4412 5062 gene locus_tag LOCUS_28910 4412 5062 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594346.1 protein_id gnl|my_center|LOCUS_28910 5539 5327 gene locus_tag LOCUS_28920 5539 5327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 7346 7699 gene locus_tag LOCUS_28930 7346 7699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 7737 8066 gene locus_tag LOCUS_28940 7737 8066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28940 8021 8221 gene locus_tag LOCUS_28950 8021 8221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 8404 8619 gene locus_tag LOCUS_28960 8404 8619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 14229 10123 gene locus_tag LOCUS_28970 14229 10123 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403261.1 protein_id gnl|my_center|LOCUS_28970 14762 14589 gene locus_tag LOCUS_28980 14762 14589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 14879 15124 gene locus_tag LOCUS_28990 14879 15124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 15376 15759 gene locus_tag LOCUS_29000 15376 15759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 16269 16760 gene locus_tag LOCUS_29010 16269 16760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 17384 16737 gene locus_tag LOCUS_29020 17384 16737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 >Feature sequence103 <1 894 gene locus_tag LOCUS_29030 <1 894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005817866.1:helicase 962 1726 gene locus_tag LOCUS_29040 962 1726 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108741.1 protein_id gnl|my_center|LOCUS_29040 1973 3658 gene locus_tag LOCUS_29050 1973 3658 CDS product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817202.1 protein_id gnl|my_center|LOCUS_29050 3853 4485 gene locus_tag LOCUS_29060 3853 4485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977465.1 protein_id gnl|my_center|LOCUS_29060 5556 4501 gene locus_tag LOCUS_29070 gene hypE 5556 4501 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933452.1 protein_id gnl|my_center|LOCUS_29070 6659 5553 gene locus_tag LOCUS_29080 6659 5553 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_29080 9020 6708 gene locus_tag LOCUS_29090 gene hypF 9020 6708 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66902 protein_id gnl|my_center|LOCUS_29090 9429 9115 gene locus_tag LOCUS_29100 9429 9115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964062.1 protein_id gnl|my_center|LOCUS_29100 10204 9476 gene locus_tag LOCUS_29110 10204 9476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 10934 10326 gene locus_tag LOCUS_29120 10934 10326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 11243 12523 gene locus_tag LOCUS_29130 gene radA 11243 12523 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVU9 protein_id gnl|my_center|LOCUS_29130 12533 14071 gene locus_tag LOCUS_29140 12533 14071 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787651.1 protein_id gnl|my_center|LOCUS_29140 14249 16453 gene locus_tag LOCUS_29150 14249 16453 CDS product bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763077.1 protein_id gnl|my_center|LOCUS_29150 16470 17534 gene locus_tag LOCUS_29160 16470 17534 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942993.1 protein_id gnl|my_center|LOCUS_29160 >Feature sequence104 279 860 gene locus_tag LOCUS_29170 279 860 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU8 protein_id gnl|my_center|LOCUS_29170 862 1230 gene locus_tag LOCUS_29180 862 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403459.1 protein_id gnl|my_center|LOCUS_29180 1290 1706 gene locus_tag LOCUS_29190 1290 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090582.1 protein_id gnl|my_center|LOCUS_29190 1754 1957 gene locus_tag LOCUS_29200 1754 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786366.1 protein_id gnl|my_center|LOCUS_29200 2437 1973 gene locus_tag LOCUS_29210 2437 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 2617 3102 gene locus_tag LOCUS_29220 2617 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 3103 4173 gene locus_tag LOCUS_29230 3103 4173 CDS product O-succinylbenzoic acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786035.1 protein_id gnl|my_center|LOCUS_29230 4148 4831 gene locus_tag LOCUS_29240 4148 4831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 5577 4828 gene locus_tag LOCUS_29250 5577 4828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 5704 6948 gene locus_tag LOCUS_29260 5704 6948 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405216.1 protein_id gnl|my_center|LOCUS_29260 7024 7707 gene locus_tag LOCUS_29270 7024 7707 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962705.1 protein_id gnl|my_center|LOCUS_29270 7710 8108 gene locus_tag LOCUS_29280 7710 8108 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962706.1 protein_id gnl|my_center|LOCUS_29280 8912 8166 gene locus_tag LOCUS_29290 gene algR 8912 8166 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403194.1 protein_id gnl|my_center|LOCUS_29290 9973 8909 gene locus_tag LOCUS_29300 9973 8909 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403193.1 protein_id gnl|my_center|LOCUS_29300 10712 10080 gene locus_tag LOCUS_29310 gene gpm 10712 10080 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404101.1 protein_id gnl|my_center|LOCUS_29310 11005 11727 gene locus_tag LOCUS_29320 11005 11727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 11866 12516 gene locus_tag LOCUS_29330 11866 12516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962799.1 protein_id gnl|my_center|LOCUS_29330 14606 12597 gene locus_tag LOCUS_29340 gene ftsH 14606 12597 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX85 protein_id gnl|my_center|LOCUS_29340 15078 14677 gene locus_tag LOCUS_29350 gene rsfS 15078 14677 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX84 protein_id gnl|my_center|LOCUS_29350 15169 15930 gene locus_tag LOCUS_29360 gene birA 15169 15930 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361998.1 protein_id gnl|my_center|LOCUS_29360 >Feature sequence105 3108 1567 gene locus_tag LOCUS_29370 3108 1567 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203677.1 protein_id gnl|my_center|LOCUS_29370 6202 3137 gene locus_tag LOCUS_29380 6202 3137 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405543.1 protein_id gnl|my_center|LOCUS_29380 7791 6622 gene locus_tag LOCUS_29390 7791 6622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 7966 8889 gene locus_tag LOCUS_29400 7966 8889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037756.1 protein_id gnl|my_center|LOCUS_29400 8956 9669 gene locus_tag LOCUS_29410 gene pyrH 8956 9669 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS3 protein_id gnl|my_center|LOCUS_29410 9710 10270 gene locus_tag LOCUS_29420 gene frr 9710 10270 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS4 protein_id gnl|my_center|LOCUS_29420 10328 12259 gene locus_tag LOCUS_29430 10328 12259 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962262.1 protein_id gnl|my_center|LOCUS_29430 12726 12256 gene locus_tag LOCUS_29440 12726 12256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 14034 12793 gene locus_tag LOCUS_29450 14034 12793 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964503.1 protein_id gnl|my_center|LOCUS_29450 14744 14154 gene locus_tag LOCUS_29460 14744 14154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 14873 16654 gene locus_tag LOCUS_29470 gene ggt 14873 16654 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963831.1 protein_id gnl|my_center|LOCUS_29470 16708 17106 gene locus_tag LOCUS_29480 16708 17106 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089880.1 protein_id gnl|my_center|LOCUS_29480 >Feature sequence106 1141 977 gene locus_tag LOCUS_29490 1141 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 2296 1514 gene locus_tag LOCUS_29500 2296 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 3169 2327 gene locus_tag LOCUS_29510 3169 2327 CDS product conjugative transposon protein TraN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485412.1 protein_id gnl|my_center|LOCUS_29510 4487 3186 gene locus_tag LOCUS_29520 4487 3186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 5450 4830 gene locus_tag LOCUS_29530 5450 4830 CDS product conjugative transposon protein TraK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107100.1 protein_id gnl|my_center|LOCUS_29530 6668 5478 gene locus_tag LOCUS_29540 6668 5478 CDS product conjugative transposon protein TraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291518.1 protein_id gnl|my_center|LOCUS_29540 7319 6681 gene locus_tag LOCUS_29550 7319 6681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 7960 7325 gene locus_tag LOCUS_29560 7960 7325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 8664 7978 gene locus_tag LOCUS_29570 8664 7978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 11144 8667 gene locus_tag LOCUS_29580 11144 8667 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107104.1 protein_id gnl|my_center|LOCUS_29580 11481 11149 gene locus_tag LOCUS_29590 11481 11149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291514.1 protein_id gnl|my_center|LOCUS_29590 11914 11486 gene locus_tag LOCUS_29600 11914 11486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 12322 11918 gene locus_tag LOCUS_29610 12322 11918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 12832 12383 gene locus_tag LOCUS_29620 12832 12383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 13460 13789 gene locus_tag LOCUS_29630 13460 13789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 14731 14222 gene locus_tag LOCUS_29640 14731 14222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 15724 15263 gene locus_tag LOCUS_29650 15724 15263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 16259 15870 gene locus_tag LOCUS_29660 16259 15870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 16869 16414 gene locus_tag LOCUS_29670 16869 16414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 >Feature sequence107 1510 923 gene locus_tag LOCUS_29680 1510 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108764.1 protein_id gnl|my_center|LOCUS_29680 1579 4218 gene locus_tag LOCUS_29690 1579 4218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 5168 4215 gene locus_tag LOCUS_29700 5168 4215 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E005 protein_id gnl|my_center|LOCUS_29700 5628 5161 gene locus_tag LOCUS_29710 5628 5161 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140300.1 protein_id gnl|my_center|LOCUS_29710 6374 5625 gene locus_tag LOCUS_29720 gene truA 6374 5625 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH6 protein_id gnl|my_center|LOCUS_29720 6450 7652 gene locus_tag LOCUS_29730 6450 7652 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097691.1 protein_id gnl|my_center|LOCUS_29730 7682 9118 gene locus_tag LOCUS_29740 gene arsA 7682 9118 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122622.1 protein_id gnl|my_center|LOCUS_29740 9233 10636 gene locus_tag LOCUS_29750 gene fumC 9233 10636 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H000 protein_id gnl|my_center|LOCUS_29750 10668 10970 gene locus_tag LOCUS_29760 10668 10970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 11023 12042 gene locus_tag LOCUS_29770 11023 12042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 12894 12091 gene locus_tag LOCUS_29780 12894 12091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_29780 12992 13498 gene locus_tag LOCUS_29790 12992 13498 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222931.1 protein_id gnl|my_center|LOCUS_29790 15110 13488 gene locus_tag LOCUS_29800 15110 13488 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764149.1 protein_id gnl|my_center|LOCUS_29800 15627 15178 gene locus_tag LOCUS_29810 15627 15178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 16790 15684 gene locus_tag LOCUS_29820 gene mnmA 16790 15684 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZN9 protein_id gnl|my_center|LOCUS_29820 >Feature sequence108 559 3099 gene locus_tag LOCUS_29830 gene gyrA 559 3099 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXM8 protein_id gnl|my_center|LOCUS_29830 3205 4290 gene locus_tag LOCUS_29840 3205 4290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 4612 4391 gene locus_tag LOCUS_29850 4612 4391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 5070 4657 gene locus_tag LOCUS_29860 5070 4657 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793753.1 protein_id gnl|my_center|LOCUS_29860 6315 5497 gene locus_tag LOCUS_29870 gene dapD 6315 5497 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_29870 6737 7741 gene locus_tag LOCUS_29880 6737 7741 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RFN9 protein_id gnl|my_center|LOCUS_29880 8451 7795 gene locus_tag LOCUS_29890 8451 7795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 9728 8448 gene locus_tag LOCUS_29900 gene folC 9728 8448 CDS product tetrahydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962704.1 protein_id gnl|my_center|LOCUS_29900 10729 9800 gene locus_tag LOCUS_29910 10729 9800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 11870 10710 gene locus_tag LOCUS_29920 11870 10710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 12513 11890 gene locus_tag LOCUS_29930 12513 11890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 13562 12489 gene locus_tag LOCUS_29940 13562 12489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 16493 13566 gene locus_tag LOCUS_29950 16493 13566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962684.1 protein_id gnl|my_center|LOCUS_29950 >Feature sequence109 <1 813 gene locus_tag LOCUS_29960 <1 813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZQ9:chaperone protein HtpG 836 1240 gene locus_tag LOCUS_29970 836 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 1237 1602 gene locus_tag LOCUS_29980 1237 1602 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963359.1 protein_id gnl|my_center|LOCUS_29980 2278 1679 gene locus_tag LOCUS_29990 2278 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964127.1 protein_id gnl|my_center|LOCUS_29990 2424 4088 gene locus_tag LOCUS_30000 gene glnS 2424 4088 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UX42 protein_id gnl|my_center|LOCUS_30000 4140 4595 gene locus_tag LOCUS_30010 4140 4595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 4654 6693 gene locus_tag LOCUS_30020 4654 6693 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689344.1 protein_id gnl|my_center|LOCUS_30020 6742 7458 gene locus_tag LOCUS_30030 6742 7458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767943.1 protein_id gnl|my_center|LOCUS_30030 7468 8319 gene locus_tag LOCUS_30040 7468 8319 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097180.1 protein_id gnl|my_center|LOCUS_30040 8426 9616 gene locus_tag LOCUS_30050 8426 9616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 10002 9622 gene locus_tag LOCUS_30060 10002 9622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 10957 10007 gene locus_tag LOCUS_30070 10957 10007 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963293.1 protein_id gnl|my_center|LOCUS_30070 11135 11872 gene locus_tag LOCUS_30080 gene plsC 11135 11872 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962233.1 protein_id gnl|my_center|LOCUS_30080 11937 13685 gene locus_tag LOCUS_30090 gene aspS 11937 13685 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB6 protein_id gnl|my_center|LOCUS_30090 13994 13695 gene locus_tag LOCUS_30100 13994 13695 CDS product toxin ParE1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409896.1 protein_id gnl|my_center|LOCUS_30100 14247 13981 gene locus_tag LOCUS_30110 14247 13981 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527850.1 protein_id gnl|my_center|LOCUS_30110 <16842 14280 gene locus_tag LOCUS_30120 <16842 14280 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013368537.1:dehydrogenase >Feature sequence110 <1 1157 gene locus_tag LOCUS_30130 <1 1157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404472.1:DUF5103 domain-containing protein 2117 1182 gene locus_tag LOCUS_30140 2117 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 2902 2303 gene locus_tag LOCUS_30150 gene miaE 2902 2303 CDS product tRNA 2-methylthio-N6-isopentenyl adenosine(37) hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_30150 5282 2895 gene locus_tag LOCUS_30160 5282 2895 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_30160 5889 5362 gene locus_tag LOCUS_30170 5889 5362 CDS product non-canonical purine NTP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7E1 protein_id gnl|my_center|LOCUS_30170 6599 5886 gene locus_tag LOCUS_30180 gene ispD 6599 5886 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0U8 protein_id gnl|my_center|LOCUS_30180 7688 6636 gene locus_tag LOCUS_30190 gene queA 7688 6636 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2U1 protein_id gnl|my_center|LOCUS_30190 8627 7845 gene locus_tag LOCUS_30200 8627 7845 CDS product putative isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY42 protein_id gnl|my_center|LOCUS_30200 9352 8627 gene locus_tag LOCUS_30210 gene gldF 9352 8627 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_30210 9872 9357 gene locus_tag LOCUS_30220 9872 9357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 10401 9883 gene locus_tag LOCUS_30230 10401 9883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 11668 10394 gene locus_tag LOCUS_30240 gene pyrC 11668 10394 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0H8 protein_id gnl|my_center|LOCUS_30240 12088 11705 gene locus_tag LOCUS_30250 gene gcvH 12088 11705 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1F8 protein_id gnl|my_center|LOCUS_30250 <16830 12195 gene locus_tag LOCUS_30260 <16830 12195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964220.1:cell surface protein SprA >Feature sequence111 432 1769 gene locus_tag LOCUS_30270 gene mnmE 432 1769 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB2 protein_id gnl|my_center|LOCUS_30270 1866 2516 gene locus_tag LOCUS_30280 1866 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 2663 6364 gene locus_tag LOCUS_30290 gene purL 2663 6364 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXH5 protein_id gnl|my_center|LOCUS_30290 7318 6380 gene locus_tag LOCUS_30300 7318 6380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223913.1 protein_id gnl|my_center|LOCUS_30300 8091 7408 gene locus_tag LOCUS_30310 8091 7408 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963527.1 protein_id gnl|my_center|LOCUS_30310 9353 8097 gene locus_tag LOCUS_30320 9353 8097 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963526.1 protein_id gnl|my_center|LOCUS_30320 10299 9499 gene locus_tag LOCUS_30330 10299 9499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 11474 10704 gene locus_tag LOCUS_30340 11474 10704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 12104 11679 gene locus_tag LOCUS_30350 12104 11679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 12693 12379 gene locus_tag LOCUS_30360 12693 12379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 15496 13133 gene locus_tag LOCUS_30370 15496 13133 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022354.1 protein_id gnl|my_center|LOCUS_30370 16534 15500 gene locus_tag LOCUS_30380 16534 15500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 >Feature sequence112 79 993 gene locus_tag LOCUS_30390 79 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 2074 971 gene locus_tag LOCUS_30400 2074 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 2555 2151 gene locus_tag LOCUS_30410 2555 2151 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_30410 2814 4265 gene locus_tag LOCUS_30420 2814 4265 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920922.1 protein_id gnl|my_center|LOCUS_30420 5124 4258 gene locus_tag LOCUS_30430 gene mtlR 5124 4258 CDS product transcriptional regulator MtlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089438.1 protein_id gnl|my_center|LOCUS_30430 5313 6218 gene locus_tag LOCUS_30440 5313 6218 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389819.1 protein_id gnl|my_center|LOCUS_30440 6218 7282 gene locus_tag LOCUS_30450 6218 7282 CDS product hydroxyproline-2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385697.1 protein_id gnl|my_center|LOCUS_30450 7283 8536 gene locus_tag LOCUS_30460 gene dadA 7283 8536 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120365.1 protein_id gnl|my_center|LOCUS_30460 8918 10378 gene locus_tag LOCUS_30470 8918 10378 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109365.1 protein_id gnl|my_center|LOCUS_30470 10427 11119 gene locus_tag LOCUS_30480 10427 11119 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785882.1 protein_id