>Feature sequence0001 307 1587 gene locus_tag LOCUS_00010 307 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1858 1577 gene locus_tag LOCUS_00020 1858 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2793 1855 gene locus_tag LOCUS_00030 2793 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3146 2793 gene locus_tag LOCUS_00040 3146 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3544 3143 gene locus_tag LOCUS_00050 3544 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 3799 3990 gene locus_tag LOCUS_00060 3799 3990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 5365 4469 gene locus_tag LOCUS_00070 5365 4469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 5809 5372 gene locus_tag LOCUS_00080 5809 5372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 5902 6246 gene locus_tag LOCUS_00090 5902 6246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 6239 6697 gene locus_tag LOCUS_00100 6239 6697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 6694 7464 gene locus_tag LOCUS_00110 6694 7464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 7711 8904 gene locus_tag LOCUS_00120 7711 8904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 9182 10183 gene locus_tag LOCUS_00130 9182 10183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 10180 12144 gene locus_tag LOCUS_00140 10180 12144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 12144 13097 gene locus_tag LOCUS_00150 12144 13097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 14562 14768 gene locus_tag LOCUS_00160 14562 14768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 14765 15412 gene locus_tag LOCUS_00170 14765 15412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 15445 16977 gene locus_tag LOCUS_00180 15445 16977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 17054 18058 gene locus_tag LOCUS_00190 17054 18058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 18040 18927 gene locus_tag LOCUS_00200 18040 18927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 18936 19328 gene locus_tag LOCUS_00210 18936 19328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 19330 20337 gene locus_tag LOCUS_00220 19330 20337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339629.1 protein_id gnl|my_center|LOCUS_00220 20334 20942 gene locus_tag LOCUS_00230 20334 20942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 21172 20948 gene locus_tag LOCUS_00240 21172 20948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 21341 21568 gene locus_tag LOCUS_00250 21341 21568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 21730 22329 gene locus_tag LOCUS_00260 21730 22329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 22357 22521 gene locus_tag LOCUS_00270 22357 22521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 22598 23284 gene locus_tag LOCUS_00280 22598 23284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 23281 23592 gene locus_tag LOCUS_00290 23281 23592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 23589 23864 gene locus_tag LOCUS_00300 23589 23864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 23867 24643 gene locus_tag LOCUS_00310 23867 24643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 24652 25242 gene locus_tag LOCUS_00320 24652 25242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 25266 26123 gene locus_tag LOCUS_00330 25266 26123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 26398 29625 gene locus_tag LOCUS_00340 26398 29625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 29622 29801 gene locus_tag LOCUS_00350 29622 29801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 29905 30462 gene locus_tag LOCUS_00360 29905 30462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 30469 30813 gene locus_tag LOCUS_00370 30469 30813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 30818 31057 gene locus_tag LOCUS_00380 30818 31057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 31057 31287 gene locus_tag LOCUS_00390 31057 31287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 31573 31289 gene locus_tag LOCUS_00400 31573 31289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 31822 32676 gene locus_tag LOCUS_00410 31822 32676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 32677 33660 gene locus_tag LOCUS_00420 32677 33660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004566292.1 protein_id gnl|my_center|LOCUS_00420 33664 34653 gene locus_tag LOCUS_00430 33664 34653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 34653 35132 gene locus_tag LOCUS_00440 34653 35132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 35135 35692 gene locus_tag LOCUS_00450 35135 35692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 35696 36181 gene locus_tag LOCUS_00460 35696 36181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 36175 36618 gene locus_tag LOCUS_00470 36175 36618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 36618 37511 gene locus_tag LOCUS_00480 36618 37511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 37577 37840 gene locus_tag LOCUS_00490 37577 37840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 37837 38634 gene locus_tag LOCUS_00500 37837 38634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 38644 39078 gene locus_tag LOCUS_00510 38644 39078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 39088 39852 gene locus_tag LOCUS_00520 39088 39852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 39933 40307 gene locus_tag LOCUS_00530 39933 40307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 40309 46548 gene locus_tag LOCUS_00540 40309 46548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 46548 48953 gene locus_tag LOCUS_00550 46548 48953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 48956 49786 gene locus_tag LOCUS_00560 48956 49786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 49787 50278 gene locus_tag LOCUS_00570 49787 50278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 50410 50955 gene locus_tag LOCUS_00580 50410 50955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 50952 52340 gene locus_tag LOCUS_00590 50952 52340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 52337 53794 gene locus_tag LOCUS_00600 52337 53794 CDS product large terminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003587.1 protein_id gnl|my_center|LOCUS_00600 53795 55252 gene locus_tag LOCUS_00610 53795 55252 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816192.1 protein_id gnl|my_center|LOCUS_00610 55268 60373 gene locus_tag LOCUS_00620 55268 60373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 >Feature sequence0002 <1 1557 gene locus_tag LOCUS_00630 <1 1557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001702460.1:putative histidine kinase sensor of two-component system 1573 2931 gene locus_tag LOCUS_00640 1573 2931 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941974.1 protein_id gnl|my_center|LOCUS_00640 3191 3919 gene locus_tag LOCUS_00650 3191 3919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 4060 4578 gene locus_tag LOCUS_00660 4060 4578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 4657 5520 gene locus_tag LOCUS_00670 4657 5520 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223594.1 protein_id gnl|my_center|LOCUS_00670 5517 5807 gene locus_tag LOCUS_00680 5517 5807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 5918 6418 gene locus_tag LOCUS_00690 5918 6418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 8468 6480 gene locus_tag LOCUS_00700 8468 6480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 8919 10289 gene locus_tag LOCUS_00710 8919 10289 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141364.1 protein_id gnl|my_center|LOCUS_00710 11288 10317 gene locus_tag LOCUS_00720 11288 10317 CDS product NADP-dependent aryl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198121.1 protein_id gnl|my_center|LOCUS_00720 13049 11301 gene locus_tag LOCUS_00730 13049 11301 CDS product putative aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705270.1 protein_id gnl|my_center|LOCUS_00730 13425 15551 gene locus_tag LOCUS_00740 13425 15551 CDS product alpha-1,4 glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG52 protein_id gnl|my_center|LOCUS_00740 >Feature sequence0003 463 666 gene locus_tag LOCUS_00750 463 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 660 965 gene locus_tag LOCUS_00760 660 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 1243 1037 gene locus_tag LOCUS_00770 1243 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 1545 1273 gene locus_tag LOCUS_00780 1545 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 3137 2082 gene locus_tag LOCUS_00790 gene xerD 3137 2082 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92ME3 protein_id gnl|my_center|LOCUS_00790 3521 4273 gene locus_tag LOCUS_00800 3521 4273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 4270 6387 gene locus_tag LOCUS_00810 4270 6387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 6384 7802 gene locus_tag LOCUS_00820 6384 7802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 7799 9454 gene locus_tag LOCUS_00830 7799 9454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 9475 9957 gene locus_tag LOCUS_00840 9475 9957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 10005 11012 gene locus_tag LOCUS_00850 10005 11012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 11067 11444 gene locus_tag LOCUS_00860 11067 11444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 11444 11890 gene locus_tag LOCUS_00870 11444 11890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 11894 12367 gene locus_tag LOCUS_00880 11894 12367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 12364 12909 gene locus_tag LOCUS_00890 12364 12909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 12925 14316 gene locus_tag LOCUS_00900 12925 14316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 14328 14993 gene locus_tag LOCUS_00910 14328 14993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 >Feature sequence0004 2429 1284 gene locus_tag LOCUS_00920 2429 1284 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942781.1 protein_id gnl|my_center|LOCUS_00920 2373 2585 gene locus_tag LOCUS_00930 2373 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 3853 2555 gene locus_tag LOCUS_00940 3853 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142450.1 protein_id gnl|my_center|LOCUS_00940 4192 4323 gene locus_tag LOCUS_00950 4192 4323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 5043 5432 gene locus_tag LOCUS_00960 5043 5432 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546202.1 protein_id gnl|my_center|LOCUS_00960 7919 5559 gene locus_tag LOCUS_00970 7919 5559 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402954.1 protein_id gnl|my_center|LOCUS_00970 9650 8541 gene locus_tag LOCUS_00980 9650 8541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 12048 9664 gene locus_tag LOCUS_00990 12048 9664 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528058.1 protein_id gnl|my_center|LOCUS_00990 12548 12123 gene locus_tag LOCUS_01000 12548 12123 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429838.1 protein_id gnl|my_center|LOCUS_01000 13766 12567 gene locus_tag LOCUS_01010 13766 12567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405182.1 protein_id gnl|my_center|LOCUS_01010 14293 13823 gene locus_tag LOCUS_01020 14293 13823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 >Feature sequence0005 1745 1143 gene locus_tag LOCUS_01030 1745 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 3223 1847 gene locus_tag LOCUS_01040 3223 1847 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939137.1 protein_id gnl|my_center|LOCUS_01040 4335 3892 gene locus_tag LOCUS_01050 4335 3892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 5928 4390 gene locus_tag LOCUS_01060 5928 4390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 11995 6185 gene locus_tag LOCUS_01070 11995 6185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113834.1 protein_id gnl|my_center|LOCUS_01070 14510 12453 gene locus_tag LOCUS_01080 14510 12453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975548.1 protein_id gnl|my_center|LOCUS_01080 >Feature sequence0006 <1 1809 gene locus_tag LOCUS_01090 <1 1809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q747S2:Lon protease 1799 2803 gene locus_tag LOCUS_01100 gene thiL 1799 2803 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX7 protein_id gnl|my_center|LOCUS_01100 3789 3067 gene locus_tag LOCUS_01110 3789 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 7998 4621 gene locus_tag LOCUS_01120 7998 4621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 9311 7995 gene locus_tag LOCUS_01130 gene aroA2 9311 7995 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L213 protein_id gnl|my_center|LOCUS_01130 9843 9289 gene locus_tag LOCUS_01140 9843 9289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 9899 10165 gene locus_tag LOCUS_01150 9899 10165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 10523 12577 gene locus_tag LOCUS_01160 gene uvrD 10523 12577 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F454 protein_id gnl|my_center|LOCUS_01160 13109 12633 gene locus_tag LOCUS_01170 13109 12633 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229486.1 protein_id gnl|my_center|LOCUS_01170 >Feature sequence0007 3776 501 gene locus_tag LOCUS_01180 3776 501 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258002.1 protein_id gnl|my_center|LOCUS_01180 4491 3829 gene locus_tag LOCUS_01190 4491 3829 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258004.1 protein_id gnl|my_center|LOCUS_01190 7464 5026 gene locus_tag LOCUS_01200 7464 5026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141418.1 protein_id gnl|my_center|LOCUS_01200 9113 7677 gene locus_tag LOCUS_01210 9113 7677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 10554 9313 gene locus_tag LOCUS_01220 gene ftsA 10554 9313 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748E0 protein_id gnl|my_center|LOCUS_01220 12126 10576 gene locus_tag LOCUS_01230 12126 10576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 >Feature sequence0008 2826 1804 gene locus_tag LOCUS_01240 2826 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 4371 2869 gene locus_tag LOCUS_01250 4371 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 6233 4407 gene locus_tag LOCUS_01260 6233 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 6503 6591 gene locus_tag LOCUS_t00010 6503 6591 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7105 7983 gene locus_tag LOCUS_01270 7105 7983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 8199 9272 gene locus_tag LOCUS_01280 8199 9272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 10613 9411 gene locus_tag LOCUS_01290 10613 9411 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393486.1 protein_id gnl|my_center|LOCUS_01290 10815 11165 gene locus_tag LOCUS_01300 gene fbp 10815 11165 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63J95 protein_id gnl|my_center|LOCUS_01300 >Feature sequence0009 847 512 gene locus_tag LOCUS_01310 847 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 1222 2454 gene locus_tag LOCUS_01320 1222 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 2439 3125 gene locus_tag LOCUS_01330 2439 3125 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAJ7 protein_id gnl|my_center|LOCUS_01330 3115 3864 gene locus_tag LOCUS_01340 3115 3864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 4280 4531 gene locus_tag LOCUS_01350 4280 4531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 4528 6168 gene locus_tag LOCUS_01360 4528 6168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 6668 8023 gene locus_tag LOCUS_01370 6668 8023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 8932 8303 gene locus_tag LOCUS_01380 8932 8303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 <11815 8929 gene locus_tag LOCUS_01390 <11815 8929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259063.1:sugar-binding protein >Feature sequence0010 1225 809 gene locus_tag LOCUS_01400 1225 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 1423 1839 gene locus_tag LOCUS_01410 1423 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391102.1 protein_id gnl|my_center|LOCUS_01410 2595 1861 gene locus_tag LOCUS_01420 2595 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 3010 2639 gene locus_tag LOCUS_01430 3010 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 3035 3301 gene locus_tag LOCUS_01440 3035 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 3313 4521 gene locus_tag LOCUS_01450 3313 4521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 5606 4533 gene locus_tag LOCUS_01460 5606 4533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 6053 5619 gene locus_tag LOCUS_01470 6053 5619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 6677 6240 gene locus_tag LOCUS_01480 gene dut 6677 6240 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S160 protein_id gnl|my_center|LOCUS_01480 7609 6674 gene locus_tag LOCUS_01490 7609 6674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 8043 7603 gene locus_tag LOCUS_01500 gene oxpG 8043 7603 CDS product type II secretion system pseudopilin OxpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942420.1 protein_id gnl|my_center|LOCUS_01500 8588 8103 gene locus_tag LOCUS_01510 gene pulG 8588 8103 CDS product type II secretion system pseudopilin PulG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942421.1 protein_id gnl|my_center|LOCUS_01510 10605 8689 gene locus_tag LOCUS_01520 10605 8689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 >Feature sequence0011 <1 792 gene locus_tag LOCUS_01530 <1 792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003092007.1:rhamnosyltransferase subunit B 2159 795 gene locus_tag LOCUS_01540 2159 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 2384 3916 gene locus_tag LOCUS_01550 2384 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 4028 4864 gene locus_tag LOCUS_01560 4028 4864 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_01560 4872 6074 gene locus_tag LOCUS_01570 4872 6074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861504.1 protein_id gnl|my_center|LOCUS_01570 6284 8104 gene locus_tag LOCUS_01580 6284 8104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 9709 8180 gene locus_tag LOCUS_01590 9709 8180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057239.1 protein_id gnl|my_center|LOCUS_01590 <10999 9856 gene locus_tag LOCUS_01600 <10999 9856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706588.1:aromatic amino acid aminotransferase >Feature sequence0012 96 1649 gene locus_tag LOCUS_01610 96 1649 CDS product 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391777.1 protein_id gnl|my_center|LOCUS_01610 1716 3626 gene locus_tag LOCUS_01620 1716 3626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 4223 3825 gene locus_tag LOCUS_01630 4223 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 5707 4430 gene locus_tag LOCUS_01640 5707 4430 CDS product diacylglycerol O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D3K1 protein_id gnl|my_center|LOCUS_01640 <10907 5709 gene locus_tag LOCUS_01650 <10907 5709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011726922.1:polyketide synthase >Feature sequence0013 2912 726 gene locus_tag LOCUS_01660 2912 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 3459 2989 gene locus_tag LOCUS_01670 3459 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 3694 6159 gene locus_tag LOCUS_01680 3694 6159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 6508 7530 gene locus_tag LOCUS_01690 6508 7530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 9836 7614 gene locus_tag LOCUS_01700 9836 7614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 10740 10237 gene locus_tag LOCUS_01710 10740 10237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 >Feature sequence0014 495 929 gene locus_tag LOCUS_01720 495 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483188.1 protein_id gnl|my_center|LOCUS_01720 3411 1021 gene locus_tag LOCUS_01730 3411 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 4328 3471 gene locus_tag LOCUS_01740 4328 3471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 6173 4335 gene locus_tag LOCUS_01750 gene mmgC 6173 4335 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085442.1 protein_id gnl|my_center|LOCUS_01750 6236 6439 gene locus_tag LOCUS_01760 6236 6439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 6469 6687 gene locus_tag LOCUS_01770 6469 6687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 7066 7494 gene locus_tag LOCUS_01780 7066 7494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 8884 7472 gene locus_tag LOCUS_01790 8884 7472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 9993 8881 gene locus_tag LOCUS_01800 9993 8881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 >Feature sequence0015 2432 588 gene locus_tag LOCUS_01810 2432 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 2811 4088 gene locus_tag LOCUS_01820 2811 4088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 4525 4352 gene locus_tag LOCUS_01830 4525 4352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 4551 6443 gene locus_tag LOCUS_01840 4551 6443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 9495 6535 gene locus_tag LOCUS_01850 9495 6535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 >Feature sequence0016 2966 1128 gene locus_tag LOCUS_01860 2966 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072522.1 protein_id gnl|my_center|LOCUS_01860 3783 3142 gene locus_tag LOCUS_01870 3783 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 3944 4825 gene locus_tag LOCUS_01880 3944 4825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 6098 4923 gene locus_tag LOCUS_01890 6098 4923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 6643 6257 gene locus_tag LOCUS_01900 6643 6257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86237 protein_id gnl|my_center|LOCUS_01900 7061 6801 gene locus_tag LOCUS_01910 7061 6801 CDS product NrdH-redoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728032.1 protein_id gnl|my_center|LOCUS_01910 8144 7356 gene locus_tag LOCUS_01920 8144 7356 CDS product glucose-1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947852.1 protein_id gnl|my_center|LOCUS_01920 8983 8384 gene locus_tag LOCUS_01930 8983 8384 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957824.1 protein_id gnl|my_center|LOCUS_01930 10251 9088 gene locus_tag LOCUS_01940 10251 9088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 >Feature sequence0017 921 2534 gene locus_tag LOCUS_01950 921 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 3085 3429 gene locus_tag LOCUS_01960 3085 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 3451 4152 gene locus_tag LOCUS_01970 3451 4152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 4149 4550 gene locus_tag LOCUS_01980 4149 4550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 4766 5323 gene locus_tag LOCUS_01990 4766 5323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 5863 7494 gene locus_tag LOCUS_02000 5863 7494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 7753 9369 gene locus_tag LOCUS_02010 7753 9369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 >Feature sequence0018 864 1631 gene locus_tag LOCUS_02020 864 1631 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932563.1 protein_id gnl|my_center|LOCUS_02020 1638 2105 gene locus_tag LOCUS_02030 1638 2105 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055869.1 protein_id gnl|my_center|LOCUS_02030 3101 2319 gene locus_tag LOCUS_02040 3101 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02040 3800 3171 gene locus_tag LOCUS_02050 3800 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 4233 4799 gene locus_tag LOCUS_02060 4233 4799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 4844 5344 gene locus_tag LOCUS_02070 4844 5344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 6253 5468 gene locus_tag LOCUS_02080 6253 5468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 6397 7161 gene locus_tag LOCUS_02090 6397 7161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 7447 7854 gene locus_tag LOCUS_02100 7447 7854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 8037 9170 gene locus_tag LOCUS_02110 8037 9170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 >Feature sequence0019 1404 205 gene locus_tag LOCUS_02120 1404 205 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941822.1 protein_id gnl|my_center|LOCUS_02120 2215 1526 gene locus_tag LOCUS_02130 gene queE 2215 1526 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6F5 protein_id gnl|my_center|LOCUS_02130 2660 2274 gene locus_tag LOCUS_02140 gene queD 2660 2274 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CF4 protein_id gnl|my_center|LOCUS_02140 2940 2725 gene locus_tag LOCUS_02150 2940 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 5640 2950 gene locus_tag LOCUS_02160 5640 2950 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHM1 protein_id gnl|my_center|LOCUS_02160 6212 6787 gene locus_tag LOCUS_02170 6212 6787 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A311 protein_id gnl|my_center|LOCUS_02170 6857 7609 gene locus_tag LOCUS_02180 6857 7609 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142151.1 protein_id gnl|my_center|LOCUS_02180 7638 7844 gene locus_tag LOCUS_02190 7638 7844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 >Feature sequence0020 3567 2092 gene locus_tag LOCUS_02200 3567 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 4919 3627 gene locus_tag LOCUS_02210 4919 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 5940 5710 gene locus_tag LOCUS_02220 5940 5710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 >Feature sequence0021 <1 1224 gene locus_tag LOCUS_02230 <1 1224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259373.1:histidine kinase 4876 1277 gene locus_tag LOCUS_02240 4876 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 5188 5985 gene locus_tag LOCUS_02250 5188 5985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 7259 7921 gene locus_tag LOCUS_02260 7259 7921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 7978 8433 gene locus_tag LOCUS_02270 7978 8433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 9654 8587 gene locus_tag LOCUS_02280 9654 8587 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119474.1 protein_id gnl|my_center|LOCUS_02280 >Feature sequence0022 154 828 gene locus_tag LOCUS_02290 154 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 825 2354 gene locus_tag LOCUS_02300 gene oprJ 825 2354 CDS product outer membrane protein OprJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51397 protein_id gnl|my_center|LOCUS_02300 2474 3526 gene locus_tag LOCUS_02310 2474 3526 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072024.1 protein_id gnl|my_center|LOCUS_02310 3528 6689 gene locus_tag LOCUS_02320 3528 6689 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529195.1 protein_id gnl|my_center|LOCUS_02320 8324 8854 gene locus_tag LOCUS_02330 8324 8854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02330 <9636 8961 gene locus_tag LOCUS_02340 <9636 8961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015065005.1:solute-binding periplasmic protein >Feature sequence0023 1703 810 gene locus_tag LOCUS_02350 1703 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 3607 1850 gene locus_tag LOCUS_02360 3607 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 4256 4669 gene locus_tag LOCUS_02370 4256 4669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 4843 5166 gene locus_tag LOCUS_02380 4843 5166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 >Feature sequence0024 1484 2239 gene locus_tag LOCUS_02390 1484 2239 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_02390 2236 2796 gene locus_tag LOCUS_02400 2236 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 2849 3667 gene locus_tag LOCUS_02410 2849 3667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 3762 4979 gene locus_tag LOCUS_02420 gene pulF 3762 4979 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942428.1 protein_id gnl|my_center|LOCUS_02420 5002 6669 gene locus_tag LOCUS_02430 gene pulE 5002 6669 CDS product type II secretion system ATPase PulE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942427.1 protein_id gnl|my_center|LOCUS_02430 6830 7612 gene locus_tag LOCUS_02440 6830 7612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 7614 9053 gene locus_tag LOCUS_02450 7614 9053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 >Feature sequence0025 <1 649 gene locus_tag LOCUS_02460 <1 649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258223.1:methylmalonyl-CoA carboxyltransferase 758 1216 gene locus_tag LOCUS_02470 gene rpiB 758 1216 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546357.1 protein_id gnl|my_center|LOCUS_02470 1278 2531 gene locus_tag LOCUS_02480 gene glyA 1278 2531 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CR5 protein_id gnl|my_center|LOCUS_02480 2497 3954 gene locus_tag LOCUS_02490 2497 3954 CDS product dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228491.1 protein_id gnl|my_center|LOCUS_02490 5020 3977 gene locus_tag LOCUS_02500 5020 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 6394 5054 gene locus_tag LOCUS_02510 gene folC 6394 5054 CDS product folylpolyglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141076.1 protein_id gnl|my_center|LOCUS_02510 7248 6391 gene locus_tag LOCUS_02520 gene accD 7248 6391 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJI7 protein_id gnl|my_center|LOCUS_02520 7621 7394 gene locus_tag LOCUS_02530 7621 7394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 9280 7727 gene locus_tag LOCUS_02540 9280 7727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 >Feature sequence0026 298 122 gene locus_tag LOCUS_02550 298 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 1270 311 gene locus_tag LOCUS_02560 1270 311 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391547.1 protein_id gnl|my_center|LOCUS_02560 1866 1270 gene locus_tag LOCUS_02570 1866 1270 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940393.1 protein_id gnl|my_center|LOCUS_02570 2159 2920 gene locus_tag LOCUS_02580 2159 2920 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943748.1 protein_id gnl|my_center|LOCUS_02580 5072 2943 gene locus_tag LOCUS_02590 5072 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 5493 5074 gene locus_tag LOCUS_02600 5493 5074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 7206 5521 gene locus_tag LOCUS_02610 7206 5521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 8162 7203 gene locus_tag LOCUS_02620 8162 7203 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118555.1 protein_id gnl|my_center|LOCUS_02620 8551 8159 gene locus_tag LOCUS_02630 8551 8159 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121968.1 protein_id gnl|my_center|LOCUS_02630 >Feature sequence0027 2704 2615 gene locus_tag LOCUS_t00020 2704 2615 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2883 2794 gene locus_tag LOCUS_t00030 2883 2794 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3397 2912 gene locus_tag LOCUS_02640 gene tadA 3397 2912 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H28 protein_id gnl|my_center|LOCUS_02640 3847 5790 gene locus_tag LOCUS_02650 3847 5790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 5787 6080 gene locus_tag LOCUS_02660 5787 6080 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRX1 protein_id gnl|my_center|LOCUS_02660 6090 6674 gene locus_tag LOCUS_02670 gene recR 6090 6674 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMH0 protein_id gnl|my_center|LOCUS_02670 6674 7990 gene locus_tag LOCUS_02680 6674 7990 CDS product 4-aminobutyrate aminotransferase GabT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704934.1 protein_id gnl|my_center|LOCUS_02680 7987 8589 gene locus_tag LOCUS_02690 7987 8589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 >Feature sequence0028 255 1646 gene locus_tag LOCUS_02700 255 1646 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528421.1 protein_id gnl|my_center|LOCUS_02700 2916 1729 gene locus_tag LOCUS_02710 gene fldA 2916 1729 CDS product FldA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039102.1 protein_id gnl|my_center|LOCUS_02710 3197 4303 gene locus_tag LOCUS_02720 3197 4303 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804128.1 protein_id gnl|my_center|LOCUS_02720 4493 4263 gene locus_tag LOCUS_02730 4493 4263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 4401 5399 gene locus_tag LOCUS_02740 4401 5399 CDS product polyamine-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TDV6 protein_id gnl|my_center|LOCUS_02740 5396 7069 gene locus_tag LOCUS_02750 5396 7069 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804130.1 protein_id gnl|my_center|LOCUS_02750 7077 8297 gene locus_tag LOCUS_02760 7077 8297 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918931.1 protein_id gnl|my_center|LOCUS_02760 >Feature sequence0029 1957 548 gene locus_tag LOCUS_02770 1957 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 2233 2000 gene locus_tag LOCUS_02780 2233 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 2970 2233 gene locus_tag LOCUS_02790 2970 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 3877 4539 gene locus_tag LOCUS_02800 3877 4539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 4536 5135 gene locus_tag LOCUS_02810 4536 5135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 7196 6126 gene locus_tag LOCUS_02820 7196 6126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 8097 7690 gene locus_tag LOCUS_02830 8097 7690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 8485 8141 gene locus_tag LOCUS_02840 8485 8141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 >Feature sequence0030 1409 249 gene locus_tag LOCUS_02850 1409 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 1918 1451 gene locus_tag LOCUS_02860 1918 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 2201 3010 gene locus_tag LOCUS_02870 gene trmJ 2201 3010 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWJ5 protein_id gnl|my_center|LOCUS_02870 3762 2989 gene locus_tag LOCUS_02880 3762 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 4675 4839 gene locus_tag LOCUS_02890 4675 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 6462 4852 gene locus_tag LOCUS_02900 gene glgA 6462 4852 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q816G8 protein_id gnl|my_center|LOCUS_02900 7727 6462 gene locus_tag LOCUS_02910 gene glgC 7727 6462 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404664.1 protein_id gnl|my_center|LOCUS_02910 >Feature sequence0031 152 895 gene locus_tag LOCUS_02920 152 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143168.1 protein_id gnl|my_center|LOCUS_02920 1043 1696 gene locus_tag LOCUS_02930 gene tdk 1043 1696 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5G4 protein_id gnl|my_center|LOCUS_02930 2588 1713 gene locus_tag LOCUS_02940 2588 1713 CDS product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89JC3 protein_id gnl|my_center|LOCUS_02940 3267 2710 gene locus_tag LOCUS_02950 3267 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 6698 3438 gene locus_tag LOCUS_02960 6698 3438 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_02960 7756 6695 gene locus_tag LOCUS_02970 7756 6695 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142490.1 protein_id gnl|my_center|LOCUS_02970 <8697 8168 gene locus_tag LOCUS_02980 <8697 8168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003400106.1:methionine gamma-lyase >Feature sequence0032 6825 106 gene locus_tag LOCUS_02990 6825 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 >Feature sequence0033 361 1107 gene locus_tag LOCUS_03000 361 1107 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ99 protein_id gnl|my_center|LOCUS_03000 1270 3186 gene locus_tag LOCUS_03010 1270 3186 CDS product peptidase S9 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140278.1 protein_id gnl|my_center|LOCUS_03010 4402 3290 gene locus_tag LOCUS_03020 4402 3290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 5064 4612 gene locus_tag LOCUS_03030 5064 4612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 5697 5104 gene locus_tag LOCUS_03040 5697 5104 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_03040 5853 6488 gene locus_tag LOCUS_03050 gene udk 5853 6488 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCC8 protein_id gnl|my_center|LOCUS_03050 7834 6461 gene locus_tag LOCUS_03060 7834 6461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 >Feature sequence0034 747 2354 gene locus_tag LOCUS_03070 gene rtcR 747 2354 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122266.1 protein_id gnl|my_center|LOCUS_03070 2465 2848 gene locus_tag LOCUS_03080 2465 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 2989 5286 gene locus_tag LOCUS_03090 2989 5286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 5341 6291 gene locus_tag LOCUS_03100 5341 6291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 6630 6340 gene locus_tag LOCUS_03110 6630 6340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 7374 6691 gene locus_tag LOCUS_03120 7374 6691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 <8350 7371 gene locus_tag LOCUS_03130 <8350 7371 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141367.1:folate hydrolase >Feature sequence0035 <8298 451 gene locus_tag LOCUS_03140 <8298 451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123429.1:aggregation factor core protein MAFp3, isoform C >Feature sequence0036 856 1830 gene locus_tag LOCUS_03150 gene ybgG 856 1830 CDS product homocysteine S-methyltransferase YbgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31463 protein_id gnl|my_center|LOCUS_03150 2048 2176 gene locus_tag LOCUS_03160 2048 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 3789 2410 gene locus_tag LOCUS_03170 3789 2410 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WE20 protein_id gnl|my_center|LOCUS_03170 5096 3801 gene locus_tag LOCUS_03180 gene metB 5096 3801 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037981.1 protein_id gnl|my_center|LOCUS_03180 5589 6791 gene locus_tag LOCUS_03190 gene alaS 5589 6791 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181813.1 protein_id gnl|my_center|LOCUS_03190 <8287 6915 gene locus_tag LOCUS_03200 <8287 6915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YLB7:5-methylthioadenosine/S-adenosylhomocysteine deaminase >Feature sequence0037 <1 1053 gene locus_tag LOCUS_03210 <1 1053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889131.1:ferric enterobactin