gnl|my_center|LOCUS_30480 11112 11507 gene locus_tag LOCUS_30490 gene gloA 11112 11507 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027458.1 protein_id gnl|my_center|LOCUS_30490 11693 13459 gene locus_tag LOCUS_30500 11693 13459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 13553 14896 gene locus_tag LOCUS_30510 13553 14896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 15017 16258 gene locus_tag LOCUS_30520 15017 16258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 >Feature sequence113 <1 1704 gene locus_tag LOCUS_30530 <1 1704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259046.1:peptidase M61 1984 1748 gene locus_tag LOCUS_30540 1984 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 1965 2993 gene locus_tag LOCUS_30550 1965 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 3880 2990 gene locus_tag LOCUS_30560 3880 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028563.1 protein_id gnl|my_center|LOCUS_30560 5626 3971 gene locus_tag LOCUS_30570 gene menD 5626 3971 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H070 protein_id gnl|my_center|LOCUS_30570 6546 5683 gene locus_tag LOCUS_30580 6546 5683 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_30580 8752 6635 gene locus_tag LOCUS_30590 gene pnp 8752 6635 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64N73 protein_id gnl|my_center|LOCUS_30590 9192 8917 gene locus_tag LOCUS_30600 gene rpsO 9192 8917 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MT6 protein_id gnl|my_center|LOCUS_30600 10737 9238 gene locus_tag LOCUS_30610 10737 9238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 11196 10810 gene locus_tag LOCUS_30620 11196 10810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 11403 11477 gene locus_tag LOCUS_t00230 11403 11477 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 12519 11509 gene locus_tag LOCUS_30630 gene holA 12519 11509 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_30630 13126 12536 gene locus_tag LOCUS_30640 13126 12536 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_30640 13596 13123 gene locus_tag LOCUS_30650 13596 13123 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879260.1 protein_id gnl|my_center|LOCUS_30650 14858 13596 gene locus_tag LOCUS_30660 14858 13596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 15783 14833 gene locus_tag LOCUS_30670 gene phoH 15783 14833 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963220.1 protein_id gnl|my_center|LOCUS_30670 >Feature sequence114 461 1168 gene locus_tag LOCUS_30680 461 1168 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074612.1 protein_id gnl|my_center|LOCUS_30680 1209 2213 gene locus_tag LOCUS_30690 1209 2213 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255955.1 protein_id gnl|my_center|LOCUS_30690 2217 3314 gene locus_tag LOCUS_30700 2217 3314 CDS product putative glutamate--cysteine ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAH5 protein_id gnl|my_center|LOCUS_30700 3353 4183 gene locus_tag LOCUS_30710 3353 4183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 4187 5383 gene locus_tag LOCUS_30720 4187 5383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 5387 6589 gene locus_tag LOCUS_30730 gene argD 5387 6589 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_30730 6965 6642 gene locus_tag LOCUS_30740 6965 6642 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YG6 protein_id gnl|my_center|LOCUS_30740 7247 8017 gene locus_tag LOCUS_30750 7247 8017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 11659 8069 gene locus_tag LOCUS_30760 gene dnaE 11659 8069 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI1 protein_id gnl|my_center|LOCUS_30760 12404 12748 gene locus_tag LOCUS_30770 gene rplT 12404 12748 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAN9 protein_id gnl|my_center|LOCUS_30770 12899 15709 gene locus_tag LOCUS_30780 12899 15709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 >Feature sequence115 413 988 gene locus_tag LOCUS_30790 413 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 981 3260 gene locus_tag LOCUS_30800 981 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 3250 4008 gene locus_tag LOCUS_30810 3250 4008 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405557.1 protein_id gnl|my_center|LOCUS_30810 4057 4320 gene locus_tag LOCUS_30820 4057 4320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 4305 4601 gene locus_tag LOCUS_30830 4305 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 4704 5654 gene locus_tag LOCUS_30840 4704 5654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 6513 5656 gene locus_tag LOCUS_30850 gene tesB 6513 5656 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167662.1 protein_id gnl|my_center|LOCUS_30850 6573 6827 gene locus_tag LOCUS_30860 6573 6827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 6805 7098 gene locus_tag LOCUS_30870 6805 7098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 7865 7095 gene locus_tag LOCUS_30880 7865 7095 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730375.1 protein_id gnl|my_center|LOCUS_30880 8007 9545 gene locus_tag LOCUS_30890 8007 9545 CDS product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107210.1 protein_id gnl|my_center|LOCUS_30890 9627 10466 gene locus_tag LOCUS_30900 9627 10466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30900 10474 10776 gene locus_tag LOCUS_30910 10474 10776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 10987 12276 gene locus_tag LOCUS_30920 gene metK 10987 12276 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA9 protein_id gnl|my_center|LOCUS_30920 12364 13236 gene locus_tag LOCUS_30930 12364 13236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820330.1 protein_id gnl|my_center|LOCUS_30930 14070 13324 gene locus_tag LOCUS_30940 14070 13324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787827.1 protein_id gnl|my_center|LOCUS_30940 15195 14098 gene locus_tag LOCUS_30950 15195 14098 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TP1 protein_id gnl|my_center|LOCUS_30950 15474 16196 gene locus_tag LOCUS_30960 15474 16196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 >Feature sequence116 2960 981 gene locus_tag LOCUS_30970 2960 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122005.1 protein_id gnl|my_center|LOCUS_30970 4937 3039 gene locus_tag LOCUS_30980 4937 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 6338 5148 gene locus_tag LOCUS_30990 6338 5148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 7494 6331 gene locus_tag LOCUS_31000 7494 6331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 9185 7506 gene locus_tag LOCUS_31010 9185 7506 CDS product starch-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681494.1 protein_id gnl|my_center|LOCUS_31010 12199 9197 gene locus_tag LOCUS_31020 12199 9197 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203130.1 protein_id gnl|my_center|LOCUS_31020 13056 12874 gene locus_tag LOCUS_31030 13056 12874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31030 14100 13528 gene locus_tag LOCUS_31040 14100 13528 CDS product carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226688.1 protein_id gnl|my_center|LOCUS_31040 15353 14103 gene locus_tag LOCUS_31050 15353 14103 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140914.1 protein_id gnl|my_center|LOCUS_31050 >Feature sequence117 683 1027 gene locus_tag LOCUS_31060 683 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529095.1 protein_id gnl|my_center|LOCUS_31060 1071 2294 gene locus_tag LOCUS_31070 1071 2294 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121878.1 protein_id gnl|my_center|LOCUS_31070 2905 2291 gene locus_tag LOCUS_31080 2905 2291 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H133 protein_id gnl|my_center|LOCUS_31080 3002 4363 gene locus_tag LOCUS_31090 3002 4363 CDS product glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919625.1 protein_id gnl|my_center|LOCUS_31090 7296 4801 gene locus_tag LOCUS_31100 7296 4801 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086596.1 protein_id gnl|my_center|LOCUS_31100 7690 7388 gene locus_tag LOCUS_31110 7690 7388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 8345 7896 gene locus_tag LOCUS_31120 8345 7896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 9101 8430 gene locus_tag LOCUS_31130 9101 8430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 9576 9085 gene locus_tag LOCUS_31140 9576 9085 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788990.1 protein_id gnl|my_center|LOCUS_31140 9850 13542 gene locus_tag LOCUS_31150 gene yobI 9850 13542 CDS product putative membrane protein YobI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34784 protein_id gnl|my_center|LOCUS_31150 14151 13693 gene locus_tag LOCUS_31160 14151 13693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 15217 14189 gene locus_tag LOCUS_31170 15217 14189 CDS product glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708307.1 protein_id gnl|my_center|LOCUS_31170 >Feature sequence118 2551 2069 gene locus_tag LOCUS_31180 2551 2069 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_31180 3040 2594 gene locus_tag LOCUS_31190 3040 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 3228 4199 gene locus_tag LOCUS_31200 3228 4199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 4202 5299 gene locus_tag LOCUS_31210 4202 5299 CDS product xanthine and CO dehydrogenase family maturation factor XdhC/CoxF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072950.1 protein_id gnl|my_center|LOCUS_31210 5371 6567 gene locus_tag LOCUS_31220 gene moeA 5371 6567 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057204.1 protein_id gnl|my_center|LOCUS_31220 7109 6564 gene locus_tag LOCUS_31230 7109 6564 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S591 protein_id gnl|my_center|LOCUS_31230 7254 8177 gene locus_tag LOCUS_31240 7254 8177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 9177 8179 gene locus_tag LOCUS_31250 gene recF 9177 8179 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H141 protein_id gnl|my_center|LOCUS_31250 9643 10662 gene locus_tag LOCUS_31260 gene pdhA 9643 10662 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE5 protein_id gnl|my_center|LOCUS_31260 10823 11518 gene locus_tag LOCUS_31270 10823 11518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 11588 12070 gene locus_tag LOCUS_31280 gene ribH 11588 12070 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XS0 protein_id gnl|my_center|LOCUS_31280 12141 12494 gene locus_tag LOCUS_31290 12141 12494 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964356.1 protein_id gnl|my_center|LOCUS_31290 12557 13894 gene locus_tag LOCUS_31300 12557 13894 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z9 protein_id gnl|my_center|LOCUS_31300 13921 14361 gene locus_tag LOCUS_31310 13921 14361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 14361 15629 gene locus_tag LOCUS_31320 gene serS 14361 15629 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962253.1 protein_id gnl|my_center|LOCUS_31320 15699 15878 gene locus_tag LOCUS_31330 15699 15878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 >Feature sequence119 <1 999 gene locus_tag LOCUS_31340 <1 999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005793798.1:sigma-54-dependent Fis family transcriptional regulator 1160 2485 gene locus_tag LOCUS_31350 1160 2485 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202701.1 protein_id gnl|my_center|LOCUS_31350 3373 2534 gene locus_tag LOCUS_31360 3373 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 3915 3490 gene locus_tag LOCUS_31370 3915 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 4968 4048 gene locus_tag LOCUS_31380 4968 4048 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_31380 5198 6412 gene locus_tag LOCUS_31390 5198 6412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001178915.1 protein_id gnl|my_center|LOCUS_31390 6418 7101 gene locus_tag LOCUS_31400 6418 7101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506001.1 protein_id gnl|my_center|LOCUS_31400 7094 8542 gene locus_tag LOCUS_31410 7094 8542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 9734 8700 gene locus_tag LOCUS_31420 9734 8700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 9937 11658 gene locus_tag LOCUS_31430 9937 11658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 12056 14332 gene locus_tag LOCUS_31440 12056 14332 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963986.1 protein_id gnl|my_center|LOCUS_31440 >Feature sequence120 564 1910 gene locus_tag LOCUS_31450 564 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 2049 3188 gene locus_tag LOCUS_31460 2049 3188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085074.1 protein_id gnl|my_center|LOCUS_31460 3175 6555 gene locus_tag LOCUS_31470 3175 6555 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022007.1 protein_id gnl|my_center|LOCUS_31470 6767 8017 gene locus_tag LOCUS_31480 6767 8017 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202492.1 protein_id gnl|my_center|LOCUS_31480 8435 8070 gene locus_tag LOCUS_31490 8435 8070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340660.1 protein_id gnl|my_center|LOCUS_31490 8521 9198 gene locus_tag LOCUS_31500 8521 9198 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787762.1 protein_id gnl|my_center|LOCUS_31500 9634 9266 gene locus_tag LOCUS_31510 9634 9266 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389994.1 protein_id gnl|my_center|LOCUS_31510 10155 9637 gene locus_tag LOCUS_31520 10155 9637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 10734 10255 gene locus_tag LOCUS_31530 10734 10255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 11471 10842 gene locus_tag LOCUS_31540 11471 10842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 12142 11594 gene locus_tag LOCUS_31550 12142 11594 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970075.1 protein_id gnl|my_center|LOCUS_31550 12676 12146 gene locus_tag LOCUS_31560 gene vanZ 12676 12146 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889012.1 protein_id gnl|my_center|LOCUS_31560 13368 12739 gene locus_tag LOCUS_31570 13368 12739 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510731.1 protein_id gnl|my_center|LOCUS_31570 13623 14537 gene locus_tag LOCUS_31580 13623 14537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 >Feature sequence121 157 1710 gene locus_tag LOCUS_31590 157 1710 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964301.1 protein_id gnl|my_center|LOCUS_31590 1792 2295 gene locus_tag LOCUS_31600 1792 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 2413 3294 gene locus_tag LOCUS_31610 gene folD 2413 3294 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RB7 protein_id gnl|my_center|LOCUS_31610 4676 3303 gene locus_tag LOCUS_31620 4676 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 5113 4673 gene locus_tag LOCUS_31630 5113 4673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 5272 5484 gene locus_tag LOCUS_31640 5272 5484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 7004 5541 gene locus_tag LOCUS_31650 gene gltB2 7004 5541 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181592.1 protein_id gnl|my_center|LOCUS_31650 8353 7106 gene locus_tag LOCUS_31660 gene aroA 8353 7106 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YD8 protein_id gnl|my_center|LOCUS_31660 8924 8412 gene locus_tag LOCUS_31670 8924 8412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 9597 8986 gene locus_tag LOCUS_31680 9597 8986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 11170 9605 gene locus_tag LOCUS_31690 11170 9605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 11341 12414 gene locus_tag LOCUS_31700 11341 12414 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_31700 12578 13363 gene locus_tag LOCUS_31710 12578 13363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 13803 13369 gene locus_tag LOCUS_31720 13803 13369 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123483.1 protein_id gnl|my_center|LOCUS_31720 13956 14825 gene locus_tag LOCUS_31730 13956 14825 CDS product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933176.1 protein_id gnl|my_center|LOCUS_31730 <15645 14904 gene locus_tag LOCUS_31740 <15645 14904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964482.1:Fe-S cluster assembly protein SufB >Feature sequence122 2 871 gene locus_tag LOCUS_31750 2 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 1628 984 gene locus_tag LOCUS_31760 1628 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 2026 1766 gene locus_tag LOCUS_31770 2026 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 2162 3052 gene locus_tag LOCUS_31780 2162 3052 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933484.1 protein_id gnl|my_center|LOCUS_31780 3123 4202 gene locus_tag LOCUS_31790 3123 4202 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963537.1 protein_id gnl|my_center|LOCUS_31790 4339 5184 gene locus_tag LOCUS_31800 4339 5184 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121449.1 protein_id gnl|my_center|LOCUS_31800 6119 5472 gene locus_tag LOCUS_31810 6119 5472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 6534 9011 gene locus_tag LOCUS_31820 gene mrcA 6534 9011 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_31820 9417 9905 gene locus_tag LOCUS_31830 9417 9905 CDS product isoquinoline 1-oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529191.1 protein_id gnl|my_center|LOCUS_31830 9928 12087 gene locus_tag LOCUS_31840 9928 12087 CDS product aldehyde oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940876.1 protein_id gnl|my_center|LOCUS_31840 12203 13255 gene locus_tag LOCUS_31850 12203 13255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 13289 13705 gene locus_tag LOCUS_31860 13289 13705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 13695 13982 gene locus_tag LOCUS_31870 13695 13982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 14103 15314 gene locus_tag LOCUS_31880 14103 15314 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785790.1 protein_id gnl|my_center|LOCUS_31880 >Feature sequence123 2244 2975 gene locus_tag LOCUS_31890 2244 2975 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_31890 3322 6264 gene locus_tag LOCUS_31900 3322 6264 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202162.1 protein_id gnl|my_center|LOCUS_31900 6277 7725 gene locus_tag LOCUS_31910 6277 7725 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_31910 7783 9705 gene locus_tag LOCUS_31920 7783 9705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 9722 12532 gene locus_tag LOCUS_31930 9722 12532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 12716 13954 gene locus_tag LOCUS_31940 12716 13954 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087688.1 protein_id gnl|my_center|LOCUS_31940 13941 15323 gene locus_tag LOCUS_31950 13941 15323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 >Feature sequence124 7861 9219 gene locus_tag LOCUS_31960 7861 9219 CDS product xylitol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226269.1 protein_id gnl|my_center|LOCUS_31960 9919 9332 gene locus_tag LOCUS_31970 gene ahpD 9919 9332 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BM5 protein_id gnl|my_center|LOCUS_31970 10524 9982 gene locus_tag LOCUS_31980 10524 9982 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948056.1 protein_id gnl|my_center|LOCUS_31980 10790 11623 gene locus_tag LOCUS_31990 10790 11623 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816458.1 protein_id gnl|my_center|LOCUS_31990 12322 11720 gene locus_tag LOCUS_32000 12322 11720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 13690 12374 gene locus_tag LOCUS_32010 13690 12374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 14296 13727 gene locus_tag LOCUS_32020 14296 13727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 15142 14864 gene locus_tag LOCUS_32030 15142 14864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 >Feature sequence125 425 1459 gene locus_tag LOCUS_32040 425 1459 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266146.1 protein_id gnl|my_center|LOCUS_32040 1456 2238 gene locus_tag LOCUS_32050 1456 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_32050 2597 4759 gene locus_tag LOCUS_32060 2597 4759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 4810 5205 gene locus_tag LOCUS_32070 4810 5205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 5597 5253 gene locus_tag LOCUS_32080 5597 5253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 5979 8657 gene locus_tag LOCUS_32090 5979 8657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 8658 9128 gene locus_tag LOCUS_32100 8658 9128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 9547 9125 gene locus_tag LOCUS_32110 9547 9125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120045.1 protein_id gnl|my_center|LOCUS_32110 9748 9590 gene locus_tag LOCUS_32120 9748 9590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 11118 9886 gene locus_tag LOCUS_32130 11118 9886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 11286 12809 gene locus_tag LOCUS_32140 11286 12809 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963061.1 protein_id gnl|my_center|LOCUS_32140 12910 14082 gene locus_tag LOCUS_32150 12910 14082 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224039.1 protein_id gnl|my_center|LOCUS_32150 14538 14119 gene locus_tag LOCUS_32160 gene osmC 14538 14119 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089002.1 protein_id gnl|my_center|LOCUS_32160 <15180 14647 gene locus_tag LOCUS_32170 <15180 14647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8UEA1:glutaminase >Feature sequence126 546 1337 gene locus_tag LOCUS_32180 546 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 1613 2431 gene locus_tag LOCUS_32190 1613 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 2523 2897 gene locus_tag LOCUS_32200 2523 2897 CDS product glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968054.1 protein_id gnl|my_center|LOCUS_32200 2960 3379 gene locus_tag LOCUS_32210 2960 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 6390 3376 gene locus_tag LOCUS_32220 6390 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 6885 7988 gene locus_tag LOCUS_32230 6885 7988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 8044 8403 gene locus_tag LOCUS_32240 8044 8403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 8397 8774 gene locus_tag LOCUS_32250 8397 8774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 8827 9198 gene locus_tag LOCUS_32260 8827 9198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 10404 9199 gene locus_tag LOCUS_32270 10404 9199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201963.1 protein_id gnl|my_center|LOCUS_32270 11573 10416 gene locus_tag LOCUS_32280 11573 10416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295249.1 protein_id gnl|my_center|LOCUS_32280 11828 12826 gene locus_tag LOCUS_32290 11828 12826 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123934.1 protein_id gnl|my_center|LOCUS_32290 12891 13793 gene locus_tag LOCUS_32300 12891 13793 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109048.1 protein_id gnl|my_center|LOCUS_32300 13855 14265 gene locus_tag LOCUS_32310 13855 14265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029381.1 protein_id gnl|my_center|LOCUS_32310 >Feature sequence127 2812 26 gene locus_tag LOCUS_32320 2812 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202277.1 protein_id gnl|my_center|LOCUS_32320 2847 3734 gene locus_tag LOCUS_32330 2847 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 3814 5112 gene locus_tag LOCUS_32340 gene amaA 3814 5112 CDS product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 protein_id gnl|my_center|LOCUS_32340 5112 5741 gene locus_tag LOCUS_32350 5112 5741 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_32350 6646 5738 gene locus_tag LOCUS_32360 6646 5738 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790934.1 protein_id gnl|my_center|LOCUS_32360 7245 6652 gene locus_tag LOCUS_32370 7245 6652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 7347 8360 gene locus_tag LOCUS_32380 7347 8360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 8457 9095 gene locus_tag LOCUS_32390 8457 9095 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963076.1 protein_id gnl|my_center|LOCUS_32390 9228 10640 gene locus_tag LOCUS_32400 9228 10640 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_32400 11163 10780 gene locus_tag LOCUS_32410 11163 10780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 11301 11867 gene locus_tag LOCUS_32420 11301 11867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889422.1 protein_id gnl|my_center|LOCUS_32420 11870 12382 gene locus_tag LOCUS_32430 11870 12382 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963793.1 protein_id gnl|my_center|LOCUS_32430 13005 13982 gene locus_tag LOCUS_32440 13005 13982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 13979 14401 gene locus_tag LOCUS_32450 gene ybeY 13979 14401 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVJ9 protein_id gnl|my_center|LOCUS_32450 >Feature sequence128 2284 1094 gene locus_tag LOCUS_32460 gene pobA 2284 1094 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556451.1 protein_id gnl|my_center|LOCUS_32460 3475 2351 gene locus_tag LOCUS_32470 3475 2351 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920269.1 protein_id gnl|my_center|LOCUS_32470 4804 3488 gene locus_tag LOCUS_32480 gene pcaB 4804 3488 CDS product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205324.1 protein_id gnl|my_center|LOCUS_32480 5334 4810 gene locus_tag LOCUS_32490 gene pcaG 5334 4810 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184553.1 protein_id gnl|my_center|LOCUS_32490 5766 5392 gene locus_tag LOCUS_32500 5766 5392 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962274.1 protein_id gnl|my_center|LOCUS_32500 6574 5867 gene locus_tag LOCUS_32510 gene pcaH 6574 5867 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524239.1 protein_id gnl|my_center|LOCUS_32510 6739 7611 gene locus_tag LOCUS_32520 6739 7611 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086449.1 protein_id gnl|my_center|LOCUS_32520 7707 9260 gene locus_tag LOCUS_32530 7707 9260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 9486 10268 gene locus_tag LOCUS_32540 9486 10268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 10521 12758 gene locus_tag LOCUS_32550 10521 12758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 13183 13779 gene locus_tag LOCUS_32560 13183 13779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 >Feature sequence129 365 126 gene locus_tag LOCUS_32570 gene rpmB 365 126 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MGM8 protein_id gnl|my_center|LOCUS_32570 1119 604 gene locus_tag LOCUS_32580 1119 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 1410 3542 gene locus_tag LOCUS_32590 1410 3542 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769027.1 protein_id gnl|my_center|LOCUS_32590 3609 4745 gene locus_tag LOCUS_32600 3609 4745 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968362.1 protein_id gnl|my_center|LOCUS_32600 4938 6563 gene locus_tag LOCUS_32610 4938 6563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 7515 6640 gene locus_tag LOCUS_32620 7515 6640 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442783.1 protein_id gnl|my_center|LOCUS_32620 7850 7641 gene locus_tag LOCUS_32630 7850 7641 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257467.1 protein_id gnl|my_center|LOCUS_32630 8833 7949 gene locus_tag LOCUS_32640 8833 7949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 9010 10080 gene locus_tag LOCUS_32650 9010 10080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 10137 11240 gene locus_tag LOCUS_32660 gene ychF 10137 11240 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MH1 protein_id gnl|my_center|LOCUS_32660 11233 11736 gene locus_tag LOCUS_32670 11233 11736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 11789 12190 gene locus_tag LOCUS_32680 11789 12190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 13440 12187 gene locus_tag LOCUS_32690 13440 12187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 13565 14611 gene locus_tag LOCUS_32700 13565 14611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 >Feature sequence130 191 925 gene locus_tag LOCUS_32710 191 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 1113 1790 gene locus_tag LOCUS_32720 1113 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 3403 1985 gene locus_tag LOCUS_32730 3403 1985 CDS product iron transporter FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392918.1 protein_id gnl|my_center|LOCUS_32730 4320 3550 gene locus_tag LOCUS_32740 4320 3550 CDS product iron transporter FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392919.1 protein_id gnl|my_center|LOCUS_32740 5350 4322 gene locus_tag LOCUS_32750 5350 4322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 7274 5661 gene locus_tag LOCUS_32760 7274 5661 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920680.1 protein_id gnl|my_center|LOCUS_32760 7571 8059 gene locus_tag LOCUS_32770 7571 8059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 8937 8050 gene locus_tag LOCUS_32780 8937 8050 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764311.1 protein_id gnl|my_center|LOCUS_32780 9920 8967 gene locus_tag LOCUS_32790 9920 8967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 10585 10001 gene locus_tag LOCUS_32800 10585 10001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 10760 11713 gene locus_tag LOCUS_32810 10760 11713 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776891.1 protein_id gnl|my_center|LOCUS_32810 12672 11707 gene locus_tag LOCUS_32820 12672 11707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 13139 12750 gene locus_tag LOCUS_32830 13139 12750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 <14600 13302 gene locus_tag LOCUS_32840 <14600 13302 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64X01:chaperone protein DnaK >Feature sequence131 643 1608 gene locus_tag LOCUS_32850 643 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 1627 2022 gene locus_tag LOCUS_32860 1627 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 5141 2097 gene locus_tag LOCUS_32870 5141 2097 CDS product beta-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_32870 5939 5211 gene locus_tag LOCUS_32880 5939 5211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 6209 6532 gene locus_tag LOCUS_32890 6209 6532 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760318.1 protein_id gnl|my_center|LOCUS_32890 6832 6542 gene locus_tag LOCUS_32900 6832 6542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 7730 6822 gene locus_tag LOCUS_32910 7730 6822 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789714.1 protein_id gnl|my_center|LOCUS_32910 7874 8119 gene locus_tag LOCUS_32920 7874 8119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 8954 8112 gene locus_tag LOCUS_32930 8954 8112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203200.1 protein_id gnl|my_center|LOCUS_32930 9568 8951 gene locus_tag LOCUS_32940 9568 8951 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117778.1 protein_id gnl|my_center|LOCUS_32940 9592 10239 gene locus_tag LOCUS_32950 9592 10239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963857.1 protein_id gnl|my_center|LOCUS_32950 10264 10950 gene locus_tag LOCUS_32960 10264 10950 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888194.1 protein_id gnl|my_center|LOCUS_32960 11116 11916 gene locus_tag LOCUS_32970 11116 11916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 11913 13277 gene locus_tag LOCUS_32980 11913 13277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 <14558 13333 gene locus_tag LOCUS_32990 <14558 13333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962693.1:protein translocase subunit SecDF >Feature sequence132 503 2320 gene locus_tag LOCUS_33000 503 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 2475 4145 gene locus_tag LOCUS_33010 2475 4145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 4224 5177 gene locus_tag LOCUS_33020 4224 5177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 5700 5179 gene locus_tag LOCUS_33030 5700 5179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 5773 6486 gene locus_tag LOCUS_33040 5773 6486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 6568 7293 gene locus_tag LOCUS_33050 6568 7293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 8899 7295 gene locus_tag LOCUS_33060 8899 7295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 8945 10450 gene locus_tag LOCUS_33070 8945 10450 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123682.1 protein_id gnl|my_center|LOCUS_33070 10499 13726 gene locus_tag LOCUS_33080 10499 13726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 >Feature sequence133 <1 1157 gene locus_tag LOCUS_33090 <1 1157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120646.1:oxidase 2420 1143 gene locus_tag LOCUS_33100 2420 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120645.1 protein_id gnl|my_center|LOCUS_33100 2621 3523 gene locus_tag LOCUS_33110 2621 3523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 3617 5173 gene locus_tag LOCUS_33120 3617 5173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783832.1 protein_id gnl|my_center|LOCUS_33120 5372 7756 gene locus_tag LOCUS_33130 5372 7756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 8349 7753 gene locus_tag LOCUS_33140 8349 7753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 8806 8429 gene locus_tag LOCUS_33150 8806 8429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 10553 8961 gene locus_tag LOCUS_33160 10553 8961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789122.1 protein_id gnl|my_center|LOCUS_33160 13787 10581 gene locus_tag LOCUS_33170 13787 10581 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203176.1 protein_id gnl|my_center|LOCUS_33170 >Feature sequence134 1151 261 gene locus_tag LOCUS_33180 1151 261 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119308.1 protein_id gnl|my_center|LOCUS_33180 1455 2996 gene locus_tag LOCUS_33190 gene fucI 1455 2996 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122003.1 protein_id gnl|my_center|LOCUS_33190 2993 4633 gene locus_tag LOCUS_33200 gene araB 2993 4633 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N7T7 protein_id gnl|my_center|LOCUS_33200 4838 5770 gene locus_tag LOCUS_33210 gene dapA 4838 5770 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974650.1 protein_id gnl|my_center|LOCUS_33210 5794 7176 gene locus_tag LOCUS_33220 5794 7176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_33220 7587 8756 gene locus_tag LOCUS_33230 7587 8756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 10254 9211 gene locus_tag LOCUS_33240 10254 9211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 11219 10770 gene locus_tag LOCUS_33250 11219 10770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33250 11628 11182 gene locus_tag LOCUS_33260 11628 11182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33260 14205 12217 gene locus_tag LOCUS_33270 14205 12217 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108393.1 protein_id gnl|my_center|LOCUS_33270 >Feature sequence135 1592 264 gene locus_tag LOCUS_33280 1592 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 2680 1598 gene locus_tag LOCUS_33290 2680 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 2759 3523 gene locus_tag LOCUS_33300 2759 3523 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964187.1 protein_id gnl|my_center|LOCUS_33300 3520 3942 gene locus_tag LOCUS_33310 3520 3942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477375.1 protein_id gnl|my_center|LOCUS_33310 5050 4112 gene locus_tag LOCUS_33320 gene mdh 5050 4112 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0W0 protein_id gnl|my_center|LOCUS_33320 5203 5640 gene locus_tag LOCUS_33330 5203 5640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 5711 5911 gene locus_tag LOCUS_33340 gene tatA 5711 5911 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KC14 protein_id gnl|my_center|LOCUS_33340 6138 7952 gene locus_tag LOCUS_33350 gene mltD 6138 7952 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962200.1 protein_id gnl|my_center|LOCUS_33350 8579 8148 gene locus_tag LOCUS_33360 8579 8148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 9144 8626 gene locus_tag LOCUS_33370 9144 8626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 11831 9141 gene locus_tag LOCUS_33380 11831 9141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 12652 11852 gene locus_tag LOCUS_33390 12652 11852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 13289 12729 gene locus_tag LOCUS_33400 13289 12729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 >Feature sequence136 607 1800 gene locus_tag LOCUS_33410 607 1800 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005677642.1 protein_id gnl|my_center|LOCUS_33410 3285 2062 gene locus_tag LOCUS_33420 gene yjhB 3285 2062 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021355.1 protein_id gnl|my_center|LOCUS_33420 4444 3293 gene locus_tag LOCUS_33430 4444 3293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118378.1 protein_id gnl|my_center|LOCUS_33430 6044 4617 gene locus_tag LOCUS_33440 6044 4617 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 protein_id gnl|my_center|LOCUS_33440 9344 6057 gene locus_tag LOCUS_33450 9344 6057 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202162.1 protein_id gnl|my_center|LOCUS_33450 10586 9492 gene locus_tag LOCUS_33460 10586 9492 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768135.1 protein_id gnl|my_center|LOCUS_33460 11255 10608 gene locus_tag LOCUS_33470 11255 10608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 11847 12137 gene locus_tag LOCUS_33480 11847 12137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 >Feature sequence137 806 315 gene locus_tag LOCUS_33490 806 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 1189 992 gene locus_tag LOCUS_33500 1189 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 1646 1173 gene locus_tag LOCUS_33510 1646 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 2628 2182 gene locus_tag LOCUS_33520 2628 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 3453 3142 gene locus_tag LOCUS_33530 3453 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 4429 4259 gene locus_tag LOCUS_33540 4429 4259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 4904 4662 gene locus_tag LOCUS_33550 4904 4662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 6293 5460 gene locus_tag LOCUS_33560 6293 5460 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764311.1 protein_id gnl|my_center|LOCUS_33560 6787 6428 gene locus_tag LOCUS_33570 6787 6428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 6888 7763 gene locus_tag LOCUS_33580 6888 7763 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963067.1 protein_id gnl|my_center|LOCUS_33580 9505 7892 gene locus_tag LOCUS_33590 9505 7892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 9671 10531 gene locus_tag LOCUS_33600 9671 10531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 11039 10533 gene locus_tag LOCUS_33610 11039 10533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 11326 11703 gene locus_tag LOCUS_33620 11326 11703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 11794 12183 gene locus_tag LOCUS_33630 11794 12183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 13174 12218 gene locus_tag LOCUS_33640 13174 12218 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978446.1 protein_id gnl|my_center|LOCUS_33640 13329 13766 gene locus_tag LOCUS_33650 13329 13766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 >Feature sequence138 2272 2742 gene locus_tag LOCUS_33660 2272 2742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245307.1 protein_id gnl|my_center|LOCUS_33660 2828 5170 gene locus_tag LOCUS_33670 2828 5170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 5262 6527 gene locus_tag LOCUS_33680 5262 6527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 6925 8073 gene locus_tag LOCUS_33690 6925 8073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 8297 9250 gene locus_tag LOCUS_33700 8297 9250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 9516 9923 gene locus_tag LOCUS_33710 9516 9923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 10186 12987 gene locus_tag LOCUS_33720 10186 12987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 14062 13136 gene locus_tag LOCUS_33730 14062 13136 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088459.1 protein_id gnl|my_center|LOCUS_33730 >Feature sequence139 2870 1212 gene locus_tag LOCUS_33740 2870 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 3008 3874 gene locus_tag LOCUS_33750 3008 3874 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_33750 4980 3970 gene locus_tag LOCUS_33760 4980 3970 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986537.1 protein_id gnl|my_center|LOCUS_33760 6384 5143 gene locus_tag LOCUS_33770 gene lysA-2 6384 5143 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q728N7 protein_id gnl|my_center|LOCUS_33770 6467 7804 gene locus_tag LOCUS_33780 6467 7804 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671775.1 protein_id gnl|my_center|LOCUS_33780 7845 8354 gene locus_tag LOCUS_33790 gene msrB 7845 8354 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJK9 protein_id gnl|my_center|LOCUS_33790 8486 9556 gene locus_tag LOCUS_33800 8486 9556 