esterase 1666 1085 gene locus_tag LOCUS_03220 1666 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036824.1 protein_id gnl|my_center|LOCUS_03220 2628 1693 gene locus_tag LOCUS_03230 gene yrbG 2628 1693 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261186.1 protein_id gnl|my_center|LOCUS_03230 3803 2640 gene locus_tag LOCUS_03240 gene lipE 3803 2640 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907540.1 protein_id gnl|my_center|LOCUS_03240 3781 4005 gene locus_tag LOCUS_03250 3781 4005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 4071 4751 gene locus_tag LOCUS_03260 4071 4751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 4919 6505 gene locus_tag LOCUS_03270 4919 6505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 6666 7862 gene locus_tag LOCUS_03280 6666 7862 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104643.1 protein_id gnl|my_center|LOCUS_03280 >Feature sequence0038 3322 1328 gene locus_tag LOCUS_03290 gene ftsI 3322 1328 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_03290 3666 3319 gene locus_tag LOCUS_03300 3666 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 4726 3692 gene locus_tag LOCUS_03310 gene rsmH 4726 3692 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFU3 protein_id gnl|my_center|LOCUS_03310 5223 4783 gene locus_tag LOCUS_03320 gene mraZ 5223 4783 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CH09 protein_id gnl|my_center|LOCUS_03320 7078 5924 gene locus_tag LOCUS_03330 7078 5924 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H77 protein_id gnl|my_center|LOCUS_03330 7895 7056 gene locus_tag LOCUS_03340 7895 7056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 8232 7978 gene locus_tag LOCUS_03350 8232 7978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 >Feature sequence0039 1293 730 gene locus_tag LOCUS_03360 1293 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030649.1 protein_id gnl|my_center|LOCUS_03360 1498 3060 gene locus_tag LOCUS_03370 1498 3060 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259049.1 protein_id gnl|my_center|LOCUS_03370 3148 6072 gene locus_tag LOCUS_03380 3148 6072 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259048.1 protein_id gnl|my_center|LOCUS_03380 6423 6139 gene locus_tag LOCUS_03390 6423 6139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 6749 7582 gene locus_tag LOCUS_03400 6749 7582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 >Feature sequence0040 486 1712 gene locus_tag LOCUS_03410 486 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 2746 1808 gene locus_tag LOCUS_03420 2746 1808 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858299.1 protein_id gnl|my_center|LOCUS_03420 3528 2743 gene locus_tag LOCUS_03430 3528 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 3741 4727 gene locus_tag LOCUS_03440 3741 4727 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_03440 4814 5329 gene locus_tag LOCUS_03450 gene rfbC 4814 5329 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403366.1 protein_id gnl|my_center|LOCUS_03450 5398 6282 gene locus_tag LOCUS_03460 gene fcl 5398 6282 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF18 protein_id gnl|my_center|LOCUS_03460 7403 6363 gene locus_tag LOCUS_03470 7403 6363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 <8196 7390 gene locus_tag LOCUS_03480 <8196 7390 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065995.1:UDP-glucose 4-epimerase >Feature sequence0041 258 2666 gene locus_tag LOCUS_03490 258 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 2954 3226 gene locus_tag LOCUS_03500 2954 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 3299 3514 gene locus_tag LOCUS_03510 3299 3514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 3550 4089 gene locus_tag LOCUS_03520 3550 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 4086 4808 gene locus_tag LOCUS_03530 4086 4808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 4888 6030 gene locus_tag LOCUS_03540 4888 6030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 6030 6611 gene locus_tag LOCUS_03550 6030 6611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 6608 7573 gene locus_tag LOCUS_03560 6608 7573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 >Feature sequence0042 148 1476 gene locus_tag LOCUS_03570 148 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 1977 4781 gene locus_tag LOCUS_03580 1977 4781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 4881 6095 gene locus_tag LOCUS_03590 gene tagH 4881 6095 CDS product teichoic acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289079.1 protein_id gnl|my_center|LOCUS_03590 6972 6118 gene locus_tag LOCUS_03600 6972 6118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 >Feature sequence0043 1427 36 gene locus_tag LOCUS_03610 1427 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 2766 1504 gene locus_tag LOCUS_03620 2766 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 4610 2766 gene locus_tag LOCUS_03630 4610 2766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 4837 6192 gene locus_tag LOCUS_03640 4837 6192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 6192 8024 gene locus_tag LOCUS_03650 6192 8024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 >Feature sequence0044 2718 1021 gene locus_tag LOCUS_03660 2718 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 3820 2777 gene locus_tag LOCUS_03670 gene petB 3820 2777 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F721 protein_id gnl|my_center|LOCUS_03670 4442 3822 gene locus_tag LOCUS_03680 4442 3822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 4720 5529 gene locus_tag LOCUS_03690 4720 5529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 7043 5523 gene locus_tag LOCUS_03700 7043 5523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 8032 7190 gene locus_tag LOCUS_03710 8032 7190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 >Feature sequence0045 3989 3438 gene locus_tag LOCUS_03720 3989 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 4378 4536 gene locus_tag LOCUS_03730 4378 4536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 4974 6662 gene locus_tag LOCUS_03740 4974 6662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118597.1 protein_id gnl|my_center|LOCUS_03740 >Feature sequence0046 2322 4121 gene locus_tag LOCUS_03750 2322 4121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 5741 4503 gene locus_tag LOCUS_03760 5741 4503 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121176.1 protein_id gnl|my_center|LOCUS_03760 6078 6004 gene locus_tag LOCUS_t00040 6078 6004 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 6285 6971 gene locus_tag LOCUS_03770 6285 6971 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040230.1 protein_id gnl|my_center|LOCUS_03770 7996 6941 gene locus_tag LOCUS_03780 7996 6941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 >Feature sequence0047 4223 1971 gene locus_tag LOCUS_03790 4223 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 5489 4242 gene locus_tag LOCUS_03800 5489 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 6531 5509 gene locus_tag LOCUS_03810 6531 5509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 7952 6531 gene locus_tag LOCUS_03820 7952 6531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 >Feature sequence0048 1896 1009 gene locus_tag LOCUS_03830 1896 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 4416 1933 gene locus_tag LOCUS_03840 4416 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140564.1 protein_id gnl|my_center|LOCUS_03840 5210 4665 gene locus_tag LOCUS_03850 5210 4665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 6421 5210 gene locus_tag LOCUS_03860 6421 5210 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804287.1 protein_id gnl|my_center|LOCUS_03860 >Feature sequence0049 <1 1839 gene locus_tag LOCUS_03870 <1 1839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943442.1:histidine kinase 2288 1956 gene locus_tag LOCUS_03880 2288 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03880 5254 2246 gene locus_tag LOCUS_03890 5254 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03890 >Feature sequence0050 3108 1348 gene locus_tag LOCUS_03900 3108 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 3851 3105 gene locus_tag LOCUS_03910 3851 3105 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 protein_id gnl|my_center|LOCUS_03910 5371 3848 gene locus_tag LOCUS_03920 5371 3848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 5654 6616 gene locus_tag LOCUS_03930 5654 6616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 >Feature sequence0051 3945 1045 gene locus_tag LOCUS_03940 3945 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 4335 5819 gene locus_tag LOCUS_03950 4335 5819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 5928 6818 gene locus_tag LOCUS_03960 5928 6818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 <7771 6961 gene locus_tag LOCUS_03970 <7771 6961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_635937.2:Xaa-Pro dipeptidase >Feature sequence0052 403 696 gene locus_tag LOCUS_03980 403 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762031.1 protein_id gnl|my_center|LOCUS_03980 764 2071 gene locus_tag LOCUS_03990 764 2071 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 protein_id gnl|my_center|LOCUS_03990 2262 4058 gene locus_tag LOCUS_04000 2262 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 4131 4676 gene locus_tag LOCUS_04010 4131 4676 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_04010 <7725 4639 gene locus_tag LOCUS_04020 <7725 4639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141097.1:serine/threonine protein kinase >Feature sequence0053 <1 1390 gene locus_tag LOCUS_04030 <1 1390 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259065.1:3-hydroxyacyl-CoA dehydrogenase 1407 2591 gene locus_tag LOCUS_04040 1407 2591 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259064.1 protein_id gnl|my_center|LOCUS_04040 4238 2742 gene locus_tag LOCUS_04050 4238 2742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 5376 4417 gene locus_tag LOCUS_04060 5376 4417 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815416.1 protein_id gnl|my_center|LOCUS_04060 5598 6167 gene locus_tag LOCUS_04070 gene efp 5598 6167 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYS4 protein_id gnl|my_center|LOCUS_04070 6244 7236 gene locus_tag LOCUS_04080 gene epmA 6244 7236 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNS6 protein_id gnl|my_center|LOCUS_04080 7682 7281 gene locus_tag LOCUS_04090 7682 7281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 >Feature sequence0054 <1 2563 gene locus_tag LOCUS_04100 <1 2563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O33407:esterase EstA 2577 4166 gene locus_tag LOCUS_04110 2577 4166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 4753 5178 gene locus_tag LOCUS_04120 4753 5178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 6761 5319 gene locus_tag LOCUS_04130 6761 5319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 >Feature sequence0055 3320 549 gene locus_tag LOCUS_04140 3320 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 3728 4492 gene locus_tag LOCUS_04150 gene prmC 3728 4492 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULT2 protein_id gnl|my_center|LOCUS_04150 4519 5319 gene locus_tag LOCUS_04160 4519 5319 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903097.1 protein_id gnl|my_center|LOCUS_04160 5369 5629 gene locus_tag LOCUS_04170 5369 5629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 5676 6449 gene locus_tag LOCUS_04180 5676 6449 CDS product histidinol phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257802.1 protein_id gnl|my_center|LOCUS_04180 7138 6497 gene locus_tag LOCUS_04190 7138 6497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 >Feature sequence0056 2006 2506 gene locus_tag LOCUS_04200 2006 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 <7564 2995 gene locus_tag LOCUS_04210 <7564 2995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969213.1:relaxase >Feature sequence0057 2407 4554 gene locus_tag LOCUS_04220 gene ptrB 2407 4554 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 protein_id gnl|my_center|LOCUS_04220 5374 4649 gene locus_tag LOCUS_04230 5374 4649 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483532.1 protein_id gnl|my_center|LOCUS_04230 6332 5694 gene locus_tag LOCUS_04240 6332 5694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 7000 6332 gene locus_tag LOCUS_04250 7000 6332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 >Feature sequence0058 1328 2050 gene locus_tag LOCUS_04260 gene truC 1328 2050 CDS product tRNA pseudouridine synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943781.1 protein_id gnl|my_center|LOCUS_04260 2775 2047 gene locus_tag LOCUS_04270 gene aat 2775 2047 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUM5 protein_id gnl|my_center|LOCUS_04270 3995 3054 gene locus_tag LOCUS_04280 3995 3054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 6869 4110 gene locus_tag LOCUS_04290 6869 4110 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140762.1 protein_id gnl|my_center|LOCUS_04290 >Feature sequence0059 1222 494 gene locus_tag LOCUS_04300 1222 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04300 2230 1454 gene locus_tag LOCUS_04310 2230 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 2681 2253 gene locus_tag LOCUS_04320 2681 2253 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940705.1 protein_id gnl|my_center|LOCUS_04320 3522 2776 gene locus_tag LOCUS_04330 3522 2776 CDS product Tol-Pal system subunit TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_04330 4024 4815 gene locus_tag LOCUS_04340 gene fixA 4024 4815 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 protein_id gnl|my_center|LOCUS_04340 4937 5791 gene locus_tag LOCUS_04350 gene etfA 4937 5791 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072965.1 protein_id gnl|my_center|LOCUS_04350 >Feature sequence0060 1823 2557 gene locus_tag LOCUS_04360 1823 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 2617 3972 gene locus_tag LOCUS_04370 2617 3972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 4162 4548 gene locus_tag LOCUS_04380 4162 4548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 4548 6440 gene locus_tag LOCUS_04390 4548 6440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 >Feature sequence0061 1665 205 gene locus_tag LOCUS_04400 1665 205 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530690.1 protein_id gnl|my_center|LOCUS_04400 3091 2570 gene locus_tag LOCUS_04410 3091 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 6326 3219 gene locus_tag LOCUS_04420 6326 3219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 <7452 6899 gene locus_tag LOCUS_04430 <7452 6899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KFZ5:GMP synthase [glutamine-hydrolyzing] >Feature sequence0062 555 58 gene locus_tag LOCUS_04440 555 58 CDS product phosphohistidine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088598.1 protein_id gnl|my_center|LOCUS_04440 586 2820 gene locus_tag LOCUS_04450 gene ppk 586 2820 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B706 protein_id gnl|my_center|LOCUS_04450 3330 2920 gene locus_tag LOCUS_04460 3330 2920 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249285.1 protein_id gnl|my_center|LOCUS_04460 4481 3330 gene locus_tag LOCUS_04470 4481 3330 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229031.1 protein_id gnl|my_center|LOCUS_04470 5850 6872 gene locus_tag LOCUS_04480 5850 6872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 >Feature sequence0063 1729 1256 gene locus_tag LOCUS_04490 gene rimP 1729 1256 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X299 protein_id gnl|my_center|LOCUS_04490 3010 2069 gene locus_tag LOCUS_04500 3010 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120268.1 protein_id gnl|my_center|LOCUS_04500 3735 3049 gene locus_tag LOCUS_04510 3735 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 5868 3832 gene locus_tag LOCUS_04520 gene mutL 5868 3832 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WKI6 protein_id gnl|my_center|LOCUS_04520 <7408 5835 gene locus_tag LOCUS_04530 <7408 5835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RKV5:glycine--tRNA ligase beta subunit >Feature sequence0064 2347 713 gene locus_tag LOCUS_04540 2347 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 3296 2340 gene locus_tag LOCUS_04550 3296 2340 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405383.1 protein_id gnl|my_center|LOCUS_04550 3731 5626 gene locus_tag LOCUS_04560 3731 5626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 5671 6684 gene locus_tag LOCUS_04570 5671 6684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 >Feature sequence0065 1314 412 gene locus_tag LOCUS_04580 gene menA 1314 412 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBE2 protein_id gnl|my_center|LOCUS_04580 2087 1311 gene locus_tag LOCUS_04590 gene menH 2087 1311 CDS product putative 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBD4 protein_id gnl|my_center|LOCUS_04590 3887 2103 gene locus_tag LOCUS_04600 3887 2103 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902775.1 protein_id gnl|my_center|LOCUS_04600 5436 3961 gene locus_tag LOCUS_04610 5436 3961 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259490.1 protein_id gnl|my_center|LOCUS_04610 6257 5433 gene locus_tag LOCUS_04620 gene ubiE 6257 5433 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EU2 protein_id gnl|my_center|LOCUS_04620 <7392 6259 gene locus_tag LOCUS_04630 <7392 6259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011974661.1:polyprenyl synthetase >Feature sequence0066 <1 1878 gene locus_tag LOCUS_04640 <1 1878 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003408499.1:penicillin-binding protein 1992 2912 gene locus_tag LOCUS_04650 1992 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 5563 2825 gene locus_tag LOCUS_04660 5563 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 6212 5646 gene locus_tag LOCUS_04670 6212 5646 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_04670 6315 6484 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gaataacgtaagagtagtcccggaa >Feature sequence0067 2077 119 gene locus_tag LOCUS_04680 2077 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 3380 2289 gene locus_tag LOCUS_04690 3380 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 3844 3377 gene locus_tag LOCUS_04700 3844 3377 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCR4 protein_id gnl|my_center|LOCUS_04700 4066 5268 gene locus_tag LOCUS_04710 4066 5268 CDS product acyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103022.1 protein_id gnl|my_center|LOCUS_04710 >Feature sequence0068 3463 1775 gene locus_tag LOCUS_04720 3463 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 >Feature sequence0069 498 28 gene locus_tag LOCUS_04730 498 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 1760 498 gene locus_tag LOCUS_04740 gene iscS 1760 498 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND52 protein_id gnl|my_center|LOCUS_04740 3028 1757 gene locus_tag LOCUS_04750 3028 1757 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122552.1 protein_id gnl|my_center|LOCUS_04750 3587 3862 gene locus_tag LOCUS_04760 3587 3862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 4441 3902 gene locus_tag LOCUS_04770 4441 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 4716 4438 gene locus_tag LOCUS_04780 4716 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 5637 5056 gene locus_tag LOCUS_04790 5637 5056 CDS product DNA-invertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_457172.1 protein_id gnl|my_center|LOCUS_04790 5824 6864 gene locus_tag LOCUS_04800 5824 6864 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280585.1 protein_id gnl|my_center|LOCUS_04800 >Feature sequence0070 110 1306 gene locus_tag LOCUS_04810 gene dprA 110 1306 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_04810 1388 2770 gene locus_tag LOCUS_04820 gene trmFO 1388 2770 CDS product methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74A44 protein_id gnl|my_center|LOCUS_04820 2767 3771 gene locus_tag LOCUS_04830 gene xerC 2767 3771 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FW0 protein_id gnl|my_center|LOCUS_04830 3874 4401 gene locus_tag LOCUS_04840 gene hslV 3874 4401 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYZ1 protein_id gnl|my_center|LOCUS_04840 4408 5793 gene locus_tag LOCUS_04850 gene hslU 4408 5793 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66574 protein_id gnl|my_center|LOCUS_04850 5783 6859 gene locus_tag LOCUS_04860 5783 6859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 >Feature sequence0071 171 581 gene locus_tag LOCUS_04870 171 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 772 566 gene locus_tag LOCUS_04880 772 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 1045 845 gene locus_tag LOCUS_04890 1045 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 1149 1529 gene locus_tag LOCUS_04900 1149 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 1861 3375 gene locus_tag LOCUS_04910 1861 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 4393 3500 gene locus_tag LOCUS_04920 4393 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 5893 4529 gene locus_tag LOCUS_04930 5893 4529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 6767 5949 gene locus_tag LOCUS_04940 6767 5949 CDS product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570845.1 protein_id gnl|my_center|LOCUS_04940 >Feature sequence0072 721 2901 gene locus_tag LOCUS_04950 721 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 2901 4097 gene locus_tag LOCUS_04960 2901 4097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 4184 5302 gene locus_tag LOCUS_04970 4184 5302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 >Feature sequence0073 1942 2289 gene locus_tag LOCUS_04980 1942 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 5055 2323 gene locus_tag LOCUS_04990 5055 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 5296 5553 gene locus_tag LOCUS_05000 5296 5553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 >Feature sequence0074 752 1651 gene locus_tag LOCUS_05010 gene rarD 752 1651 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535550.1 protein_id gnl|my_center|LOCUS_05010 5754 1540 gene locus_tag LOCUS_05020 5754 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 5933 6646 gene locus_tag LOCUS_05030 5933 6646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404527.1 protein_id gnl|my_center|LOCUS_05030 <7179 6669 gene locus_tag LOCUS_05040 <7179 6669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0C6P3P9:dual-specificity RNA methyltransferase RlmN >Feature sequence0075 365 1720 gene locus_tag LOCUS_05050 gene manB 365 1720 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727940.1 protein_id gnl|my_center|LOCUS_05050 1919 3277 gene locus_tag LOCUS_05060 1919 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 3732 3481 gene locus_tag LOCUS_05070 3732 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 5638 7068 gene locus_tag LOCUS_05080 5638 7068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 >Feature sequence0076 1106 1900 gene locus_tag LOCUS_05090 gene nodB 1106 1900 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038465.1 protein_id gnl|my_center|LOCUS_05090 2049 3065 gene locus_tag LOCUS_05100 2049 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 4074 3199 gene locus_tag LOCUS_05110 4074 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 4318 5433 gene locus_tag LOCUS_05120 gene carA 4318 5433 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGJ6 protein_id gnl|my_center|LOCUS_05120 5430 6680 gene locus_tag LOCUS_05130 5430 6680 CDS product lipoprotein releasing system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191984.1 protein_id gnl|my_center|LOCUS_05130 >Feature sequence0077 4067 2451 gene locus_tag LOCUS_05140 4067 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 4304 4648 gene locus_tag LOCUS_05150 4304 4648 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141461.1 protein_id gnl|my_center|LOCUS_05150 4674 4832 gene locus_tag LOCUS_05160 4674 4832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 >Feature sequence0078 1285 1458 gene locus_tag LOCUS_05170 1285 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 1477 1722 gene locus_tag LOCUS_05180 1477 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 2817 2362 gene locus_tag LOCUS_05190 2817 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 4208 3171 gene locus_tag LOCUS_05200 4208 3171 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970303.1 protein_id gnl|my_center|LOCUS_05200 5049 5222 gene locus_tag LOCUS_05210 5049 5222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 6721 5387 gene locus_tag LOCUS_05220 6721 5387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 >Feature sequence0079 253 1092 gene locus_tag LOCUS_05230 253 1092 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259304.1 protein_id gnl|my_center|LOCUS_05230 1112 2032 gene locus_tag LOCUS_05240 1112 2032 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256872.1 protein_id gnl|my_center|LOCUS_05240 2055 3206 gene locus_tag LOCUS_05250 2055 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 3227 4432 gene locus_tag LOCUS_05260 3227 4432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256669.1 protein_id gnl|my_center|LOCUS_05260 5662 4721 gene locus_tag LOCUS_05270 5662 4721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 <7151 5803 gene locus_tag LOCUS_05280 <7151 5803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122293.1:ABC transporter ATP-binding protein >Feature sequence0080 2303 1095 gene locus_tag LOCUS_05290 2303 1095 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903808.1 protein_id gnl|my_center|LOCUS_05290 3873 2476 gene locus_tag LOCUS_05300 3873 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 4515 3904 gene locus_tag LOCUS_05310 4515 3904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 <7109 4829 gene locus_tag LOCUS_05320 <7109 4829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223261.1:CHAT domain-containing protein >Feature sequence0081 144 1319 gene locus_tag LOCUS_05330 144 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 1675 2682 gene locus_tag LOCUS_05340 1675 2682 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393640.1 protein_id gnl|my_center|LOCUS_05340 2796 3752 gene locus_tag LOCUS_05350 2796 3752 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJS5 protein_id gnl|my_center|LOCUS_05350 5033 3738 gene locus_tag LOCUS_05360 5033 3738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 >Feature sequence0082 2326 998 gene locus_tag LOCUS_05370 gene ugdH 2326 998 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090851.1 protein_id gnl|my_center|LOCUS_05370 3441 2461 gene locus_tag LOCUS_05380 3441 2461 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403405.1 protein_id gnl|my_center|LOCUS_05380 4231 3830 gene locus_tag LOCUS_05390 4231 3830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 4559 5344 gene locus_tag LOCUS_05400 gene plsC 4559 5344 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW5 protein_id gnl|my_center|LOCUS_05400 >Feature sequence0083 3475 1667 gene locus_tag LOCUS_05410 3475 1667 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73KH3 protein_id gnl|my_center|LOCUS_05410 4417 3719 gene locus_tag LOCUS_05420 4417 3719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 6483 4438 gene locus_tag LOCUS_05430 6483 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 >Feature sequence0084 274 2325 gene locus_tag LOCUS_05440 274 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 3255 2554 gene locus_tag LOCUS_05450 gene fabG 3255 2554 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002027497.1 protein_id gnl|my_center|LOCUS_05450 3491 4924 gene locus_tag LOCUS_05460 3491 4924 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121006.1 protein_id gnl|my_center|LOCUS_05460 5076 5864 gene locus_tag LOCUS_05470 5076 5864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 <7038 6224 gene locus_tag LOCUS_05480 <7038 6224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942684.1:acetoacetate metabolism regulatory protein AtoC >Feature sequence0085 471 1004 gene locus_tag LOCUS_05490 471 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 2065 1001 gene locus_tag LOCUS_05500 2065 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 3867 2119 gene locus_tag LOCUS_05510 3867 2119 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257697.1 protein_id gnl|my_center|LOCUS_05510 4118 4741 gene locus_tag LOCUS_05520 4118 4741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 5378 4785 gene locus_tag LOCUS_05530 5378 4785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 5715 5482 gene locus_tag LOCUS_05540 5715 5482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 >Feature sequence0086 >Feature sequence0087 1930 929 gene locus_tag LOCUS_05550 1930 929 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404470.1 protein_id gnl|my_center|LOCUS_05550 2042 2230 gene locus_tag LOCUS_05560 2042 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 2281 2718 gene locus_tag LOCUS_05570 2281 2718 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035482.1 protein_id gnl|my_center|LOCUS_05570 2764 3168 gene locus_tag LOCUS_05580 2764 3168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056657.1 protein_id gnl|my_center|LOCUS_05580 3811 3485 gene locus_tag LOCUS_05590 3811 3485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 <6955 3944 gene locus_tag LOCUS_05600 <6955 3944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87LY0:histidine kinase >Feature sequence0088 >Feature sequence0089 4659 3409 gene locus_tag LOCUS_05610 4659 3409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 4953 5471 gene locus_tag LOCUS_05620 4953 5471 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888792.1 protein_id gnl|my_center|LOCUS_05620 6829 5468 gene locus_tag LOCUS_05630 6829 5468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 >Feature sequence0090 6647 3402 gene locus_tag LOCUS_05640 6647 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 >Feature sequence0091 3049 173 gene locus_tag LOCUS_05650 3049 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 4077 3046 gene locus_tag LOCUS_05660 4077 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 >Feature sequence0092 3583 2078 gene locus_tag LOCUS_05670 3583 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 >Feature sequence0093 339 710 gene locus_tag LOCUS_05680 339 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 1076 930 gene locus_tag LOCUS_05690 1076 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 1455 3404 gene locus_tag LOCUS_05700 1455 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 4400 3447 gene locus_tag LOCUS_05710 4400 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 5117 4749 gene locus_tag LOCUS_05720 5117 4749 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJJ7 protein_id gnl|my_center|LOCUS_05720 6210 5119 gene locus_tag LOCUS_05730 6210 5119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 >Feature sequence0094 1738 188 gene locus_tag LOCUS_05740 1738 188 CDS product proline permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877529.1 protein_id gnl|my_center|LOCUS_05740 2211 1738 gene locus_tag LOCUS_05750 2211 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 2325 3515 gene locus_tag LOCUS_05760 gene celE 2325 3515 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972927.1 protein_id gnl|my_center|LOCUS_05760 3534 4499 gene locus_tag LOCUS_05770 3534 4499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 4503 5369 gene locus_tag LOCUS_05780 4503 5369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 5611 5258 gene locus_tag LOCUS_05790 5611 5258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 6363 5608 gene locus_tag LOCUS_05800 6363 5608 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105585.1 protein_id gnl|my_center|LOCUS_05800 >Feature sequence0095 2907 3470 gene locus_tag LOCUS_05810 2907 3470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 4173 3640 gene locus_tag LOCUS_05820 4173 3640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 4702 4298 gene locus_tag LOCUS_05830 4702 4298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 4954 4772 gene locus_tag LOCUS_05840 4954 4772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 5540 5079 gene locus_tag LOCUS_05850 5540 5079 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437844.1 protein_id gnl|my_center|LOCUS_05850 6793 5657 gene locus_tag LOCUS_05860 6793 5657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 >Feature sequence0096 2707 2120 gene locus_tag LOCUS_05870 gene pgsA 2707 2120 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46322 protein_id gnl|my_center|LOCUS_05870 3753 2938 gene locus_tag LOCUS_05880 3753 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 4726 3893 gene locus_tag LOCUS_05890 4726 3893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 6477 4726 gene locus_tag LOCUS_05900 6477 4726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 6756 6544 gene locus_tag LOCUS_05910 6756 6544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 >Feature sequence0097 1222 290 gene locus_tag LOCUS_05920 1222 290 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 protein_id gnl|my_center|LOCUS_05920 1568 2368 gene locus_tag LOCUS_05930 1568 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 2386 3507 gene locus_tag LOCUS_05940 2386 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 3504 4382 gene locus_tag LOCUS_05950 3504 4382 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090346.1 protein_id gnl|my_center|LOCUS_05950 4578 5723 gene locus_tag LOCUS_05960 gene ada 4578 5723 CDS product bifunctional transcriptional activator/DNA repair enzyme protein Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190110.1 protein_id gnl|my_center|LOCUS_05960 6689 5736 gene locus_tag LOCUS_05970 6689 5736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 >Feature sequence0098 2294 5035 gene locus_tag LOCUS_05980 2294 5035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 6283 5237 gene locus_tag LOCUS_05990 6283 5237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 >Feature sequence0099 2296 413 gene locus_tag LOCUS_06000 gene ntrC2 2296 413 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881164.1 protein_id gnl|my_center|LOCUS_06000 2759 4756 gene locus_tag LOCUS_06010 2759 4756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 4884 5819 gene locus_tag LOCUS_06020 4884 5819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402886.1 protein_id gnl|my_center|LOCUS_06020 <6654 5941 gene locus_tag LOCUS_06030 <6654 5941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121001.1:ATP-binding protein >Feature sequence0100 2058 466 gene locus_tag LOCUS_06040 2058 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 3433 2048 gene locus_tag LOCUS_06050 3433 2048 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946753.1 protein_id gnl|my_center|LOCUS_06050 4176 4328 gene locus_tag LOCUS_06060 4176 4328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 4851 4657 gene locus_tag LOCUS_06070 4851 4657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 5201 4851 gene locus_tag LOCUS_06080 gene spbB 5201 4851 CDS product histone-like nucleoid-structuring protein H-NS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337920.1 protein_id gnl|my_center|LOCUS_06080 6055 5198 gene locus_tag LOCUS_06090 6055 5198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 6414 6596 gene locus_tag LOCUS_06100 6414 6596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 >Feature sequence0101 3132 2509 gene locus_tag LOCUS_06110 3132 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 3704 3129 gene locus_tag LOCUS_06120 3704 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 4328 3720 gene locus_tag LOCUS_06130 4328 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 5390 4332 gene locus_tag LOCUS_06140 gene pilM 5390 4332 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_06140 <6619 5724 gene locus_tag LOCUS_06150 <6619 5724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942876.1:GTP pyrophosphokinase >Feature sequence0102 2280 1291 gene locus_tag LOCUS_06160 2280 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06160 3513 2335 gene locus_tag LOCUS_06170 3513 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06170 4125 3553 gene locus_tag LOCUS_06180 4125 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 4344 4814 gene locus_tag LOCUS_06190 gene smpB 4344 4814 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_228068.1 protein_id gnl|my_center|LOCUS_06190 4910 5494 gene locus_tag LOCUS_06200 4910 5494 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DC87 protein_id gnl|my_center|LOCUS_06200 6586 5513 gene locus_tag LOCUS_06210 6586 5513 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388525.1 protein_id gnl|my_center|LOCUS_06210 >Feature sequence0103 <1 944 gene locus_tag LOCUS_06220 <1 944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J3M6:1,4-alpha-glucan branching enzyme GlgB 1482 964 gene locus_tag LOCUS_06230 1482 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821005.1 protein_id gnl|my_center|LOCUS_06230 1869 2084 gene locus_tag LOCUS_06240 1869 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 4625 2205 gene locus_tag LOCUS_06250 4625 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141479.1 protein_id gnl|my_center|LOCUS_06250 4877 6124 gene locus_tag LOCUS_06260 gene fadA 4877 6124 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207598.1 protein_id gnl|my_center|LOCUS_06260 >Feature sequence0104 3879 4667 gene locus_tag LOCUS_06270 gene dnaC 3879 4667 CDS product DNA replication protein DnaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880556.1 protein_id gnl|my_center|LOCUS_06270 >Feature sequence0105 1742 594 gene locus_tag LOCUS_06280 1742 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 3006 1855 gene locus_tag LOCUS_06290 3006 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 4630 3134 gene locus_tag LOCUS_06300 4630 3134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 5062 4679 gene locus_tag LOCUS_06310 5062 4679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 5659 5078 gene locus_tag LOCUS_06320 5659 5078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 6257 6526 gene locus_tag LOCUS_06330 6257 6526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 >Feature sequence0106 2342 60 gene