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_33800 12018 9631 gene locus_tag LOCUS_33810 12018 9631 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_33810 13102 12011 gene locus_tag LOCUS_33820 13102 12011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 >Feature sequence140 2405 2151 gene locus_tag LOCUS_33830 2405 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 2477 3358 gene locus_tag LOCUS_33840 2477 3358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 3854 3564 gene locus_tag LOCUS_33850 3854 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 4053 4439 gene locus_tag LOCUS_33860 4053 4439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 4927 6888 gene locus_tag LOCUS_33870 4927 6888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 6881 7549 gene locus_tag LOCUS_33880 6881 7549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203322.1 protein_id gnl|my_center|LOCUS_33880 8093 7674 gene locus_tag LOCUS_33890 8093 7674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143823.1 protein_id gnl|my_center|LOCUS_33890 8460 8095 gene locus_tag LOCUS_33900 8460 8095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 10070 8658 gene locus_tag LOCUS_33910 10070 8658 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_33910 10970 10176 gene locus_tag LOCUS_33920 10970 10176 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K9 protein_id gnl|my_center|LOCUS_33920 11722 11249 gene locus_tag LOCUS_33930 11722 11249 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963793.1 protein_id gnl|my_center|LOCUS_33930 12298 11726 gene locus_tag LOCUS_33940 12298 11726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889422.1 protein_id gnl|my_center|LOCUS_33940 13656 12313 gene locus_tag LOCUS_33950 13656 12313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 >Feature sequence141 2430 688 gene locus_tag LOCUS_33960 2430 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 3693 2647 gene locus_tag LOCUS_33970 gene selD 3693 2647 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKE7 protein_id gnl|my_center|LOCUS_33970 4742 3699 gene locus_tag LOCUS_33980 4742 3699 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124924.1 protein_id gnl|my_center|LOCUS_33980 5512 4844 gene locus_tag LOCUS_33990 5512 4844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224502.1 protein_id gnl|my_center|LOCUS_33990 5929 5720 gene locus_tag LOCUS_34000 5929 5720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 6076 6264 gene locus_tag LOCUS_34010 6076 6264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 6266 6472 gene locus_tag LOCUS_34020 6266 6472 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791339.1 protein_id gnl|my_center|LOCUS_34020 6478 7578 gene locus_tag LOCUS_34030 6478 7578 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262601.1 protein_id gnl|my_center|LOCUS_34030 8335 7580 gene locus_tag LOCUS_34040 8335 7580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 9325 8339 gene locus_tag LOCUS_34050 gene hemB 9325 8339 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLQ6 protein_id gnl|my_center|LOCUS_34050 9430 10206 gene locus_tag LOCUS_34060 9430 10206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 10802 10203 gene locus_tag LOCUS_34070 gene tpm 10802 10203 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963562.1 protein_id gnl|my_center|LOCUS_34070 10945 11709 gene locus_tag LOCUS_34080 10945 11709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 13208 11715 gene locus_tag LOCUS_34090 13208 11715 CDS product C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001253926.1 protein_id gnl|my_center|LOCUS_34090 13756 13319 gene locus_tag LOCUS_34100 13756 13319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34100 >Feature sequence142 360 1646 gene locus_tag LOCUS_34110 360 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 1619 2434 gene locus_tag LOCUS_34120 1619 2434 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788741.1 protein_id gnl|my_center|LOCUS_34120 4107 2431 gene locus_tag LOCUS_34130 4107 2431 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263346.1 protein_id gnl|my_center|LOCUS_34130 4240 5445 gene locus_tag LOCUS_34140 4240 5445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 6392 5442 gene locus_tag LOCUS_34150 gene aao 6392 5442 CDS product amino acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409545.1 protein_id gnl|my_center|LOCUS_34150 7751 6393 gene locus_tag LOCUS_34160 7751 6393 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202535.1 protein_id gnl|my_center|LOCUS_34160 8772 7756 gene locus_tag LOCUS_34170 gene aspG 8772 7756 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638262.2 protein_id gnl|my_center|LOCUS_34170 9463 8930 gene locus_tag LOCUS_34180 9463 8930 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107717.1 protein_id gnl|my_center|LOCUS_34180 9573 10397 gene locus_tag LOCUS_34190 gene pyrF 9573 10397 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A012 protein_id gnl|my_center|LOCUS_34190 10394 11665 gene locus_tag LOCUS_34200 10394 11665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963326.1 protein_id gnl|my_center|LOCUS_34200 13185 11725 gene locus_tag LOCUS_34210 13185 11725 CDS product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797884.1 protein_id gnl|my_center|LOCUS_34210 <13919 13222 gene locus_tag LOCUS_34220 <13919 13222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962336.1:ATP-dependent helicase >Feature sequence143 614 42 gene locus_tag LOCUS_34230 gene ruvC 614 42 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW52 protein_id gnl|my_center|LOCUS_34230 805 1803 gene locus_tag LOCUS_34240 805 1803 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_34240 1803 2423 gene locus_tag LOCUS_34250 1803 2423 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_34250 3491 2424 gene locus_tag LOCUS_34260 3491 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 3734 5797 gene locus_tag LOCUS_34270 3734 5797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 5832 7568 gene locus_tag LOCUS_34280 5832 7568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 7569 9140 gene locus_tag LOCUS_34290 7569 9140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 9142 10242 gene locus_tag LOCUS_34300 9142 10242 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975709.1 protein_id gnl|my_center|LOCUS_34300 10890 10423 gene locus_tag LOCUS_34310 10890 10423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 11142 11462 gene locus_tag LOCUS_34320 11142 11462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 <13854 11520 gene locus_tag LOCUS_34330 <13854 11520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107463.1:membrane protein >Feature sequence144 2613 724 gene locus_tag LOCUS_34340 2613 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 4678 2603 gene locus_tag LOCUS_34350 4678 2603 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119288.1 protein_id gnl|my_center|LOCUS_34350 4923 5690 gene locus_tag LOCUS_34360 4923 5690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 5722 6594 gene locus_tag LOCUS_34370 5722 6594 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640183.1 protein_id gnl|my_center|LOCUS_34370 7088 6750 gene locus_tag LOCUS_34380 7088 6750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 7606 7235 gene locus_tag LOCUS_34390 7606 7235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 8081 7611 gene locus_tag LOCUS_34400 8081 7611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 8311 8874 gene locus_tag LOCUS_34410 8311 8874 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103394.1 protein_id gnl|my_center|LOCUS_34410 9671 9033 gene locus_tag LOCUS_34420 9671 9033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 10163 10387 gene locus_tag LOCUS_34430 10163 10387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 10400 10786 gene locus_tag LOCUS_34440 10400 10786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 10808 11911 gene locus_tag LOCUS_34450 10808 11911 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704251.1 protein_id gnl|my_center|LOCUS_34450 12885 12118 gene locus_tag LOCUS_34460 12885 12118 CDS product DNA metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207772.1 protein_id gnl|my_center|LOCUS_34460 <13795 12887 gene locus_tag LOCUS_34470 <13795 12887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764634.1:putative DNA modification/repair radical SAM protein >Feature sequence145 1644 433 gene locus_tag LOCUS_34480 1644 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962655.1 protein_id gnl|my_center|LOCUS_34480 2918 1641 gene locus_tag LOCUS_34490 2918 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 3221 2988 gene locus_tag LOCUS_34500 3221 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 3394 3861 gene locus_tag LOCUS_34510 3394 3861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 5010 6110 gene locus_tag LOCUS_34520 5010 6110 CDS product adenosine monophosphate-protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSZ0 protein_id gnl|my_center|LOCUS_34520 6354 7256 gene locus_tag LOCUS_34530 6354 7256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 7285 7581 gene locus_tag LOCUS_34540 7285 7581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 8147 9166 gene locus_tag LOCUS_34550 gene yjjN 8147 9166 CDS product zinc-type alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119735.1 protein_id gnl|my_center|LOCUS_34550 9221 11305 gene locus_tag LOCUS_34560 9221 11305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 11455 12045 gene locus_tag LOCUS_34570 11455 12045 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_34570 >Feature sequence146 78 5 gene locus_tag LOCUS_t00240 78 5 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2030 210 gene locus_tag LOCUS_34580 2030 210 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_34580 2691 2179 gene locus_tag LOCUS_34590 2691 2179 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403943.1 protein_id gnl|my_center|LOCUS_34590 3225 2770 gene locus_tag LOCUS_34600 gene smpB 3225 2770 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RD6 protein_id gnl|my_center|LOCUS_34600 3705 4952 gene locus_tag LOCUS_34610 gene hflX 3705 4952 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YK6 protein_id gnl|my_center|LOCUS_34610 5000 5072 gene locus_tag LOCUS_t00250 5000 5072 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5454 5651 gene locus_tag LOCUS_34620 5454 5651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 6378 6184 gene locus_tag LOCUS_34630 6378 6184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 6434 6640 gene locus_tag LOCUS_34640 6434 6640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 6640 7011 gene locus_tag LOCUS_34650 6640 7011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 7494 8531 gene locus_tag LOCUS_34660 7494 8531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34660 8821 9615 gene locus_tag LOCUS_34670 8821 9615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 9843 11675 gene locus_tag LOCUS_34680 9843 11675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 >Feature sequence147 141 1751 gene locus_tag LOCUS_34690 141 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 1753 2706 gene locus_tag LOCUS_34700 1753 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 2724 2945 gene locus_tag LOCUS_34710 2724 2945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 2973 3362 gene locus_tag LOCUS_34720 2973 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 3496 3798 gene locus_tag LOCUS_34730 3496 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 3801 5204 gene locus_tag LOCUS_34740 3801 5204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 5229 5948 gene locus_tag LOCUS_34750 5229 5948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 5965 6600 gene locus_tag LOCUS_34760 5965 6600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 6591 7277 gene locus_tag LOCUS_34770 6591 7277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 7277 7834 gene locus_tag LOCUS_34780 7277 7834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 7940 8566 gene locus_tag LOCUS_34790 7940 8566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 8608 9009 gene locus_tag LOCUS_34800 8608 9009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 9034 9771 gene locus_tag LOCUS_34810 9034 9771 CDS product protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_34810 9768 11438 gene locus_tag LOCUS_34820 9768 11438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 11456 13426 gene locus_tag LOCUS_34830 11456 13426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 >Feature sequence148 4290 1900 gene locus_tag LOCUS_34840 4290 1900 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_34840 5457 4300 gene locus_tag LOCUS_34850 5457 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 6982 5576 gene locus_tag LOCUS_34860 gene lpdA1 6982 5576 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0C9 protein_id gnl|my_center|LOCUS_34860 8573 7032 gene locus_tag LOCUS_34870 gene sucB 8573 7032 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ87 protein_id gnl|my_center|LOCUS_34870 11360 8577 gene locus_tag LOCUS_34880 gene sucA 11360 8577 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 protein_id gnl|my_center|LOCUS_34880 12368 11556 gene locus_tag LOCUS_34890 12368 11556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 <13517 12504 gene locus_tag LOCUS_34900 <13517 12504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962492.1:cell envelope biogenesis protein OmpA >Feature sequence149 793 1182 gene locus_tag LOCUS_34910 793 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 1284 1883 gene locus_tag LOCUS_34920 1284 1883 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_34920 1960 2697 gene locus_tag LOCUS_34930 1960 2697 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105573.1 protein_id gnl|my_center|LOCUS_34930 2713 5109 gene locus_tag LOCUS_34940 2713 5109 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963130.1 protein_id gnl|my_center|LOCUS_34940 >Feature sequence150 2949 631 gene locus_tag LOCUS_34950 2949 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 3788 3000 gene locus_tag LOCUS_34960 3788 3000 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I615 protein_id gnl|my_center|LOCUS_34960 5098 3932 gene locus_tag LOCUS_34970 5098 3932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 6167 5085 gene locus_tag LOCUS_34980 6167 5085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 7370 6243 gene locus_tag LOCUS_34990 7370 6243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 9917 7374 gene locus_tag LOCUS_35000 9917 7374 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202132.1 protein_id gnl|my_center|LOCUS_35000 11310 10171 gene locus_tag LOCUS_35010 11310 10171 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107393.1 protein_id gnl|my_center|LOCUS_35010 12222 11389 gene locus_tag LOCUS_35020 12222 11389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 >Feature sequence151 7289 6927 gene locus_tag LOCUS_35030 7289 6927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 10869 7747 gene locus_tag LOCUS_35040 10869 7747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 <12404 10977 gene locus_tag LOCUS_35050 <12404 10977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109117.1:hybrid sensor histidine kinase/response regulator >Feature sequence152 <1 664 gene locus_tag LOCUS_35060 <1 664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108882.1:DDE transposase 1862 966 gene locus_tag LOCUS_35070 1862 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 3126 1876 gene locus_tag LOCUS_35080 3126 1876 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029014.1 protein_id gnl|my_center|LOCUS_35080 4633 3176 gene locus_tag LOCUS_35090 4633 3176 CDS product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_35090 5985 4693 gene locus_tag LOCUS_35100 5985 4693 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919382.1 protein_id gnl|my_center|LOCUS_35100 6635 5982 gene locus_tag LOCUS_35110 gene eda 6635 5982 CDS product 2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729327.1 protein_id gnl|my_center|LOCUS_35110 7633 6632 gene locus_tag LOCUS_35120 gene dgoK 7633 6632 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707017.1 protein_id gnl|my_center|LOCUS_35120 9826 7661 gene locus_tag LOCUS_35130 9826 7661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 10753 9830 gene locus_tag LOCUS_35140 10753 9830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 12070 10826 gene locus_tag LOCUS_35150 12070 10826 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969235.1 protein_id gnl|my_center|LOCUS_35150 >Feature sequence153 176 1501 gene locus_tag LOCUS_35160 gene secY 176 1501 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A496 protein_id gnl|my_center|LOCUS_35160 1510 2313 gene locus_tag LOCUS_35170 gene map 1510 2313 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A497 protein_id gnl|my_center|LOCUS_35170 2315 2533 gene locus_tag LOCUS_35180 gene infA 2315 2533 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A498 protein_id gnl|my_center|LOCUS_35180 2686 3060 gene locus_tag LOCUS_35190 gene rpsM 2686 3060 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NN2 protein_id gnl|my_center|LOCUS_35190 3119 3514 gene locus_tag LOCUS_35200 gene rpsK 3119 3514 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ75 protein_id gnl|my_center|LOCUS_35200 3595 4200 gene locus_tag LOCUS_35210 gene rpsD 3595 4200 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NN4 protein_id gnl|my_center|LOCUS_35210 4313 5281 gene locus_tag LOCUS_35220 gene rpoA 4313 5281 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ73 protein_id gnl|my_center|LOCUS_35220 5370 5939 gene locus_tag LOCUS_35230 gene rplQ 5370 5939 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4A3 protein_id gnl|my_center|LOCUS_35230 6808 5993 gene locus_tag LOCUS_35240 6808 5993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 7006 8112 gene locus_tag LOCUS_35250 gene carA 7006 8112 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ71 protein_id gnl|my_center|LOCUS_35250 9234 8113 gene locus_tag LOCUS_35260 9234 8113 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108720.1 protein_id gnl|my_center|LOCUS_35260 9326 10630 gene locus_tag LOCUS_35270 9326 10630 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 protein_id gnl|my_center|LOCUS_35270 11366 10638 gene locus_tag LOCUS_35280 11366 10638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 <12121 11447 gene locus_tag LOCUS_35290 <12121 11447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YHB1:1,4-alpha-glucan branching enzyme GlgB >Feature sequence154 1546 3477 gene locus_tag LOCUS_35300 1546 3477 CDS product large multi-functional protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119646.1 protein_id gnl|my_center|LOCUS_35300 3504 4427 gene locus_tag LOCUS_35310 3504 4427 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_35310 5650 4484 gene locus_tag LOCUS_35320 5650 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 6319 5750 gene locus_tag LOCUS_35330 6319 5750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 6504 7253 gene locus_tag LOCUS_35340 6504 7253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 8077 7256 gene locus_tag LOCUS_35350 8077 7256 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038886.1 protein_id gnl|my_center|LOCUS_35350 9080 8232 gene locus_tag LOCUS_35360 9080 8232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 9260 9832 gene locus_tag LOCUS_35370 9260 9832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 >Feature sequence155 1751 2764 gene locus_tag LOCUS_35380 1751 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 2916 3401 gene locus_tag LOCUS_35390 2916 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 3578 4483 gene locus_tag LOCUS_35400 3578 4483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 5629 4493 gene locus_tag LOCUS_35410 5629 4493 CDS product sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119313.1 protein_id gnl|my_center|LOCUS_35410 5821 7248 gene locus_tag LOCUS_35420 5821 7248 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798159.1 protein_id gnl|my_center|LOCUS_35420 7820 7305 gene locus_tag LOCUS_35430 7820 7305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 8390 7905 gene locus_tag LOCUS_35440 8390 7905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 8784 8413 gene locus_tag LOCUS_35450 8784 8413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 9755 8853 gene locus_tag LOCUS_35460 9755 8853 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889058.1 protein_id gnl|my_center|LOCUS_35460 10339 9749 gene locus_tag LOCUS_35470 