locus_tag LOCUS_06340 2342 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 4864 2429 gene locus_tag LOCUS_06350 4864 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 4991 5860 gene locus_tag LOCUS_06360 4991 5860 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898866.1 protein_id gnl|my_center|LOCUS_06360 >Feature sequence0107 387 815 gene locus_tag LOCUS_06370 387 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 825 2486 gene locus_tag LOCUS_06380 825 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 2796 3776 gene locus_tag LOCUS_06390 2796 3776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 3837 4583 gene locus_tag LOCUS_06400 3837 4583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 >Feature sequence0108 2284 1589 gene locus_tag LOCUS_06410 2284 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 2634 2284 gene locus_tag LOCUS_06420 2634 2284 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195236.1 protein_id gnl|my_center|LOCUS_06420 3206 2871 gene locus_tag LOCUS_06430 3206 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 3471 3707 gene locus_tag LOCUS_06440 3471 3707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 4937 3825 gene locus_tag LOCUS_06450 4937 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 >Feature sequence0109 1 345 gene locus_tag LOCUS_06460 1 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 443 988 gene locus_tag LOCUS_06470 443 988 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143573.1 protein_id gnl|my_center|LOCUS_06470 1091 1591 gene locus_tag LOCUS_06480 1091 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 1708 2904 gene locus_tag LOCUS_06490 1708 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 3676 2897 gene locus_tag LOCUS_06500 3676 2897 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249790.1 protein_id gnl|my_center|LOCUS_06500 5792 3690 gene locus_tag LOCUS_06510 5792 3690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 6203 5796 gene locus_tag LOCUS_06520 6203 5796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 >Feature sequence0110 691 230 gene locus_tag LOCUS_06530 gene rimI 691 230 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJL0 protein_id gnl|my_center|LOCUS_06530 1366 698 gene locus_tag LOCUS_06540 1366 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 1616 3160 gene locus_tag LOCUS_06550 gene lysS 1616 3160 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNK7 protein_id gnl|my_center|LOCUS_06550 3168 4430 gene locus_tag LOCUS_06560 3168 4430 CDS product lipoprotein-releasing system protein LolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706248.1 protein_id gnl|my_center|LOCUS_06560 4464 5144 gene locus_tag LOCUS_06570 gene lolD 4464 5144 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AT2 protein_id gnl|my_center|LOCUS_06570 >Feature sequence0111 1323 622 gene locus_tag LOCUS_06580 1323 622 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941648.1 protein_id gnl|my_center|LOCUS_06580 2030 1527 gene locus_tag LOCUS_06590 2030 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 2640 2191 gene locus_tag LOCUS_06600 2640 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 3150 2677 gene locus_tag LOCUS_06610 3150 2677 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941646.1 protein_id gnl|my_center|LOCUS_06610 4830 3196 gene locus_tag LOCUS_06620 4830 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 5715 4846 gene locus_tag LOCUS_06630 5715 4846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 6329 5712 gene locus_tag LOCUS_06640 6329 5712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 >Feature sequence0112 1374 442 gene locus_tag LOCUS_06650 1374 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 2463 1567 gene locus_tag LOCUS_06660 2463 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 3292 2477 gene locus_tag LOCUS_06670 3292 2477 CDS product GlcNAc-PI de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256999.1 protein_id gnl|my_center|LOCUS_06670 4562 3285 gene locus_tag LOCUS_06680 4562 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 5998 4559 gene locus_tag LOCUS_06690 5998 4559 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202937.1 protein_id gnl|my_center|LOCUS_06690 >Feature sequence0113 1371 868 gene locus_tag LOCUS_06700 1371 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 2207 1368 gene locus_tag LOCUS_06710 2207 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 3097 2318 gene locus_tag LOCUS_06720 3097 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 3426 5258 gene locus_tag LOCUS_06730 gene argS 3426 5258 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MX8 protein_id gnl|my_center|LOCUS_06730 5327 6247 gene locus_tag LOCUS_06740 5327 6247 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189844.1 protein_id gnl|my_center|LOCUS_06740 >Feature sequence0114 642 373 gene locus_tag LOCUS_06750 642 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 1230 853 gene locus_tag LOCUS_06760 1230 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 1782 1342 gene locus_tag LOCUS_06770 1782 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 5077 1847 gene locus_tag LOCUS_06780 5077 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 6298 5315 gene locus_tag LOCUS_06790 6298 5315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 >Feature sequence0115 435 70 gene locus_tag LOCUS_06800 435 70 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065974.1 protein_id gnl|my_center|LOCUS_06800 451 714 gene locus_tag LOCUS_06810 451 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 909 1304 gene locus_tag LOCUS_06820 909 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 1486 3933 gene locus_tag LOCUS_06830 1486 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 4266 5690 gene locus_tag LOCUS_06840 4266 5690 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334318.1 protein_id gnl|my_center|LOCUS_06840 >Feature sequence0116 2885 1626 gene locus_tag LOCUS_06850 2885 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 4305 2896 gene locus_tag LOCUS_06860 4305 2896 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036664.1 protein_id gnl|my_center|LOCUS_06860 >Feature sequence0117 159 1754 gene locus_tag LOCUS_06870 159 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 2136 1825 gene locus_tag LOCUS_06880 2136 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 2392 3174 gene locus_tag LOCUS_06890 2392 3174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 3275 4345 gene locus_tag LOCUS_06900 3275 4345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 >Feature sequence0118 37 1566 gene locus_tag LOCUS_06910 37 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 3057 1738 gene locus_tag LOCUS_06920 3057 1738 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941138.1 protein_id gnl|my_center|LOCUS_06920 4388 3054 gene locus_tag LOCUS_06930 gene selA 4388 3054 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QTI0 protein_id gnl|my_center|LOCUS_06930 4526 5086 gene locus_tag LOCUS_06940 4526 5086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 >Feature sequence0119 382 3372 gene locus_tag LOCUS_06950 382 3372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 4145 3486 gene locus_tag LOCUS_06960 4145 3486 CDS product iron-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528606.1 protein_id gnl|my_center|LOCUS_06960 5460 4906 gene locus_tag LOCUS_06970 gene mogA 5460 4906 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422732.1 protein_id gnl|my_center|LOCUS_06970 5798 5457 gene locus_tag LOCUS_06980 5798 5457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 >Feature sequence0120 1437 238 gene locus_tag LOCUS_06990 1437 238 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256238.1 protein_id gnl|my_center|LOCUS_06990 2075 1434 gene locus_tag LOCUS_07000 gene leuD 2075 1434 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B6F7 protein_id gnl|my_center|LOCUS_07000 3415 2075 gene locus_tag LOCUS_07010 gene leuC 3415 2075 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B6F6 protein_id gnl|my_center|LOCUS_07010 4656 3412 gene locus_tag LOCUS_07020 4656 3412 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256235.1 protein_id gnl|my_center|LOCUS_07020 >Feature sequence0121 572 4456 gene locus_tag LOCUS_07030 572 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 4807 5079 gene locus_tag LOCUS_07040 4807 5079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 >Feature sequence0122 139 1113 gene locus_tag LOCUS_07050 139 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 1899 1192 gene locus_tag LOCUS_07060 gene pyrE 1899 1192 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MF81 protein_id gnl|my_center|LOCUS_07060 2263 3189 gene locus_tag LOCUS_07070 2263 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 3261 4652 gene locus_tag LOCUS_07080 3261 4652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 4806 5762 gene locus_tag LOCUS_07090 4806 5762 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869707.1 protein_id gnl|my_center|LOCUS_07090 >Feature sequence0123 3 938 gene locus_tag LOCUS_07100 gene mutY 3 938 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404847.1 protein_id gnl|my_center|LOCUS_07100 1286 2377 gene locus_tag LOCUS_07110 gene dnaN 1286 2377 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7C4 protein_id gnl|my_center|LOCUS_07110 2693 2959 gene locus_tag LOCUS_07120 2693 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 2959 3519 gene locus_tag LOCUS_07130 2959 3519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 3713 6205 gene locus_tag LOCUS_07140 gene gyrB 3713 6205 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8Y9 protein_id gnl|my_center|LOCUS_07140 >Feature sequence0124 269 1177 gene locus_tag LOCUS_07150 gene dapA 269 1177 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037553.1 protein_id gnl|my_center|LOCUS_07150 2049 1231 gene locus_tag LOCUS_07160 2049 1231 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404077.1 protein_id gnl|my_center|LOCUS_07160 4568 2304 gene locus_tag LOCUS_07170 4568 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 6184 4559 gene locus_tag LOCUS_07180 6184 4559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 >Feature sequence0125 1890 259 gene locus_tag LOCUS_07190 gene nadB 1890 259 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92R32 protein_id gnl|my_center|LOCUS_07190 2936 1887 gene locus_tag LOCUS_07200 gene nadA 2936 1887 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89S63 protein_id gnl|my_center|LOCUS_07200 3771 3268 gene locus_tag LOCUS_07210 3771 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 3946 4599 gene locus_tag LOCUS_07220 3946 4599 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_07220 >Feature sequence0126 2 181 gene locus_tag LOCUS_07230 2 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 178 903 gene locus_tag LOCUS_07240 gene leuD 178 903 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDX5 protein_id gnl|my_center|LOCUS_07240 900 1997 gene locus_tag LOCUS_07250 gene leuB 900 1997 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAR7 protein_id gnl|my_center|LOCUS_07250 3269 2196 gene locus_tag LOCUS_07260 3269 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 4988 3309 gene locus_tag LOCUS_07270 4988 3309 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228221.1 protein_id gnl|my_center|LOCUS_07270 5248 4988 gene locus_tag LOCUS_07280 5248 4988 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720744.1 protein_id gnl|my_center|LOCUS_07280 >Feature sequence0127 <1 831 gene locus_tag LOCUS_07290 <1 831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250640.1:alkaline serine protease 1032 4163 gene locus_tag LOCUS_07300 1032 4163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 4240 4944 gene locus_tag LOCUS_07310 4240 4944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 6177 4993 gene locus_tag LOCUS_07320 6177 4993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 >Feature sequence0128 3 311 gene locus_tag LOCUS_07330 3 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 337 1335 gene locus_tag LOCUS_07340 337 1335 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SIC8 protein_id gnl|my_center|LOCUS_07340 1533 2021 gene locus_tag LOCUS_07350 gene dcd 1533 2021 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E3D845 protein_id gnl|my_center|LOCUS_07350 2557 4026 gene locus_tag LOCUS_07360 2557 4026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 4272 5729 gene locus_tag LOCUS_07370 4272 5729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 >Feature sequence0129 633 2132 gene locus_tag LOCUS_07380 633 2132 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_07380 2148 3269 gene locus_tag LOCUS_07390 2148 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 4804 3263 gene locus_tag LOCUS_07400 4804 3263 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_07400 >Feature sequence0130 2894 1074 gene locus_tag LOCUS_07410 2894 1074 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_07410 5263 3290 gene locus_tag LOCUS_07420 5263 3290 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902257.1 protein_id gnl|my_center|LOCUS_07420 >Feature sequence0131 5250 1468 gene locus_tag LOCUS_07430 5250 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 5929 5264 gene locus_tag LOCUS_07440 5929 5264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531332.1 protein_id gnl|my_center|LOCUS_07440 >Feature sequence0132 148 5754 gene locus_tag LOCUS_07450 148 5754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 >Feature sequence0133 1310 765 gene locus_tag LOCUS_07460 1310 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 4120 1640 gene locus_tag LOCUS_07470 4120 1640 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546857.1 protein_id gnl|my_center|LOCUS_07470 <6110 4801 gene locus_tag LOCUS_07480 <6110 4801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391709.1:ATP-dependent Clp protease ATP-binding subunit ClpC >Feature sequence0134 607 41 gene locus_tag LOCUS_07490 607 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 1242 604 gene locus_tag LOCUS_07500 1242 604 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGE6 protein_id gnl|my_center|LOCUS_07500 1568 1239 gene locus_tag LOCUS_07510 1568 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 1963 5286 gene locus_tag LOCUS_07520 1963 5286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 >Feature sequence0135 273 611 gene locus_tag LOCUS_07530 273 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 777 1913 gene locus_tag LOCUS_07540 777 1913 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803946.1 protein_id gnl|my_center|LOCUS_07540 2239 3693 gene locus_tag LOCUS_07550 2239 3693 CDS product UDP-phosphate galactose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259098.1 protein_id gnl|my_center|LOCUS_07550 3807 4895 gene locus_tag LOCUS_07560 3807 4895 CDS product ADP-heptose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057610.1 protein_id gnl|my_center|LOCUS_07560 4957 5436 gene locus_tag LOCUS_07570 4957 5436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 >Feature sequence0136 1521 2189 gene locus_tag LOCUS_07580 1521 2189 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704391.1 protein_id gnl|my_center|LOCUS_07580 3389 2226 gene locus_tag LOCUS_07590 3389 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 4370 3453 gene locus_tag LOCUS_07600 4370 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 <6083 4567 gene locus_tag LOCUS_07610 <6083 4567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083081.1:cytosine deaminase >Feature sequence0137 1589 579 gene locus_tag LOCUS_07620 1589 579 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103810.1 protein_id gnl|my_center|LOCUS_07620 1757 3886 gene locus_tag LOCUS_07630 1757 3886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 3991 5295 gene locus_tag LOCUS_07640 3991 5295 CDS product hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039084.1 protein_id gnl|my_center|LOCUS_07640 >Feature sequence0138 710 2362 gene locus_tag LOCUS_07650 710 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07650 2405 3763 gene locus_tag LOCUS_07660 2405 3763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07660 >Feature sequence0139 1757 1317 gene locus_tag LOCUS_07670 1757 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 2255 1839 gene locus_tag LOCUS_07680 2255 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 2509 2802 gene locus_tag LOCUS_07690 2509 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 2975 3469 gene locus_tag LOCUS_07700 2975 3469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 3576 4055 gene locus_tag LOCUS_07710 3576 4055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 4101 5447 gene locus_tag LOCUS_07720 gene pfkA 4101 5447 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AD6 protein_id gnl|my_center|LOCUS_07720 >Feature sequence0140 <1 975 gene locus_tag LOCUS_07730 <1 975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035568.1:conditioned medium factor 2137 1124 gene locus_tag LOCUS_07740 2137 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 4073 2346 gene locus_tag LOCUS_07750 4073 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 5360 4254 gene locus_tag LOCUS_07760 5360 4254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 >Feature sequence0141 2622 772 gene locus_tag LOCUS_07770 2622 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 4583 2778 gene locus_tag LOCUS_07780 4583 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 <6003 4687 gene locus_tag LOCUS_07790 <6003 4687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123036.1:protein kinase >Feature sequence0142 260 1018 gene locus_tag LOCUS_07800 260 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 1107 1778 gene locus_tag LOCUS_07810 gene rpe 1107 1778 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H188 protein_id gnl|my_center|LOCUS_07810 1844 2677 gene locus_tag LOCUS_07820 1844 2677 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546017.1 protein_id gnl|my_center|LOCUS_07820 2733 3629 gene locus_tag LOCUS_07830 2733 3629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 3922 5211 gene locus_tag LOCUS_07840 3922 5211 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704267.1 protein_id gnl|my_center|LOCUS_07840 5422 5688 gene locus_tag LOCUS_07850 5422 5688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 >Feature sequence0143 1133 1057 gene locus_tag LOCUS_t00050 1133 1057 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1574 1269 gene locus_tag LOCUS_07860 1574 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 2691 2092 gene locus_tag LOCUS_07870 gene sodA 2691 2092 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HDP2 protein_id gnl|my_center|LOCUS_07870 3113 3189 gene locus_tag LOCUS_t00060 3113 3189 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3436 3512 gene locus_tag LOCUS_t00070 3436 3512 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 3706 3861 gene locus_tag LOCUS_07880 gene rpmG 3706 3861 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM33 protein_id gnl|my_center|LOCUS_07880 3898 5283 gene locus_tag LOCUS_07890 gene mtaD 3898 5283 CDS product 5-methylthioadenosine/S-adenosylhomocysteine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJ51 protein_id gnl|my_center|LOCUS_07890 >Feature sequence0144 >Feature sequence0145 1415 1711 gene locus_tag LOCUS_07900 1415 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 1840 3315 gene locus_tag LOCUS_07910 1840 3315 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0P8 protein_id gnl|my_center|LOCUS_07910 4681 3377 gene locus_tag LOCUS_07920 gene GALNS 4681 3377 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121616.1 protein_id gnl|my_center|LOCUS_07920 5005 5538 gene locus_tag LOCUS_07930 5005 5538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 >Feature sequence0146 219 854 gene locus_tag LOCUS_07940 219 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016561.1 protein_id gnl|my_center|LOCUS_07940 1216 1007 gene locus_tag LOCUS_07950 1216 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 1231 4311 gene locus_tag LOCUS_07960 1231 4311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 >Feature sequence0147 1235 405 gene locus_tag LOCUS_07970 1235 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728394.1 protein_id gnl|my_center|LOCUS_07970 1333 3888 gene locus_tag LOCUS_07980 1333 3888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141479.1 protein_id gnl|my_center|LOCUS_07980 >Feature sequence0148 <1 862 gene locus_tag LOCUS_07990 <1 862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203562.1:alpha-1,3-fucosyltransferase 1706 930 gene locus_tag LOCUS_08000 1706 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 1795 2091 gene locus_tag LOCUS_08010 1795 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 2196 2708 gene locus_tag LOCUS_08020 2196 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 2843 3325 gene locus_tag LOCUS_08030 2843 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 3394 4563 gene locus_tag LOCUS_08040 3394 4563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 >Feature sequence0149 <1 545 gene locus_tag LOCUS_08050 <1 545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120088.1:IS256 family transposase 1652 900 gene locus_tag LOCUS_08060 1652 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 2093 4504 gene locus_tag LOCUS_08070 2093 4504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945803.1 protein_id gnl|my_center|LOCUS_08070 >Feature sequence0150 <1 2161 gene locus_tag LOCUS_08080 <1 2161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000849249.1:phospholipase 2287 2865 gene locus_tag LOCUS_08090 2287 2865 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_08090 5421 2905 gene locus_tag LOCUS_08100 5421 2905 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037079.1 protein_id gnl|my_center|LOCUS_08100 5843 5613 gene locus_tag LOCUS_08110 5843 5613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 >Feature sequence0151 <1 768 gene locus_tag LOCUS_08120 <1 768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZNN2:Na(+)/H(+) antiporter NhaA 2 3510 901 gene locus_tag LOCUS_08130 3510 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 3657 4094 gene locus_tag LOCUS_08140 3657 4094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920749.1 protein_id gnl|my_center|LOCUS_08140 4099 4656 gene locus_tag LOCUS_08150 4099 4656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 5266 4775 gene locus_tag LOCUS_08160 5266 4775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 >Feature sequence0152 284 2563 gene locus_tag LOCUS_08170 284 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 3757 2609 gene locus_tag LOCUS_08180 3757 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 4985 3987 gene locus_tag LOCUS_08190 4985 3987 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391950.1 protein_id gnl|my_center|LOCUS_08190 >Feature sequence0153 2943 1564 gene locus_tag LOCUS_08200 gene mpl 2943 1564 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403684.1 protein_id gnl|my_center|LOCUS_08200 3230 4255 gene locus_tag LOCUS_08210 3230 4255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 4899 4369 gene locus_tag LOCUS_08220 4899 4369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 5752 4892 gene locus_tag LOCUS_08230 5752 4892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 >Feature sequence0154 4322 1227 gene locus_tag LOCUS_08240 4322 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 4973 4464 gene locus_tag LOCUS_08250 4973 4464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 5381 5109 gene locus_tag LOCUS_08260 5381 5109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 >Feature sequence0155 77 793 gene locus_tag LOCUS_08270 77 793 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037361.1 protein_id gnl|my_center|LOCUS_08270 1329 2249 gene locus_tag LOCUS_08280 1329 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 3387 2686 gene locus_tag LOCUS_08290 3387 2686 CDS product tRNA/rRNA methyltransferase SpoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393254.1 protein_id gnl|my_center|LOCUS_08290 3554 4054 gene locus_tag LOCUS_08300 3554 4054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 4295 5437 gene locus_tag LOCUS_08310 gene metK 4295 5437 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHE2 protein_id gnl|my_center|LOCUS_08310 >Feature sequence0156 <1 1382 gene locus_tag LOCUS_08320 <1 1382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941581.1:heme ABC transporter ATPase 1469 2569 gene locus_tag LOCUS_08330 gene clpX 1469 2569 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67356 protein_id gnl|my_center|LOCUS_08330 2621 3940 gene locus_tag LOCUS_08340 2621 3940 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_08340 >Feature sequence0157 <1 647 gene locus_tag LOCUS_08350 <1 647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226170.1:CDP-6-deoxy-delta-3,4-glucoseen reductase 1000 1968 gene locus_tag LOCUS_08360 1000 1968 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338984.1 protein_id gnl|my_center|LOCUS_08360 1965 2681 gene locus_tag LOCUS_08370 1965 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 2678 3637 gene locus_tag LOCUS_08380 2678 3637 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081376.1 protein_id gnl|my_center|LOCUS_08380 3637 4626 gene locus_tag LOCUS_08390 gene oppC 3637 4626 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880981.1 protein_id gnl|my_center|LOCUS_08390 4940 4752 gene locus_tag LOCUS_08400 4940 4752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 >Feature sequence0158 1594 2841 gene locus_tag LOCUS_08410 1594 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 3884 2850 gene locus_tag LOCUS_08420 3884 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 4443 3907 gene locus_tag LOCUS_08430 4443 3907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 >Feature sequence0159 711 2408 gene locus_tag LOCUS_08440 711 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 4317 2509 gene locus_tag LOCUS_08450 4317 2509 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403922.1 protein_id gnl|my_center|LOCUS_08450 5517 4459 gene locus_tag LOCUS_08460 gene mtnA 5517 4459 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X013 protein_id gnl|my_center|LOCUS_08460 >Feature sequence0160 746 1093 gene locus_tag LOCUS_08470 746 1093 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122598.1 protein_id gnl|my_center|LOCUS_08470 1132 1992 gene locus_tag LOCUS_08480 1132 1992 CDS product phosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061131.1 protein_id gnl|my_center|LOCUS_08480 1955 2839 gene locus_tag LOCUS_08490 1955 2839 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DX88 protein_id gnl|my_center|LOCUS_08490 2934 3707 gene locus_tag LOCUS_08500 gene pstA2 2934 3707 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E4D9 protein_id gnl|my_center|LOCUS_08500 3704 4513 gene locus_tag LOCUS_08510 gene pstB2 3704 4513 CDS product phosphate import ATP-binding protein PstB 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9I8 protein_id gnl|my_center|LOCUS_08510 >Feature sequence0161 108 1094 gene locus_tag LOCUS_08520 108 1094 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496450.1 protein_id gnl|my_center|LOCUS_08520 1265 1843 gene locus_tag LOCUS_08530 1265 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 2413 1868 gene locus_tag LOCUS_08540 2413 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 2964 2425 gene locus_tag LOCUS_08550 2964 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167115.1 protein_id gnl|my_center|LOCUS_08550 3981 2986 gene locus_tag LOCUS_08560 3981 2986 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064349.1 protein_id gnl|my_center|LOCUS_08560 4974 4042 gene locus_tag LOCUS_08570 4974 4042 CDS product RNA polymerase sigma24 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977567.1 protein_id gnl|my_center|LOCUS_08570 <5610 5020 gene locus_tag LOCUS_08580 <5610 5020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000713010.1:dehydrogenase >Feature sequence0162 2105 1785 gene locus_tag LOCUS_08590 gene clpS 2105 1785 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RWS9 protein_id gnl|my_center|LOCUS_08590 2334 3428 gene locus_tag LOCUS_08600 2334 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112360.1 protein_id gnl|my_center|LOCUS_08600 4579 3557 gene locus_tag LOCUS_08610 4579 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 <5609 4708 gene locus_tag LOCUS_08620 <5609 4708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012709510.1:epimerase >Feature sequence0163 315 1019 gene locus_tag LOCUS_08630 315 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08630 1016 2227 gene locus_tag LOCUS_08640 1016 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08640 2802 5216 gene locus_tag LOCUS_08650 2802 5216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 5206 5400 gene locus_tag LOCUS_08660 5206 5400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 >Feature sequence0164 730 38 gene locus_tag LOCUS_08670 730 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 1069 773 gene locus_tag LOCUS_08680 1069 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 1646 1149 gene locus_tag LOCUS_08690 1646 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 2461 1772 gene locus_tag LOCUS_08700 2461 1772 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546351.1 protein_id gnl|my_center|LOCUS_08700 3244 2486 gene locus_tag LOCUS_08710 3244 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 3365 3292 gene locus_tag LOCUS_t00080 3365 3292 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4959 3451 gene locus_tag LOCUS_08720 4959 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 >Feature sequence0165 <1 1070 gene locus_tag LOCUS_08730 <1 1070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962454.1:peptidase M36 3178 1166 gene locus_tag LOCUS_08740 3178 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 >Feature sequence0166 81 584 gene locus_tag LOCUS_08750 81 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 581 2713 gene locus_tag LOCUS_08760 581 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 4110 2860 gene locus_tag LOCUS_08770 4110 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 5395 4154 gene locus_tag LOCUS_08780 5395 4154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 >Feature sequence0167 1389 31 gene locus_tag LOCUS_08790 1389 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 1612 1788 gene locus_tag LOCUS_08800 1612 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 3218 2316 gene locus_tag LOCUS_08810 3218 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 4793 3288 gene locus_tag LOCUS_08820 4793 3288 CDS product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887609.1 protein_id gnl|my_center|LOCUS_08820 >Feature sequence0168 637 1635 gene locus_tag LOCUS_08830 637 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 1874 2818 gene locus_tag LOCUS_08840 gene ctaB 1874 2818 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S012 protein_id gnl|my_center|LOCUS_08840 2889 3515 gene locus_tag LOCUS_08850 2889 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 4761 3484 gene locus_tag LOCUS_08860 4761 3484 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943373.1 protein_id gnl|my_center|LOCUS_08860 >Feature sequence0169 1541 483 gene locus_tag LOCUS_08870 1541 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 1787 1551 gene locus_tag LOCUS_08880 1787 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 1828 2667 gene locus_tag LOCUS_08890 1828 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 >Feature sequence0170 2229 919 gene locus_tag LOCUS_08900 2229 919 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068542.1 protein_id gnl|my_center|LOCUS_08900 3344 2448 gene locus_tag LOCUS_08910 3344 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 5524 3977 gene locus_tag LOCUS_08920 5524 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 >Feature sequence0171 3167 3526 gene locus_tag LOCUS_08930 3167 3526 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108621.1 protein_id gnl|my_center|LOCUS_08930 3523 4800 gene locus_tag LOCUS_08940 3523 4800 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919382.1 protein_id gnl|my_center|LOCUS_08940 >Feature sequence0172 1472 1563 gene locus_tag LOCUS_t00090 1472 1563 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1893 3890 gene locus_tag LOCUS_08950 1893 3890 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142294.1 protein_id gnl|my_center|LOCUS_08950 5124 3976 gene locus_tag LOCUS_08960 5124 3976 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897309.1 protein_id gnl|my_center|LOCUS_08960 >Feature sequence0173 1524 682 gene locus_tag LOCUS_08970 1524 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 1956 2960 gene locus_tag LOCUS_08980 gene pheS 1956 2960 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDN0 protein_id gnl|my_center|LOCUS_08980 >Feature sequence0174 <1 1286 gene locus_tag LOCUS_08990 <1 1286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257951.1:thiamine pyrophosphate protein central region 1600 2583 gene locus_tag LOCUS_09000 1600 2583 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AE7 protein_id gnl|my_center|LOCUS_09000 >Feature sequence0175 414 1136 gene locus_tag LOCUS_09010 414 1136 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947293.1 protein_id gnl|my_center|LOCUS_09010 1803 1153 gene locus_tag LOCUS_09020 1803 1153 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_09020 3272 1803 gene locus_tag LOCUS_09030 3272 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 3532 3807 gene locus_tag LOCUS_09040 3532 3807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 >Feature sequence0176 239 114 gene locus_tag LOCUS_09050 239 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 571 762 gene locus_tag LOCUS_09060 571 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 3186 2497 gene locus_tag LOCUS_09070 gene phoP 3186 2497 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357427.1 protein_id gnl|my_center|LOCUS_09070 5119 3215 gene locus_tag LOCUS_09080 5119 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 >Feature sequence0177 2763 2209 gene locus_tag LOCUS_09090 2763 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 3861 2770 gene locus_tag LOCUS_09100 gene ychF 3861 2770 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC2 protein_id gnl|my_center|LOCUS_09100 5351 4227 gene locus_tag LOCUS_09110 gene wecE 5351 4227 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538757.1 protein_id gnl|my_center|LOCUS_09110 >Feature sequence0178 2057 546 gene locus_tag LOCUS_09120 2057 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 3646 2054 gene locus_tag LOCUS_09130 3646 2054 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404644.1 protein_id gnl|my_center|LOCUS_09130 3923 4645 gene locus_tag LOCUS_09140 3923 4645 CDS product UPF0502 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GL3 protein_id gnl|my_center|LOCUS_09140 >Feature sequence0179 <1 995 gene locus_tag LOCUS_09150 <1 995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003088336.1:ABC-F family ATPase 1078 1974 gene locus_tag LOCUS_09160 1078 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074019.1 protein_id gnl|my_center|LOCUS_09160 1999 2706 gene locus_tag LOCUS_09170 gene sfsA 1999 2706 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61664 protein_id gnl|my_center|LOCUS_09170 2764 3846 gene locus_tag LOCUS_09180 2764 3846 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762579.1 protein_id gnl|my_center|LOCUS_09180 3853 4596 gene locus_tag LOCUS_09190 3853 4596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100328.1 protein_id gnl|my_center|LOCUS_09190 4802 5422 gene locus_tag LOCUS_09200 gene ppa 4802 5422 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67501 protein_id gnl|my_center|LOCUS_09200 >Feature sequence0180 344 117 gene locus_tag LOCUS_09210 344 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 2246 576 gene locus_tag LOCUS_09220 2246 576 CDS product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902419.1 protein_id gnl|my_center|LOCUS_09220 2276 2452 gene locus_tag LOCUS_09230 2276 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 2546 2968 gene locus_tag LOCUS_09240 2546 2968 CDS product heat-shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804865.1 protein_id gnl|my_center|LOCUS_09240 2972 4303 gene locus_tag LOCUS_09250 gene galK 2972 4303 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQH8 protein_id gnl|my_center|LOCUS_09250 >Feature sequence0181 794 2989 gene locus_tag LOCUS_09260 794 2989 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112888.1 protein_id gnl|my_center|LOCUS_09260 2991 3749 gene locus_tag LOCUS_09270 2991 3749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 >Feature sequence0182 1434 2264 gene locus_tag LOCUS_09280 1434 2264 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029631.1 protein_id gnl|my_center|LOCUS_09280 >Feature sequence0183 673 1122 gene locus_tag LOCUS_09290 gene ytoQ 673 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34305 protein_id gnl|my_center|LOCUS_09290 2192 1167 gene locus_tag LOCUS_09300 2192 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 2599 4950 gene locus_tag LOCUS_09310 2599 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 >Feature sequence0184 2741 1416 gene locus_tag LOCUS_09320 2741 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 4798 3005 gene locus_tag LOCUS_09330 4798 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 >Feature sequence0185 807 2075 gene locus_tag LOCUS_09340 807 2075 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482970.1 protein_id gnl|my_center|LOCUS_09340 2086 3147 gene locus_tag LOCUS_09350 2086 3147 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089020.1 protein_id gnl|my_center|LOCUS_09350 4105 3185 gene locus_tag LOCUS_09360 4105 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 4127 4312 gene locus_tag LOCUS_09370 4127 4312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 >Feature sequence0186 3450 2731 gene locus_tag LOCUS_09380 3450 2731 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WKD5 protein_id gnl|my_center|LOCUS_09380 3521 4972 gene locus_tag LOCUS_09390 gene gatB 3521 4972 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61343 protein_id gnl|my_center|LOCUS_09390 >Feature sequence0187 158 898 gene locus_tag LOCUS_09400 158 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 1073 888 gene locus_tag LOCUS_09410 1073 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 1465 1052 gene locus_tag LOCUS_09420 1465 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 1596 3980 gene locus_tag LOCUS_09430 1596 3980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 >Feature sequence0188 1399 518 gene locus_tag LOCUS_09440 1399 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 2280 1399 gene locus_tag LOCUS_09450 2280 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 2613 2296 gene locus_tag LOCUS_09460 2613 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 3256 2606 gene locus_tag LOCUS_09470 3256 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 >Feature sequence0189 588 1283 gene locus_tag LOCUS_09480 588 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 1946 1416 gene locus_tag LOCUS_09490 1946 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 2568 2323 gene locus_tag LOCUS_09500 2568 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 2629 3078 gene locus_tag LOCUS_09510 2629 3078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 >Feature sequence0190 <1 1426 gene locus_tag LOCUS_09520 <1 1426 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004530004.1:non-ribosomal peptide synthase 2638 1685 gene locus_tag LOCUS_09530 2638 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 3174 2638 gene locus_tag LOCUS_09540 3174 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 4183 3194 gene locus_tag LOCUS_09550 gene kdsD 4183 3194 CDS product arabinose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942538.1 protein_id gnl|my_center|LOCUS_09550 5106 4180 gene locus_tag LOCUS_09560 gene kdsA 5106 4180 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66496 protein_id gnl|my_center|LOCUS_09560 >Feature sequence0191 2123 597 gene locus_tag LOCUS_09570 2123 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 2543 4255 gene locus_tag LOCUS_09580 2543 4255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 >Feature sequence0192 668 1738 gene locus_tag LOCUS_09590 668 1738 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393452.1 protein_id gnl|my_center|LOCUS_09590 4927 1925 gene locus_tag LOCUS_09600 4927 1925 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109196.1 protein_id gnl|my_center|LOCUS_09600 >Feature sequence0193 <1 1881 gene locus_tag LOCUS_09610 <1 1881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123866.1:adhesin 2184 2636 gene locus_tag LOCUS_09620 2184 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 3359 2670 gene locus_tag LOCUS_09630 3359 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 3572 3943 gene locus_tag LOCUS_09640 3572 3943 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142971.1 protein_id gnl|my_center|LOCUS_09640 >Feature sequence0194 2047 2790 gene locus_tag LOCUS_09650 2047 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 2918 3913 gene locus_tag LOCUS_09660 2918 3913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 4934 4035 gene locus_tag LOCUS_09670 4934 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 >Feature sequence0195 1255 986 gene locus_tag LOCUS_09680 1255 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 1868 1479 gene locus_tag LOCUS_09690 1868 1479 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272733.1 protein_id gnl|my_center|LOCUS_09690 3382 2429 gene locus_tag LOCUS_09700 gene czcD 3382 2429 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122027.1 protein_id gnl|my_center|LOCUS_09700 5256 3382 gene locus_tag LOCUS_09710 5256 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 >Feature sequence0196 847 1800 gene locus_tag LOCUS_09720 847 1800 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256277.1 protein_id gnl|my_center|LOCUS_09720 1837 3798 gene locus_tag LOCUS_09730 1837 3798 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119822.1 protein_id gnl|my_center|LOCUS_09730 4589 3771 gene locus_tag LOCUS_09740 gene rph 4589 3771 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5T5 protein_id gnl|my_center|LOCUS_09740 <5248 4688 gene locus_tag LOCUS_09750 <5248 4688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q748S8:glutamate racemase >Feature sequence0197 2331 514 gene locus_tag LOCUS_09760 gene dnaK 2331 514 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H59 protein_id gnl|my_center|LOCUS_09760 3519 2734 gene locus_tag LOCUS_09770 3519 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 4510 3638 gene locus_tag LOCUS_09780 gene hrcA 4510 3638 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H61 protein_id gnl|my_center|LOCUS_09780 >Feature sequence0198 74 1054 gene locus_tag LOCUS_09790 74 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 1703 1239 gene locus_tag LOCUS_09800 1703 1239 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038200.1 protein_id gnl|my_center|LOCUS_09800 1936 3942 gene locus_tag LOCUS_09810 gene glgX 1936 3942 CDS product glycogen operon protein GlgX homolog inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KR57 protein_id gnl|my_center|LOCUS_09810 4122 5075 gene locus_tag LOCUS_09820 gene glk 4122 5075 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLF5 protein_id gnl|my_center|LOCUS_09820 >Feature sequence0199 662 87 gene locus_tag LOCUS_09830 662 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 834 1655 gene locus_tag LOCUS_09840 gene mutM 834 1655 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3C4 protein_id gnl|my_center|LOCUS_09840 1715 2593 gene locus_tag LOCUS_09850 1715 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 2872 3144 gene locus_tag LOCUS_09860 2872 3144 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939702.1 protein_id gnl|my_center|LOCUS_09860 4032 3361 gene locus_tag LOCUS_09870 4032 3361 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932468.1 protein_id gnl|my_center|LOCUS_09870 4355 4798 gene locus_tag LOCUS_09880 4355 4798 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189082.1 protein_id gnl|my_center|LOCUS_09880 >Feature sequence0200 890 393 gene locus_tag LOCUS_09890 890 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 2410 1031 gene locus_tag LOCUS_09900 2410 1031 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118049.1 protein_id gnl|my_center|LOCUS_09900 3182 2553 gene locus_tag LOCUS_09910 3182 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 3927 3205 gene locus_tag LOCUS_09920 3927 3205 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087759.1 protein_id gnl|my_center|LOCUS_09920 4239 4066 gene locus_tag LOCUS_09930 4239 4066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 4866 4468 gene locus_tag LOCUS_09940 4866 4468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 >Feature sequence0201 35 3235 gene locus_tag LOCUS_09950 35 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 4481 3261 gene locus_tag LOCUS_09960 4481 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 4982 4650 gene locus_tag LOCUS_09970 4982 4650 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887589.1 protein_id gnl|my_center|LOCUS_09970 >Feature sequence0202 2121 2735 gene locus_tag LOCUS_09980 2121 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 >Feature sequence0203 <1 2118 gene locus_tag LOCUS_09990 <1 2118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000615086.1:cholesterol oxidase 2150 4504 gene locus_tag LOCUS_10000 2150 4504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 >Feature sequence0204 1201 722 gene locus_tag LOCUS_10010 1201 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 1444 3192 gene locus_tag LOCUS_10020 1444 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 3248 4027 gene locus_tag LOCUS_10030 3248 4027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 >Feature sequence0205 1128 157 gene locus_tag LOCUS_10040 gene asd 1128 157 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHE3 protein_id gnl|my_center|LOCUS_10040 2247 1396 gene locus_tag LOCUS_10050 gene pssA 2247 1396 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942552.1 protein_id gnl|my_center|LOCUS_10050 2889 2671 gene locus_tag LOCUS_10060 2889 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 3332 4489 gene locus_tag LOCUS_10070 3332 4489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 >Feature sequence0206 >Feature sequence0207 2010 850 gene locus_tag LOCUS_10080 2010 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085074.1 protein_id gnl|my_center|LOCUS_10080 2322 4454 gene locus_tag LOCUS_10090 2322 4454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 4660 5079 gene locus_tag LOCUS_10100 4660 5079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 >Feature sequence0208 <1 1127 gene locus_tag LOCUS_10110 <1 1127 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942139.1:type II secretion system protein F 1274 3181 gene locus_tag LOCUS_10120 gene pilS 1274 3181 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942140.1 protein_id gnl|my_center|LOCUS_10120 3193 4566 gene locus_tag LOCUS_10130 gene pilR 3193 4566 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_10130 >Feature sequence0209 <1 1317 gene locus_tag LOCUS_10140 <1 1317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259373.1:histidine kinase 1608 3380 gene locus_tag LOCUS_10150 1608 3380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 3525 3944 gene locus_tag LOCUS_10160 3525 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 <5125 4332 gene locus_tag LOCUS_10170 <5125 4332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259373.1:histidine kinase >Feature sequence0210 2196 70 gene locus_tag LOCUS_10180 2196 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 >Feature sequence0211 2428 2527 gene locus_tag LOCUS_t00100 2428 2527 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 3880 2681 gene locus_tag LOCUS_10190 gene moeA 3880 2681 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943341.1 protein_id gnl|my_center|LOCUS_10190 4109 4831 gene locus_tag LOCUS_10200 4109 4831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 >Feature sequence0212 <1 1427 gene locus_tag LOCUS_10210 <1 1427 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P63430:putative acyl-CoA dehydrogenase FadE10 1685 1885 gene locus_tag LOCUS_10220 1685 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 2524 4422 gene locus_tag LOCUS_10230 gene dnaK 2524 4422 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H59 protein_id gnl|my_center|LOCUS_10230 4617 4997 gene locus_tag LOCUS_10240 gene merR 4617 4997 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880418.1 protein_id gnl|my_center|LOCUS_10240 >Feature sequence0213 <1 520 gene locus_tag LOCUS_10250 <1 520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P55631:putative transposase y4qJ 2465 975 gene locus_tag LOCUS_10260 2465 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123104.1 protein_id gnl|my_center|LOCUS_10260 3633 2671 gene locus_tag LOCUS_10270 3633 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 4576 3956 gene locus_tag LOCUS_10280 4576 3956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 <5101 4588 gene locus_tag LOCUS_10290 <5101 4588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141821.1:quercetin 2,3-dioxygenase >Feature sequence0214 271 1005 gene locus_tag LOCUS_10300 271 1005 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057460.1 protein_id gnl|my_center|LOCUS_10300 1082 3487 gene locus_tag LOCUS_10310 1082 3487 CDS product beta-lactam antibiotic acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110242.1 protein_id gnl|my_center|LOCUS_10310 3695 4624 gene locus_tag LOCUS_10320 3695 4624 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I583 protein_id gnl|my_center|LOCUS_10320 5080 4673 gene locus_tag LOCUS_10330 5080 4673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 >Feature sequence0215 <1 1262 gene locus_tag LOCUS_10340 <1 1262 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036622.1:asparagine synthetase B 1300 2424 gene locus_tag LOCUS_10350 1300 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 4311 2452 gene locus_tag LOCUS_10360 gene gaa 4311 2452 CDS product glutaryl-7-ACA acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_10360 4630 4788 gene locus_tag LOCUS_10370 4630 4788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 >Feature sequence0216 1644 505 gene locus_tag LOCUS_10380 1644 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 1855 3135 gene locus_tag LOCUS_10390 1855 3135 CDS product rRNA (guanine-N2)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886697.1 protein_id gnl|my_center|LOCUS_10390 <5092 3542 gene locus_tag LOCUS_10400 <5092 3542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962454.1:peptidase M36 >Feature sequence0217 1807 4209 gene locus_tag LOCUS_10410 1807 4209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 <5092 4347 gene locus_tag LOCUS_10420 <5092 4347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265999.1:ATP-grasp domain protein >Feature sequence0218 271 1038 gene locus_tag LOCUS_10430 gene rsmA 271 1038 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C862 protein_id gnl|my_center|LOCUS_10430 1562 4864 gene locus_tag LOCUS_10440 1562 4864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 >Feature sequence0219 <1 1722 gene locus_tag LOCUS_10450 <1 1722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259699.1:beta-glucosidase 1719 4175 gene locus_tag LOCUS_10460 1719 4175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 4172 4714 gene locus_tag LOCUS_10470 4172 4714 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RT56 protein_id gnl|my_center|LOCUS_10470 >Feature sequence0220 1169 3790 gene locus_tag LOCUS_10480 1169 3790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 >Feature sequence0221 <1 733 gene locus_tag LOCUS_10490 <1 733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404732.1:pantothenate permease 868 1401 gene locus_tag LOCUS_10500 868 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 2569 1427 gene locus_tag LOCUS_10510 2569 1427 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031816.1 protein_id gnl|my_center|LOCUS_10510 4230 2566 gene locus_tag LOCUS_10520 4230 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 4706 4428 gene locus_tag LOCUS_10530 4706 4428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 >Feature sequence0222 1865 570 gene locus_tag LOCUS_10540 gene hemL 1865 570 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHH6 protein_id gnl|my_center|LOCUS_10540 2756 1926 gene locus_tag LOCUS_10550 2756 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 3707 2796 gene locus_tag LOCUS_10560 gene hemC 3707 2796 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WIS3 protein_id gnl|my_center|LOCUS_10560 <5005 3704 gene locus_tag LOCUS_10570 <5005 3704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q72C23:glutamyl-tRNA reductase >Feature sequence0223 <1 682 gene locus_tag LOCUS_10580 <1 682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391410.1:glutamate dehydrogenase 897 2867 gene locus_tag LOCUS_10590 gene htpG 897 2867 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMJ7 protein_id gnl|my_center|LOCUS_10590 3184 4092 gene locus_tag LOCUS_10600 gene waaM 3184 4092 CDS product lipid A lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948625.1 protein_id gnl|my_center|LOCUS_10600 >Feature sequence0224 639 178 gene locus_tag LOCUS_10610 639 178 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406573.1 protein_id gnl|my_center|LOCUS_10610 904 743 gene locus_tag LOCUS_10620 904 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 1480 938 gene locus_tag LOCUS_10630 1480 938 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H57 protein_id gnl|my_center|LOCUS_10630 1682 3391 gene locus_tag LOCUS_10640 1682 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 4832 3402 gene locus_tag LOCUS_10650 4832 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 >Feature sequence0225 1295 3004 gene locus_tag LOCUS_10660 1295 3004 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_10660 3004 3954 gene locus_tag LOCUS_10670 3004 3954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225285.1 protein_id gnl|my_center|LOCUS_10670 4689 3991 gene locus_tag LOCUS_10680 4689 3991 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531378.1 protein_id gnl|my_center|LOCUS_10680 >Feature sequence0226 >Feature sequence0227 236 2047 gene locus_tag LOCUS_10690 236 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 2260 4260 gene locus_tag LOCUS_10700 2260 4260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 4496 4696 gene locus_tag LOCUS_10710 4496 4696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 >Feature sequence0228 1382 93 gene locus_tag LOCUS_10720 1382 93 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257610.1 protein_id gnl|my_center|LOCUS_10720 2224 1379 gene locus_tag LOCUS_10730 2224 1379 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97GN7 protein_id gnl|my_center|LOCUS_10730 3585 2368 gene locus_tag LOCUS_10740 3585 2368 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080272.1 protein_id gnl|my_center|LOCUS_10740 3957 4211 gene locus_tag LOCUS_10750 3957 4211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 4894 4244 gene locus_tag LOCUS_10760 gene msrA 4894 4244 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKH4 protein_id gnl|my_center|LOCUS_10760 >Feature sequence0229 <4966 1973 gene locus_tag LOCUS_10770 <4966 1973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760378.1:hybrid sensor histidine kinase/response regulator >Feature sequence0230 1139 2062 gene locus_tag LOCUS_10780 gene catE 1139 2062 CDS product catechol-2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54721 protein_id gnl|my_center|LOCUS_10780 >Feature sequence0231 1201 275 gene locus_tag LOCUS_10790 1201 275 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937728.1 protein_id gnl|my_center|LOCUS_10790 1378 2391 gene locus_tag LOCUS_10800 1378 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 2557 3456 gene locus_tag LOCUS_10810 2557 3456 CDS product molecular chaperone Hsp33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460517.1 protein_id gnl|my_center|LOCUS_10810 >Feature sequence0232 2644 2039 gene locus_tag LOCUS_10820 2644 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 2785 3747 gene locus_tag LOCUS_10830 2785 3747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 >Feature sequence0233 627 442 gene locus_tag LOCUS_10840 627 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 903 1955 gene locus_tag LOCUS_10850 903 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 2875 1988 gene locus_tag LOCUS_10860 2875 1988 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SI78 protein_id gnl|my_center|LOCUS_10860 3228 3899 gene locus_tag LOCUS_10870 3228 3899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 <4945 3939 gene locus_tag LOCUS_10880 <4945 3939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072930.1:periplasmic siderophore cleavage esterase IroE family protein >Feature sequence0234 <1 534 gene locus_tag LOCUS_10890 <1 534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057178.1:peptidase M16 665 2023 gene locus_tag LOCUS_10900 665 2023 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074151.1 protein_id gnl|my_center|LOCUS_10900 3445 2069 gene locus_tag LOCUS_10910 3445 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776294.1 protein_id gnl|my_center|LOCUS_10910 <4939 3442 gene locus_tag LOCUS_10920 <4939 3442 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392429.1:serine/threonine protein kinase >Feature sequence0235 1405 182 gene locus_tag LOCUS_10930 1405 182 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763226.1 protein_id gnl|my_center|LOCUS_10930 1778 3739 gene locus_tag LOCUS_10940 1778 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 3765 4259 gene locus_tag LOCUS_10950 3765 4259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 >Feature sequence0236 531 3368 gene locus_tag LOCUS_10960 531 3368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 >Feature sequence0237 318 1334 gene locus_tag LOCUS_10970 gene gluQ 318 1334 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BE3 protein_id gnl|my_center|LOCUS_10970 3600 1480 gene locus_tag LOCUS_10980 3600 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 >Feature sequence0238 4293 3175 gene locus_tag LOCUS_10990 4293 3175 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926967.1 protein_id gnl|my_center|LOCUS_10990 >Feature sequence0239 492 1739 gene locus_tag LOCUS_11000 492 1739 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202444.1 protein_id gnl|my_center|LOCUS_11000 1736 2932 gene locus_tag LOCUS_11010 1736 2932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 2925 4337 gene locus_tag LOCUS_11020 2925 4337 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786303.1 protein_id gnl|my_center|LOCUS_11020 >Feature sequence0240 217 89 gene locus_tag LOCUS_11030 217 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 1903 224 gene locus_tag LOCUS_11040 1903 224 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118364.1 protein_id gnl|my_center|LOCUS_11040 2208 1900 gene locus_tag LOCUS_11050 2208 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 3719 2208 gene locus_tag LOCUS_11060 3719 2208 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118365.1 protein_id gnl|my_center|LOCUS_11060 <4897 3716 gene locus_tag LOCUS_11070 <4897 3716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007328227.1:cation:proton antiporter >Feature sequence0241 1286 165 gene locus_tag LOCUS_11080 1286 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 2060 1314 gene locus_tag LOCUS_11090 2060 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 2679 2185 gene locus_tag LOCUS_11100 2679 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119100.1 protein_id gnl|my_center|LOCUS_11100 3598 2720 gene locus_tag LOCUS_11110 3598 2720 CDS product NmrA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028549.1 protein_id gnl|my_center|LOCUS_11110 4842 3835 gene locus_tag LOCUS_11120 4842 3835 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113970.1 protein_id gnl|my_center|LOCUS_11120 >Feature sequence0242 3533 2091 gene locus_tag LOCUS_11130 3533 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 4876 4046 gene locus_tag LOCUS_11140 4876 4046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 >Feature sequence0243 2063 1209 gene locus_tag LOCUS_11150 2063 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071847.1 protein_id gnl|my_center|LOCUS_11150 3783 2554 gene locus_tag LOCUS_11160 3783 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 4019 3944 gene locus_tag LOCUS_t00110 4019 3944 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 <4877 4088 gene locus_tag LOCUS_11170 <4877 4088 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KCN0:GTPase HflX >Feature sequence0244 2519 492 gene locus_tag LOCUS_11180 2519 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 3073 2516 gene locus_tag LOCUS_11190 3073 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 >Feature sequence0245 378 1007 gene locus_tag LOCUS_11200 378 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 1038 2327 gene locus_tag LOCUS_11210 gene ftsA 1038 2327 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122747.1 protein_id gnl|my_center|LOCUS_11210 2480 3886 gene locus_tag LOCUS_11220 2480 3886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918952.1 protein_id gnl|my_center|LOCUS_11220 >Feature sequence0246 >Feature sequence0247 3108 316 gene locus_tag LOCUS_11230 3108 316 CDS product phosphate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269389.1 protein_id gnl|my_center|LOCUS_11230 4339 3359 gene locus_tag LOCUS_11240 gene pstS 4339 3359 CDS product phosphate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XDA8 protein_id gnl|my_center|LOCUS_11240 >Feature sequence0248 1157 81 gene locus_tag LOCUS_11250 1157 81 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937492.1 protein_id gnl|my_center|LOCUS_11250 2314 1154 gene locus_tag LOCUS_11260 2314 1154 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228090.1 protein_id gnl|my_center|LOCUS_11260 2871 2311 gene locus_tag LOCUS_11270 2871 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 >Feature sequence0249 734 1318 gene locus_tag LOCUS_11280 734 1318 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_11280 1413 3818 gene locus_tag LOCUS_11290 1413 3818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 <4854 3820 gene locus_tag LOCUS_11300 <4854 3820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DG65:DNA helicase >Feature sequence0250 914 624 gene locus_tag LOCUS_11310 914 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 1146 1322 gene locus_tag LOCUS_11320 gene tatA1 1146 1322 CDS product Sec-independent protein translocase protein TatA 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66477 protein_id gnl|my_center|LOCUS_11320 2087 1344 gene locus_tag LOCUS_11330 2087 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 2355 2552 gene locus_tag LOCUS_11340 2355 2552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 2644 3408 gene locus_tag LOCUS_11350 2644 3408 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107567.1 protein_id gnl|my_center|LOCUS_11350 <4849 3510 gene locus_tag LOCUS_11360 <4849 3510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009873895.1:helicase >Feature sequence0251 824 2812 gene locus_tag LOCUS_11370 824 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 3909 2833 gene locus_tag LOCUS_11380 3909 2833 CDS product aminotransferase class V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727328.1 protein_id gnl|my_center|LOCUS_11380 4077 4391 gene locus_tag LOCUS_11390 4077 4391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 >Feature sequence0252 1900 872 gene locus_tag LOCUS_11400 1900 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11400 2380 1901 gene locus_tag LOCUS_11410 2380 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11410 2971 2895 gene locus_tag LOCUS_t00120 2971 2895 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3455 4567 gene locus_tag LOCUS_11420 3455 4567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 >Feature sequence0253 1803 2819 gene locus_tag LOCUS_11430 gene ltaE 1803 2819 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939164.1 protein_id gnl|my_center|LOCUS_11430 2997 4223 gene locus_tag LOCUS_11440 2997 4223 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104167.1 protein_id gnl|my_center|LOCUS_11440 4220 4744 gene locus_tag LOCUS_11450 4220 4744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 >Feature sequence0254 201 1466 gene locus_tag LOCUS_11460 201 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 3003 1540 gene locus_tag LOCUS_11470 3003 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 >Feature sequence0255 575 423 gene locus_tag LOCUS_11480 575 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 750 1286 gene locus_tag LOCUS_11490 750 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 1328 2722 gene locus_tag LOCUS_11500 gene xseA 1328 2722 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S09 protein_id gnl|my_center|LOCUS_11500 2719 2934 gene locus_tag LOCUS_11510 2719 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 3011 4072 gene locus_tag LOCUS_11520 3011 4072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 <4833 4079 gene locus_tag LOCUS_11530 <4833 4079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011462189.1:excinuclease ABC subunit A >Feature sequence0256 1354 341 gene locus_tag LOCUS_11540 1354 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 3861 1411 gene locus_tag LOCUS_11550 3861 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 <4821 3908 gene locus_tag LOCUS_11560 <4821 3908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073464.1:TonB-dependent receptor >Feature sequence0257 2296 566 gene locus_tag LOCUS_11570 2296 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 3070 2300 gene locus_tag LOCUS_11580 3070 2300 CDS product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460285.1 protein_id gnl|my_center|LOCUS_11580 3727 3206 gene locus_tag LOCUS_11590 3727 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 >Feature sequence0258 1394 2941 gene locus_tag LOCUS_11600 1394 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 2938 3714 gene locus_tag LOCUS_11610 2938 3714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 3959 4402 gene locus_tag LOCUS_11620 3959 4402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 >Feature sequence0259 <1 731 gene locus_tag LOCUS_11630 <1 731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228793.1:serine/threonine protein kinase 691 3984 gene locus_tag LOCUS_11640 691 3984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 4500 4042 gene locus_tag LOCUS_11650 4500 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 >Feature sequence0260 >Feature sequence0261 <1 527 gene locus_tag LOCUS_11660 <1 527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P58254:protein RecA 624 2609 gene locus_tag LOCUS_11670 624 2609 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404041.1 protein_id gnl|my_center|LOCUS_11670 2606 4711 gene locus_tag LOCUS_11680 2606 4711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 >Feature sequence0262 1191 505 gene locus_tag LOCUS_11690 1191 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 4804 1397 gene locus_tag LOCUS_11700 4804 1397 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071882.1 protein_id gnl|my_center|LOCUS_11700 >Feature sequence0263 83 859 gene locus_tag LOCUS_11710 83 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 1083 1883 gene locus_tag LOCUS_11720 gene scpA 1083 1883 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIP8 protein_id gnl|my_center|LOCUS_11720 1880 2884 gene locus_tag LOCUS_11730 1880 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 2881 3936 gene locus_tag LOCUS_11740 2881 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 3933 4661 gene locus_tag LOCUS_11750 gene cmk 3933 4661 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749Y7 protein_id gnl|my_center|LOCUS_11750 >Feature sequence0264 445 1404 gene locus_tag LOCUS_11760 445 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 1578 2201 gene locus_tag LOCUS_11770 1578 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 2368 4167 gene locus_tag LOCUS_11780 2368 4167 CDS product long-chain acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229431.1 protein_id gnl|my_center|LOCUS_11780 >Feature sequence0265 <1 1589 gene locus_tag LOCUS_11790 <1 1589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87LY0:histidine kinase note possible pseudo, internal stop codon 1620 2537 gene locus_tag LOCUS_11800 1620 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11800 3648 2764 gene locus_tag LOCUS_11810 3648 2764 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532094.1 protein_id gnl|my_center|LOCUS_11810 >Feature sequence0266 2545 2201 gene locus_tag LOCUS_11820 2545 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587853.1 protein_id gnl|my_center|LOCUS_11820 2832 2542 gene locus_tag LOCUS_11830 2832 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 3998 3021 gene locus_tag LOCUS_11840 3998 3021 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114042.1 protein_id gnl|my_center|LOCUS_11840 4204 4743 gene locus_tag LOCUS_11850 4204 4743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 >Feature sequence0267 441 25 gene locus_tag LOCUS_11860 441 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 570 1364 gene locus_tag LOCUS_11870 570 1364 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403695.1 protein_id gnl|my_center|LOCUS_11870 1651 2160 gene locus_tag LOCUS_11880 1651 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 2304 2612 gene locus_tag LOCUS_11890 2304 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 >Feature sequence0268 3749 2046 gene locus_tag LOCUS_11900 3749 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 >Feature sequence0269 1629 541 gene locus_tag LOCUS_11910 1629 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 2874 1669 gene locus_tag LOCUS_11920 2874 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 3129 3794 gene locus_tag LOCUS_11930 3129 3794 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_11930 3909 4481 gene locus_tag LOCUS_11940 3909 4481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 4587 4663 gene locus_tag LOCUS_t00130 4587 4663 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0270 <1 1044 gene locus_tag LOCUS_11950 <1 1044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012707855.1:nitrogen regulation protein NR(I) 1479 2690 gene locus_tag LOCUS_11960 1479 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 2687 3700 gene locus_tag LOCUS_11970 2687 3700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 3705 4505 gene locus_tag LOCUS_11980 3705 4505 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088429.1 protein_id gnl|my_center|LOCUS_11980 >Feature sequence0271 2504 543 gene locus_tag LOCUS_11990 2504 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 2794 3144 gene locus_tag LOCUS_12000 2794 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 4027 3188 gene locus_tag LOCUS_12010 4027 3188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 >Feature sequence0272 1030 275 gene locus_tag LOCUS_12020 gene surE 1030 275 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67004 protein_id gnl|my_center|LOCUS_12020 1998 1123 gene locus_tag LOCUS_12030 gene mtnP 1998 1123 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E52 protein_id gnl|my_center|LOCUS_12030 3046 2105 gene locus_tag LOCUS_12040 gene gnnA 3046 2105 CDS product UDP-N-acetylglucosamine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_12040 3951 3133 gene locus_tag LOCUS_12050 gene lpxA 3951 3133 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q729I3 protein_id gnl|my_center|LOCUS_12050 4399 3962 gene locus_tag LOCUS_12060 gene fabZ 4399 3962 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PIM2 protein_id gnl|my_center|LOCUS_12060 >Feature sequence0273 78 3695 gene locus_tag LOCUS_12070 78 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 3785 4039 gene locus_tag LOCUS_12080 3785 4039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 4248 4030 gene locus_tag LOCUS_12090 4248 4030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 >Feature sequence0274 742 1932 gene locus_tag LOCUS_12100 742 1932 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405558.1 protein_id gnl|my_center|LOCUS_12100 1929 2660 gene locus_tag LOCUS_12110 1929 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 2781 4175 gene locus_tag LOCUS_12120 2781 4175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 >Feature sequence0275 706 1911 gene locus_tag LOCUS_12130 706 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 2767 1949 gene locus_tag LOCUS_12140 2767 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 3059 4438 gene locus_tag LOCUS_12150 3059 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123104.1 protein_id gnl|my_center|LOCUS_12150 >Feature sequence0276 1644 3530 gene locus_tag LOCUS_12160 1644 3530 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029751.1 protein_id gnl|my_center|LOCUS_12160 3532 4536 gene locus_tag LOCUS_12170 3532 4536 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029750.1 protein_id gnl|my_center|LOCUS_12170 >Feature sequence0277 <1 608 gene locus_tag LOCUS_12180 <1 608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705373.1:sodium:proton antiporter 750 1568 gene locus_tag LOCUS_12190 gene thiG 750 1568 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FL9 protein_id gnl|my_center|LOCUS_12190 1718 1794 gene locus_tag LOCUS_t00140 1718 1794 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4180 3023 gene locus_tag LOCUS_12200 4180 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 >Feature sequence0278 675 2228 gene locus_tag LOCUS_12210 675 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 3791 2298 gene locus_tag LOCUS_12220 3791 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 >Feature sequence0279 66 248 gene locus_tag LOCUS_12230 66 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 1543 467 gene locus_tag LOCUS_12240 1543 467 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256126.1 protein_id gnl|my_center|LOCUS_12240 4059 1582 gene locus_tag LOCUS_12250 gene thrA 4059 1582 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108282.1 protein_id gnl|my_center|LOCUS_12250 >Feature sequence0280 3093 2662 gene locus_tag LOCUS_12260 3093 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 3446 3913 gene locus_tag LOCUS_12270 3446 3913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 >Feature sequence0281 578 1039 gene locus_tag LOCUS_12280 578 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 1058 1969 gene locus_tag LOCUS_12290 1058 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 1999 3744 gene locus_tag LOCUS_12300 1999 3744 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257958.1 protein_id gnl|my_center|LOCUS_12300 <4667 3790 gene locus_tag LOCUS_12310 <4667 3790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023003693.1:hybrid sensor histidine kinase/response regulator >Feature sequence0282 2295 274 gene locus_tag LOCUS_12320 2295 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 3601 2348 gene locus_tag LOCUS_12330 3601 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 4526 3618 gene locus_tag LOCUS_12340 4526 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 >Feature sequence0283 2644 1622 gene locus_tag LOCUS_12350 2644 1622 CDS product NAD regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969045.1 protein_id gnl|my_center|LOCUS_12350 3410 2679 gene locus_tag LOCUS_12360 gene lipB 3410 2679 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZI1 protein_id gnl|my_center|LOCUS_12360 4308 3403 gene locus_tag LOCUS_12370 4308 3403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 >Feature sequence0284 1302 1916 gene locus_tag LOCUS_12380 gene algU 1302 1916 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WIP2 protein_id gnl|my_center|LOCUS_12380 1913 2593 gene locus_tag LOCUS_12390 1913 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 >Feature sequence0285 431 862 gene locus_tag LOCUS_12400 431 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 2522 819 gene locus_tag LOCUS_12410 2522 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 <4635 2740 gene locus_tag LOCUS_12420 <4635 2740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066164.1:catalase-peroxidase >Feature sequence0286 1 657 gene locus_tag LOCUS_12430 1 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 849 1085 gene locus_tag LOCUS_12440 849 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 2209 1187 gene locus_tag LOCUS_12450 2209 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 2691 2206 gene locus_tag LOCUS_12460 2691 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 2910 4478 gene locus_tag LOCUS_12470 2910 4478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 >Feature sequence0287 313 594 gene locus_tag LOCUS_12480 313 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 1406 735 gene locus_tag LOCUS_12490 1406 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 >Feature sequence0288 <1 2174 gene locus_tag LOCUS_12500 <1 2174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920890.1:beta-glucosidase 2177 3691 gene locus_tag LOCUS_12510 2177 3691 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_12510 >Feature sequence0289 <1 2311 gene locus_tag LOCUS_12520 <1 2311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140588.1:serine/threonine protein kinase 2355 3065 gene locus_tag LOCUS_12530 2355 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 >Feature sequence0290 631 1833 gene locus_tag LOCUS_12540 631 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 1995 2630 gene locus_tag LOCUS_12550 1995 2630 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HD72 protein_id gnl|my_center|LOCUS_12550 2733 3506 gene locus_tag LOCUS_12560 2733 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 3647 4147 gene locus_tag LOCUS_12570 3647 4147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 >Feature sequence0291 4530 2449 gene locus_tag LOCUS_12580 4530 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 >Feature sequence0292 <1 1370 gene locus_tag LOCUS_12590 <1 1370 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967947.1:adenylate cyclase 1381 2895 gene locus_tag LOCUS_12600 1381 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 3956 2907 gene locus_tag LOCUS_12610 3956 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 >Feature sequence0293 1769 492 gene locus_tag LOCUS_12620 gene tyrS2 1769 492 CDS product tyrosine--tRNA ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q834C7 protein_id gnl|my_center|LOCUS_12620 1981 2118 gene locus_tag LOCUS_12630 1981 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 2343 3341 gene locus_tag LOCUS_12640 2343 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 >Feature sequence0294 676 203 gene locus_tag LOCUS_12650 676 203 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121867.1 protein_id gnl|my_center|LOCUS_12650 2087 669 gene locus_tag LOCUS_12660 2087 669 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118182.1 protein_id gnl|my_center|LOCUS_12660 3618 2299 gene locus_tag LOCUS_12670 3618 2299 CDS product alkylhalidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117886.1 protein_id gnl|my_center|LOCUS_12670 <4588 3784 gene locus_tag LOCUS_12680 <4588 3784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123801.1:alcohol dehydrogenase >Feature sequence0295 291 950 gene locus_tag LOCUS_12690 291 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 943 1485 gene locus_tag LOCUS_12700 943 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 1548 2843 gene locus_tag LOCUS_12710 1548 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 2852 3463 gene locus_tag LOCUS_12720 2852 3463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 >Feature sequence0296 983 81 gene locus_tag LOCUS_12730 983 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 1257 1688 gene locus_tag LOCUS_12740 1257 1688 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256620.1 protein_id gnl|my_center|LOCUS_12740 1688 3184 gene locus_tag LOCUS_12750 gene glpK 1688 3184 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y6Z2 protein_id gnl|my_center|LOCUS_12750 4278 3280 gene locus_tag LOCUS_12760 gene hemB 4278 3280 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLQ6 protein_id gnl|my_center|LOCUS_12760 >Feature sequence0297 <1 800 gene locus_tag LOCUS_12770 <1 800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405033.1:amino acid permease 793 1995 gene locus_tag LOCUS_12780 793 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088279.1 protein_id gnl|my_center|LOCUS_12780 2165 3346 gene locus_tag LOCUS_12790 2165 3346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 3364 4440 gene locus_tag LOCUS_12800 3364 4440 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYT3 protein_id gnl|my_center|LOCUS_12800 >Feature sequence0298 857 1042 gene locus_tag LOCUS_12810 857 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 <4562 1191 gene locus_tag LOCUS_12820 <4562 1191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259099.1:glutamate synthase >Feature sequence0299 >Feature sequence0300 <1 738 gene locus_tag LOCUS_12830 <1 738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202554.1:alkaline phosphatase 813 1388 gene locus_tag LOCUS_12840 813 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963697.1 protein_id gnl|my_center|LOCUS_12840 1489 2481 gene locus_tag LOCUS_12850 1489 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 3441 2659 gene locus_tag LOCUS_12860 3441 2659 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141949.1 protein_id gnl|my_center|LOCUS_12860 4007 3507 gene locus_tag LOCUS_12870 4007 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 >Feature sequence0301 <1 684 gene locus_tag LOCUS_12880 <1 684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403125.1:cell envelope biogenesis protein OmpA 741 2801 gene locus_tag LOCUS_12890 741 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 >Feature sequence0302 >Feature sequence0303 2928 1309 gene locus_tag LOCUS_12900 2928 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 3573 3082 gene locus_tag LOCUS_12910 3573 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404314.1 protein_id gnl|my_center|LOCUS_12910 3666 4394 gene locus_tag LOCUS_12920 3666 4394 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941989.1 protein_id gnl|my_center|LOCUS_12920 >Feature sequence0304 3375 148 gene locus_tag LOCUS_12930 3375 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 3575 3372 gene locus_tag LOCUS_12940 3575 3372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 >Feature sequence0305 2801 60 gene locus_tag LOCUS_12950 2801 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 3729 2965 gene locus_tag LOCUS_12960 3729 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 >Feature sequence0306 <1 503 gene locus_tag LOCUS_12970 <1 503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259373.1:histidine kinase 821 528 gene locus_tag LOCUS_12980 821 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 1523 1086 gene locus_tag LOCUS_12990 1523 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 1920 2243 gene locus_tag LOCUS_13000 1920 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 2256 2924 gene locus_tag LOCUS_13010 2256 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 3386 2952 gene locus_tag LOCUS_13020 3386 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 4021 3383 gene locus_tag LOCUS_13030 4021 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890570.1 protein_id gnl|my_center|LOCUS_13030 >Feature sequence0307 <1 2125 gene locus_tag LOCUS_13040 <1 2125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404548.1:ATP-dependent DNA helicase 2205 2837 gene locus_tag LOCUS_13050 2205 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 2834 4180 gene locus_tag LOCUS_13060 gene pyrC 2834 4180 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFD0 protein_id gnl|my_center|LOCUS_13060 >Feature sequence0308 9 2279 gene locus_tag LOCUS_13070 9 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 2416 3399 gene locus_tag LOCUS_13080 2416 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 3475 4278 gene locus_tag LOCUS_13090 3475 4278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 >Feature sequence0309 936 2009 gene locus_tag LOCUS_13100 936 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 2006 2980 gene locus_tag LOCUS_13110 2006 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 3218 4243 gene locus_tag LOCUS_13120 3218 4243 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_13120 >Feature sequence0310 <1 1136 gene locus_tag LOCUS_13130 <1 1136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89DS6:histidine kinase 2476 1157 gene locus_tag LOCUS_13140 gene hutF 2476 1157 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727478.1 protein_id gnl|my_center|LOCUS_13140 3675 2482 gene locus_tag LOCUS_13150 gene argE 3675 2482 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CF54 protein_id gnl|my_center|LOCUS_13150 <4486 3726 gene locus_tag LOCUS_13160 <4486 3726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011227731.1:serine/threonine protein kinase >Feature sequence0311 3537 664 gene locus_tag LOCUS_13170 3537 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 3711 4187 gene locus_tag LOCUS_13180 3711 4187 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_13180 >Feature sequence0312 141 2444 gene locus_tag LOCUS_13190 141 2444 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203679.1 protein_id gnl|my_center|LOCUS_13190 >Feature sequence0313 1903 971 gene locus_tag LOCUS_13200 1903 971 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530044.1 protein_id gnl|my_center|LOCUS_13200 3522 1900 gene locus_tag LOCUS_13210 gene glpD 3522 1900 CDS product aerobic glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CPE6 protein_id gnl|my_center|LOCUS_13210 <4471 3522 gene locus_tag LOCUS_13220 <4471 3522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027282.1:alkyldihydroxyacetonephosphate synthase >Feature sequence0314 110 997 gene locus_tag LOCUS_13230 gene lpxK 110 997 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AU2 protein_id gnl|my_center|LOCUS_13230 1057 2031 gene locus_tag LOCUS_13240 1057 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 2107 2457 gene locus_tag LOCUS_tm00010 2107 2457 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 2964 4352 gene locus_tag LOCUS_13250 2964 4352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 >Feature sequence0315 <1 1986 gene locus_tag LOCUS_13260 <1 1986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227211.1:type IV secretion protein Rhs >Feature sequence0316 754 1455 gene locus_tag LOCUS_13270 754 1455 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327344.1 protein_id gnl|my_center|LOCUS_13270 1708 3942 gene locus_tag LOCUS_13280 1708 3942 CDS product marine proteobacterial sortase target protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083797.1 protein_id gnl|my_center|LOCUS_13280 >Feature sequence0317 707 282 gene locus_tag LOCUS_13290 707 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 1036 2499 gene locus_tag LOCUS_13300 1036 2499 CDS product myeloperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143588.1 protein_id gnl|my_center|LOCUS_13300 >Feature sequence0318 21 986 gene locus_tag LOCUS_13310 gene selD 21 986 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RI12 protein_id gnl|my_center|LOCUS_13310 1161 2177 gene locus_tag LOCUS_13320 gene phnD 1161 2177 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125171.1 protein_id gnl|my_center|LOCUS_13320 2205 3035 gene locus_tag LOCUS_13330 gene phnC1 2205 3035 CDS product phosphonates import ATP-binding protein PhnC 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYT0 protein_id gnl|my_center|LOCUS_13330 3094 3912 gene locus_tag LOCUS_13340 3094 3912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 >Feature sequence0319 802 2871 gene locus_tag LOCUS_13350 802 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 <4448 3213 gene locus_tag LOCUS_13360 <4448 3213 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228849.1:peptidase M20 >Feature sequence0320 2004 2930 gene locus_tag LOCUS_13370 2004 2930 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257729.1 protein_id gnl|my_center|LOCUS_13370 3889 3014 gene locus_tag LOCUS_13380 3889 3014 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096618.1 protein_id gnl|my_center|LOCUS_13380 <4448 3894 gene locus_tag LOCUS_13390 <4448 3894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EKQ2:oxygen-dependent coproporphyrinogen-III oxidase >Feature sequence0321 829 305 gene locus_tag LOCUS_13400 829 305 CDS product DUF2004 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265696.1 protein_id gnl|my_center|LOCUS_13400 1194 856 gene locus_tag LOCUS_13410 1194 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 1617 1285 gene locus_tag LOCUS_13420 1617 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 2114 1614 gene locus_tag LOCUS_13430 2114 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 2885 2118 gene locus_tag LOCUS_13440 2885 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 3217 3831 gene locus_tag LOCUS_13450 3217 3831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400645.1 protein_id gnl|my_center|LOCUS_13450 4211 3828 gene locus_tag LOCUS_13460 4211 3828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 >Feature sequence0322 314 2653 gene locus_tag LOCUS_13470 314 2653 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141097.1 protein_id gnl|my_center|LOCUS_13470 <4441 2663 gene locus_tag LOCUS_13480 <4441 2663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030712.1:metal-dependent hydrolase >Feature sequence0323 100 489 gene locus_tag LOCUS_13490 100 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 818 1327 gene locus_tag LOCUS_13500 818 1327 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730866.1 protein_id gnl|my_center|LOCUS_13500 1330 3696 gene locus_tag LOCUS_13510 1330 3696 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257971.1 protein_id gnl|my_center|LOCUS_13510 >Feature sequence0324 2178 1228 gene locus_tag LOCUS_13520 2178 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 >Feature sequence0325 988 3270 gene locus_tag LOCUS_13530 gene fadE 988 3270 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403966.1 protein_id gnl|my_center|LOCUS_13530 3305 3973 gene locus_tag LOCUS_13540 3305 3973 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940717.1 protein_id gnl|my_center|LOCUS_13540 >Feature sequence0326 2692 1862 gene locus_tag LOCUS_13550 2692 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 2866 3855 gene locus_tag LOCUS_13560 2866 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 >Feature sequence0327 1960 2769 gene locus_tag LOCUS_13570 1960 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 >Feature sequence0328 <1 703 gene locus_tag LOCUS_13580 <1 703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393353.1:group 1 glycosyl transferase 759 1916 gene locus_tag LOCUS_13590 759 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 1920 2879 gene locus_tag LOCUS_13600 1920 2879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 2881 3858 gene locus_tag LOCUS_13610 2881 3858 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942602.1 protein_id gnl|my_center|LOCUS_13610 3952 4365 gene locus_tag LOCUS_13620 3952 4365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 >Feature sequence0329 <1 629 gene locus_tag LOCUS_13630 <1 629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962745.1:macrolide ABC transporter ATP-binding protein 759 2564 gene locus_tag LOCUS_13640 759 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 >Feature sequence0330 >Feature sequence0331 <1 1864 gene locus_tag LOCUS_13650 <1 1864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P45745:dimodular nonribosomal peptide synthase 3577 1919 gene locus_tag LOCUS_13660 3577 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 3804 3658 gene locus_tag LOCUS_13670 3804 3658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 >Feature sequence0332 869 3148 gene locus_tag LOCUS_13680 869 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 >Feature sequence0333 217 2394 gene locus_tag LOCUS_13690 217 2394 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259046.1 protein_id gnl|my_center|LOCUS_13690 >Feature sequence0334 1164 715 gene locus_tag LOCUS_13700 1164 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 2300 1170 gene locus_tag LOCUS_13710 2300 1170 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969607.1 protein_id gnl|my_center|LOCUS_13710 2537 4303 gene locus_tag LOCUS_13720 2537 4303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106392.1 protein_id gnl|my_center|LOCUS_13720 >Feature sequence0335 2217 1330 gene locus_tag LOCUS_13730 gene kdsB 2217 1330 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BY2 protein_id gnl|my_center|LOCUS_13730 3675 2332 gene locus_tag LOCUS_13740 3675 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 >Feature sequence0336 >Feature sequence0337 2166 2870 gene locus_tag LOCUS_13750 2166 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 3661 2909 gene locus_tag LOCUS_13760 3661 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 3787 4314 gene locus_tag LOCUS_13770 3787 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 >Feature sequence0338 1209 13 gene locus_tag LOCUS_13780 1209 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 3880 1397 gene locus_tag LOCUS_13790 3880 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_13790 >Feature sequence0339 3502 2663 gene locus_tag LOCUS_13800 3502 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 >Feature sequence0340 <1 1050 gene locus_tag LOCUS_13810 <1 1050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011055906.1:peptidase M16 1047 2333 gene locus_tag LOCUS_13820 1047 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 2545 4194 gene locus_tag LOCUS_13830 2545 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 >Feature sequence0341 486 1718 gene locus_tag LOCUS_13840 486 1718 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881249.1 protein_id gnl|my_center|LOCUS_13840 1846 2835 gene locus_tag LOCUS_13850 1846 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 3069 3932 gene locus_tag LOCUS_13860 3069 3932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 >Feature sequence0342 552 3311 gene locus_tag LOCUS_13870 552 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 <4319 3433 gene locus_tag LOCUS_13880 <4319 3433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393215.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence0343 >Feature sequence0344 316 2667 gene locus_tag LOCUS_13890 316 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 2684 3511 gene locus_tag LOCUS_13900 2684 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421145.1 protein_id gnl|my_center|LOCUS_13900 3699 3833 gene locus_tag LOCUS_13910 3699 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 >Feature sequence0345 1263 2339 gene locus_tag LOCUS_13920 1263 2339 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464586.1 protein_id gnl|my_center|LOCUS_13920 2350 2904 gene locus_tag LOCUS_13930 2350 2904 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977253.1 protein_id gnl|my_center|LOCUS_13930 >Feature sequence0346 2315 9 gene locus_tag LOCUS_13940 2315 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 2203 2421 gene locus_tag LOCUS_13950 2203 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 2651 3775 gene locus_tag LOCUS_13960 2651 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141310.1 protein_id gnl|my_center|LOCUS_13960 >Feature sequence0347 1798 794 gene locus_tag LOCUS_13970 1798 794 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942339.1 protein_id gnl|my_center|LOCUS_13970 2668 2018 gene locus_tag LOCUS_13980 2668 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 3446 2742 gene locus_tag LOCUS_13990 3446 2742 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_13990 >Feature sequence0348 1531 86 gene locus_tag LOCUS_14000 1531 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265931.1 protein_id gnl|my_center|LOCUS_14000 2483 1563 gene locus_tag LOCUS_14010 2483 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085244.1 protein_id gnl|my_center|LOCUS_14010 3112 2615 gene locus_tag LOCUS_14020 3112 2615 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944407.1 protein_id gnl|my_center|LOCUS_14020 >Feature sequence0349 >Feature sequence0350 <1 859 gene locus_tag LOCUS_14030 <1 859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0C6P2B1:tRNA N6-adenosine threonylcarbamoyltransferase 982 2265 gene locus_tag LOCUS_14040 gene aspC 982 2265 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4H3 protein_id gnl|my_center|LOCUS_14040 3134 2286 gene locus_tag LOCUS_14050 3134 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 3285 4241 gene locus_tag LOCUS_14060 3285 4241 CDS product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LM8 protein_id gnl|my_center|LOCUS_14060 >Feature sequence0351 1450 2070 gene locus_tag LOCUS_14070 1450 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878930.1 protein_id gnl|my_center|LOCUS_14070 2415 3791 gene locus_tag LOCUS_14080 2415 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 >Feature sequence0352 >Feature sequence0353 603 1451 gene locus_tag LOCUS_14090 603 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 1448 1765 gene locus_tag LOCUS_14100 1448 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 2054 1836 gene locus_tag LOCUS_14110 2054 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 >Feature sequence0354 575 937 gene locus_tag LOCUS_14120 575 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 944 2305 gene locus_tag LOCUS_14130 944 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14130 2333 3364 gene locus_tag LOCUS_14140 2333 3364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 >Feature sequence0355 >Feature sequence0356 >Feature sequence0357 4236 3523 gene locus_tag LOCUS_14150 4236 3523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 >Feature sequence0358 1461 874 gene locus_tag LOCUS_14160 1461 874 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_14160 2075 1458 gene locus_tag LOCUS_14170 2075 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 3529 2138 gene locus_tag LOCUS_14180 3529 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 >Feature sequence0359 501 2537 gene locus_tag LOCUS_14190 501 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 2640 2960 gene locus_tag LOCUS_14200 2640 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 3475 3786 gene locus_tag LOCUS_14210 3475 3786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 >Feature sequence0360 718 314 gene locus_tag LOCUS_14220 718 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 1021 1791 gene locus_tag LOCUS_14230 gene wzm 1021 1791 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTB8 protein_id gnl|my_center|LOCUS_14230 1980 3668 gene locus_tag LOCUS_14240 1980 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 >Feature sequence0361 <1 602 gene locus_tag LOCUS_14250 <1 602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141092.1:DNA-directed RNA polymerase sigma-70 factor 605 3502 gene locus_tag LOCUS_14260 605 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 >Feature sequence0362 <1 520 gene locus_tag LOCUS_14270 <1 520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038890.1:amino acid transporter 664 1662 gene locus_tag LOCUS_14280 664 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 4157 2022 gene locus_tag LOCUS_14290 4157 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 >Feature sequence0363 2240 486 gene locus_tag LOCUS_14300 2240 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 >Feature sequence0364 155 676 gene locus_tag LOCUS_14310 155 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 2343 760 gene locus_tag LOCUS_14320 2343 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 >Feature sequence0365 1659 1276 gene locus_tag LOCUS_14330 1659 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14330 1905 1660 gene locus_tag LOCUS_14340 1905 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14340 2127 2990 gene locus_tag LOCUS_14350 2127 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 >Feature sequence0366 785 321 gene locus_tag LOCUS_14360 785 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 866 2632 gene locus_tag LOCUS_14370 866 2632 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114325.1 protein_id gnl|my_center|LOCUS_14370 2873 3514 gene locus_tag LOCUS_14380 2873 3514 CDS product 2'-5' RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884034.1 protein_id gnl|my_center|LOCUS_14380 >Feature sequence0367 2175 109 gene locus_tag LOCUS_14390 2175 109 CDS product putative acetyl/propionyl carboxylase alpha subunit AccA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702801.1 protein_id gnl|my_center|LOCUS_14390 3859 2264 gene locus_tag LOCUS_14400 3859 2264 CDS product acetyl-CoA carboxylase carboxyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224753.1 protein_id gnl|my_center|LOCUS_14400 >Feature sequence0368 <1 757 gene locus_tag LOCUS_14410 <1 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228441.1:enoyl-CoA hydratase 778 2655 gene locus_tag LOCUS_14420 778 2655 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726857.1 protein_id gnl|my_center|LOCUS_14420 2648 3550 gene locus_tag LOCUS_14430 2648 3550 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704716.1 protein_id gnl|my_center|LOCUS_14430 >Feature sequence0369 2735 30 gene locus_tag LOCUS_14440 2735 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 2829 3695 gene locus_tag LOCUS_14450 2829 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 >Feature sequence0370 1820 3733 gene locus_tag LOCUS_14460 1820 3733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 >Feature sequence0371 3400 1574 gene locus_tag LOCUS_14470 gene glmS 3400 1574 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GH6 protein_id gnl|my_center|LOCUS_14470 3802 3446 gene locus_tag LOCUS_14480 3802 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 >Feature sequence0372 >Feature sequence0373 290 1585 gene locus_tag LOCUS_14490 290 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 1852 2532 gene locus_tag LOCUS_14500 1852 2532 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029201.1 protein_id gnl|my_center|LOCUS_14500 >Feature sequence0374 365 3112 gene locus_tag LOCUS_14510 365 3112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 3241 3747 gene locus_tag LOCUS_14520 3241 3747 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNB5 protein_id gnl|my_center|LOCUS_14520 >Feature sequence0375 910 197 gene locus_tag LOCUS_14530 910 197 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121044.1 protein_id gnl|my_center|LOCUS_14530 1998 907 gene locus_tag LOCUS_14540 1998 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 2355 3500 gene locus_tag LOCUS_14550 gene bcd2 2355 3500 CDS product butyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418888.1 protein_id gnl|my_center|LOCUS_14550 >Feature sequence0376 555 163 gene locus_tag LOCUS_14560 gene rpsI 555 163 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNX3 protein_id gnl|my_center|LOCUS_14560 1051 602 gene locus_tag LOCUS_14570 gene rplM 1051 602 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9Y8 protein_id gnl|my_center|LOCUS_14570 1378 2322 gene locus_tag LOCUS_14580 gene folD 1378 2322 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1I0 protein_id gnl|my_center|LOCUS_14580 2319 2927 gene locus_tag LOCUS_14590 gene coaE 2319 2927 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58897 protein_id gnl|my_center|LOCUS_14590 3618 3073 gene locus_tag LOCUS_14600 3618 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 >Feature sequence0377 >Feature sequence0378 777 1622 gene locus_tag LOCUS_14610 777 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 >Feature sequence0379 2987 1521 gene locus_tag LOCUS_14620 gene gltB2 2987 1521 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181592.1 protein_id gnl|my_center|LOCUS_14620 4166 3195 gene locus_tag LOCUS_14630 4166 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 >Feature sequence0380 >Feature sequence0381 2107 854 gene locus_tag LOCUS_14640 gene argD 2107 854 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WB46 protein_id gnl|my_center|LOCUS_14640 2946 2104 gene locus_tag LOCUS_14650 2946 2104 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WIL8 protein_id gnl|my_center|LOCUS_14650 4083 2974 gene locus_tag LOCUS_14660 gene argC 4083 2974 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WD17 protein_id gnl|my_center|LOCUS_14660 >Feature sequence0382 1689 790 gene locus_tag LOCUS_14670 1689 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 2921 1671 gene locus_tag LOCUS_14680 gene hutI 2921 1671 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RUU1 protein_id gnl|my_center|LOCUS_14680 3142 3897 gene locus_tag LOCUS_14690 gene hutC 3142 3897 CDS product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211280.1 protein_id gnl|my_center|LOCUS_14690 >Feature sequence0383 1057 1482 gene locus_tag LOCUS_14700 1057 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 3213 1633 gene locus_tag LOCUS_14710 3213 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 >Feature sequence0384 2979 340 gene locus_tag LOCUS_14720 2979 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 3160 4125 gene locus_tag LOCUS_14730 gene yhaM 3160 4125 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_14730 >Feature sequence0385 2907 3092 gene locus_tag LOCUS_14740 2907 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 >Feature sequence0386 80 1087 gene locus_tag LOCUS_14750 gene moaA 80 1087 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WJJ4 protein_id gnl|my_center|LOCUS_14750 1271 2650 gene locus_tag LOCUS_14760 1271 2650 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256013.1 protein_id gnl|my_center|LOCUS_14760 >Feature sequence0387 1237 38 gene locus_tag LOCUS_14770 1237 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 2692 1280 gene locus_tag LOCUS_14780 2692 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 3688 2996 gene locus_tag LOCUS_14790 3688 2996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 >Feature sequence0388 110 322 gene locus_tag LOCUS_14800 110 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 366 1247 gene locus_tag LOCUS_14810 366 1247 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973213.1 protein_id gnl|my_center|LOCUS_14810 1422 2351 gene locus_tag LOCUS_14820 1422 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 <4121 2394 gene locus_tag LOCUS_14830 <4121 2394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707240.1:type I secretion C-terminal target domain-containing protein >Feature sequence0389 2242 1721 gene locus_tag LOCUS_14840 2242 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 2833 3453 gene locus_tag LOCUS_14850 2833 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 >Feature sequence0390 <1 976 gene locus_tag LOCUS_14860 <1 976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011110234.1:penicillin-binding protein 2830 1487 gene locus_tag LOCUS_14870 2830 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 <4106 2852 gene locus_tag LOCUS_14880 <4106 2852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545922.1:sensor histidine kinase >Feature sequence0391 >Feature sequence0392 1201 599 gene locus_tag LOCUS_14890 1201 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 1749 3734 gene locus_tag LOCUS_14900 1749 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 >Feature sequence0393 1805 2602 gene locus_tag LOCUS_14910 1805 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 2620 3441 gene locus_tag LOCUS_14920 2620 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 <4095 3487 gene locus_tag LOCUS_14930 <4095 3487 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080176.1:ADP-ribose pyrophosphatase >Feature sequence0394 1179 397 gene locus_tag LOCUS_14940 1179 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 2266 1172 gene locus_tag LOCUS_14950 2266 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 2856 2263 gene locus_tag LOCUS_14960 2856 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 3134 2853 gene locus_tag LOCUS_14970 3134 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 >Feature sequence0395 2430 1654 gene locus_tag LOCUS_14980 2430 1654 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090653.1 protein_id gnl|my_center|LOCUS_14980 3206 2427 gene locus_tag LOCUS_14990 3206 2427 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090654.1 protein_id gnl|my_center|LOCUS_14990 <4086 3203 gene locus_tag LOCUS_15000 <4086 3203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090655.1:branched-chain amino acid ABC transporter permease >Feature sequence0396 2519 1476 gene locus_tag LOCUS_15010 2519 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 >Feature sequence0397 2307 1597 gene locus_tag LOCUS_15020 gene bioD 2307 1597 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U8T9 protein_id gnl|my_center|LOCUS_15020 3599 2304 gene locus_tag LOCUS_15030 gene bioF 3599 2304 CDS product 8-amino-7-oxononanoate synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53556 protein_id gnl|my_center|LOCUS_15030 >Feature sequence0398 2343 664 gene locus_tag LOCUS_15040 2343 664 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403563.1 protein_id gnl|my_center|LOCUS_15040 2722 3468 gene locus_tag LOCUS_15050 2722 3468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 >Feature sequence0399 2755 515 gene locus_tag LOCUS_15060 2755 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 3518 3063 gene locus_tag LOCUS_15070 3518 3063 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N76 protein_id gnl|my_center|LOCUS_15070 >Feature sequence0400 17 892 gene locus_tag LOCUS_15080 17 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 3664 821 gene locus_tag LOCUS_15090 3664 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 >Feature sequence0401 521 1384 gene locus_tag LOCUS_15100 521 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 3691 1970 gene locus_tag LOCUS_15110 3691 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 >Feature sequence0402 127 1155 gene locus_tag LOCUS_15120 127 1155 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869954.1 protein_id gnl|my_center|LOCUS_15120 1281 2435 gene locus_tag LOCUS_15130 gene tyrA 1281 2435 CDS product T-protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FII6 protein_id gnl|my_center|LOCUS_15130 <4037 2632 gene locus_tag LOCUS_15140 <4037 2632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545922.1:sensor histidine kinase >Feature sequence0403 <1 617 gene locus_tag LOCUS_15150 <1 617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HU44:imidazole glycerol phosphate synthase subunit hisF1 617 1297 gene locus_tag LOCUS_15160 gene hisI 617 1297 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SIC9 protein_id gnl|my_center|LOCUS_15160 1297 2772 gene locus_tag LOCUS_15170 gene trpE 1297 2772 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_15170 2769 3437 gene locus_tag LOCUS_15180 2769 3437 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919763.1 protein_id gnl|my_center|LOCUS_15180 >Feature sequence0404 167 1510 gene locus_tag LOCUS_15190 167 1510 CDS product asparagine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123609.1 protein_id gnl|my_center|LOCUS_15190 1514 2485 gene locus_tag LOCUS_15200 1514 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 >Feature sequence0405 2585 2752 gene locus_tag LOCUS_15210 2585 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 >Feature sequence0406 125 1132 gene locus_tag LOCUS_15220 gene truD 125 1132 CDS product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RSX8 protein_id gnl|my_center|LOCUS_15220 1291 2211 gene locus_tag LOCUS_15230 1291 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 <4024 2420 gene locus_tag LOCUS_15240 <4024 2420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963751.1:glycoside hydrolase >Feature sequence0407 3214 728 gene locus_tag LOCUS_15250 3214 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 >Feature sequence0408 >Feature sequence0409 3653 2724 gene locus_tag LOCUS_15260 3653 2724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 >Feature sequence0410 >Feature sequence0411 2277 1735 gene locus_tag LOCUS_15270 2277 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 2440 2321 gene locus_tag LOCUS_15280 2440 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 3142 2474 gene locus_tag LOCUS_15290 3142 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 3890 3219 gene locus_tag LOCUS_15300 3890 3219 CDS product cytochrome C biogenesis protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256830.1 protein_id gnl|my_center|LOCUS_15300 >Feature sequence0412 319 594 gene locus_tag LOCUS_15310 319 594 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222118.1 protein_id gnl|my_center|LOCUS_15310 617 1051 gene locus_tag LOCUS_15320 617 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 1252 1166 gene locus_tag LOCUS_t00150 1252 1166 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1709 2323 gene locus_tag LOCUS_15330 1709 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 2508 3818 gene locus_tag LOCUS_15340 gene der 2508 3818 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AX4 protein_id gnl|my_center|LOCUS_15340 >Feature sequence0413 1862 1191 gene locus_tag LOCUS_15350 1862 1191 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970048.1 protein_id gnl|my_center|LOCUS_15350 2156 2494 gene locus_tag LOCUS_15360 2156 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 3824 2625 gene locus_tag LOCUS_15370 3824 2625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 >Feature sequence0414 2750 309 gene locus_tag LOCUS_15380 2750 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 >Feature sequence0415 1131 1733 gene locus_tag LOCUS_15390 1131 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 2567 1920 gene locus_tag LOCUS_15400 2567 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 >Feature sequence0416 <1 1446 gene locus_tag LOCUS_15410 <1 1446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393846.1:multidrug ABC transporter 2685 1549 gene locus_tag LOCUS_15420 2685 1549 CDS product saccharopine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249826.1 protein_id gnl|my_center|LOCUS_15420 2956 3792 gene locus_tag LOCUS_15430 2956 3792 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405048.1 protein_id gnl|my_center|LOCUS_15430 >Feature sequence0417 