10339 9749 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970757.1 protein_id gnl|my_center|LOCUS_35470 10830 10342 gene locus_tag LOCUS_35480 10830 10342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338370.1 protein_id gnl|my_center|LOCUS_35480 10933 11424 gene locus_tag LOCUS_35490 10933 11424 CDS product twin-arginine translocation pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383266.1 protein_id gnl|my_center|LOCUS_35490 >Feature sequence156 765 232 gene locus_tag LOCUS_35500 gene rimM 765 232 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI5 protein_id gnl|my_center|LOCUS_35500 1425 826 gene locus_tag LOCUS_35510 1425 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 3370 2078 gene locus_tag LOCUS_35520 3370 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964213.1 protein_id gnl|my_center|LOCUS_35520 4373 3441 gene locus_tag LOCUS_35530 4373 3441 CDS product mannonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763962.1 protein_id gnl|my_center|LOCUS_35530 6451 4373 gene locus_tag LOCUS_35540 6451 4373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404150.1 protein_id gnl|my_center|LOCUS_35540 7212 6466 gene locus_tag LOCUS_35550 7212 6466 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_35550 7892 7209 gene locus_tag LOCUS_35560 gene rsmI 7892 7209 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5G6 protein_id gnl|my_center|LOCUS_35560 8571 8341 gene locus_tag LOCUS_35570 8571 8341 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WZ6 protein_id gnl|my_center|LOCUS_35570 8688 11486 gene locus_tag LOCUS_35580 gene leuS 8688 11486 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MG4 protein_id gnl|my_center|LOCUS_35580 11753 11559 gene locus_tag LOCUS_35590 11753 11559 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388930.1 protein_id gnl|my_center|LOCUS_35590 >Feature sequence157 207 1664 gene locus_tag LOCUS_35600 207 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 2713 1985 gene locus_tag LOCUS_35610 2713 1985 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_35610 2849 6898 gene locus_tag LOCUS_35620 2849 6898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 7046 7432 gene locus_tag LOCUS_35630 7046 7432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 7519 8538 gene locus_tag LOCUS_35640 7519 8538 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084062.1 protein_id gnl|my_center|LOCUS_35640 <11821 8875 gene locus_tag LOCUS_35650 <11821 8875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962756.1:T9SS C-terminal target domain-containing protein >Feature sequence158 138 1388 gene locus_tag LOCUS_35660 138 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 2390 3007 gene locus_tag LOCUS_35670 2390 3007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 3051 3383 gene locus_tag LOCUS_35680 3051 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 4219 3584 gene locus_tag LOCUS_35690 4219 3584 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943590.1 protein_id gnl|my_center|LOCUS_35690 6206 4224 gene locus_tag LOCUS_35700 6206 4224 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787236.1 protein_id gnl|my_center|LOCUS_35700 6452 6279 gene locus_tag LOCUS_35710 6452 6279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 6935 6501 gene locus_tag LOCUS_35720 6935 6501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 7076 7813 gene locus_tag LOCUS_35730 7076 7813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 7912 8118 gene locus_tag LOCUS_35740 7912 8118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 8246 8797 gene locus_tag LOCUS_35750 8246 8797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 8823 9722 gene locus_tag LOCUS_35760 8823 9722 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119250.1 protein_id gnl|my_center|LOCUS_35760 9730 10569 gene locus_tag LOCUS_35770 9730 10569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 10623 11558 gene locus_tag LOCUS_35780 gene lolI 10623 11558 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122269.1 protein_id gnl|my_center|LOCUS_35780 >Feature sequence159 <1 545 gene locus_tag LOCUS_35790 <1 545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GY93:succinate--CoA ligase [ADP-forming] subunit alpha 1246 605 gene locus_tag LOCUS_35800 1246 605 CDS product transcriptional initiation protein Tat inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405240.1 protein_id gnl|my_center|LOCUS_35800 2991 1252 gene locus_tag LOCUS_35810 2991 1252 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405241.1 protein_id gnl|my_center|LOCUS_35810 3450 5963 gene locus_tag LOCUS_35820 3450 5963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764126.1 protein_id gnl|my_center|LOCUS_35820 6269 9367 gene locus_tag LOCUS_35830 6269 9367 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766148.1 protein_id gnl|my_center|LOCUS_35830 9394 10944 gene locus_tag LOCUS_35840 9394 10944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403146.1 protein_id gnl|my_center|LOCUS_35840 >Feature sequence160 911 645 gene locus_tag LOCUS_35850 911 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 984 2201 gene locus_tag LOCUS_35860 984 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963733.1 protein_id gnl|my_center|LOCUS_35860 2194 3048 gene locus_tag LOCUS_35870 2194 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 3059 4057 gene locus_tag LOCUS_35880 3059 4057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 5193 4069 gene locus_tag LOCUS_35890 5193 4069 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769083.1 protein_id gnl|my_center|LOCUS_35890 5498 5190 gene locus_tag LOCUS_35900 5498 5190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 6916 5495 gene locus_tag LOCUS_35910 6916 5495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 8398 7007 gene locus_tag LOCUS_35920 8398 7007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 8535 11201 gene locus_tag LOCUS_35930 gene alaS 8535 11201 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Y3 protein_id gnl|my_center|LOCUS_35930 >Feature sequence161 1327 470 gene locus_tag LOCUS_35940 gene hisG 1327 470 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABB0 protein_id gnl|my_center|LOCUS_35940 1663 2925 gene locus_tag LOCUS_35950 1663 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 2912 3460 gene locus_tag LOCUS_35960 2912 3460 CDS product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331372.1 protein_id gnl|my_center|LOCUS_35960 3566 4735 gene locus_tag LOCUS_35970 3566 4735 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790532.1 protein_id gnl|my_center|LOCUS_35970 6324 4795 gene locus_tag LOCUS_35980 gene guaA 6324 4795 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XQ7 protein_id gnl|my_center|LOCUS_35980 7499 6324 gene locus_tag LOCUS_35990 7499 6324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108150.1 protein_id gnl|my_center|LOCUS_35990 7511 8731 gene locus_tag LOCUS_36000 7511 8731 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107808.1 protein_id gnl|my_center|LOCUS_36000 9783 8779 gene locus_tag LOCUS_36010 9783 8779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461600.1 protein_id gnl|my_center|LOCUS_36010 10298 9810 gene locus_tag LOCUS_36020 10298 9810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461601.1 protein_id gnl|my_center|LOCUS_36020 10934 10410 gene locus_tag LOCUS_36030 10934 10410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 >Feature sequence162 7670 5385 gene locus_tag LOCUS_36040 7670 5385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 8749 7697 gene locus_tag LOCUS_36050 gene fjo30 8749 7697 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_36050 9438 8749 gene locus_tag LOCUS_36060 gene cmk 9438 8749 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PU2 protein_id gnl|my_center|LOCUS_36060 10065 9538 gene locus_tag LOCUS_36070 gene yceI 10065 9538 CDS product lipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962678.1 protein_id gnl|my_center|LOCUS_36070 >Feature sequence163 97 546 gene locus_tag LOCUS_36080 97 546 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783995.1 protein_id gnl|my_center|LOCUS_36080 827 1336 gene locus_tag LOCUS_36090 827 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 1427 5326 gene locus_tag LOCUS_36100 1427 5326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 6097 5390 gene locus_tag LOCUS_36110 6097 5390 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 protein_id gnl|my_center|LOCUS_36110 7205 6213 gene locus_tag LOCUS_36120 7205 6213 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962285.1 protein_id gnl|my_center|LOCUS_36120 7628 7278 gene locus_tag LOCUS_36130 gene panD 7628 7278 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZR7 protein_id gnl|my_center|LOCUS_36130 7873 8781 gene locus_tag LOCUS_36140 7873 8781 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962832.1 protein_id gnl|my_center|LOCUS_36140 9255 8950 gene locus_tag LOCUS_36150 9255 8950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 9577 9236 gene locus_tag LOCUS_36160 9577 9236 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201974.1 protein_id gnl|my_center|LOCUS_36160 >Feature sequence164 448 1203 gene locus_tag LOCUS_36170 448 1203 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680560.1 protein_id gnl|my_center|LOCUS_36170 1301 2074 gene locus_tag LOCUS_36180 gene pcbD 1301 2074 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 protein_id gnl|my_center|LOCUS_36180 2071 2727 gene locus_tag LOCUS_36190 2071 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 2732 3643 gene locus_tag LOCUS_36200 gene nadK 2732 3643 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D1 protein_id gnl|my_center|LOCUS_36200 3773 4771 gene locus_tag LOCUS_36210 3773 4771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 4785 5600 gene locus_tag LOCUS_36220 4785 5600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 5687 6439 gene locus_tag LOCUS_36230 gene uppS 5687 6439 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D3 protein_id gnl|my_center|LOCUS_36230 6445 9075 gene locus_tag LOCUS_36240 6445 9075 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108949.1 protein_id gnl|my_center|LOCUS_36240 9192 9710 gene locus_tag LOCUS_36250 9192 9710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 9744 10301 gene locus_tag LOCUS_36260 9744 10301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 >Feature sequence165 2254 3300 gene locus_tag LOCUS_36270 2254 3300 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962811.1 protein_id gnl|my_center|LOCUS_36270 3650 4483 gene locus_tag LOCUS_36280 3650 4483 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792006.1 protein_id gnl|my_center|LOCUS_36280 4545 5141 gene locus_tag LOCUS_36290 4545 5141 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792004.1 protein_id gnl|my_center|LOCUS_36290 5143 5700 gene locus_tag LOCUS_36300 gene exbD2 5143 5700 CDS product biopolymer transport ExbD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964298.1 protein_id gnl|my_center|LOCUS_36300 5730 6572 gene locus_tag LOCUS_36310 5730 6572 CDS product cell envelope biogenesis protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763546.1 protein_id gnl|my_center|LOCUS_36310 6581 6790 gene locus_tag LOCUS_36320 6581 6790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 6874 7776 gene locus_tag LOCUS_36330 6874 7776 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763547.1 protein_id gnl|my_center|LOCUS_36330 7949 9661 gene locus_tag LOCUS_36340 7949 9661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 9783 10355 gene locus_tag LOCUS_36350 gene adk 9783 10355 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XA6 protein_id gnl|my_center|LOCUS_36350 >Feature sequence166 <1 530 gene locus_tag LOCUS_36360 <1 530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766013.1:glycosyl transferase 870 610 gene locus_tag LOCUS_36370 870 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 2473 2943 gene locus_tag LOCUS_36380 2473 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 2940 4133 gene locus_tag LOCUS_36390 2940 4133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 4130 5119 gene locus_tag LOCUS_36400 4130 5119 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545841.1 protein_id gnl|my_center|LOCUS_36400 5705 6406 gene locus_tag LOCUS_36410 5705 6406 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964336.1 protein_id gnl|my_center|LOCUS_36410 6666 8189 gene locus_tag LOCUS_36420 6666 8189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 8526 9914 gene locus_tag LOCUS_36430 8526 9914 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766006.1 protein_id gnl|my_center|LOCUS_36430 >Feature sequence167 1567 269 gene locus_tag LOCUS_36440 1567 269 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_36440 1811 4249 gene locus_tag LOCUS_36450 1811 4249 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_36450 5435 4359 gene locus_tag LOCUS_36460 5435 4359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 6622 5438 gene locus_tag LOCUS_36470 6622 5438 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918429.1 protein_id gnl|my_center|LOCUS_36470 7233 6622 gene locus_tag LOCUS_36480 7233 6622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 8773 7304 gene locus_tag LOCUS_36490 8773 7304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 10149 8773 gene locus_tag LOCUS_36500 10149 8773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120254.1 protein_id gnl|my_center|LOCUS_36500 10749 10171 gene locus_tag LOCUS_36510 10749 10171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 >Feature sequence168 482 1927 gene locus_tag LOCUS_36520 482 1927 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760476.1 protein_id gnl|my_center|LOCUS_36520 1929 3602 gene locus_tag LOCUS_36530 1929 3602 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404427.1 protein_id gnl|my_center|LOCUS_36530 4570 3599 gene locus_tag LOCUS_36540 4570 3599 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_36540 5898 4579 gene locus_tag LOCUS_36550 5898 4579 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NW8 protein_id gnl|my_center|LOCUS_36550 8227 5906 gene locus_tag LOCUS_36560 8227 5906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 9365 8328 gene locus_tag LOCUS_36570 9365 8328 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933174.1 protein_id gnl|my_center|LOCUS_36570 9590 10129 gene locus_tag LOCUS_36580 9590 10129 CDS product RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142702.1 protein_id gnl|my_center|LOCUS_36580 >Feature sequence169 1014 37 gene locus_tag LOCUS_36590 1014 37 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120895.1 protein_id gnl|my_center|LOCUS_36590 1272 1466 gene locus_tag LOCUS_36600 1272 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 1436 1675 gene locus_tag LOCUS_36610 1436 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 1715 2908 gene locus_tag LOCUS_36620 1715 2908 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385749.1 protein_id gnl|my_center|LOCUS_36620 4149 3028 gene locus_tag LOCUS_36630 4149 3028 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545331.1 protein_id gnl|my_center|LOCUS_36630 4401 4174 gene locus_tag LOCUS_36640 4401 4174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 4606 5808 gene locus_tag LOCUS_36650 4606 5808 CDS product hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 protein_id gnl|my_center|LOCUS_36650 5902 7980 gene locus_tag LOCUS_36660 5902 7980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 7988 9562 gene locus_tag LOCUS_36670 gene ndhD 7988 9562 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932457.1 protein_id gnl|my_center|LOCUS_36670 >Feature sequence170 <1 1549 gene locus_tag LOCUS_36680 <1 1549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763956.1:TonB-dependent receptor 1554 2561 gene locus_tag LOCUS_36690 1554 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 2619 3746 gene locus_tag LOCUS_36700 2619 3746 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706898.1 protein_id gnl|my_center|LOCUS_36700 3753 4724 gene locus_tag LOCUS_36710 3753 4724 CDS product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404019.1 protein_id gnl|my_center|LOCUS_36710 6880 4784 gene locus_tag LOCUS_36720 gene feoB 6880 4784 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVT6 protein_id gnl|my_center|LOCUS_36720 7158 6910 gene locus_tag LOCUS_36730 7158 6910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 7401 8363 gene locus_tag LOCUS_36740 7401 8363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 >Feature sequence171 671 177 gene locus_tag LOCUS_36750 671 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 1024 1500 gene locus_tag LOCUS_36760 1024 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788988.1 protein_id gnl|my_center|LOCUS_36760 1564 2187 gene locus_tag LOCUS_36770 1564 2187 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548076.1 protein_id gnl|my_center|LOCUS_36770 2258 2767 gene locus_tag LOCUS_36780 2258 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 2877 3254 gene locus_tag LOCUS_36790 2877 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 3777 3259 gene locus_tag LOCUS_36800 3777 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119352.1 protein_id gnl|my_center|LOCUS_36800 4281 3787 gene locus_tag LOCUS_36810 4281 3787 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963592.1 protein_id gnl|my_center|LOCUS_36810 5543 4284 gene locus_tag LOCUS_36820 5543 4284 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083543.1 protein_id gnl|my_center|LOCUS_36820 5756 5547 gene locus_tag LOCUS_36830 5756 5547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 6383 5760 gene locus_tag LOCUS_36840 6383 5760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 7190 6459 gene locus_tag LOCUS_36850 7190 6459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 7501 7187 gene locus_tag LOCUS_36860 gene rhaM 7501 7187 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CFA8 protein_id gnl|my_center|LOCUS_36860 7961 7503 gene locus_tag LOCUS_36870 7961 7503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 8236 7964 gene locus_tag LOCUS_36880 8236 7964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 8439 8233 gene locus_tag LOCUS_36890 8439 8233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 9888 8536 gene locus_tag LOCUS_36900 9888 8536 CDS product 4,5-dihydroxyphthalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972774.1 protein_id gnl|my_center|LOCUS_36900 <10503 9968 gene locus_tag LOCUS_36910 <10503 9968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039188.1:hexuronate transporter >Feature sequence172 <1 973 gene locus_tag LOCUS_36920 <1 973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8AA33:elongation factor 4 1063 2697 gene locus_tag LOCUS_36930 gene pdhC 1063 2697 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE4 protein_id gnl|my_center|LOCUS_36930 2926 3297 gene locus_tag LOCUS_36940 2926 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 3425 4513 gene locus_tag LOCUS_36950 gene gfo 3425 4513 CDS product glucose-fructose oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036051.1 protein_id gnl|my_center|LOCUS_36950 7249 4517 gene locus_tag LOCUS_36960 7249 4517 CDS product alpha-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202068.1 protein_id gnl|my_center|LOCUS_36960 8399 7251 gene locus_tag LOCUS_36970 8399 7251 CDS product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583041.1 protein_id gnl|my_center|LOCUS_36970 10168 8474 gene locus_tag LOCUS_36980 10168 8474 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973790.1 protein_id gnl|my_center|LOCUS_36980 10451 10170 gene locus_tag LOCUS_36990 10451 10170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 >Feature sequence173 386 1213 gene locus_tag LOCUS_37000 386 1213 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065081.1 protein_id gnl|my_center|LOCUS_37000 1213 1659 gene locus_tag LOCUS_37010 1213 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 1659 2564 gene locus_tag LOCUS_37020 1659 2564 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786279.1 protein_id gnl|my_center|LOCUS_37020 2787 3968 gene locus_tag LOCUS_37030 2787 3968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 4692 4399 gene locus_tag LOCUS_37040 4692 4399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 4889 5248 gene locus_tag LOCUS_37050 4889 5248 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860832.1 protein_id gnl|my_center|LOCUS_37050 7843 5426 gene locus_tag LOCUS_37060 7843 5426 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_37060 10338 7909 gene locus_tag LOCUS_37070 10338 7909 