553 3180 gene locus_tag LOCUS_15440 gene hrpB 553 3180 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405451.1 protein_id gnl|my_center|LOCUS_15440 <3969 3282 gene locus_tag LOCUS_15450 <3969 3282 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000096571.1:exopolyphosphatase >Feature sequence0418 <1 1736 gene locus_tag LOCUS_15460 <1 1736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405361.1:peptidase S9 1752 2036 gene locus_tag LOCUS_15470 1752 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 >Feature sequence0419 463 1464 gene locus_tag LOCUS_15480 463 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 3594 1681 gene locus_tag LOCUS_15490 3594 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 >Feature sequence0420 2153 573 gene locus_tag LOCUS_15500 2153 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 3003 3647 gene locus_tag LOCUS_15510 3003 3647 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_15510 >Feature sequence0421 3009 2308 gene locus_tag LOCUS_15520 3009 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 3356 3697 gene locus_tag LOCUS_15530 gene ytxJ 3356 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39914 protein_id gnl|my_center|LOCUS_15530 >Feature sequence0422 <1 1035 gene locus_tag LOCUS_15540 <1 1035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941040.1:sigma-54-dependent Fis family transcriptional regulator 2207 1191 gene locus_tag LOCUS_15550 2207 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 2618 3262 gene locus_tag LOCUS_15560 2618 3262 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_15560 >Feature sequence0423 907 86 gene locus_tag LOCUS_15570 gene uppP1 907 86 CDS product undecaprenyl-diphosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHD3 protein_id gnl|my_center|LOCUS_15570 1142 2230 gene locus_tag LOCUS_15580 gene rfbB-2 1142 2230 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UA9 protein_id gnl|my_center|LOCUS_15580 2236 2793 gene locus_tag LOCUS_15590 gene rfbC 2236 2793 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143691.1 protein_id gnl|my_center|LOCUS_15590 >Feature sequence0424 171 1580 gene locus_tag LOCUS_15600 171 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 1577 2887 gene locus_tag LOCUS_15610 1577 2887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 3082 3606 gene locus_tag LOCUS_15620 3082 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583304.1 protein_id gnl|my_center|LOCUS_15620 >Feature sequence0425 <1 1548 gene locus_tag LOCUS_15630 <1 1548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6UFZ7:histidine kinase 1708 2292 gene locus_tag LOCUS_15640 1708 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 2500 3720 gene locus_tag LOCUS_15650 2500 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 >Feature sequence0426 2458 1277 gene locus_tag LOCUS_15660 2458 1277 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142191.1 protein_id gnl|my_center|LOCUS_15660 3600 2635 gene locus_tag LOCUS_15670 3600 2635 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937626.1 protein_id gnl|my_center|LOCUS_15670 >Feature sequence0427 678 1382 gene locus_tag LOCUS_15680 gene fkpA 678 1382 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGZ9 protein_id gnl|my_center|LOCUS_15680 >Feature sequence0428 3819 2230 gene locus_tag LOCUS_15690 3819 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 >Feature sequence0429 >Feature sequence0430 1369 131 gene locus_tag LOCUS_15700 1369 131 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_15700 2875 1427 gene locus_tag LOCUS_15710 2875 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 <3912 2872 gene locus_tag LOCUS_15720 <3912 2872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337795.1:MexH family multidrug efflux RND transporter periplasmic adaptor subunit >Feature sequence0431 14 871 gene locus_tag LOCUS_15730 14 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 3218 1140 gene locus_tag LOCUS_15740 gene fusA-1 3218 1140 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942578.1 protein_id gnl|my_center|LOCUS_15740 >Feature sequence0432 1493 3268 gene locus_tag LOCUS_15750 1493 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 3481 3855 gene locus_tag LOCUS_15760 3481 3855 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546202.1 protein_id gnl|my_center|LOCUS_15760 >Feature sequence0433 985 575 gene locus_tag LOCUS_15770 985 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140630.1 protein_id gnl|my_center|LOCUS_15770 1423 1932 gene locus_tag LOCUS_15780 1423 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 >Feature sequence0434 <3896 3095 gene locus_tag LOCUS_15790 <3896 3095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005477351.1:MexE family multidrug efflux RND transporter periplasmic adaptor subunit >Feature sequence0435 1560 2336 gene locus_tag LOCUS_15800 1560 2336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 >Feature sequence0436 <1 1544 gene locus_tag LOCUS_15810 <1 1544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225853.1:glycosyl transferase 2474 1602 gene locus_tag LOCUS_15820 gene psd 2474 1602 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PW03 protein_id gnl|my_center|LOCUS_15820 <3892 2480 gene locus_tag LOCUS_15830 <3892 2480 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920205.1:nitrate reductase >Feature sequence0437 2026 704 gene locus_tag LOCUS_15840 2026 704 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F940 protein_id gnl|my_center|LOCUS_15840 <3882 2115 gene locus_tag LOCUS_15850 <3882 2115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZVD6:pyruvate dehydrogenase E1 component >Feature sequence0438 3167 828 gene locus_tag LOCUS_15860 3167 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933858.1 protein_id gnl|my_center|LOCUS_15860 3675 3430 gene locus_tag LOCUS_15870 3675 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 >Feature sequence0439 <1 984 gene locus_tag LOCUS_15880 <1 984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259063.1:sugar-binding protein 996 1616 gene locus_tag LOCUS_15890 996 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095017.1 protein_id gnl|my_center|LOCUS_15890 1732 2133 gene locus_tag LOCUS_15900 1732 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 2901 2350 gene locus_tag LOCUS_15910 2901 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 >Feature sequence0440 1320 3617 gene locus_tag LOCUS_15920 1320 3617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877966.1 protein_id gnl|my_center|LOCUS_15920 >Feature sequence0441 1426 341 gene locus_tag LOCUS_15930 1426 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 1636 3642 gene locus_tag LOCUS_15940 1636 3642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 >Feature sequence0442 3361 1379 gene locus_tag LOCUS_15950 gene feoB 3361 1379 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326708.1 protein_id gnl|my_center|LOCUS_15950 3578 3363 gene locus_tag LOCUS_15960 3578 3363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 >Feature sequence0443 889 629 gene locus_tag LOCUS_15970 gene rpmA 889 629 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60493 protein_id gnl|my_center|LOCUS_15970 1266 949 gene locus_tag LOCUS_15980 gene rplU 1266 949 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O84425 protein_id gnl|my_center|LOCUS_15980 >Feature sequence0444 3 500 gene locus_tag LOCUS_15990 3 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 973 812 gene locus_tag LOCUS_16000 973 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 1997 1062 gene locus_tag LOCUS_16010 1997 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 2076 3071 gene locus_tag LOCUS_16020 2076 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 3434 3817 gene locus_tag LOCUS_16030 3434 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 >Feature sequence0445 <1 2152 gene locus_tag LOCUS_16040 <1 2152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013384209.1:TonB-dependent heme/hemoglobin receptor family protein >Feature sequence0446 >Feature sequence0447 <1 2966 gene locus_tag LOCUS_16050 <1 2966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122194.1:alpha-2-macroglobulin 3550 3014 gene locus_tag LOCUS_16060 3550 3014 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962833.1 protein_id gnl|my_center|LOCUS_16060 >Feature sequence0448 1132 1464 gene locus_tag LOCUS_16070 1132 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 >Feature sequence0449 1105 386 gene locus_tag LOCUS_16080 1105 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 3089 2322 gene locus_tag LOCUS_16090 3089 2322 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S5Q8 protein_id gnl|my_center|LOCUS_16090 <3835 3298 gene locus_tag LOCUS_16100 <3835 3298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403105.1:MBL fold metallo-hydrolase >Feature sequence0450 700 1596 gene locus_tag LOCUS_16110 700 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226431.1 protein_id gnl|my_center|LOCUS_16110 1760 2410 gene locus_tag LOCUS_16120 1760 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 >Feature sequence0451 >Feature sequence0452 966 214 gene locus_tag LOCUS_16130 966 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 1326 3380 gene locus_tag LOCUS_16140 1326 3380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 >Feature sequence0453 <1 656 gene locus_tag LOCUS_16150 <1 656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118002.1:protein kinase 843 1934 gene locus_tag LOCUS_16160 843 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 2271 2963 gene locus_tag LOCUS_16170 2271 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 >Feature sequence0454 388 1041 gene locus_tag LOCUS_16180 388 1041 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225016.1 protein_id gnl|my_center|LOCUS_16180 1118 3532 gene locus_tag LOCUS_16190 1118 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 >Feature sequence0455 >Feature sequence0456 2371 308 gene locus_tag LOCUS_16200 2371 308 CDS product dipeptidyl carboxypeptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203174.1 protein_id gnl|my_center|LOCUS_16200 3490 2642 gene locus_tag LOCUS_16210 3490 2642 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403967.1 protein_id gnl|my_center|LOCUS_16210 >Feature sequence0457 <1 1211 gene locus_tag LOCUS_16220 <1 1211 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257170.1:peptidase S10 1461 2324 gene locus_tag LOCUS_16230 1461 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 >Feature sequence0458 422 1822 gene locus_tag LOCUS_16240 422 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 >Feature sequence0459 971 1321 gene locus_tag LOCUS_16250 971 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 1342 2076 gene locus_tag LOCUS_16260 1342 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 2073 3131 gene locus_tag LOCUS_16270 2073 3131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 >Feature sequence0460 >Feature sequence0461 >Feature sequence0462 >Feature sequence0463 1289 1789 gene locus_tag LOCUS_16280 1289 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 1875 3335 gene locus_tag LOCUS_16290 1875 3335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 >Feature sequence0464 1048 713 gene locus_tag LOCUS_16300 1048 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 1284 2393 gene locus_tag LOCUS_16310 1284 2393 CDS product putative glutamate--cysteine ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAH5 protein_id gnl|my_center|LOCUS_16310 >Feature sequence0465 <1 696 gene locus_tag LOCUS_16320 <1 696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038421.1:gamma-glutamyltranspeptidase 920 1228 gene locus_tag LOCUS_16330 920 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 1361 2638 gene locus_tag LOCUS_16340 1361 2638 CDS product polyvinyl alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122626.1 protein_id gnl|my_center|LOCUS_16340 2650 3210 gene locus_tag LOCUS_16350 2650 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036322.1 protein_id gnl|my_center|LOCUS_16350 >Feature sequence0466 >Feature sequence0467 943 5 gene locus_tag LOCUS_16360 943 5 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120056.1 protein_id gnl|my_center|LOCUS_16360 1240 1836 gene locus_tag LOCUS_16370 1240 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16370 1743 2078 gene locus_tag LOCUS_16380 1743 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16380 >Feature sequence0468 235 1182 gene locus_tag LOCUS_16390 235 1182 CDS product nucleotide sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060801.1 protein_id gnl|my_center|LOCUS_16390 1995 1189 gene locus_tag LOCUS_16400 1995 1189 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888014.1 protein_id gnl|my_center|LOCUS_16400 2642 1992 gene locus_tag LOCUS_16410 2642 1992 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009839.1 protein_id gnl|my_center|LOCUS_16410 <3749 2673 gene locus_tag LOCUS_16420 <3749 2673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87LD0:RNA polymerase-associated protein RapA >Feature sequence0469 1282 287 gene locus_tag LOCUS_16430 1282 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256411.1 protein_id gnl|my_center|LOCUS_16430 2166 1279 gene locus_tag LOCUS_16440 2166 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 2915 2163 gene locus_tag LOCUS_16450 gene pcm 2915 2163 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJY2 protein_id gnl|my_center|LOCUS_16450 >Feature sequence0470 <1 902 gene locus_tag LOCUS_16460 <1 902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070558.1:aminobenzoyl-glutamate transporter 1131 3545 gene locus_tag LOCUS_16470 1131 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035989.1 protein_id gnl|my_center|LOCUS_16470 >Feature sequence0471 1812 478 gene locus_tag LOCUS_16480 1812 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 1891 2601 gene locus_tag LOCUS_16490 1891 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 <3741 2612 gene locus_tag LOCUS_16500 <3741 2612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142358.1:threonine synthase >Feature sequence0472 324 449 gene locus_tag LOCUS_16510 324 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 >Feature sequence0473 1614 25 gene locus_tag LOCUS_16520 1614 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114139.1 protein_id gnl|my_center|LOCUS_16520 2961 1798 gene locus_tag LOCUS_16530 2961 1798 CDS product multidrug ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941825.1 protein_id gnl|my_center|LOCUS_16530 <3733 2961 gene locus_tag LOCUS_16540 <3733 2961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005817388.1:ABC transporter permease >Feature sequence0474 5 3655 gene locus_tag LOCUS_16550 5 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 >Feature sequence0475 1830 571 gene locus_tag LOCUS_16560 1830 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 3321 2074 gene locus_tag LOCUS_16570 3321 2074 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266767.1 protein_id gnl|my_center|LOCUS_16570 >Feature sequence0476 1307 522 gene locus_tag LOCUS_16580 1307 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 >Feature sequence0477 <1 779 gene locus_tag LOCUS_16590 <1 779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016960.1:phosphate acetyltransferase 783 2057 gene locus_tag LOCUS_16600 gene purD 783 2057 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FJ8 protein_id gnl|my_center|LOCUS_16600 2439 3287 gene locus_tag LOCUS_16610 2439 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 3284 3598 gene locus_tag LOCUS_16620 3284 3598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 >Feature sequence0478 >Feature sequence0479 >Feature sequence0480 <1 2563 gene locus_tag LOCUS_16630 <1 2563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760378.1:hybrid sensor histidine kinase/response regulator >Feature sequence0481 3626 2166 gene locus_tag LOCUS_16640 3626 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 >Feature sequence0482 3647 2415 gene locus_tag LOCUS_16650 3647 2415 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335012.1 protein_id gnl|my_center|LOCUS_16650 >Feature sequence0483 1005 115 gene locus_tag LOCUS_16660 1005 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 1291 3039 gene locus_tag LOCUS_16670 1291 3039 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_16670 >Feature sequence0484 112 984 gene locus_tag LOCUS_16680 112 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 2049 1150 gene locus_tag LOCUS_16690 2049 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 2577 2098 gene locus_tag LOCUS_16700 2577 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 2967 2641 gene locus_tag LOCUS_16710 2967 2641 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405420.1 protein_id gnl|my_center|LOCUS_16710 3228 3013 gene locus_tag LOCUS_16720 3228 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 >Feature sequence0485 87 293 gene locus_tag LOCUS_16730 87 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 301 1563 gene locus_tag LOCUS_16740 301 1563 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706126.1 protein_id gnl|my_center|LOCUS_16740 1943 2875 gene locus_tag LOCUS_16750 1943 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 >Feature sequence0486 <3687 2136 gene locus_tag LOCUS_16760 <3687 2136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KK36:DNA polymerase >Feature sequence0487 <3685 327 gene locus_tag LOCUS_16770 <3685 327 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225226.1:polyketide synthase >Feature sequence0488 1373 1068 gene locus_tag LOCUS_16780 1373 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16780 1714 3276 gene locus_tag LOCUS_16790 1714 3276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 >Feature sequence0489 1641 3065 gene locus_tag LOCUS_16800 gene cca 1641 3065 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ91 protein_id gnl|my_center|LOCUS_16800 >Feature sequence0490 323 1816 gene locus_tag LOCUS_16810 323 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 >Feature sequence0491 1931 1065 gene locus_tag LOCUS_16820 1931 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 2441 3319 gene locus_tag LOCUS_16830 2441 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 >Feature sequence0492 1395 238 gene locus_tag LOCUS_16840 gene degP 1395 238 CDS product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120947.1 protein_id gnl|my_center|LOCUS_16840 <3670 1418 gene locus_tag LOCUS_16850 <3670 1418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012255965.1:protein kinase >Feature sequence0493 <1 2569 gene locus_tag LOCUS_16860 <1 2569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227211.1:type IV secretion protein Rhs 2566 3036 gene locus_tag LOCUS_16870 2566 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 3668 3069 gene locus_tag LOCUS_16880 3668 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 >Feature sequence0494 <1 1245 gene locus_tag LOCUS_16890 <1 1245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001133941.1:non-ribosomal peptide synthetase 2009 1341 gene locus_tag LOCUS_16900 2009 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 3428 2238 gene locus_tag LOCUS_16910 3428 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 >Feature sequence0495 273 2306 gene locus_tag LOCUS_16920 273 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 2303 2719 gene locus_tag LOCUS_16930 2303 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 3460 2747 gene locus_tag LOCUS_16940 3460 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653722.1 protein_id gnl|my_center|LOCUS_16940 >Feature sequence0496 <1 988 gene locus_tag LOCUS_16950 <1 988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002211122.1:short-chain dehydrogenase 1984 1058 gene locus_tag LOCUS_16960 1984 1058 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947299.1 protein_id gnl|my_center|LOCUS_16960 3433 1988 gene locus_tag LOCUS_16970 3433 1988 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_16970 >Feature sequence0497 >Feature sequence0498 <1 990 gene locus_tag LOCUS_16980 <1 990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122942.1:iron alcohol dehydrogenase 1007 2176 gene locus_tag LOCUS_16990 1007 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 >Feature sequence0499 560 1156 gene locus_tag LOCUS_17000 gene def1 560 1156 CDS product peptide deformylase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7W0Q0 protein_id gnl|my_center|LOCUS_17000 1153 1623 gene locus_tag LOCUS_17010 gene rlmH 1153 1623 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LB0 protein_id gnl|my_center|LOCUS_17010 1789 2175 gene locus_tag LOCUS_17020 gene dksA 1789 2175 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GG2 protein_id gnl|my_center|LOCUS_17020 >Feature sequence0500 2381 1056 gene locus_tag LOCUS_17030 2381 1056 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403751.1 protein_id gnl|my_center|LOCUS_17030 3004 2381 gene locus_tag LOCUS_17040 3004 2381 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403750.1 protein_id gnl|my_center|LOCUS_17040 >Feature sequence0501 3231 715 gene locus_tag LOCUS_17050 3231 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 >Feature sequence0502 3 209 gene locus_tag LOCUS_17060 3 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 1326 370 gene locus_tag LOCUS_17070 1326 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895438.1 protein_id gnl|my_center|LOCUS_17070 1594 3297 gene locus_tag LOCUS_17080 gene hflX 1594 3297 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q725J4 protein_id gnl|my_center|LOCUS_17080 >Feature sequence0503 290 1756 gene locus_tag LOCUS_17090 gene zwf 290 1756 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D148 protein_id gnl|my_center|LOCUS_17090 1961 2677 gene locus_tag LOCUS_17100 gene pgl 1961 2677 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072453.1 protein_id gnl|my_center|LOCUS_17100 2684 3535 gene locus_tag LOCUS_17110 2684 3535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 >Feature sequence0504 293 1345 gene locus_tag LOCUS_17120 293 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 1655 2080 gene locus_tag LOCUS_17130 1655 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 3619 2237 gene locus_tag LOCUS_17140 3619 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 >Feature sequence0505 885 1997 gene locus_tag LOCUS_17150 885 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 2349 3065 gene locus_tag LOCUS_17160 2349 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 >Feature sequence0506 <1 697 gene locus_tag LOCUS_17170 <1 697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000499920.1:homogentisate 1,2-dioxygenase 710 1315 gene locus_tag LOCUS_17180 710 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 1539 2264 gene locus_tag LOCUS_17190 1539 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 2386 3546 gene locus_tag LOCUS_17200 2386 3546 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121077.1 protein_id gnl|my_center|LOCUS_17200 >Feature sequence0507 1504 476 gene locus_tag LOCUS_17210 1504 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 1926 1558 gene locus_tag LOCUS_17220 1926 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 2419 1934 gene locus_tag LOCUS_17230 2419 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 3344 2523 gene locus_tag LOCUS_17240 3344 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 >Feature sequence0508 790 242 gene locus_tag LOCUS_17250 790 242 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_17250 3060 916 gene locus_tag LOCUS_17260 3060 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 >Feature sequence0509 972 2354 gene locus_tag LOCUS_17270 972 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404247.1 protein_id gnl|my_center|LOCUS_17270 2351 3169 gene locus_tag LOCUS_17280 gene truA 2351 3169 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WSC1 protein_id gnl|my_center|LOCUS_17280 >Feature sequence0510 <1 1045 gene locus_tag LOCUS_17290 <1 1045 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114948.1:oxidoreductase 1066 1737 gene locus_tag LOCUS_17300 1066 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339093.1 protein_id gnl|my_center|LOCUS_17300 2785 2000 gene locus_tag LOCUS_17310 2785 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 >Feature sequence0511 <3589 1064 gene locus_tag LOCUS_17320 <3589 1064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461050.1:multidrug ABC transporter >Feature sequence0512 <1 819 gene locus_tag LOCUS_17330 <1 819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258212.1:(2Fe-2S)-binding protein 816 1892 gene locus_tag LOCUS_17340 gene paaE 816 1892 CDS product flavodoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964555.1 protein_id gnl|my_center|LOCUS_17340 3579 1906 gene locus_tag LOCUS_17350 3579 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 >Feature sequence0513 1334 2542 gene locus_tag LOCUS_17360 gene solA 1334 2542 CDS product N-methyltryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_17360 >Feature sequence0514 <1 3198 gene locus_tag LOCUS_17370 <1 3198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941478.1:PAS domain-containing sensor histidine kinase >Feature sequence0515 1803 1369 gene locus_tag LOCUS_17380 1803 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 2019 1870 gene locus_tag LOCUS_17390 2019 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 >Feature sequence0516 88 867 gene locus_tag LOCUS_17400 88 867 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815367.1 protein_id gnl|my_center|LOCUS_17400 3030 940 gene locus_tag LOCUS_17410 3030 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 <3571 3046 gene locus_tag LOCUS_17420 <3571 3046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123155.1:serine/threonine protein kinase note possible pseudo, internal stop codon >Feature sequence0517 2977 2021 gene locus_tag LOCUS_17430 2977 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 >Feature sequence0518 3189 361 gene locus_tag LOCUS_17440 3189 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 >Feature sequence0519 530 1150 gene locus_tag LOCUS_17450 530 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 1465 1160 gene locus_tag LOCUS_17460 1465 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 2356 1517 gene locus_tag LOCUS_17470 2356 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 >Feature sequence0520 230 706 gene locus_tag LOCUS_17480 gene folA 230 706 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89G37 protein_id gnl|my_center|LOCUS_17480 766 2706 gene locus_tag LOCUS_17490 766 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 >Feature sequence0521 1918 1259 gene locus_tag LOCUS_17500 1918 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 >Feature sequence0522 387 1028 gene locus_tag LOCUS_17510 gene cynT 387 1028 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGU2 protein_id gnl|my_center|LOCUS_17510 1047 1904 gene locus_tag LOCUS_17520 1047 1904 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104934.1 protein_id gnl|my_center|LOCUS_17520 2021 2494 gene locus_tag LOCUS_17530 2021 2494 CDS product lumazine-binding domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265636.1 protein_id gnl|my_center|LOCUS_17530 >Feature sequence0523 179 724 gene locus_tag LOCUS_17540 179 724 CDS product biotin biosynthesis protein BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140078.1 protein_id gnl|my_center|LOCUS_17540 1175 2365 gene locus_tag LOCUS_17550 gene capB 1175 2365 CDS product poly-gamma-glutamate synthase PgsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118210.1 protein_id gnl|my_center|LOCUS_17550 2358 2810 gene locus_tag LOCUS_17560 gene capC 2358 2810 CDS product poly-gamma-glutamate biosynthesis protein PgsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016687.1 protein_id gnl|my_center|LOCUS_17560 >Feature sequence0524 1222 293 gene locus_tag LOCUS_17570 1222 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957516.1 protein_id gnl|my_center|LOCUS_17570 <3551 1314 gene locus_tag LOCUS_17580 <3551 1314 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403935.1:acriflavin resistance protein >Feature sequence0525 >Feature sequence0526 <1 1978 gene locus_tag LOCUS_17590 <1 1978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962455.1:peptidase M36 >Feature sequence0527 715 1803 gene locus_tag LOCUS_17600 715 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122219.1 protein_id gnl|my_center|LOCUS_17600 1803 3239 gene locus_tag LOCUS_17610 1803 3239 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122220.1 protein_id gnl|my_center|LOCUS_17610 >Feature sequence0528 1471 521 gene locus_tag LOCUS_17620 gene dmt 1471 521 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881241.1 protein_id gnl|my_center|LOCUS_17620 3341 1719 gene locus_tag LOCUS_17630 3341 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 >Feature sequence0529 1291 986 gene locus_tag LOCUS_17640 1291 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 2898 1492 gene locus_tag LOCUS_17650 2898 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 >Feature sequence0530 1683 1048 gene locus_tag LOCUS_17660 gene tpm 1683 1048 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQC3 protein_id gnl|my_center|LOCUS_17660 1892 2329 gene locus_tag LOCUS_17670 1892 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 2363 3028 gene locus_tag LOCUS_17680 2363 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 >Feature sequence0531 >Feature sequence0532 <1 2686 gene locus_tag LOCUS_17690 <1 2686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RL27:valine--tRNA ligase >Feature sequence0533 2125 1382 gene locus_tag LOCUS_17700 2125 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 >Feature sequence0534 406 1053 gene locus_tag LOCUS_17710 406 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 1038 1688 gene locus_tag LOCUS_17720 1038 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 1759 2697 gene locus_tag LOCUS_17730 1759 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 >Feature sequence0535 1591 2811 gene locus_tag LOCUS_17740 gene add 1591 2811 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403444.1 protein_id gnl|my_center|LOCUS_17740 2811 3122 gene locus_tag LOCUS_17750 gene yhbY 2811 3122 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941918.1 protein_id gnl|my_center|LOCUS_17750 >Feature sequence0536 364 762 gene locus_tag LOCUS_17760 364 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 765 1040 gene locus_tag LOCUS_17770 765 1040 CDS product UPF0109 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YK95 protein_id gnl|my_center|LOCUS_17770 1123 1635 gene locus_tag LOCUS_17780 gene rimM 1123 1635 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJV5 protein_id gnl|my_center|LOCUS_17780 1617 2387 gene locus_tag LOCUS_17790 gene trmD 1617 2387 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJV4 protein_id gnl|my_center|LOCUS_17790 2505 2852 gene locus_tag LOCUS_17800 gene rplS 2505 2852 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B6K2 protein_id gnl|my_center|LOCUS_17800 >Feature sequence0537 <1 2051 gene locus_tag LOCUS_17810 <1 2051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E2T9:penicillin-binding protein 1B 3474 2614 gene locus_tag LOCUS_17820 3474 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 >Feature sequence0538 1093 170 gene locus_tag LOCUS_17830 1093 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 1571 3505 gene locus_tag LOCUS_17840 gene cmfA 1571 3505 CDS product conditioned medium factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035568.1 protein_id gnl|my_center|LOCUS_17840 >Feature sequence0539 1065 2732 gene locus_tag LOCUS_17850 1065 2732 CDS product malate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RYN3 protein_id gnl|my_center|LOCUS_17850 >Feature sequence0540 3204 520 gene locus_tag LOCUS_17860 gene topA 3204 520 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMV5 protein_id gnl|my_center|LOCUS_17860 >Feature sequence0541 835 215 gene locus_tag LOCUS_17870 835 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 >Feature sequence0542 2 676 gene locus_tag LOCUS_17880 2 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 1113 2975 gene locus_tag LOCUS_17890 1113 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 >Feature sequence0543 965 1609 gene locus_tag LOCUS_17900 gene lexA 965 1609 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81A92 protein_id gnl|my_center|LOCUS_17900 1953 3419 gene locus_tag LOCUS_17910 1953 3419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 >Feature sequence0544 2 583 gene locus_tag LOCUS_17920 2 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 583 1581 gene locus_tag LOCUS_17930 gene gap 583 1581 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67161 protein_id gnl|my_center|LOCUS_17930 2136 2729 gene locus_tag LOCUS_17940 2136 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 2896 3423 gene locus_tag LOCUS_17950 2896 3423 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389331.1 protein_id gnl|my_center|LOCUS_17950 >Feature sequence0545 <1 981 gene locus_tag LOCUS_17960 <1 981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P04189:subtilisin E >Feature sequence0546 2484 3401 gene locus_tag LOCUS_17970 2484 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 >Feature sequence0547 390 1313 gene locus_tag LOCUS_17980 390 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 1625 2365 gene locus_tag LOCUS_17990 1625 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 >Feature sequence0548 267 548 gene locus_tag LOCUS_18000 267 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 1061 2461 gene locus_tag LOCUS_18010 gene fumC 1061 2461 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIP7 protein_id gnl|my_center|LOCUS_18010 >Feature sequence0549 <1 1799 gene locus_tag LOCUS_18020 <1 1799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120685.1:squalene--hopene cyclase 1840 3123 gene locus_tag LOCUS_18030 1840 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 >Feature sequence0550 1400 69 gene locus_tag LOCUS_18040 1400 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895673.1 protein_id gnl|my_center|LOCUS_18040 2302 1523 gene locus_tag LOCUS_18050 2302 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 3094 2585 gene locus_tag LOCUS_18060 3094 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 >Feature sequence0551 2337 736 gene locus_tag LOCUS_18070 2337 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 >Feature sequence0552 487 1152 gene locus_tag LOCUS_18080 487 1152 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085667.1 protein_id gnl|my_center|LOCUS_18080 <3462 1183 gene locus_tag LOCUS_18090 <3462 1183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070433.1:bifunctional TolB-family protein/amidohydrolase >Feature sequence0553 533 1528 gene locus_tag LOCUS_18100 533 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 2593 1625 gene locus_tag LOCUS_18110 2593 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 2930 3076 gene locus_tag LOCUS_18120 2930 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 >Feature sequence0554 <1 867 gene locus_tag LOCUS_18130 <1 867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74BZ6:phosphoenolpyruvate-protein phosphotransferase 885 1718 gene locus_tag LOCUS_18140 885 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 1723 3066 gene locus_tag LOCUS_18150 gene miaB 1723 3066 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IW81 protein_id gnl|my_center|LOCUS_18150 >Feature sequence0555 <1 1800 gene locus_tag LOCUS_18160 <1 1800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87MS9:protease 4 2831 1947 gene locus_tag LOCUS_18170 2831 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 <3452 2909 gene locus_tag LOCUS_18180 <3452 2909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010945856.1:5' nucleotidase >Feature sequence0556 <1 2357 gene locus_tag LOCUS_18190 <1 2357 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011458930.1:NHLP family bacteriocin export ABC transporter permease/ATPase subunit >Feature sequence0557 932 324 gene locus_tag LOCUS_18200 932 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 >Feature sequence0558 1748 2989 gene locus_tag LOCUS_18210 1748 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940824.1 protein_id gnl|my_center|LOCUS_18210 >Feature sequence0559 2320 194 gene locus_tag LOCUS_18220 2320 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 2742 2356 gene locus_tag LOCUS_18230 2742 2356 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230197.1 protein_id gnl|my_center|LOCUS_18230 >Feature sequence0560 79 729 gene locus_tag LOCUS_18240 79 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 764 2098 gene locus_tag LOCUS_18250 gene kynU 764 2098 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I235 protein_id gnl|my_center|LOCUS_18250 2232 2597 gene locus_tag LOCUS_18260 2232 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 2984 2634 gene locus_tag LOCUS_18270 2984 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 >Feature sequence0561 288 1229 gene locus_tag LOCUS_18280 288 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 1472 1636 gene locus_tag LOCUS_18290 1472 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 >Feature sequence0562 1993 2541 gene locus_tag LOCUS_18300 1993 2541 CDS product non-canonical purine NTP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJB7 protein_id gnl|my_center|LOCUS_18300 2731 3318 gene locus_tag LOCUS_18310 2731 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 >Feature sequence0563 1687 428 gene locus_tag LOCUS_18320 gene sbcD 1687 428 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVQ9 protein_id gnl|my_center|LOCUS_18320 2296 1736 gene locus_tag LOCUS_18330 2296 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939699.1 protein_id gnl|my_center|LOCUS_18330 >Feature sequence0564 330 1271 gene locus_tag LOCUS_18340 gene psuG 330 1271 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNP3 protein_id gnl|my_center|LOCUS_18340 >Feature sequence0565 1816 1511 gene locus_tag LOCUS_18350 1816 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 2709 1816 gene locus_tag LOCUS_18360 2709 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 >Feature sequence0566 <1 510 gene locus_tag LOCUS_18370 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117973.1:RNA polymerase subunit sigma-24 640 1953 gene locus_tag LOCUS_18380 640 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 