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_37070 >Feature sequence174 2194 197 gene locus_tag LOCUS_37080 2194 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229021.1 protein_id gnl|my_center|LOCUS_37080 3070 2399 gene locus_tag LOCUS_37090 3070 2399 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962587.1 protein_id gnl|my_center|LOCUS_37090 3210 3524 gene locus_tag LOCUS_37100 3210 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 3722 3579 gene locus_tag LOCUS_37110 3722 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 3944 5308 gene locus_tag LOCUS_37120 gene hisS 3944 5308 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QS2 protein_id gnl|my_center|LOCUS_37120 5301 6338 gene locus_tag LOCUS_37130 5301 6338 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202520.1 protein_id gnl|my_center|LOCUS_37130 6338 6742 gene locus_tag LOCUS_37140 6338 6742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 6742 7671 gene locus_tag LOCUS_37150 gene yfkH 6742 7671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963960.1 protein_id gnl|my_center|LOCUS_37150 7680 8141 gene locus_tag LOCUS_37160 gene elaA 7680 8141 CDS product ElaA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962201.1 protein_id gnl|my_center|LOCUS_37160 9735 8131 gene locus_tag LOCUS_37170 9735 8131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058364.1 protein_id gnl|my_center|LOCUS_37170 >Feature sequence175 2562 745 gene locus_tag LOCUS_37180 2562 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 2657 2857 gene locus_tag LOCUS_37190 2657 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 2850 4751 gene locus_tag LOCUS_37200 2850 4751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 4756 5118 gene locus_tag LOCUS_37210 4756 5118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 5123 6163 gene locus_tag LOCUS_37220 5123 6163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 6169 9744 gene locus_tag LOCUS_37230 6169 9744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 >Feature sequence176 <1 557 gene locus_tag LOCUS_37240 <1 557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89ZI9:GTPase Obg 780 3332 gene locus_tag LOCUS_37250 780 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 3329 5578 gene locus_tag LOCUS_37260 3329 5578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 5691 6065 gene locus_tag LOCUS_37270 gene nuoA 5691 6065 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1R4 protein_id gnl|my_center|LOCUS_37270 6067 6609 gene locus_tag LOCUS_37280 gene nuoB 6067 6609 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1R3 protein_id gnl|my_center|LOCUS_37280 6612 7112 gene locus_tag LOCUS_37290 gene nuoC 6612 7112 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1R2 protein_id gnl|my_center|LOCUS_37290 7093 8355 gene locus_tag LOCUS_37300 gene nuoD 7093 8355 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1R1 protein_id gnl|my_center|LOCUS_37300 8348 8851 gene locus_tag LOCUS_37310 gene nuoE 8348 8851 CDS product NADH dehydrogenase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964318.1 protein_id gnl|my_center|LOCUS_37310 >Feature sequence177 3 473 gene locus_tag LOCUS_37320 3 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 1949 507 gene locus_tag LOCUS_37330 1949 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963476.1 protein_id gnl|my_center|LOCUS_37330 5195 1971 gene locus_tag LOCUS_37340 5195 1971 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963475.1 protein_id gnl|my_center|LOCUS_37340 5632 6741 gene locus_tag LOCUS_37350 5632 6741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 7076 7423 gene locus_tag LOCUS_37360 7076 7423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 7463 8101 gene locus_tag LOCUS_37370 7463 8101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 9096 8107 gene locus_tag LOCUS_37380 9096 8107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 <9929 9114 gene locus_tag LOCUS_37390 <9929 9114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DHP3:beta-xylanase >Feature sequence178 218 1285 gene locus_tag LOCUS_37400 218 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 1299 2375 gene locus_tag LOCUS_37410 1299 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 2389 3450 gene locus_tag LOCUS_37420 2389 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 4448 3444 gene locus_tag LOCUS_37430 4448 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 4579 4839 gene locus_tag LOCUS_37440 gene rpsT 4579 4839 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF2 protein_id gnl|my_center|LOCUS_37440 4919 5617 gene locus_tag LOCUS_37450 gene radC 4919 5617 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 protein_id gnl|my_center|LOCUS_37450 5622 5906 gene locus_tag LOCUS_37460 5622 5906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 6254 7297 gene locus_tag LOCUS_37470 6254 7297 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784707.1 protein_id gnl|my_center|LOCUS_37470 >Feature sequence179 1708 575 gene locus_tag LOCUS_37480 1708 575 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_37480 2595 1726 gene locus_tag LOCUS_37490 2595 1726 CDS product tagatose 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339518.1 protein_id gnl|my_center|LOCUS_37490 6138 2611 gene locus_tag LOCUS_37500 6138 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 6274 7143 gene locus_tag LOCUS_37510 6274 7143 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530722.1 protein_id gnl|my_center|LOCUS_37510 7528 7220 gene locus_tag LOCUS_37520 7528 7220 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390183.1 protein_id gnl|my_center|LOCUS_37520 7723 7541 gene locus_tag LOCUS_37530 7723 7541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 9090 8215 gene locus_tag LOCUS_37540 9090 8215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 <9844 9208 gene locus_tag LOCUS_37550 <9844 9208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q97H96:5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase >Feature sequence180 1468 2823 gene locus_tag LOCUS_37560 1468 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 2825 4294 gene locus_tag LOCUS_37570 2825 4294 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703431.1 protein_id gnl|my_center|LOCUS_37570 4297 5169 gene locus_tag LOCUS_37580 4297 5169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 5303 6073 gene locus_tag LOCUS_37590 5303 6073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 6459 6653 gene locus_tag LOCUS_37600 6459 6653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 >Feature sequence181 203 1438 gene locus_tag LOCUS_37610 203 1438 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478185.1 protein_id gnl|my_center|LOCUS_37610 1747 1439 gene locus_tag LOCUS_37620 1747 1439 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272543.1 protein_id gnl|my_center|LOCUS_37620 1998 4454 gene locus_tag LOCUS_37630 gene thrA 1998 4454 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108282.1 protein_id gnl|my_center|LOCUS_37630 4482 5414 gene locus_tag LOCUS_37640 gene thrB 4482 5414 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW7 protein_id gnl|my_center|LOCUS_37640 5411 5950 gene locus_tag LOCUS_37650 5411 5950 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919345.1 protein_id gnl|my_center|LOCUS_37650 6025 6432 gene locus_tag LOCUS_37660 6025 6432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 7006 6434 gene locus_tag LOCUS_37670 7006 6434 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783481.1 protein_id gnl|my_center|LOCUS_37670 7894 7010 gene locus_tag LOCUS_37680 gene dapA 7894 7010 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TM6 protein_id gnl|my_center|LOCUS_37680 8217 7987 gene locus_tag LOCUS_37690 8217 7987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 <9753 8316 gene locus_tag LOCUS_37700 <9753 8316 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64TM7:DNA ligase >Feature sequence182 360 1706 gene locus_tag LOCUS_37710 360 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 1830 3317 gene locus_tag LOCUS_37720 1830 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 3420 4475 gene locus_tag LOCUS_37730 3420 4475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 5061 4531 gene locus_tag LOCUS_37740 5061 4531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 6414 5140 gene locus_tag LOCUS_37750 6414 5140 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405234.1 protein_id gnl|my_center|LOCUS_37750 6615 7511 gene locus_tag LOCUS_37760 6615 7511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 7520 8323 gene locus_tag LOCUS_37770 7520 8323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 9507 8395 gene locus_tag LOCUS_37780 gene xynA 9507 8395 CDS product beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3F6 protein_id gnl|my_center|LOCUS_37780 >Feature sequence183 1571 948 gene locus_tag LOCUS_37790 1571 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 2751 1597 gene locus_tag LOCUS_37800 2751 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 2898 5201 gene locus_tag LOCUS_37810 2898 5201 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 protein_id gnl|my_center|LOCUS_37810 5421 6794 gene locus_tag LOCUS_37820 5421 6794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 6868 8136 gene locus_tag LOCUS_37830 6868 8136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 8349 8738 gene locus_tag LOCUS_37840 8349 8738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 8835 9260 gene locus_tag LOCUS_37850 8835 9260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 >Feature sequence184 9077 5190 gene locus_tag LOCUS_37860 9077 5190 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_37860 >Feature sequence185 <1 1661 gene locus_tag LOCUS_37870 <1 1661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64WV9:endonuclease MutS2 2336 1662 gene locus_tag LOCUS_37880 2336 1662 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962592.1 protein_id gnl|my_center|LOCUS_37880 2457 4109 gene locus_tag LOCUS_37890 2457 4109 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962591.1 protein_id gnl|my_center|LOCUS_37890 4102 5457 gene locus_tag LOCUS_37900 4102 5457 CDS product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962590.1 protein_id gnl|my_center|LOCUS_37900 5477 6826 gene locus_tag LOCUS_37910 5477 6826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 6832 7140 gene locus_tag LOCUS_37920 6832 7140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 7154 7702 gene locus_tag LOCUS_37930 7154 7702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 <9408 7776 gene locus_tag LOCUS_37940 <9408 7776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein >Feature sequence186 1972 689 gene locus_tag LOCUS_37950 gene phrB1 1972 689 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_37950 2673 1975 gene locus_tag LOCUS_37960 2673 1975 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 protein_id gnl|my_center|LOCUS_37960 2783 4027 gene locus_tag LOCUS_37970 2783 4027 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785125.1 protein_id gnl|my_center|LOCUS_37970 4042 5070 gene locus_tag LOCUS_37980 gene lpxD 4042 5070 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY99 protein_id gnl|my_center|LOCUS_37980 5071 6456 gene locus_tag LOCUS_37990 gene lpxC/fabZ 5071 6456 CDS product bifunctional enzyme LpxC/FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A015 protein_id gnl|my_center|LOCUS_37990 6472 7266 gene locus_tag LOCUS_38000 gene lpxA 6472 7266 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY97 protein_id gnl|my_center|LOCUS_38000 7269 7880 gene locus_tag LOCUS_38010 gene yybJ 7269 7880 CDS product putative ABC transporter ATP-binding protein YybJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37494 protein_id gnl|my_center|LOCUS_38010 >Feature sequence187 435 121 gene locus_tag LOCUS_38020 435 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 1724 747 gene locus_tag LOCUS_38030 1724 747 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964234.1 protein_id gnl|my_center|LOCUS_38030 2002 2367 gene locus_tag LOCUS_38040 2002 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 3030 2524 gene locus_tag LOCUS_38050 3030 2524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 4930 3098 gene locus_tag LOCUS_38060 4930 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 5429 5091 gene locus_tag LOCUS_38070 5429 5091 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764143.1 protein_id gnl|my_center|LOCUS_38070 6295 5426 gene locus_tag LOCUS_38080 6295 5426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993022.1 protein_id gnl|my_center|LOCUS_38080 6356 6775 gene locus_tag LOCUS_38090 6356 6775 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402855.1 protein_id gnl|my_center|LOCUS_38090 7015 6836 gene locus_tag LOCUS_38100 7015 6836 CDS product histone H1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404475.1 protein_id gnl|my_center|LOCUS_38100 8443 7181 gene locus_tag LOCUS_38110 8443 7181 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_38110 8757 8844 gene locus_tag LOCUS_t00260 8757 8844 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8898 8973 gene locus_tag LOCUS_t00270 8898 8973 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence188 3763 749 gene locus_tag LOCUS_38120 3763 749 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798907.1 protein_id gnl|my_center|LOCUS_38120 4921 3788 gene locus_tag LOCUS_38130 gene galA 4921 3788 CDS product arabinogalactan endo-beta-1,4-galactanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB67 protein_id gnl|my_center|LOCUS_38130 8312 5115 gene locus_tag LOCUS_38140 8312 5115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 >Feature sequence189 482 1198 gene locus_tag LOCUS_38150 482 1198 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798966.1 protein_id gnl|my_center|LOCUS_38150 1198 2310 gene locus_tag LOCUS_38160 1198 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 2679 6101 gene locus_tag LOCUS_38170 2679 6101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 6207 6851 gene locus_tag LOCUS_38180 6207 6851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 7752 6856 gene locus_tag LOCUS_38190 7752 6856 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118968.1 protein_id gnl|my_center|LOCUS_38190 >Feature sequence190 <1 2170 gene locus_tag LOCUS_38200 <1 2170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011201936.1:beta-glucuronidase 2505 5723 gene locus_tag LOCUS_38210 2505 5723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 5779 6171 gene locus_tag LOCUS_38220 5779 6171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 6275 6922 gene locus_tag LOCUS_38230 gene cynT 6275 6922 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H168 protein_id gnl|my_center|LOCUS_38230 >Feature sequence191 1584 850 gene locus_tag LOCUS_38240 gene etfB 1584 850 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_38240 1689 2018 gene locus_tag LOCUS_38250 1689 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 2012 3058 gene locus_tag LOCUS_38260 gene ansA 2012 3058 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964381.1 protein_id gnl|my_center|LOCUS_38260 3138 3223 gene locus_tag LOCUS_t00280 3138 3223 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3485 5806 gene locus_tag LOCUS_38270 3485 5806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 5784 8207 gene locus_tag LOCUS_38280 5784 8207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 >Feature sequence192 1007 1477 gene locus_tag LOCUS_38290 1007 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 2094 1498 gene locus_tag LOCUS_38300 gene sodC 2094 1498 CDS product superoxide dismutase [Cu-Zn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0D0 protein_id gnl|my_center|LOCUS_38300 3346 2201 gene locus_tag LOCUS_38310 3346 2201 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAV6 protein_id gnl|my_center|LOCUS_38310 5021 3405 gene locus_tag LOCUS_38320 5021 3405 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_38320 6013 5240 gene locus_tag LOCUS_38330 6013 5240 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYK9 protein_id gnl|my_center|LOCUS_38330 8429 6045 gene locus_tag LOCUS_38340 8429 6045 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_38340 >Feature sequence193 635 2410 gene locus_tag LOCUS_38350 635 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 2419 3096 gene locus_tag LOCUS_38360 gene lytT 2419 3096 CDS product sensory transduction protein LytT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q82Z76 protein_id gnl|my_center|LOCUS_38360 3343 3651 gene locus_tag LOCUS_38370 3343 3651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 3683 4048 gene locus_tag LOCUS_38380 3683 4048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 >Feature sequence194 3590 2157 gene locus_tag LOCUS_38390 3590 2157 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291422.1 protein_id gnl|my_center|LOCUS_38390 6584 3606 gene locus_tag LOCUS_38400 6584 3606 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107165.1 protein_id gnl|my_center|LOCUS_38400 6790 8337 gene locus_tag LOCUS_38410 6790 8337 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203619.1 protein_id gnl|my_center|LOCUS_38410 >Feature sequence195 2108 1197 gene locus_tag LOCUS_38420 2108 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 3918 2437 gene locus_tag LOCUS_38430 3918 2437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 5210 4917 gene locus_tag LOCUS_38440 5210 4917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 5703 5431 gene locus_tag LOCUS_38450 5703 5431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 6939 7325 gene locus_tag LOCUS_38460 6939 7325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 >Feature sequence196 1130 270 gene locus_tag LOCUS_38470 1130 270 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963067.1 protein_id gnl|my_center|LOCUS_38470 1589 1149 gene locus_tag LOCUS_38480 1589 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 3215 1800 gene locus_tag LOCUS_38490 3215 1800 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202247.1 protein_id gnl|my_center|LOCUS_38490 4940 3975 gene locus_tag LOCUS_38500 4940 3975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 5278 4952 gene locus_tag LOCUS_38510 5278 4952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 6111 5482 gene locus_tag LOCUS_38520 6111 5482 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706315.1 protein_id gnl|my_center|LOCUS_38520 6485 8158 gene locus_tag LOCUS_38530 6485 8158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 >Feature sequence197 1036 1263 gene locus_tag LOCUS_38540 1036 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 1253 2149 gene locus_tag LOCUS_38550 1253 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 3064 2174 gene locus_tag LOCUS_38560 3064 2174 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973725.1 protein_id gnl|my_center|LOCUS_38560 3175 4140 gene locus_tag LOCUS_38570 3175 4140 CDS product phytanoyl-CoA dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030607.1 protein_id gnl|my_center|LOCUS_38570 <8247 4335 gene locus_tag LOCUS_38580 <8247 4335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941413.1:fibronectin type III >Feature sequence198 1167 211 gene locus_tag LOCUS_38590 1167 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 1334 1678 gene locus_tag LOCUS_38600 1334 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 1778 3901 gene locus_tag LOCUS_38610 1778 3901 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 protein_id gnl|my_center|LOCUS_38610 3901 5397 gene locus_tag LOCUS_38620 3901 5397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 5394 6818 gene locus_tag LOCUS_38630 5394 6818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 >Feature sequence199 609 265 gene locus_tag LOCUS_38640 609 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705191.1 protein_id gnl|my_center|LOCUS_38640 2063 612 gene locus_tag LOCUS_38650 2063 612 CDS product peptidoglycan synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963483.1 protein_id gnl|my_center|LOCUS_38650 2226 3665 gene locus_tag LOCUS_38660 gene speA 2226 3665 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A2 protein_id gnl|my_center|LOCUS_38660 4902 3910 gene locus_tag LOCUS_38670 4902 3910 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795082.1 protein_id gnl|my_center|LOCUS_38670 5293 6753 gene locus_tag LOCUS_38680 5293 6753 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_38680 7232 6810 gene locus_tag LOCUS_38690 7232 6810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 7767 7219 gene locus_tag LOCUS_38700 gene tag 7767 7219 