2557 1967 gene locus_tag LOCUS_18390 2557 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974022.1 protein_id gnl|my_center|LOCUS_18390 <3408 2574 gene locus_tag LOCUS_18400 <3408 2574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920000.1:CAU/MBL1b family subclass B3 metallo-beta-lactamase >Feature sequence0567 295 2487 gene locus_tag LOCUS_18410 295 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544993.1 protein_id gnl|my_center|LOCUS_18410 3397 2549 gene locus_tag LOCUS_18420 3397 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 >Feature sequence0568 2901 742 gene locus_tag LOCUS_18430 2901 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 >Feature sequence0569 1310 741 gene locus_tag LOCUS_18440 1310 741 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710981.1 protein_id gnl|my_center|LOCUS_18440 >Feature sequence0570 585 2429 gene locus_tag LOCUS_18450 585 2429 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939914.1 protein_id gnl|my_center|LOCUS_18450 >Feature sequence0571 >Feature sequence0572 77 3304 gene locus_tag LOCUS_18460 77 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 >Feature sequence0573 906 2573 gene locus_tag LOCUS_18470 gene cheA64H 906 2573 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940968.1 protein_id gnl|my_center|LOCUS_18470 2635 3306 gene locus_tag LOCUS_18480 2635 3306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 >Feature sequence0574 >Feature sequence0575 9 1355 gene locus_tag LOCUS_18490 gene glmM 9 1355 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DP16 protein_id gnl|my_center|LOCUS_18490 1452 2300 gene locus_tag LOCUS_18500 gene pdxJ 1452 2300 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKK8 protein_id gnl|my_center|LOCUS_18500 2641 2426 gene locus_tag LOCUS_18510 2641 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 3362 2775 gene locus_tag LOCUS_18520 3362 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 >Feature sequence0576 >Feature sequence0577 1897 1973 gene locus_tag LOCUS_t00160 1897 1973 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 <3361 2170 gene locus_tag LOCUS_18530 <3361 2170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942076.1:sodium/solute symporter serine/threonine phosphatase >Feature sequence0578 3276 2302 gene locus_tag LOCUS_18540 3276 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 >Feature sequence0579 1629 1054 gene locus_tag LOCUS_18550 1629 1054 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_18550 2174 1770 gene locus_tag LOCUS_18560 2174 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 3356 2301 gene locus_tag LOCUS_18570 3356 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 >Feature sequence0580 71 2317 gene locus_tag LOCUS_18580 gene recD2 71 2317 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DN4 protein_id gnl|my_center|LOCUS_18580 >Feature sequence0581 665 589 gene locus_tag LOCUS_t00170 665 589 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 799 723 gene locus_tag LOCUS_t00180 799 723 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3349 1133 gene locus_tag LOCUS_18590 3349 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 >Feature sequence0582 903 529 gene locus_tag LOCUS_18600 903 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18600 1416 943 gene locus_tag LOCUS_18610 1416 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18610 2681 1413 gene locus_tag LOCUS_18620 2681 1413 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942964.1 protein_id gnl|my_center|LOCUS_18620 >Feature sequence0583 2289 1081 gene locus_tag LOCUS_18630 2289 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 3257 2286 gene locus_tag LOCUS_18640 3257 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 >Feature sequence0584 2457 238 gene locus_tag LOCUS_18650 2457 238 CDS product dipeptidyl peptidase S46 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071328.1 protein_id gnl|my_center|LOCUS_18650 <3342 2779 gene locus_tag LOCUS_18660 <3342 2779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257115.1:peptidase M24 >Feature sequence0585 207 1583 gene locus_tag LOCUS_18670 207 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 2716 1595 gene locus_tag LOCUS_18680 2716 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 >Feature sequence0586 >Feature sequence0587 2683 3108 gene locus_tag LOCUS_18690 2683 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 >Feature sequence0588 1627 956 gene locus_tag LOCUS_18700 1627 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 2005 2160 gene locus_tag LOCUS_18710 2005 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 >Feature sequence0589 157 1422 gene locus_tag LOCUS_18720 157 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 2836 1400 gene locus_tag LOCUS_18730 2836 1400 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941974.1 protein_id gnl|my_center|LOCUS_18730 >Feature sequence0590 2 814 gene locus_tag LOCUS_18740 2 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 807 1454 gene locus_tag LOCUS_18750 807 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 2302 1754 gene locus_tag LOCUS_18760 2302 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 3304 2531 gene locus_tag LOCUS_18770 3304 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108665.1 protein_id gnl|my_center|LOCUS_18770 >Feature sequence0591 198 344 gene locus_tag LOCUS_18780 198 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 1048 2535 gene locus_tag LOCUS_18790 1048 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 >Feature sequence0592 150 539 gene locus_tag LOCUS_18800 150 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 883 1635 gene locus_tag LOCUS_18810 883 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 >Feature sequence0593 1147 128 gene locus_tag LOCUS_18820 1147 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112344.1 protein_id gnl|my_center|LOCUS_18820 2736 1144 gene locus_tag LOCUS_18830 gene badA 2736 1144 CDS product benzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228732.1 protein_id gnl|my_center|LOCUS_18830 >Feature sequence0594 <1 938 gene locus_tag LOCUS_18840 <1 938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RUU0:urocanate hydratase 955 2514 gene locus_tag LOCUS_18850 gene hutH 955 2514 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSQ4 protein_id gnl|my_center|LOCUS_18850 >Feature sequence0595 1241 2776 gene locus_tag LOCUS_18860 1241 2776 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085104.1 protein_id gnl|my_center|LOCUS_18860 >Feature sequence0596 1836 1210 gene locus_tag LOCUS_18870 1836 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 >Feature sequence0597 <1 1050 gene locus_tag LOCUS_18880 <1 1050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940478.1:acetoacetate metabolism regulatory protein AtoC 1216 1626 gene locus_tag LOCUS_18890 1216 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 2912 1623 gene locus_tag LOCUS_18900 gene alr 2912 1623 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EX97 protein_id gnl|my_center|LOCUS_18900 >Feature sequence0598 3068 1401 gene locus_tag LOCUS_18910 3068 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124765.1 protein_id gnl|my_center|LOCUS_18910 3307 3065 gene locus_tag LOCUS_18920 3307 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 >Feature sequence0599 490 2817 gene locus_tag LOCUS_18930 490 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 >Feature sequence0600 1455 577 gene locus_tag LOCUS_18940 1455 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 1803 1492 gene locus_tag LOCUS_18950 1803 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 <3306 1806 gene locus_tag LOCUS_18960 <3306 1806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880700.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence0601 >Feature sequence0602 >Feature sequence0603 3197 1875 gene locus_tag LOCUS_18970 3197 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 >Feature sequence0604 >Feature sequence0605 1 492 gene locus_tag LOCUS_18980 1 492 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391428.1 protein_id gnl|my_center|LOCUS_18980 2570 633 gene locus_tag LOCUS_18990 gene phoR 2570 633 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722633.1 protein_id gnl|my_center|LOCUS_18990 <3288 2567 gene locus_tag LOCUS_19000 <3288 2567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938382.1:DNA-binding response regulator >Feature sequence0606 1366 455 gene locus_tag LOCUS_19010 1366 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 2529 1363 gene locus_tag LOCUS_19020 2529 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 <3282 2526 gene locus_tag LOCUS_19030 <3282 2526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011462207.1:glycosyl transferase >Feature sequence0607 >Feature sequence0608 <1 1719 gene locus_tag LOCUS_19040 <1 1719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941727.1:pilus assembly protein PilY >Feature sequence0609 >Feature sequence0610 1610 339 gene locus_tag LOCUS_19050 1610 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 2271 1870 gene locus_tag LOCUS_19060 gene atpC 2271 1870 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462228.1 protein_id gnl|my_center|LOCUS_19060 <3272 2345 gene locus_tag LOCUS_19070 <3272 2345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UFB5:ATP synthase subunit beta >Feature sequence0611 251 1000 gene locus_tag LOCUS_19080 251 1000 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970134.1 protein_id gnl|my_center|LOCUS_19080 1245 1628 gene locus_tag LOCUS_19090 gene gntR 1245 1628 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118554.1 protein_id gnl|my_center|LOCUS_19090 1638 2525 gene locus_tag LOCUS_19100 1638 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 >Feature sequence0612 2469 1795 gene locus_tag LOCUS_19110 2469 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 <3268 2678 gene locus_tag LOCUS_19120 <3268 2678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533323.1:nicotinate-nucleotide diphosphorylase (carboxylating) >Feature sequence0613 153 761 gene locus_tag LOCUS_19130 153 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 758 1465 gene locus_tag LOCUS_19140 758 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 >Feature sequence0614 1262 228 gene locus_tag LOCUS_19150 1262 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WF27 protein_id gnl|my_center|LOCUS_19150 2041 1454 gene locus_tag LOCUS_19160 2041 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 2241 3251 gene locus_tag LOCUS_19170 2241 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 >Feature sequence0615 1871 1152 gene locus_tag LOCUS_19180 gene trpF 1871 1152 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AH7 protein_id gnl|my_center|LOCUS_19180 2686 1868 gene locus_tag LOCUS_19190 gene trpC 2686 1868 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIT7 protein_id gnl|my_center|LOCUS_19190 3259 2846 gene locus_tag LOCUS_19200 3259 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 >Feature sequence0616 3256 806 gene locus_tag LOCUS_19210 3256 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 >Feature sequence0617 >Feature sequence0618 554 24 gene locus_tag LOCUS_19220 554 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 1292 624 gene locus_tag LOCUS_19230 1292 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 1834 1289 gene locus_tag LOCUS_19240 1834 1289 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPD4 protein_id gnl|my_center|LOCUS_19240 >Feature sequence0619 1791 1108 gene locus_tag LOCUS_19250 1791 1108 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933371.1 protein_id gnl|my_center|LOCUS_19250 >Feature sequence0620 767 842 gene locus_tag LOCUS_t00190 767 842 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 866 1090 gene locus_tag LOCUS_19260 866 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 >Feature sequence0621 1829 513 gene locus_tag LOCUS_19270 1829 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 >Feature sequence0622 2206 1235 gene locus_tag LOCUS_19280 gene prsA 2206 1235 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389491.1 protein_id gnl|my_center|LOCUS_19280 3233 2232 gene locus_tag LOCUS_19290 3233 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 >Feature sequence0623 >Feature sequence0624 >Feature sequence0625 1418 444 gene locus_tag LOCUS_19300 1418 444 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102328.1 protein_id gnl|my_center|LOCUS_19300 1824 1501 gene locus_tag LOCUS_19310 1824 1501 CDS product UPF0235 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LJ3 protein_id gnl|my_center|LOCUS_19310 1933 2883 gene locus_tag LOCUS_19320 1933 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 >Feature sequence0626 1189 452 gene locus_tag LOCUS_19330 1189 452 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895490.1 protein_id gnl|my_center|LOCUS_19330 1479 3059 gene locus_tag LOCUS_19340 1479 3059 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402854.1 protein_id gnl|my_center|LOCUS_19340 >Feature sequence0627 285 620 gene locus_tag LOCUS_19350 285 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 881 1885 gene locus_tag LOCUS_19360 gene ftsY 881 1885 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E32 protein_id gnl|my_center|LOCUS_19360 1896 3056 gene locus_tag LOCUS_19370 1896 3056 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK07 protein_id gnl|my_center|LOCUS_19370 >Feature sequence0628 <1 1237 gene locus_tag LOCUS_19380 <1 1237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393846.1:multidrug ABC transporter 1252 2859 gene locus_tag LOCUS_19390 1252 2859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 >Feature sequence0629 1162 56 gene locus_tag LOCUS_19400 1162 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 <3217 1166 gene locus_tag LOCUS_19410 <3217 1166 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122787.1:helicase >Feature sequence0630 2117 1242 gene locus_tag LOCUS_19420 2117 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 2406 2128 gene locus_tag LOCUS_19430 2406 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 >Feature sequence0631 1025 495 gene locus_tag LOCUS_19440 1025 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 2975 1044 gene locus_tag LOCUS_19450 gene acsA 2975 1044 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNC6 protein_id gnl|my_center|LOCUS_19450 >Feature sequence0632 278 1381 gene locus_tag LOCUS_19460 278 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 1378 2397 gene locus_tag LOCUS_19470 1378 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 >Feature sequence0633 851 970 gene locus_tag LOCUS_19480 851 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 3204 994 gene locus_tag LOCUS_19490 3204 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_19490 >Feature sequence0634 <3200 873 gene locus_tag LOCUS_19500 <3200 873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9S2C0:serine/threonine-protein kinase PksC >Feature sequence0635 <1 672 gene locus_tag LOCUS_19510 <1 672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946554.1:ATP-dependent Clp protease ATP-binding subunit ClpA 1331 720 gene locus_tag LOCUS_19520 1331 720 CDS product lipoprotein, RlpA family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546239.1 protein_id gnl|my_center|LOCUS_19520 >Feature sequence0636 1373 522 gene locus_tag LOCUS_19530 1373 522 CDS product putative integrase/recombinase y4qK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55632 protein_id gnl|my_center|LOCUS_19530 2255 1614 gene locus_tag LOCUS_19540 2255 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 >Feature sequence0637 >Feature sequence0638 1839 1336 gene locus_tag LOCUS_19550 1839 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 2246 1836 gene locus_tag LOCUS_19560 2246 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 2704 2243 gene locus_tag LOCUS_19570 2704 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 >Feature sequence0639 546 2318 gene locus_tag LOCUS_19580 546 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118523.1 protein_id gnl|my_center|LOCUS_19580 >Feature sequence0640 >Feature sequence0641 1777 776 gene locus_tag LOCUS_19590 1777 776 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640443.1 protein_id gnl|my_center|LOCUS_19590 2317 1892 gene locus_tag LOCUS_19600 2317 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090099.1 protein_id gnl|my_center|LOCUS_19600 3028 2393 gene locus_tag LOCUS_19610 3028 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 >Feature sequence0642 102 644 gene locus_tag LOCUS_19620 102 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 820 1077 gene locus_tag LOCUS_19630 820 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 1472 1287 gene locus_tag LOCUS_19640 1472 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 1800 2747 gene locus_tag LOCUS_19650 1800 2747 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921395.1 protein_id gnl|my_center|LOCUS_19650 >Feature sequence0643 1180 1587 gene locus_tag LOCUS_19660 1180 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 3013 1634 gene locus_tag LOCUS_19670 3013 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 >Feature sequence0644 >Feature sequence0645 1469 258 gene locus_tag LOCUS_19680 gene metB 1469 258 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035842.1 protein_id gnl|my_center|LOCUS_19680 2181 1759 gene locus_tag LOCUS_19690 2181 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 2335 2544 gene locus_tag LOCUS_19700 2335 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084181.1 protein_id gnl|my_center|LOCUS_19700 >Feature sequence0646 428 1924 gene locus_tag LOCUS_19710 428 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 3170 1881 gene locus_tag LOCUS_19720 3170 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 >Feature sequence0647 >Feature sequence0648 >Feature sequence0649 3162 952 gene locus_tag LOCUS_19730 3162 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 >Feature sequence0650 >Feature sequence0651 <1 925 gene locus_tag LOCUS_19740 <1 925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207558.1:hybrid sensor histidine kinase/response regulator 922 1476 gene locus_tag LOCUS_19750 922 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 1497 1973 gene locus_tag LOCUS_19760 1497 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 1970 2776 gene locus_tag LOCUS_19770 1970 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 >Feature sequence0652 <3155 1014 gene locus_tag LOCUS_19780 <3155 1014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392429.1:serine/threonine protein kinase >Feature sequence0653 1785 2759 gene locus_tag LOCUS_19790 1785 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 2836 3087 gene locus_tag LOCUS_19800 2836 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 >Feature sequence0654 3155 2763 gene locus_tag LOCUS_19810 3155 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 >Feature sequence0655 1964 1539 gene locus_tag LOCUS_19820 1964 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 2992 2189 gene locus_tag LOCUS_19830 gene plsC 2992 2189 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3Q9 protein_id gnl|my_center|LOCUS_19830 >Feature sequence0656 2105 525 gene locus_tag LOCUS_19840 gene serA 2105 525 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKK8 protein_id gnl|my_center|LOCUS_19840 <3153 2214 gene locus_tag LOCUS_19850 <3153 2214 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943872.1:aminotransferase >Feature sequence0657 >Feature sequence0658 768 1922 gene locus_tag LOCUS_19860 768 1922 CDS product putative RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NGN4 protein_id gnl|my_center|LOCUS_19860 1949 3097 gene locus_tag LOCUS_19870 1949 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 >Feature sequence0659 2687 1926 gene locus_tag LOCUS_19880 2687 1926 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198263.1 protein_id gnl|my_center|LOCUS_19880 >Feature sequence0660 1398 433 gene locus_tag LOCUS_19890 1398 433 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731542.1 protein_id gnl|my_center|LOCUS_19890 <3142 1471 gene locus_tag LOCUS_19900 <3142 1471 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141946.1:acyl-CoA synthetase >Feature sequence0661 2004 1468 gene locus_tag LOCUS_19910 2004 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 2270 2902 gene locus_tag LOCUS_19920 2270 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 >Feature sequence0662 >Feature sequence0663 823 1452 gene locus_tag LOCUS_19930 823 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 >Feature sequence0664 1538 453 gene locus_tag LOCUS_19940 gene prfA 1538 453 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q812I4 protein_id gnl|my_center|LOCUS_19940 1798 2967 gene locus_tag LOCUS_19950 1798 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 >Feature sequence0665 2701 845 gene locus_tag LOCUS_19960 2701 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074318.1 protein_id gnl|my_center|LOCUS_19960 >Feature sequence0666 >Feature sequence0667 1766 498 gene locus_tag LOCUS_19970 1766 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 2669 2088 gene locus_tag LOCUS_19980 gene tag 2669 2088 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941230.1 protein_id gnl|my_center|LOCUS_19980 >Feature sequence0668 1343 2218 gene locus_tag LOCUS_19990 1343 2218 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036079.1 protein_id gnl|my_center|LOCUS_19990 >Feature sequence0669 <1 1709 gene locus_tag LOCUS_20000 <1 1709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011975826.1:adenylate/guanylate cyclase domain-containing protein 3010 2111 gene locus_tag LOCUS_20010 3010 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 >Feature sequence0670 1133 1318 gene locus_tag LOCUS_20020 1133 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 1321 2718 gene locus_tag LOCUS_20030 1321 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 >Feature sequence0671 1218 3080 gene locus_tag LOCUS_20040 1218 3080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 >Feature sequence0672 >Feature sequence0673 387 1370 gene locus_tag LOCUS_20050 387 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 1812 2051 gene locus_tag LOCUS_20060 1812 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 2129 2698 gene locus_tag LOCUS_20070 2129 2698 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_20070 >Feature sequence0674 1396 1821 gene locus_tag LOCUS_20080 1396 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 1869 2282 gene locus_tag LOCUS_20090 1869 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 2895 2323 gene locus_tag LOCUS_20100 2895 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 >Feature sequence0675 >Feature sequence0676 955 77 gene locus_tag LOCUS_20110 955 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 1275 955 gene locus_tag LOCUS_20120 1275 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 1702 2841 gene locus_tag LOCUS_20130 1702 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123970.1 protein_id gnl|my_center|LOCUS_20130 2859 3044 gene locus_tag LOCUS_20140 2859 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 >Feature sequence0677 3065 558 gene locus_tag LOCUS_20150 3065 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 >Feature sequence0678 >Feature sequence0679 470 330 gene locus_tag LOCUS_20160 470 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 >Feature sequence0680 >Feature sequence0681 650 141 gene locus_tag LOCUS_20170 650 141 CDS product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269179.1 protein_id gnl|my_center|LOCUS_20170 1051 845 gene locus_tag LOCUS_20180 1051 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 <3089 1673 gene locus_tag LOCUS_20190 <3089 1673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011201884.1:radical SAM/SPASM domain-containing protein >Feature sequence0682 2912 495 gene locus_tag LOCUS_20200 2912 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_20200 >Feature sequence0683 1440 559 gene locus_tag LOCUS_20210 1440 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 >Feature sequence0684 354 46 gene locus_tag LOCUS_20220 354 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 2087 351 gene locus_tag LOCUS_20230 gene recN 2087 351 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9UNY0 protein_id gnl|my_center|LOCUS_20230 >Feature sequence0685 532 1404 gene locus_tag LOCUS_20240 532 1404 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143634.1 protein_id gnl|my_center|LOCUS_20240 1517 2983 gene locus_tag LOCUS_20250 1517 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 >Feature sequence0686 1639 572 gene locus_tag LOCUS_20260 1639 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 2985 1774 gene locus_tag LOCUS_20270 gene wecB 2985 1774 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524905.1 protein_id gnl|my_center|LOCUS_20270 >Feature sequence0687 273 998 gene locus_tag LOCUS_20280 273 998 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404618.1 protein_id gnl|my_center|LOCUS_20280 952 2598 gene locus_tag LOCUS_20290 952 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 >Feature sequence0688 <1 818 gene locus_tag LOCUS_20300 <1 818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015366900.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence0689 >Feature sequence0690 1341 478 gene locus_tag LOCUS_20310 1341 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 >Feature sequence0691 1026 469 gene locus_tag LOCUS_20320 1026 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 1947 1450 gene locus_tag LOCUS_20330 1947 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 2372 1953 gene locus_tag LOCUS_20340 2372 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 2925 2374 gene locus_tag LOCUS_20350 2925 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 >Feature sequence0692 >Feature sequence0693 98 1237 gene locus_tag LOCUS_20360 98 1237 CDS product beta-carotene 15,15'-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861193.1 protein_id gnl|my_center|LOCUS_20360 1413 1841 gene locus_tag LOCUS_20370 1413 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 2837 2028 gene locus_tag LOCUS_20380 2837 2028 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_20380 >Feature sequence0694 1133 1726 gene locus_tag LOCUS_20390 1133 1726 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947216.1 protein_id gnl|my_center|LOCUS_20390 1746 2603 gene locus_tag LOCUS_20400 1746 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 >Feature sequence0695 2260 1166 gene locus_tag LOCUS_20410 2260 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 2569 2949 gene locus_tag LOCUS_20420 gene blaI 2569 2949 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417583.1 protein_id gnl|my_center|LOCUS_20420 >Feature sequence0696 1749 1099 gene locus_tag LOCUS_20430 gene dck 1749 1099 CDS product deoxyadenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403716.1 protein_id gnl|my_center|LOCUS_20430 >Feature sequence0697 711 34 gene locus_tag LOCUS_20440 gene thiE 711 34 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WG75 protein_id gnl|my_center|LOCUS_20440 1029 718 gene locus_tag LOCUS_20450 1029 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 1326 2210 gene locus_tag LOCUS_20460 1326 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 2303 2806 gene locus_tag LOCUS_20470 gene def 2303 2806 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SH6 protein_id gnl|my_center|LOCUS_20470 >Feature sequence0698 153 1310 gene locus_tag LOCUS_20480 153 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 <3046 1334 gene locus_tag LOCUS_20490 <3046 1334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KMU1:histidine kinase >Feature sequence0699 1721 2521 gene locus_tag LOCUS_20500 1721 2521 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259103.1 protein_id gnl|my_center|LOCUS_20500 >Feature sequence0700 >Feature sequence0701 1891 839 gene locus_tag LOCUS_20510 1891 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 <3044 1895 gene locus_tag LOCUS_20520 <3044 1895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KEQ0:protein TolB >Feature sequence0702 1726 359 gene locus_tag LOCUS_20530 1726 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 2970 2335 gene locus_tag LOCUS_20540 2970 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703633.1 protein_id gnl|my_center|LOCUS_20540 >Feature sequence0703 1426 635 gene locus_tag LOCUS_20550 1426 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461259.1 protein_id gnl|my_center|LOCUS_20550 1495 2004 gene locus_tag LOCUS_20560 1495 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 2110 2496 gene locus_tag LOCUS_20570 2110 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 >Feature sequence0704 <1 675 gene locus_tag LOCUS_20580 <1 675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000100797.1:cytochrome c oxidase subunit III 685 1143 gene locus_tag LOCUS_20590 685 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 2328 1315 gene locus_tag LOCUS_20600 2328 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 >Feature sequence0705 1086 1241 gene locus_tag LOCUS_20610 1086 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 2556 1228 gene locus_tag LOCUS_20620 2556 1228 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SIP0 protein_id gnl|my_center|LOCUS_20620 >Feature sequence0706 >Feature sequence0707 1161 886 gene locus_tag LOCUS_20630 1161 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 2721 1444 gene locus_tag LOCUS_20640 2721 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 >Feature sequence0708 1023 947 gene locus_tag LOCUS_t00200 1023 947 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1141 1065 gene locus_tag LOCUS_t00210 1141 1065 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1271 1198 gene locus_tag LOCUS_t00220 1271 1198 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1687 2502 gene locus_tag LOCUS_20650 gene kynA 1687 2502 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DG95 protein_id gnl|my_center|LOCUS_20650 >Feature sequence0709 169 1485 gene locus_tag LOCUS_20660 169 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 1482 2783 gene locus_tag LOCUS_20670 gene pmbA 1482 2783 CDS product peptide maturation inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881223.1 protein_id gnl|my_center|LOCUS_20670 >Feature sequence0710 851 2467 gene locus_tag LOCUS_20680 851 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 >Feature sequence0711 >Feature sequence0712 >Feature sequence0713 920 1987 gene locus_tag LOCUS_20690 920 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20690 2168 2425 gene locus_tag LOCUS_20700 2168 2425 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P03942 protein_id gnl|my_center|LOCUS_20700 >Feature sequence0714 752 1786 gene locus_tag LOCUS_20710 752 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 >Feature sequence0715 2109 1114 gene locus_tag LOCUS_20720 2109 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 >Feature sequence0716 1209 109 gene locus_tag LOCUS_20730 1209 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 3005 1242 gene locus_tag LOCUS_20740 3005 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 >Feature sequence0717 >Feature sequence0718 829 413 gene locus_tag LOCUS_20750 829 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 1180 857 gene locus_tag LOCUS_20760 1180 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 1738 1247 gene locus_tag LOCUS_20770 1738 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 2255 1773 gene locus_tag LOCUS_20780 2255 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 >Feature sequence0719 2032 386 gene locus_tag LOCUS_20790 2032 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 >Feature sequence0720 654 1031 gene locus_tag LOCUS_20800 654 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 2014 1940 gene locus_tag LOCUS_t00230 2014 1940 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0721 268 1488 gene locus_tag LOCUS_20810 268 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 1546 2361 gene locus_tag LOCUS_20820 1546 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 >Feature sequence0722 1328 669 gene locus_tag LOCUS_20830 1328 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 2131 1325 gene locus_tag LOCUS_20840 2131 1325 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809761.1 protein_id gnl|my_center|LOCUS_20840 2856 2143 gene locus_tag LOCUS_20850 2856 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 >Feature sequence0723 1604 1464 gene locus_tag LOCUS_20860 1604 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 >Feature sequence0724 >Feature sequence0725 881 60 gene locus_tag LOCUS_20870 881 60 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122375.1 protein_id gnl|my_center|LOCUS_20870 1849 884 gene locus_tag LOCUS_20880 1849 884 CDS product N5,N10-methylene tetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122374.1 protein_id gnl|my_center|LOCUS_20880 2846 1860 gene locus_tag LOCUS_20890 2846 1860 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122373.1 protein_id gnl|my_center|LOCUS_20890 >Feature sequence0726 2832 4 gene locus_tag LOCUS_20900 2832 4 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D5W6 protein_id gnl|my_center|LOCUS_20900 >Feature sequence0727 107 1456 gene locus_tag LOCUS_20910 107 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 <2986 1590 gene locus_tag LOCUS_20920 <2986 1590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861820.1:C4-dicarboxylate ABC transporter >Feature sequence0728 983 459 gene locus_tag LOCUS_20930 983 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964397.1 protein_id gnl|my_center|LOCUS_20930 2158 980 gene locus_tag LOCUS_20940 2158 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887318.1 protein_id gnl|my_center|LOCUS_20940 2520 2164 gene locus_tag LOCUS_20950 2520 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 2873 2547 gene locus_tag LOCUS_20960 2873 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 >Feature sequence0729 641 862 gene locus_tag LOCUS_20970 641 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 965 1972 gene locus_tag LOCUS_20980 965 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 >Feature sequence0730 1109 420 gene locus_tag LOCUS_20990 1109 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 >Feature sequence0731 2957 399 gene locus_tag LOCUS_21000 2957 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 >Feature sequence0732 1982 555 gene locus_tag LOCUS_21010 gene dctD 1982 555 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403955.1 protein_id gnl|my_center|LOCUS_21010 2300 2641 gene locus_tag LOCUS_21020 2300 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376591.1 protein_id gnl|my_center|LOCUS_21020 >Feature sequence0733 >Feature sequence0734 <1 665 gene locus_tag LOCUS_21030 <1 665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085656.1:gamma-glutamyltranspeptidase 774 1538 gene locus_tag LOCUS_21040 774 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 1554 2669 gene locus_tag LOCUS_21050 1554 2669 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329385.1 protein_id gnl|my_center|LOCUS_21050 >Feature sequence0735 616 212 gene locus_tag LOCUS_21060 616 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 1853 825 gene locus_tag LOCUS_21070 1853 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 2939 1935 gene locus_tag LOCUS_21080 2939 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 >Feature sequence0736 444 1784 gene locus_tag LOCUS_21090 444 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 2769 2155 gene locus_tag LOCUS_21100 2769 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21100 >Feature sequence0737 2956 860 gene locus_tag LOCUS_21110 2956 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 >Feature sequence0738 73 1245 gene locus_tag LOCUS_21120 73 1245 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_21120 1245 2489 gene locus_tag LOCUS_21130 1245 2489 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277803.1 protein_id gnl|my_center|LOCUS_21130 >Feature sequence0739 <1 929 gene locus_tag LOCUS_21140 <1 929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KL61:2-amino-3-ketobutyrate coenzyme A ligase 2609 1128 gene locus_tag LOCUS_21150 2609 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 >Feature sequence0740 <1 544 gene locus_tag LOCUS_21160 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89KR8:glutamine synthetase 703 1995 gene locus_tag LOCUS_21170 703 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 >Feature sequence0741 >Feature sequence0742 1820 69 gene locus_tag LOCUS_21180 1820 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 2815 1817 gene locus_tag LOCUS_21190 2815 1817 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814066.1 protein_id gnl|my_center|LOCUS_21190 >Feature sequence0743 >Feature sequence0744 1257 520 gene locus_tag LOCUS_21200 1257 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 1620 1492 gene locus_tag LOCUS_21210 1620 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 2065 2724 gene locus_tag LOCUS_21220 2065 2724 CDS product potassium transporter KefG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263153.1 protein_id gnl|my_center|LOCUS_21220 >Feature sequence0745 235 1023 gene locus_tag LOCUS_21230 235 1023 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927121.1 protein_id gnl|my_center|LOCUS_21230 1020 1427 gene locus_tag LOCUS_21240 1020 1427 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527982.1 protein_id gnl|my_center|LOCUS_21240 <2940 1482 gene locus_tag LOCUS_21250 <2940 1482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403261.1:histidine kinase >Feature sequence0746 462 1034 gene locus_tag LOCUS_21260 462 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 1077 1475 gene locus_tag LOCUS_21270 1077 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 1477 1929 gene locus_tag LOCUS_21280 1477 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 2711 2064 gene locus_tag LOCUS_21290 2711 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 >Feature sequence0747 1679 2827 gene locus_tag LOCUS_21300 1679 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 >Feature sequence0748 2222 723 gene locus_tag LOCUS_21310 2222 723 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_21310 <2938 2219 gene locus_tag LOCUS_21320 <2938 2219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KE48:thioredoxin reductase >Feature sequence0749 1071 508 gene locus_tag LOCUS_21330 1071 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 1207 2748 gene locus_tag LOCUS_21340 1207 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 >Feature sequence0750 1173 757 gene locus_tag LOCUS_21350 1173 757 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268094.1 protein_id gnl|my_center|LOCUS_21350 1737 1186 gene locus_tag LOCUS_21360 1737 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118787.1 protein_id gnl|my_center|LOCUS_21360 >Feature sequence0751 >Feature sequence0752 476 1474 gene locus_tag LOCUS_21370 476 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 >Feature sequence0753 228 929 gene locus_tag LOCUS_21380 228 929 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105616.1 protein_id gnl|my_center|LOCUS_21380 >Feature sequence0754 >Feature sequence0755 >Feature sequence0756 1821 2234 gene locus_tag LOCUS_21390 gene apaG 1821 2234 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VE6 protein_id gnl|my_center|LOCUS_21390 <2930 2245 gene locus_tag LOCUS_21400 <2930 2245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7ULP9:RNA-splicing ligase RtcB >Feature sequence0757 >Feature sequence0758 963 724 gene locus_tag LOCUS_21410 gene acpP 963 724 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHD2 protein_id gnl|my_center|LOCUS_21410 1903 1160 gene locus_tag LOCUS_21420 gene fabG-2 1903 1160 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 protein_id gnl|my_center|LOCUS_21420 <2914 2096 gene locus_tag LOCUS_21430 <2914 2096 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74CS0:malonyl CoA-acyl carrier protein transacylase >Feature sequence0759 <1 610 gene locus_tag LOCUS_21440 <1 610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108548.1:methyltransferase type 11 848 1459 gene locus_tag LOCUS_21450 848 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 <2910 1492 gene locus_tag LOCUS_21460 <2910 1492 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103522.1:DNA helicase >Feature sequence0760 <1 557 gene locus_tag LOCUS_21470 <1 557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144059.1:DNA-directed RNA polymerase sigma-70 factor >Feature sequence0761 1836 1528 gene locus_tag LOCUS_21480 1836 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 2011 2823 gene locus_tag LOCUS_21490 2011 2823 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227999.1 protein_id gnl|my_center|LOCUS_21490 >Feature sequence0762 148 2850 gene locus_tag LOCUS_21500 148 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 >Feature sequence0763 615 1985 gene locus_tag LOCUS_21510 gene rimO 615 1985 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747R0 protein_id gnl|my_center|LOCUS_21510 >Feature sequence0764 2845 50 gene locus_tag LOCUS_21520 2845 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 >Feature sequence0765 1 585 gene locus_tag LOCUS_21530 1 585 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_21530 >Feature sequence0766 >Feature sequence0767 1484 633 gene locus_tag LOCUS_21540 gene phnC 1484 633 CDS product phosphonates import ATP-binding protein PhnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HFB5 protein_id gnl|my_center|LOCUS_21540 <2879 1484 gene locus_tag LOCUS_21550 <2879 1484 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016927.1:phosphonates-binding protein >Feature sequence0768 2337 1957 gene locus_tag LOCUS_21560 2337 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 >Feature sequence0769 668 1528 gene locus_tag LOCUS_21570 668 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 2712 1813 gene locus_tag LOCUS_21580 2712 1813 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140901.1 protein_id gnl|my_center|LOCUS_21580 >Feature sequence0770 >Feature sequence0771 886 23 gene locus_tag LOCUS_21590 886 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 1096 2616 gene locus_tag LOCUS_21600 1096 2616 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085984871.1 protein_id gnl|my_center|LOCUS_21600 >Feature sequence0772 >Feature sequence0773 21 1820 gene locus_tag LOCUS_21610 21 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 >Feature sequence0774 1192 206 gene locus_tag LOCUS_21620 1192 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 1850 1185 gene locus_tag LOCUS_21630 1850 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 >Feature sequence0775 1613 855 gene locus_tag LOCUS_21640 1613 855 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405282.