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220466.1 protein_id gnl|my_center|LOCUS_38700 >Feature sequence200 <1 476 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcttaatcgcaccttgaaggaattgaaac 864 792 gene locus_tag LOCUS_t00290 864 792 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1139 3460 gene locus_tag LOCUS_38710 1139 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 3707 3453 gene locus_tag LOCUS_38720 3707 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 4043 3888 gene locus_tag LOCUS_38730 4043 3888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 <8128 4179 gene locus_tag LOCUS_38740 <8128 4179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016361986.1:protein of unknown function precursor; adhesin >Feature sequence201 632 1300 gene locus_tag LOCUS_38750 632 1300 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084072.1 protein_id gnl|my_center|LOCUS_38750 1677 1297 gene locus_tag LOCUS_38760 1677 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 2231 1674 gene locus_tag LOCUS_38770 2231 1674 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_38770 2395 2733 gene locus_tag LOCUS_38780 2395 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 2853 3896 gene locus_tag LOCUS_38790 gene pam 2853 3896 CDS product peptidylglycine monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122516.1 protein_id gnl|my_center|LOCUS_38790 3924 4808 gene locus_tag LOCUS_38800 3924 4808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816527.1 protein_id gnl|my_center|LOCUS_38800 5549 4800 gene locus_tag LOCUS_38810 5549 4800 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786519.1 protein_id gnl|my_center|LOCUS_38810 6564 5632 gene locus_tag LOCUS_38820 6564 5632 CDS product DUF4835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_38820 7823 6561 gene locus_tag LOCUS_38830 7823 6561 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107739.1 protein_id gnl|my_center|LOCUS_38830 >Feature sequence202 892 2004 gene locus_tag LOCUS_38840 892 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 3097 2543 gene locus_tag LOCUS_38850 3097 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 4098 3094 gene locus_tag LOCUS_38860 4098 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 6234 4279 gene locus_tag LOCUS_38870 6234 4279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963667.1 protein_id gnl|my_center|LOCUS_38870 <7916 6482 gene locus_tag LOCUS_38880 <7916 6482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919507.1:GMC family oxidoreductase >Feature sequence203 <1 619 gene locus_tag LOCUS_38890 <1 619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964180.1:O-methyltransferase 624 2723 gene locus_tag LOCUS_38900 624 2723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 2766 3329 gene locus_tag LOCUS_38910 2766 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_38910 3310 3642 gene locus_tag LOCUS_38920 gene ogt2 3310 3642 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_38920 3781 4251 gene locus_tag LOCUS_38930 3781 4251 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522988.1 protein_id gnl|my_center|LOCUS_38930 5462 4248 gene locus_tag LOCUS_38940 5462 4248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 5541 6071 gene locus_tag LOCUS_38950 5541 6071 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760055.1 protein_id gnl|my_center|LOCUS_38950 7075 6068 gene locus_tag LOCUS_38960 7075 6068 CDS product iron(III) ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461276.1 protein_id gnl|my_center|LOCUS_38960 7144 7851 gene locus_tag LOCUS_38970 7144 7851 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_38970 >Feature sequence204 1660 1355 gene locus_tag LOCUS_38980 1660 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 4459 1841 gene locus_tag LOCUS_38990 4459 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 5532 4471 gene locus_tag LOCUS_39000 5532 4471 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917836.1 protein_id gnl|my_center|LOCUS_39000 6776 5529 gene locus_tag LOCUS_39010 gene dctA 6776 5529 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925728.1 protein_id gnl|my_center|LOCUS_39010 <7826 6843 gene locus_tag LOCUS_39020 <7826 6843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919502.1:xylose isomerase >Feature sequence205 2592 1816 gene locus_tag LOCUS_39030 2592 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 2939 2589 gene locus_tag LOCUS_39040 2939 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 3088 4503 gene locus_tag LOCUS_39050 3088 4503 CDS product ATP-dependent exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362006.1 protein_id gnl|my_center|LOCUS_39050 5692 5231 gene locus_tag LOCUS_39060 5692 5231 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_39060 5769 6851 gene locus_tag LOCUS_39070 gene corA-1 5769 6851 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DB7 protein_id gnl|my_center|LOCUS_39070 7376 6852 gene locus_tag LOCUS_39080 7376 6852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 >Feature sequence206 1656 733 gene locus_tag LOCUS_39090 1656 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 2958 1666 gene locus_tag LOCUS_39100 gene pepP 2958 1666 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_39100 3804 2989 gene locus_tag LOCUS_39110 3804 2989 CDS product xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794479.1 protein_id gnl|my_center|LOCUS_39110 4000 4287 gene locus_tag LOCUS_39120 4000 4287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 4289 5692 gene locus_tag LOCUS_39130 gene gatA 4289 5692 CDS product aspartyl/glutamyl-tRNA amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812377.1 protein_id gnl|my_center|LOCUS_39130 >Feature sequence207 2471 1917 gene locus_tag LOCUS_39140 2471 1917 CDS product carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226688.1 protein_id gnl|my_center|LOCUS_39140 3035 2484 gene locus_tag LOCUS_39150 3035 2484 CDS product carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226688.1 protein_id gnl|my_center|LOCUS_39150 3123 3287 gene locus_tag LOCUS_39160 3123 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 4858 5046 gene locus_tag LOCUS_39170 4858 5046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 5427 5101 gene locus_tag LOCUS_39180 5427 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 <7580 5489 gene locus_tag LOCUS_39190 <7580 5489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein >Feature sequence208 2621 3004 gene locus_tag LOCUS_39200 2621 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763504.1 protein_id gnl|my_center|LOCUS_39200 3108 3902 gene locus_tag LOCUS_39210 gene trpC 3108 3902 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ3 protein_id gnl|my_center|LOCUS_39210 3934 4551 gene locus_tag LOCUS_39220 gene trpF 3934 4551 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAD7 protein_id gnl|my_center|LOCUS_39220 4609 5802 gene locus_tag LOCUS_39230 gene trpB 4609 5802 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ1 protein_id gnl|my_center|LOCUS_39230 5803 6261 gene locus_tag LOCUS_39240 5803 6261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 6281 7057 gene locus_tag LOCUS_39250 gene trpA 6281 7057 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ0 protein_id gnl|my_center|LOCUS_39250 >Feature sequence209 438 10 gene locus_tag LOCUS_39260 gene phnB 438 10 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173977.1 protein_id gnl|my_center|LOCUS_39260 882 469 gene locus_tag LOCUS_39270 882 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 1935 1078 gene locus_tag LOCUS_39280 1935 1078 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966735.1 protein_id gnl|my_center|LOCUS_39280 2355 1954 gene locus_tag LOCUS_39290 2355 1954 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528798.1 protein_id gnl|my_center|LOCUS_39290 2867 2427 gene locus_tag LOCUS_39300 2867 2427 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072758.1 protein_id gnl|my_center|LOCUS_39300 3426 3010 gene locus_tag LOCUS_39310 3426 3010 CDS product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966951.1 protein_id gnl|my_center|LOCUS_39310 3651 4619 gene locus_tag LOCUS_39320 3651 4619 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930763.1 protein_id gnl|my_center|LOCUS_39320 4834 6165 gene locus_tag LOCUS_39330 4834 6165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 >Feature sequence210 601 1470 gene locus_tag LOCUS_39340 601 1470 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109261.1 protein_id gnl|my_center|LOCUS_39340 1798 1526 gene locus_tag LOCUS_39350 1798 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39350 2215 1928 gene locus_tag LOCUS_39360 2215 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39360 2763 2395 gene locus_tag LOCUS_39370 2763 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 4608 2962 gene locus_tag LOCUS_39380 4608 2962 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q726H6 protein_id gnl|my_center|LOCUS_39380 <7425 4726 gene locus_tag LOCUS_39390 <7425 4726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q56307:beta-galactosidase >Feature sequence211 4379 2142 gene locus_tag LOCUS_39400 4379 2142 CDS product isoquinoline 1-oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_39400 4852 4397 gene locus_tag LOCUS_39410 4852 4397 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639856.1 protein_id gnl|my_center|LOCUS_39410 6111 4963 gene locus_tag LOCUS_39420 6111 4963 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_39420 7368 6268 gene locus_tag LOCUS_39430 7368 6268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 >Feature sequence212 1691 2410 gene locus_tag LOCUS_39440 1691 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 2979 3521 gene locus_tag LOCUS_39450 2979 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 3542 4051 gene locus_tag LOCUS_39460 3542 4051 CDS product tail Collar domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528764.1 protein_id gnl|my_center|LOCUS_39460 4066 4572 gene locus_tag LOCUS_39470 4066 4572 CDS product tail Collar domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528765.1 protein_id gnl|my_center|LOCUS_39470 4580 5098 gene locus_tag LOCUS_39480 4580 5098 CDS product tail Collar domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528766.1 protein_id gnl|my_center|LOCUS_39480 5099 5602 gene locus_tag LOCUS_39490 5099 5602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 5575 5877 gene locus_tag LOCUS_39500 5575 5877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 >Feature sequence213 3010 1610 gene locus_tag LOCUS_39510 3010 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119396.1 protein_id gnl|my_center|LOCUS_39510 4471 3017 gene locus_tag LOCUS_39520 4471 3017 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326676.1 protein_id gnl|my_center|LOCUS_39520 6587 4476 gene locus_tag LOCUS_39530 6587 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 7176 6862 gene locus_tag LOCUS_39540 7176 6862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 >Feature sequence214 553 1341 gene locus_tag LOCUS_39550 553 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 2604 2858 gene locus_tag LOCUS_39560 2604 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676042.1 protein_id gnl|my_center|LOCUS_39560 2848 3267 gene locus_tag LOCUS_39570 2848 3267 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680561.1 protein_id gnl|my_center|LOCUS_39570 3301 3558 gene locus_tag LOCUS_39580 3301 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39580 3760 4359 gene locus_tag LOCUS_39590 3760 4359 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_39590 4536 5720 gene locus_tag LOCUS_39600 4536 5720 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765765.1 protein_id gnl|my_center|LOCUS_39600 5997 7037 gene locus_tag LOCUS_39610 5997 7037 CDS product luciferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528461.1 protein_id gnl|my_center|LOCUS_39610 >Feature sequence215 41 334 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaattccttcaaggtgcgattaagac 799 536 gene locus_tag LOCUS_39620 gene cas2 799 536 CDS product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T87 protein_id gnl|my_center|LOCUS_39620 1465 812 gene locus_tag LOCUS_39630 1465 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39630 2519 1515 gene locus_tag LOCUS_39640 gene cas1 2519 1515 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T86 protein_id gnl|my_center|LOCUS_39640 3037 2522 gene locus_tag LOCUS_39650 3037 2522 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768968.1 protein_id gnl|my_center|LOCUS_39650 4244 3042 gene locus_tag LOCUS_39660 4244 3042 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_39660 6625 4370 gene locus_tag LOCUS_39670 6625 4370 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065767.1 protein_id gnl|my_center|LOCUS_39670 >Feature sequence216 3069 4250 gene locus_tag LOCUS_39680 3069 4250 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772650.1 protein_id gnl|my_center|LOCUS_39680 4478 4257 gene locus_tag LOCUS_39690 4478 4257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 4867 5067 gene locus_tag LOCUS_39700 4867 5067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 5381 6025 gene locus_tag LOCUS_39710 5381 6025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 6038 6526 gene locus_tag LOCUS_39720 6038 6526 CDS product DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107090.1 protein_id gnl|my_center|LOCUS_39720 >Feature sequence217 1973 2158 gene locus_tag LOCUS_39730 1973 2158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 2936 4531 gene locus_tag LOCUS_39740 2936 4531 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2X1 protein_id gnl|my_center|LOCUS_39740 5750 4536 gene locus_tag LOCUS_39750 gene dinB 5750 4536 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7USY7 protein_id gnl|my_center|LOCUS_39750 5895 6467 gene locus_tag LOCUS_39760 5895 6467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 6976 6874 gene locus_tag LOCUS_r00020 6976 6874 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence218 2602 1694 gene locus_tag LOCUS_39770 gene rnz 2602 1694 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H099 protein_id gnl|my_center|LOCUS_39770 3000 2614 gene locus_tag LOCUS_39780 3000 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 4075 2987 gene locus_tag LOCUS_39790 4075 2987 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202183.1 protein_id gnl|my_center|LOCUS_39790 4143 5063 gene locus_tag LOCUS_39800 4143 5063 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_39800 5060 6187 gene locus_tag LOCUS_39810 5060 6187 CDS product hexosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118866.1 protein_id gnl|my_center|LOCUS_39810 >Feature sequence219 <1 697 gene locus_tag LOCUS_39820 <1 697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64T40:4-diphosphocytidyl-2-C-methyl-D-erythritol kinase 701 1291 gene locus_tag LOCUS_39830 701 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 2037 1288 gene locus_tag LOCUS_39840 2037 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39840 4865 2037 gene locus_tag LOCUS_39850 4865 2037 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962441.1 protein_id gnl|my_center|LOCUS_39850 5072 5761 gene locus_tag LOCUS_39860 gene recO 5072 5761 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZM7 protein_id gnl|my_center|LOCUS_39860 6515 5685 gene locus_tag LOCUS_39870 gene yrpC 6515 5685 CDS product glutamate racemase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05412 protein_id gnl|my_center|LOCUS_39870 >Feature sequence220 1814 249 gene locus_tag LOCUS_39880 gene rny 1814 249 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR0 protein_id gnl|my_center|LOCUS_39880 2159 1875 gene locus_tag LOCUS_39890 2159 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 2569 2177 gene locus_tag LOCUS_39900 2569 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 5005 2582 gene locus_tag LOCUS_39910 gene pheT 5005 2582 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG2 protein_id gnl|my_center|LOCUS_39910 5443 5081 gene locus_tag LOCUS_39920 5443 5081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 >Feature sequence221 552 1112 gene locus_tag LOCUS_39930 552 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 1331 1672 gene locus_tag LOCUS_39940 1331 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 1859 1662 gene locus_tag LOCUS_39950 1859 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 2363 2031 gene locus_tag LOCUS_39960 2363 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39960 3257 3814 gene locus_tag LOCUS_39970 3257 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 4535 3828 gene locus_tag LOCUS_39980 4535 3828 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918603.1 protein_id gnl|my_center|LOCUS_39980 5671 4574 gene locus_tag LOCUS_39990 5671 4574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 >Feature sequence222 1304 3103 gene locus_tag LOCUS_40000 1304 3103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 3100 3729 gene locus_tag LOCUS_40010 3100 3729 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962874.1 protein_id gnl|my_center|LOCUS_40010 3828 4514 gene locus_tag LOCUS_40020 3828 4514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 4527 5114 gene locus_tag LOCUS_40030 4527 5114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 5235 5528 gene locus_tag LOCUS_40040 5235 5528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 >Feature sequence223 404 1753 gene locus_tag LOCUS_40050 404 1753 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765778.1 protein_id gnl|my_center|LOCUS_40050 2433 1759 gene locus_tag LOCUS_40060 2433 1759 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546325.1 protein_id gnl|my_center|LOCUS_40060 2853 3311 gene locus_tag LOCUS_40070 2853 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 3717 3391 gene locus_tag LOCUS_40080 3717 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 4459 3698 gene locus_tag LOCUS_40090 4459 3698 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706646.1 protein_id gnl|my_center|LOCUS_40090 6259 4766 gene locus_tag LOCUS_40100 6259 4766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 >Feature sequence224 523 1095 gene locus_tag LOCUS_40110 523 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 1799 1101 gene locus_tag LOCUS_40120 1799 1101 CDS product chitooligosaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123674.1 protein_id gnl|my_center|LOCUS_40120 2717 1917 gene locus_tag LOCUS_40130 gene proC 2717 1917 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNF3 protein_id gnl|my_center|LOCUS_40130 3336 2941 gene locus_tag LOCUS_40140 3336 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 4443 3550 gene locus_tag LOCUS_40150 4443 3550 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707740.1 protein_id gnl|my_center|LOCUS_40150 4693 6099 gene locus_tag LOCUS_40160 4693 6099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 >Feature sequence225 1222 2385 gene locus_tag LOCUS_40170 1222 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 3800 2760 gene locus_tag LOCUS_40180 3800 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064796.1 protein_id gnl|my_center|LOCUS_40180 5543 3960 gene locus_tag LOCUS_40190 5543 3960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 >Feature sequence226 <1 1267 gene locus_tag LOCUS_40200 <1 1267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108596.1:sodium:solute symporter 2785 1436 gene locus_tag LOCUS_40210 2785 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 3175 3315 gene locus_tag LOCUS_40220 3175 3315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 3306 3470 gene locus_tag LOCUS_40230 3306 3470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 4280 3639 gene locus_tag LOCUS_40240 gene msrA 4280 3639 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53W34 protein_id gnl|my_center|LOCUS_40240 5549 4287 gene locus_tag LOCUS_40250 gene kynU 5549 4287 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WK35 protein_id gnl|my_center|LOCUS_40250 >Feature sequence227 392 2137 gene locus_tag LOCUS_40260 392 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107945.1 protein_id gnl|my_center|LOCUS_40260 2453 4528 gene locus_tag LOCUS_40270 2453 4528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40270 4697 5011 gene locus_tag LOCUS_40280 4697 5011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 5125 5643 gene locus_tag LOCUS_40290 5125 5643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 >Feature sequence228 2067 1552 gene locus_tag LOCUS_40300 2067 1552 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639856.1 protein_id gnl|my_center|LOCUS_40300 4599 2137 gene locus_tag LOCUS_40310 gene mur/alr 4599 2137 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963209.1 protein_id gnl|my_center|LOCUS_40310 4682 5473 gene locus_tag LOCUS_40320 gene tatD 4682 5473 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260929.1 protein_id gnl|my_center|LOCUS_40320 >Feature sequence229 965 600 gene locus_tag LOCUS_40330 965 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 4575 2101 gene locus_tag LOCUS_40340 4575 2101 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797373.1 protein_id gnl|my_center|LOCUS_40340 <5896 4820 gene locus_tag LOCUS_40350 <5896 4820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964222.1:malic enzyme >Feature sequence230 93 614 gene locus_tag LOCUS_40360 93 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963698.1 protein_id gnl|my_center|LOCUS_40360 607 1059 gene locus_tag LOCUS_40370 607 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 2087 1116 gene locus_tag LOCUS_40380 2087 1116 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964564.1 protein_id gnl|my_center|LOCUS_40380 3416 2103 gene locus_tag LOCUS_40390 3416 2103 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405413.1 protein_id gnl|my_center|LOCUS_40390 3927 4553 gene locus_tag LOCUS_40400 3927 4553 CDS product twin-arginine translocation pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383266.1 protein_id gnl|my_center|LOCUS_40400 >Feature sequence231 1830 805 gene locus_tag LOCUS_40410 1830 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 3767 2301 gene locus_tag LOCUS_40420 3767 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 4239 3856 gene locus_tag LOCUS_40430 4239 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 4680 4312 gene locus_tag LOCUS_40440 4680 4312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 4943 5590 gene locus_tag LOCUS_40450 gene rpe 4943 5590 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H188 protein_id gnl|my_center|LOCUS_40450 >Feature sequence232 731 1318 gene locus_tag LOCUS_40460 731 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 2052 1348 gene locus_tag LOCUS_40470 2052 1348 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_40470 2485 2054 gene locus_tag LOCUS_40480 2485 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 4032 2599 gene locus_tag LOCUS_40490 gene ccoG 4032 2599 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963297.1 protein_id gnl|my_center|LOCUS_40490 5067 4234 gene locus_tag LOCUS_40500 5067 4234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 5301 5137 gene locus_tag LOCUS_40510 5301 5137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 >Feature sequence233 214 762 gene locus_tag LOCUS_40520 214 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 822 1061 gene locus_tag LOCUS_40530 822 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 1134 1481 gene locus_tag LOCUS_40540 1134 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 2902 1478 gene locus_tag LOCUS_40550 gene putA 2902 1478 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7S5 protein_id gnl|my_center|LOCUS_40550 3744 2899 gene locus_tag LOCUS_40560 3744 2899 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453865.1 protein_id gnl|my_center|LOCUS_40560 4045 3830 gene locus_tag LOCUS_40570 4045 3830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 <5691 4060 gene locus_tag LOCUS_40580 <5691 4060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765859.1:copper-translocating P-type ATPase >Feature sequence234 <1 786 gene locus_tag LOCUS_40590 <1 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8F937:glycine dehydrogenase (decarboxylating) 845 1825 gene locus_tag LOCUS_40600 845 1825 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765632.1 protein_id gnl|my_center|LOCUS_40600 1809 2420 gene locus_tag LOCUS_40610 1809 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 2417 2851 gene locus_tag LOCUS_40620 2417 2851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 3176 4465 gene locus_tag LOCUS_40630 gene MET17 3176 4465 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124952.1 protein_id gnl|my_center|LOCUS_40630 4479 5522 gene locus_tag LOCUS_40640 gene metX 4479 5522 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S5A6 protein_id gnl|my_center|LOCUS_40640 >Feature sequence235 <1 1087 gene locus_tag LOCUS_40650 <1 1087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964509.1:rod shape-determining protein RodA 1104 1799 gene locus_tag LOCUS_40660 1104 1799 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764403.1 protein_id gnl|my_center|LOCUS_40660 2383 1796 gene locus_tag LOCUS_40670 gene aat 2383 1796 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFI0 protein_id gnl|my_center|LOCUS_40670 2925 2386 gene locus_tag LOCUS_40680 gene pyrR1 2925 2386 CDS product bifunctional pyrimidine operon regulatory protein/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 protein_id gnl|my_center|LOCUS_40680 3090 3650 gene locus_tag LOCUS_40690 gene pth 3090 3650 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X30 protein_id gnl|my_center|LOCUS_40690 3898 4362 gene locus_tag LOCUS_40700 3898 4362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 5005 5081 gene locus_tag LOCUS_t00300 5005 5081 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence236 1536 544 gene locus_tag LOCUS_40710 1536 544 CDS product glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098184.1 protein_id gnl|my_center|LOCUS_40710 2701 1652 gene locus_tag LOCUS_40720 2701 1652 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968596.1 protein_id gnl|my_center|LOCUS_40720 2797 3816 gene locus_tag LOCUS_40730 gene hemE 2797 3816 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN8 protein_id gnl|my_center|LOCUS_40730 3819 4370 gene locus_tag LOCUS_40740 3819 4370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 4453 5070 gene locus_tag LOCUS_40750 4453 5070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 >Feature sequence237 505 188 gene locus_tag LOCUS_40760 505 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 1649 603 gene locus_tag LOCUS_40770 1649 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 2721 1801 gene locus_tag LOCUS_40780 2721 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 4800 2782 gene locus_tag LOCUS_40790 4800 2782 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_40790 >Feature sequence238 >Feature sequence239 1155 457 gene locus_tag LOCUS_40800 gene folE2 1155 457 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX79 protein_id gnl|my_center|LOCUS_40800 1552 1136 gene locus_tag LOCUS_40810 gene ygcM 1552 1136 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I4 protein_id gnl|my_center|LOCUS_40810 2136 3479 gene locus_tag LOCUS_40820 gene nagA 2136 3479 CDS product alpha-N-acetylgalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECL7 protein_id gnl|my_center|LOCUS_40820 3492 4472 gene locus_tag LOCUS_40830 3492 4472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40830 <5094 4464 gene locus_tag LOCUS_40840 <5094 4464 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8ABA9:histidinol dehydrogenase >Feature sequence240 320 802 gene locus_tag LOCUS_40850 320 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40850 2654 858 gene locus_tag LOCUS_40860 2654 858 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963836.1 protein_id gnl|my_center|LOCUS_40860 4613 2769 gene locus_tag LOCUS_40870 4613 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40870 >Feature sequence241 1571 222 gene locus_tag LOCUS_40880 1571 222 CDS product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962590.1 protein_id gnl|my_center|LOCUS_40880 3240 1582 gene locus_tag LOCUS_40890 3240 1582 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962591.1 protein_id gnl|my_center|LOCUS_40890 3917 3243 gene locus_tag LOCUS_40900 3917 3243 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962592.1 protein_id gnl|my_center|LOCUS_40900 4468 4151 gene locus_tag LOCUS_40910 4468 4151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 >Feature sequence242 <1 784 gene locus_tag LOCUS_40920 <1 784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005808330.1:pyridine nucleotide-disulfide oxidoreductase 784 2277 gene locus_tag LOCUS_40930 784 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 2657 2283 gene locus_tag LOCUS_40940 2657 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40940 3394 3077 gene locus_tag LOCUS_40950 3394 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40950 3832 4122 gene locus_tag LOCUS_40960 3832 4122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40960 >Feature sequence243 1027 1506 gene locus_tag LOCUS_40970 1027 1506 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941998.1 protein_id gnl|my_center|LOCUS_40970 1648 2127 gene locus_tag LOCUS_40980 1648 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 2127 2720 gene locus_tag LOCUS_40990 2127 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965936.1 protein_id gnl|my_center|LOCUS_40990 3204 3845 gene locus_tag LOCUS_41000 3204 3845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 4010 4408 gene locus_tag LOCUS_41010 4010 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 >Feature sequence244 347 562 gene locus_tag LOCUS_41020 347 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41020 1514 945 gene locus_tag LOCUS_41030 1514 945 CDS product heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_296358.1 protein_id gnl|my_center|LOCUS_41030 1649 3850 gene locus_tag LOCUS_41040 1649 3850 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971984.1 protein_id gnl|my_center|LOCUS_41040 4498 3899 gene locus_tag LOCUS_41050 4498 3899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41050 >Feature sequence245 2060 1650 gene locus_tag LOCUS_41060 2060 1650 CDS product sulfur reductase DrsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978085.1 protein_id gnl|my_center|LOCUS_41060 3110 2064 gene locus_tag LOCUS_41070 3110 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 4302 3226 gene locus_tag LOCUS_41080 4302 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 >Feature sequence246 <1 560 gene locus_tag LOCUS_41090 <1 560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943650.1:glycosyl transferase 573 1304 gene locus_tag LOCUS_41100 573 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41100 1318 2412 gene locus_tag LOCUS_41110 1318 2412 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202631.1 protein_id gnl|my_center|LOCUS_41110 2409 3626 gene locus_tag LOCUS_41120 2409 3626 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108541.1 protein_id gnl|my_center|LOCUS_41120 <4618 3636 gene locus_tag LOCUS_41130 <4618 3636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250770.1:capsular polysaccharide biosynthesis protein >Feature sequence247 633 358 gene locus_tag LOCUS_41140 633 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 874 626 gene locus_tag LOCUS_41150 874 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41150 2322 1036 gene locus_tag LOCUS_41160 2322 1036 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706833.1 protein_id gnl|my_center|LOCUS_41160 3653 2379 gene locus_tag LOCUS_41170 3653 2379 CDS product L-rhamnose catabolism isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533596.1 protein_id gnl|my_center|LOCUS_41170 4610 3732 gene locus_tag LOCUS_41180 4610 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 >Feature sequence248 1129 59 gene locus_tag LOCUS_41190 1129 59 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963343.1 protein_id gnl|my_center|LOCUS_41190 >Feature sequence249 532 86 gene locus_tag LOCUS_41200 gene mscL 532 86 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZV7 protein_id gnl|my_center|LOCUS_41200 657 938 gene locus_tag LOCUS_41210 657 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887568.1 protein_id gnl|my_center|LOCUS_41210 948 2162 gene locus_tag LOCUS_41220 948 2162 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404271.1 protein_id gnl|my_center|LOCUS_41220 2155 3609 gene locus_tag LOCUS_41230 gene opuD 2155 3609 CDS product glycine/betaine ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230127.1 protein_id gnl|my_center|LOCUS_41230 >Feature sequence250 1457 2476 gene locus_tag LOCUS_41240 1457 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41240 >Feature sequence251 2751 3782 gene locus_tag LOCUS_41250 2751 3782 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658101.1 protein_id gnl|my_center|LOCUS_41250 <4311 3775 gene locus_tag LOCUS_41260 <4311 3775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011102291.1:amidohydrolase >Feature sequence252 955 269 gene locus_tag LOCUS_41270 gene nth 955 269 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64R69 protein_id gnl|my_center|LOCUS_41270 1788 1006 gene locus_tag LOCUS_41280 1788 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361984.1 protein_id gnl|my_center|LOCUS_41280 2972 1869 gene locus_tag LOCUS_41290 2972 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_41290 3368 3284 gene locus_tag LOCUS_t00310 3368 3284 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3536 4111 gene locus_tag LOCUS_41300 3536 4111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41300 >Feature sequence253 2030 195 gene locus_tag LOCUS_41310 gene susA 2030 195 CDS product neopullulanase SusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1G0 protein_id gnl|my_center|LOCUS_41310 3403 2105 gene locus_tag LOCUS_41320 3403 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 <4236 3425 gene locus_tag LOCUS_41330 <4236 3425 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403138.1:outer membrane protein >Feature sequence254 62 586 gene locus_tag LOCUS_41340 62 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41340 662 829 gene locus_tag LOCUS_41350 662 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41350 1090 1719 gene locus_tag LOCUS_41360 1090 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 >Feature sequence255 922 32 gene locus_tag LOCUS_41370 922 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 3775 965 gene locus_tag LOCUS_41380 3775 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 >Feature sequence256 2389 908 gene locus_tag LOCUS_41390 2389 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 3727 2495 gene locus_tag LOCUS_41400 3727 2495 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 protein_id gnl|my_center|LOCUS_41400 >Feature sequence257 252 833 gene locus_tag LOCUS_41410 252 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41410 830 1417 gene locus_tag LOCUS_41420 830 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 2868 1579 gene locus_tag LOCUS_41430 2868 1579 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119292.1 protein_id gnl|my_center|LOCUS_41430 >Feature sequence258 1129 785 gene locus_tag LOCUS_41440 1129 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 1665 1132 gene locus_tag LOCUS_41450 1665 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41450 1715 2149 gene locus_tag LOCUS_41460 1715 2149 CDS product HxlR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530730.1 protein_id gnl|my_center|LOCUS_41460 2695 2276 gene locus_tag LOCUS_41470 2695 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 >Feature sequence259 1832 2428 gene locus_tag LOCUS_41480 1832 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036017.1 protein_id gnl|my_center|LOCUS_41480 2490 3197 gene locus_tag LOCUS_41490 2490 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 >Feature sequence260 1633 965 gene locus_tag LOCUS_41500 1633 965 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030700.1 protein_id gnl|my_center|LOCUS_41500 2526 1768 gene locus_tag LOCUS_41510 2526 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 >Feature sequence261 >Feature sequence262 701 1378 gene locus_tag LOCUS_41520 701 1378 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107524.1 protein_id gnl|my_center|LOCUS_41520 1375 2640 gene locus_tag LOCUS_41530 1375 2640 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788537.1 protein_id gnl|my_center|LOCUS_41530 <3434 2618 gene locus_tag LOCUS_41540 <3434 2618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786996.1:peptidase S41 >Feature sequence263 <1 600 gene locus_tag LOCUS_41550 <1 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963406.1:capsular polysaccharide biosynthesis protein 694 1221 gene locus_tag LOCUS_41560 694 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 1974 1255 gene locus_tag LOCUS_41570 gene pcrB 1974 1255 CDS product geranylgeranylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW30 protein_id gnl|my_center|LOCUS_41570 2146 3084 gene locus_tag LOCUS_41580 2146 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41580 >Feature sequence264 2368 1292 gene locus_tag LOCUS_41590 2368 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 >Feature sequence265 378 875 gene locus_tag LOCUS_41600 378 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41600 1030 2406 gene locus_tag LOCUS_41610 1030 2406 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119292.1 protein_id gnl|my_center|LOCUS_41610 >Feature sequence266 732 2528 gene locus_tag LOCUS_41620 732 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 <3194 2512 gene locus_tag LOCUS_41630 <3194 2512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036959.1:membrane protein >Feature sequence267 <1 711 gene locus_tag LOCUS_41640 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A0V3:pyridoxine 5'-phosphate synthase 1211 717 gene locus_tag LOCUS_41650 1211 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41650 1558 1247 gene locus_tag LOCUS_41660 1558 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41660 2372 1746 gene locus_tag LOCUS_41670 2372 1746 CDS product photosynthetic protein synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049241.1 protein_id gnl|my_center|LOCUS_41670 >Feature sequence268 972 286 gene locus_tag LOCUS_41680 972 286 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405245.1 protein_id gnl|my_center|LOCUS_41680 1940 1191 gene locus_tag LOCUS_41690 1940 1191 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405245.1 protein_id gnl|my_center|LOCUS_41690 2142 2696 gene locus_tag LOCUS_41700 2142 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41700 >Feature sequence269 <1 1396 gene locus_tag LOCUS_41710 <1 1396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404127.1:aminopeptidase 1764 1414 gene locus_tag LOCUS_41720 gene folB 1764 1414 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H1 protein_id gnl|my_center|LOCUS_41720 <2846 1779 gene locus_tag LOCUS_41730 <2846 1779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H1P9:50S ribosomal protein L21 >Feature sequence270 2266 2619 gene locus_tag LOCUS_41740 2266 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41740 >Feature sequence271 1314 823 gene locus_tag LOCUS_41750 1314 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41750 1864 1319 gene locus_tag LOCUS_41760 1864 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 2090 2428 gene locus_tag LOCUS_41770 gene phnA 2090 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061594.1 protein_id gnl|my_center|LOCUS_41770 2633 2502 gene locus_tag LOCUS_41780 2633 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 >Feature sequence272 1598 579 gene locus_tag LOCUS_41790 1598 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 2602 1595 gene locus_tag LOCUS_41800 2602 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 >Feature sequence273 102 1058 gene locus_tag LOCUS_41810 102 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 1065 1697 gene locus_tag LOCUS_41820 1065 1697 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF82 protein_id gnl|my_center|LOCUS_41820 >Feature sequence274 <1 855 gene locus_tag LOCUS_41830 <1 855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939508.1:alpha/beta hydrolase <2379 926 gene locus_tag LOCUS_41840 <2379 926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963618.1:TonB-dependent receptor >Feature sequence275 981 1151 gene locus_tag LOCUS_41850 981 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 >Feature sequence276 <1 939 gene locus_tag LOCUS_41860 <1 939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788070.1:23S rRNA (uracil-5-)-methyltransferase RumA <2070 936 gene locus_tag LOCUS_41870 <2070 936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GX96:replicative DNA helicase >Feature sequence277 >Feature sequence278 1067 1366 gene locus_tag LOCUS_41880 1067 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41880 1363 1650 gene locus_tag LOCUS_41890 1363 1650 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478800.1 protein_id gnl|my_center|LOCUS_41890 >Feature sequence279