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21640 1838 1623 gene locus_tag LOCUS_21650 1838 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 2437 1838 gene locus_tag LOCUS_21660 2437 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 2862 2434 gene locus_tag LOCUS_21670 2862 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 >Feature sequence0776 519 1838 gene locus_tag LOCUS_21680 gene fahA 519 1838 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808480.1 protein_id gnl|my_center|LOCUS_21680 >Feature sequence0777 <1 1645 gene locus_tag LOCUS_21690 <1 1645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7AJA5:serine/threonine-protein kinase pkn1 2584 1661 gene locus_tag LOCUS_21700 2584 1661 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404720.1 protein_id gnl|my_center|LOCUS_21700 >Feature sequence0778 >Feature sequence0779 142 627 gene locus_tag LOCUS_21710 gene ribH 142 627 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66529 protein_id gnl|my_center|LOCUS_21710 624 1298 gene locus_tag LOCUS_21720 624 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 1298 2461 gene locus_tag LOCUS_21730 1298 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 >Feature sequence0780 2532 1756 gene locus_tag LOCUS_21740 2532 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 >Feature sequence0781 156 1502 gene locus_tag LOCUS_21750 156 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 1617 1919 gene locus_tag LOCUS_21760 1617 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 2041 2706 gene locus_tag LOCUS_21770 2041 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 >Feature sequence0782 961 1170 gene locus_tag LOCUS_21780 961 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 2413 1181 gene locus_tag LOCUS_21790 2413 1181 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142595.1 protein_id gnl|my_center|LOCUS_21790 >Feature sequence0783 229 1491 gene locus_tag LOCUS_21800 229 1491 CDS product alkylhalidase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119821.1 protein_id gnl|my_center|LOCUS_21800 <2858 1488 gene locus_tag LOCUS_21810 <2858 1488 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030349.1:ATP-binding protein >Feature sequence0784 1686 1423 gene locus_tag LOCUS_21820 1686 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 1965 2513 gene locus_tag LOCUS_21830 1965 2513 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UH72 protein_id gnl|my_center|LOCUS_21830 >Feature sequence0785 2725 1148 gene locus_tag LOCUS_21840 2725 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 >Feature sequence0786 1604 720 gene locus_tag LOCUS_21850 1604 720 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RS93 protein_id gnl|my_center|LOCUS_21850 2851 1604 gene locus_tag LOCUS_21860 2851 1604 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390052.1 protein_id gnl|my_center|LOCUS_21860 >Feature sequence0787 <2850 1363 gene locus_tag LOCUS_21870 <2850 1363 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9Z3S0:phosphogluconate dehydratase >Feature sequence0788 583 1467 gene locus_tag LOCUS_21880 583 1467 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089804.1 protein_id gnl|my_center|LOCUS_21880 >Feature sequence0789 1484 279 gene locus_tag LOCUS_21890 1484 279 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207983.1 protein_id gnl|my_center|LOCUS_21890 2715 1510 gene locus_tag LOCUS_21900 2715 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258647.1 protein_id gnl|my_center|LOCUS_21900 >Feature sequence0790 <2845 1485 gene locus_tag LOCUS_21910 <2845 1485 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404368.1:lysyl endopeptidase >Feature sequence0791 356 778 gene locus_tag LOCUS_21920 356 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 1353 1132 gene locus_tag LOCUS_21930 1353 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 2581 1370 gene locus_tag LOCUS_21940 2581 1370 CDS product thiamin biosynthesis lipoprotein ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_231920.2 protein_id gnl|my_center|LOCUS_21940 >Feature sequence0792 1065 2606 gene locus_tag LOCUS_21950 1065 2606 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140057.1 protein_id gnl|my_center|LOCUS_21950 >Feature sequence0793 1 1233 gene locus_tag LOCUS_21960 1 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 <2835 1577 gene locus_tag LOCUS_21970 <2835 1577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964428.1:peptidase S9 >Feature sequence0794 >Feature sequence0795 <2831 912 gene locus_tag LOCUS_21980 <2831 912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085082.1:alkaline protease >Feature sequence0796 126 995 gene locus_tag LOCUS_21990 126 995 CDS product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_21990 >Feature sequence0797 969 523 gene locus_tag LOCUS_22000 969 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356741.1 protein_id gnl|my_center|LOCUS_22000 2357 981 gene locus_tag LOCUS_22010 2357 981 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940194.1 protein_id gnl|my_center|LOCUS_22010 >Feature sequence0798 827 108 gene locus_tag LOCUS_22020 827 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 <2828 1105 gene locus_tag LOCUS_22030 <2828 1105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039974.1:5-oxoprolinase >Feature sequence0799 2681 687 gene locus_tag LOCUS_22040 2681 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 >Feature sequence0800 >Feature sequence0801 495 713 gene locus_tag LOCUS_22050 495 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 734 1531 gene locus_tag LOCUS_22060 734 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 >Feature sequence0802 2189 666 gene locus_tag LOCUS_22070 2189 666 CDS product HTTM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902592.1 protein_id gnl|my_center|LOCUS_22070 2683 2285 gene locus_tag LOCUS_22080 2683 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 >Feature sequence0803 392 601 gene locus_tag LOCUS_22090 gene rpsU 392 601 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKU0 protein_id gnl|my_center|LOCUS_22090 740 2413 gene locus_tag LOCUS_22100 740 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22100 >Feature sequence0804 1181 156 gene locus_tag LOCUS_22110 gene mreB-1 1181 156 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_22110 >Feature sequence0805 219 1679 gene locus_tag LOCUS_22120 219 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 1689 2168 gene locus_tag LOCUS_22130 1689 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 >Feature sequence0806 2377 488 gene locus_tag LOCUS_22140 2377 488 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070554.1 protein_id gnl|my_center|LOCUS_22140 >Feature sequence0807 >Feature sequence0808 1217 1026 gene locus_tag LOCUS_22150 1217 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 2814 1441 gene locus_tag LOCUS_22160 2814 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 >Feature sequence0809 1419 2324 gene locus_tag LOCUS_22170 1419 2324 CDS product N-acetylmannosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 protein_id gnl|my_center|LOCUS_22170 >Feature sequence0810 <1 800 gene locus_tag LOCUS_22180 <1 800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545054.1:phosphohydrolase 955 1683 gene locus_tag LOCUS_22190 955 1683 CDS product cAMP phosphodiesterase class-II:metallo-beta-lactamase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_22190 1776 2585 gene locus_tag LOCUS_22200 1776 2585 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942276.1 protein_id gnl|my_center|LOCUS_22200 >Feature sequence0811 <1 636 gene locus_tag LOCUS_22210 <1 636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089515.1:two-component sensor histidine kinase 641 1357 gene locus_tag LOCUS_22220 641 1357 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_22220 1354 2385 gene locus_tag LOCUS_22230 gene hemE 1354 2385 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746R5 protein_id gnl|my_center|LOCUS_22230 2445 2663 gene locus_tag LOCUS_22240 2445 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22240 >Feature sequence0812 372 770 gene locus_tag LOCUS_22250 372 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 1058 1225 gene locus_tag LOCUS_22260 1058 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 1240 1806 gene locus_tag LOCUS_22270 1240 1806 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766910.1 protein_id gnl|my_center|LOCUS_22270 1997 2521 gene locus_tag LOCUS_22280 gene kptA 1997 2521 CDS product putative RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBW7 protein_id gnl|my_center|LOCUS_22280 >Feature sequence0813 <1 796 gene locus_tag LOCUS_22290 <1 796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228734.1:enoyl-CoA hydratase >Feature sequence0814 1980 700 gene locus_tag LOCUS_22300 gene rsgA 1980 700 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74A60 protein_id gnl|my_center|LOCUS_22300 >Feature sequence0815 <1 1098 gene locus_tag LOCUS_22310 <1 1098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HXN2:phosphoribosylformylglycinamidine synthase 1240 1545 gene locus_tag LOCUS_22320 1240 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 2566 1772 gene locus_tag LOCUS_22330 2566 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 >Feature sequence0816 2169 1147 gene locus_tag LOCUS_22340 2169 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 >Feature sequence0817 408 2141 gene locus_tag LOCUS_22350 408 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 <2807 2282 gene locus_tag LOCUS_22360 <2807 2282 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814192.1:alpha/beta hydrolase >Feature sequence0818 >Feature sequence0819 1031 3 gene locus_tag LOCUS_22370 1031 3 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RH43 protein_id gnl|my_center|LOCUS_22370 1535 2218 gene locus_tag LOCUS_22380 1535 2218 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255933.1 protein_id gnl|my_center|LOCUS_22380 2705 2370 gene locus_tag LOCUS_22390 2705 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 >Feature sequence0820 >Feature sequence0821 1807 776 gene locus_tag LOCUS_22400 gene cfa 1807 776 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207172.1 protein_id gnl|my_center|LOCUS_22400 <2796 2046 gene locus_tag LOCUS_22410 <2796 2046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103434.1:cyclopropane-fatty-acyl-phospholipid synthase >Feature sequence0822 1319 999 gene locus_tag LOCUS_22420 1319 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 >Feature sequence0823 142 1077 gene locus_tag LOCUS_22430 142 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 1626 2294 gene locus_tag LOCUS_22440 1626 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 >Feature sequence0824 1335 565 gene locus_tag LOCUS_22450 1335 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 1574 2371 gene locus_tag LOCUS_22460 1574 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 >Feature sequence0825 >Feature sequence0826 2087 1152 gene locus_tag LOCUS_22470 2087 1152 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393837.1 protein_id gnl|my_center|LOCUS_22470 >Feature sequence0827 2186 6 gene locus_tag LOCUS_22480 2186 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 >Feature sequence0828 <1 2685 gene locus_tag LOCUS_22490 <1 2685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015705805.1:type IV secretion protein Rhs >Feature sequence0829 >Feature sequence0830 44 973 gene locus_tag LOCUS_22500 44 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 975 2042 gene locus_tag LOCUS_22510 gene purM 975 2042 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG74 protein_id gnl|my_center|LOCUS_22510 2039 2647 gene locus_tag LOCUS_22520 gene purN 2039 2647 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0V4 protein_id gnl|my_center|LOCUS_22520 >Feature sequence0831 700 1443 gene locus_tag LOCUS_22530 700 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 >Feature sequence0832 <1 1659 gene locus_tag LOCUS_22540 <1 1659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_635913.2:ribonuclease >Feature sequence0833 77 916 gene locus_tag LOCUS_22550 77 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 1092 1907 gene locus_tag LOCUS_22560 1092 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 >Feature sequence0834 <1 2698 gene locus_tag LOCUS_22570 <1 2698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903780.1:ribonucleoside-diphosphate reductase subunit alpha >Feature sequence0835 594 1871 gene locus_tag LOCUS_22580 594 1871 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_22580 >Feature sequence0836 739 176 gene locus_tag LOCUS_22590 739 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 1566 727 gene locus_tag LOCUS_22600 1566 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 1990 1550 gene locus_tag LOCUS_22610 1990 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 2700 1987 gene locus_tag LOCUS_22620 2700 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 >Feature sequence0837 2168 1209 gene locus_tag LOCUS_22630 2168 1209 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404958.1 protein_id gnl|my_center|LOCUS_22630 >Feature sequence0838 2512 1073 gene locus_tag LOCUS_22640 gene murF 2512 1073 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81IU0 protein_id gnl|my_center|LOCUS_22640 2759 2505 gene locus_tag LOCUS_22650 2759 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 >Feature sequence0839 >Feature sequence0840 <1 979 gene locus_tag LOCUS_22660 <1 979 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963649.1:ATPase AAA 1553 1005 gene locus_tag LOCUS_22670 1553 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 >Feature sequence0841 >Feature sequence0842 >Feature sequence0843 <1 1593 gene locus_tag LOCUS_22680 <1 1593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222920.1:glycosyl transferase >Feature sequence0844 699 34 gene locus_tag LOCUS_22690 699 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 935 1930 gene locus_tag LOCUS_22700 935 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940235.1 protein_id gnl|my_center|LOCUS_22700 >Feature sequence0845 464 1090 gene locus_tag LOCUS_22710 464 1090 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528392.1 protein_id gnl|my_center|LOCUS_22710 1161 2408 gene locus_tag LOCUS_22720 1161 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 >Feature sequence0846 <1 512 gene locus_tag LOCUS_22730 <1 512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022027.1:ion transporter 800 1864 gene locus_tag LOCUS_22740 800 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775723.1 protein_id gnl|my_center|LOCUS_22740 >Feature sequence0847 <1 1879 gene locus_tag LOCUS_22750 <1 1879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941123.1:exporter >Feature sequence0848 <1 684 gene locus_tag LOCUS_22760 <1 684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229596.1:CoA transferase >Feature sequence0849 1 933 gene locus_tag LOCUS_22770 1 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 1816 980 gene locus_tag LOCUS_22780 1816 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22780 2251 1820 gene locus_tag LOCUS_22790 2251 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 >Feature sequence0850 958 1389 gene locus_tag LOCUS_22800 958 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 >Feature sequence0851 >Feature sequence0852 258 980 gene locus_tag LOCUS_22810 258 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 1251 1925 gene locus_tag LOCUS_22820 1251 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477484.1 protein_id gnl|my_center|LOCUS_22820 >Feature sequence0853 461 333 gene locus_tag LOCUS_22830 461 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 460 1350 gene locus_tag LOCUS_22840 460 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 1432 2343 gene locus_tag LOCUS_22850 1432 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 >Feature sequence0854 569 838 gene locus_tag LOCUS_22860 569 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 >Feature sequence0855 1333 560 gene locus_tag LOCUS_22870 1333 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 >Feature sequence0856 >Feature sequence0857 311 1024 gene locus_tag LOCUS_22880 311 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 2393 1293 gene locus_tag LOCUS_22890 2393 1293 CDS product arabinose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706056.1 protein_id gnl|my_center|LOCUS_22890 >Feature sequence0858 2439 427 gene locus_tag LOCUS_22900 2439 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 >Feature sequence0859 1015 194 gene locus_tag LOCUS_22910 1015 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 1417 1908 gene locus_tag LOCUS_22920 1417 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 1892 2659 gene locus_tag LOCUS_22930 1892 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 >Feature sequence0860 631 1365 gene locus_tag LOCUS_22940 631 1365 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TA7 protein_id gnl|my_center|LOCUS_22940 2324 1446 gene locus_tag LOCUS_22950 2324 1446 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941846.1 protein_id gnl|my_center|LOCUS_22950 >Feature sequence0861 1 378 gene locus_tag LOCUS_22960 1 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 384 878 gene locus_tag LOCUS_22970 384 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 886 1302 gene locus_tag LOCUS_22980 886 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222078.1 protein_id gnl|my_center|LOCUS_22980 1328 1738 gene locus_tag LOCUS_22990 1328 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 1665 2207 gene locus_tag LOCUS_23000 1665 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119866.1 protein_id gnl|my_center|LOCUS_23000 >Feature sequence0862 1403 393 gene locus_tag LOCUS_23010 gene citC 1403 393 CDS product isocitrate dehydrogenase, NAD-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964290.1 protein_id gnl|my_center|LOCUS_23010 2606 1521 gene locus_tag LOCUS_23020 2606 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 >Feature sequence0863 1566 451 gene locus_tag LOCUS_23030 1566 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 <2726 1923 gene locus_tag LOCUS_23040 <2726 1923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_080510933.1:formate dehydrogenase subunit alpha >Feature sequence0864 970 260 gene locus_tag LOCUS_23050 970 260 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029519.1 protein_id gnl|my_center|LOCUS_23050 2282 1488 gene locus_tag LOCUS_23060 2282 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 >Feature sequence0865 <1 1080 gene locus_tag LOCUS_23070 <1 1080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029150.1:aminotransferase 1077 1847 gene locus_tag LOCUS_23080 1077 1847 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069020.1 protein_id gnl|my_center|LOCUS_23080 >Feature sequence0866 <1 800 gene locus_tag LOCUS_23090 <1 800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005797373.1:membrane protein 800 1834 gene locus_tag LOCUS_23100 800 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 >Feature sequence0867 3 134 gene locus_tag LOCUS_23110 3 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 609 346 gene locus_tag LOCUS_23120 gene rpsT 609 346 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AZ3 protein_id gnl|my_center|LOCUS_23120 1740 964 gene locus_tag LOCUS_23130 1740 964 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038132.1 protein_id gnl|my_center|LOCUS_23130 2410 1841 gene locus_tag LOCUS_23140 2410 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 >Feature sequence0868 1235 1819 gene locus_tag LOCUS_23150 1235 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 2718 1843 gene locus_tag LOCUS_23160 2718 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 >Feature sequence0869 1159 2355 gene locus_tag LOCUS_23170 1159 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 >Feature sequence0870 1606 1100 gene locus_tag LOCUS_23180 1606 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 2262 1612 gene locus_tag LOCUS_23190 2262 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 >Feature sequence0871 1249 1812 gene locus_tag LOCUS_23200 1249 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 1923 2267 gene locus_tag LOCUS_23210 1923 2267 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72C35 protein_id gnl|my_center|LOCUS_23210 >Feature sequence0872 1461 187 gene locus_tag LOCUS_23220 gene gltA 1461 187 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F801 protein_id gnl|my_center|LOCUS_23220 2425 1715 gene locus_tag LOCUS_23230 2425 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 2713 2627 gene locus_tag LOCUS_t00240 2713 2627 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0873 <1 1093 gene locus_tag LOCUS_23240 <1 1093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HTJ5:phosphate transport system permease protein PstA 1128 2012 gene locus_tag LOCUS_23250 gene pstB 1128 2012 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51546 protein_id gnl|my_center|LOCUS_23250 >Feature sequence0874 2536 875 gene locus_tag LOCUS_23260 2536 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640232.1 protein_id gnl|my_center|LOCUS_23260 >Feature sequence0875 935 462 gene locus_tag LOCUS_23270 935 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 1112 1375 gene locus_tag LOCUS_23280 1112 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 1368 1775 gene locus_tag LOCUS_23290 1368 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 >Feature sequence0876 152 538 gene locus_tag LOCUS_23300 152 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 >Feature sequence0877 517 1035 gene locus_tag LOCUS_23310 517 1035 CDS product microcystin dependent MdpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070581.1 protein_id gnl|my_center|LOCUS_23310 1047 1559 gene locus_tag LOCUS_23320 1047 1559 CDS product tail Collar domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528766.1 protein_id gnl|my_center|LOCUS_23320 1688 2185 gene locus_tag LOCUS_23330 1688 2185 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528768.1 protein_id gnl|my_center|LOCUS_23330 2269 2589 gene locus_tag LOCUS_23340 2269 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639540.2 protein_id gnl|my_center|LOCUS_23340 >Feature sequence0878 >Feature sequence0879 589 1443 gene locus_tag LOCUS_23350 589 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 1544 2563 gene locus_tag LOCUS_23360 gene kch 1544 2563 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842311.1 protein_id gnl|my_center|LOCUS_23360 >Feature sequence0880 1700 2422 gene locus_tag LOCUS_23370 1700 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 >Feature sequence0881 894 1184 gene locus_tag LOCUS_23380 894 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 >Feature sequence0882 >Feature sequence0883 >Feature sequence0884 1681 80 gene locus_tag LOCUS_23390 1681 80 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016819.1 protein_id gnl|my_center|LOCUS_23390 >Feature sequence0885 2572 371 gene locus_tag LOCUS_23400 2572 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 >Feature sequence0886 1995 340 gene locus_tag LOCUS_23410 1995 340 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403971.1 protein_id gnl|my_center|LOCUS_23410 2177 2443 gene locus_tag LOCUS_23420 2177 2443 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251068.1 protein_id gnl|my_center|LOCUS_23420 >Feature sequence0887 1004 720 gene locus_tag LOCUS_23430 1004 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 1249 2322 gene locus_tag LOCUS_23440 1249 2322 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404003.1 protein_id gnl|my_center|LOCUS_23440 >Feature sequence0888 3 326 gene locus_tag LOCUS_23450 3 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 1100 420 gene locus_tag LOCUS_23460 1100 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 1372 2511 gene locus_tag LOCUS_23470 gene adhP 1372 2511 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870126.1 protein_id gnl|my_center|LOCUS_23470 >Feature sequence0889 901 521 gene locus_tag LOCUS_23480 901 521 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942875.1 protein_id gnl|my_center|LOCUS_23480 1410 901 gene locus_tag LOCUS_23490 gene hpt 1410 901 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416006.1 protein_id gnl|my_center|LOCUS_23490 >Feature sequence0890 >Feature sequence0891 <1 1077 gene locus_tag LOCUS_23500 <1 1077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257181.1:Bcr/CflA family drug resistance efflux transporter 1198 2412 gene locus_tag LOCUS_23510 1198 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 >Feature sequence0892 <1 575 gene locus_tag LOCUS_23520 <1 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119028.1:ethanolamine utilization protein EutD 659 1477 gene locus_tag LOCUS_23530 659 1477 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892195.1 protein_id gnl|my_center|LOCUS_23530 >Feature sequence0893 1593 61 gene locus_tag LOCUS_23540 1593 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 >Feature sequence0894 438 1628 gene locus_tag LOCUS_23550 gene murG 438 1628 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCK0 protein_id gnl|my_center|LOCUS_23550 >Feature sequence0895 456 304 gene locus_tag LOCUS_23560 456 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 976 557 gene locus_tag LOCUS_23570 976 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975330.1 protein_id gnl|my_center|LOCUS_23570 <2683 1015 gene locus_tag LOCUS_23580 <2683 1015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975332.1:nodulation protein >Feature sequence0896 <1 2001 gene locus_tag LOCUS_23590 <1 2001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038432.1:GGDEF domain-containing protein >Feature sequence0897 118 312 gene locus_tag LOCUS_23600 118 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 469 1668 gene locus_tag LOCUS_23610 gene lpxB 469 1668 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AT9 protein_id gnl|my_center|LOCUS_23610 >Feature sequence0898 <1 661 gene locus_tag LOCUS_23620 <1 661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947927.1:choline monooxygenase 1574 687 gene locus_tag LOCUS_23630 1574 687 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258345.1 protein_id gnl|my_center|LOCUS_23630 2629 1574 gene locus_tag LOCUS_23640 gene ruvB 2629 1574 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPA2 protein_id gnl|my_center|LOCUS_23640 >Feature sequence0899 >Feature sequence0900 237 1436 gene locus_tag LOCUS_23650 237 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 >Feature sequence0901 >Feature sequence0902 294 1082 gene locus_tag LOCUS_23660 294 1082 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_23660 1093 1899 gene locus_tag LOCUS_23670 1093 1899 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_23670 >Feature sequence0903 312 935 gene locus_tag LOCUS_23680 312 935 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926408.1 protein_id gnl|my_center|LOCUS_23680 982 1602 gene locus_tag LOCUS_23690 982 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 1766 2248 gene locus_tag LOCUS_23700 1766 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 >Feature sequence0904 >Feature sequence0905 1798 1067 gene locus_tag LOCUS_23710 1798 1067 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086341.1 protein_id gnl|my_center|LOCUS_23710 <2660 1836 gene locus_tag LOCUS_23720 <2660 1836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946887.1:amine oxidase >Feature sequence0906 >Feature sequence0907 5 2368 gene locus_tag LOCUS_23730 5 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 >Feature sequence0908 >Feature sequence0909 54 812 gene locus_tag LOCUS_23740 54 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 1283 1561 gene locus_tag LOCUS_23750 gene hlpA 1283 1561 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284639.1 protein_id gnl|my_center|LOCUS_23750 1615 1794 gene locus_tag LOCUS_23760 1615 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 2416 1742 gene locus_tag LOCUS_23770 2416 1742 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_23770 >Feature sequence0910 1747 806 gene locus_tag LOCUS_23780 1747 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 >Feature sequence0911 141 656 gene locus_tag LOCUS_23790 gene ppiB 141 656 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F376 protein_id gnl|my_center|LOCUS_23790 1544 870 gene locus_tag LOCUS_23800 1544 870 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550362.1 protein_id gnl|my_center|LOCUS_23800 <2645 1744 gene locus_tag LOCUS_23810 <2645 1744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942076.1:sodium/solute symporter serine/threonine phosphatase >Feature sequence0912 >Feature sequence0913 2026 599 gene locus_tag LOCUS_23820 2026 599 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_23820 <2643 2023 gene locus_tag LOCUS_23830 <2643 2023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141525.1:glycosyl transferase >Feature sequence0914 2205 400 gene locus_tag LOCUS_23840 2205 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23840 >Feature sequence0915 1445 267 gene locus_tag LOCUS_23850 1445 267 CDS product 1,2-diacylglycerol 3-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392647.1 protein_id gnl|my_center|LOCUS_23850 2143 1607 gene locus_tag LOCUS_23860 2143 1607 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036172.1 protein_id gnl|my_center|LOCUS_23860 >Feature sequence0916 814 392 gene locus_tag LOCUS_23870 814 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 <2641 998 gene locus_tag LOCUS_23880 <2641 998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583151.1:fatty acid-binding protein DegV >Feature sequence0917 >Feature sequence0918 1 891 gene locus_tag LOCUS_23890 1 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 917 1480 gene locus_tag LOCUS_23900 917 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 >Feature sequence0919 52 1875 gene locus_tag LOCUS_23910 52 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 >Feature sequence0920 103 1038 gene locus_tag LOCUS_23920 103 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 1162 2247 gene locus_tag LOCUS_23930 1162 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 2626 2285 gene locus_tag LOCUS_23940 2626 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 >Feature sequence0921 1277 1456 gene locus_tag LOCUS_23950 1277 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 >Feature sequence0922 >Feature sequence0923 <1 711 gene locus_tag LOCUS_23960 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012255972.1:permease 1873 761 gene locus_tag LOCUS_23970 gene ald 1873 761 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEW0 protein_id gnl|my_center|LOCUS_23970 2461 1895 gene locus_tag LOCUS_23980 2461 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 >Feature sequence0924 >Feature sequence0925 1556 33 gene locus_tag LOCUS_23990 1556 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 >Feature sequence0926 >Feature sequence0927 <1 850 gene locus_tag LOCUS_24000 <1 850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878451.1:FAD-dependent oxidoreductase 862 2445 gene locus_tag LOCUS_24010 862 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 >Feature sequence0928 1 228 gene locus_tag LOCUS_24020 1 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 379 678 gene locus_tag LOCUS_24030 379 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 690 1253 gene locus_tag LOCUS_24040 690 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 >Feature sequence0929 487 1080 gene locus_tag LOCUS_24050 487 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 1891 1280 gene locus_tag LOCUS_24060 1891 1280 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814899.1 protein_id gnl|my_center|LOCUS_24060 >Feature sequence0930 810 55 gene locus_tag LOCUS_24070 810 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 1820 915 gene locus_tag LOCUS_24080 1820 915 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256392.1 protein_id gnl|my_center|LOCUS_24080 <2618 1997 gene locus_tag LOCUS_24090 <2618 1997 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B8E3F3:dihydroxy-acid dehydratase >Feature sequence0931 121 1203 gene locus_tag LOCUS_24100 121 1203 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208044.1 protein_id gnl|my_center|LOCUS_24100 1196 2029 gene locus_tag LOCUS_24110 1196 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 >Feature sequence0932 2529 214 gene locus_tag LOCUS_24120 2529 214 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 protein_id gnl|my_center|LOCUS_24120 >Feature sequence0933 817 2079 gene locus_tag LOCUS_24130 817 2079 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403190.1 protein_id gnl|my_center|LOCUS_24130 >Feature sequence0934 2269 1508 gene locus_tag LOCUS_24140 2269 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 2556 2481 gene locus_tag LOCUS_t00250 2556 2481 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0935 843 1631 gene locus_tag LOCUS_24150 843 1631 CDS product guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876603.1 protein_id gnl|my_center|LOCUS_24150 1646 2098 gene locus_tag LOCUS_24160 1646 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 >Feature sequence0936 130 1977 gene locus_tag LOCUS_24170 130 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 1974 2570 gene locus_tag LOCUS_24180 1974 2570 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887827.1 protein_id gnl|my_center|LOCUS_24180 >Feature sequence0937 <1 531 gene locus_tag LOCUS_24190 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004198286.1:monooxygenase note possible pseudo, frameshifted 535 1527 gene locus_tag LOCUS_24200 535 1527 CDS product symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_24200 1520 2527 gene locus_tag LOCUS_24210 1520 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975510.1 protein_id gnl|my_center|LOCUS_24210 >Feature sequence0938 >Feature sequence0939 >Feature sequence0940 1553 1059 gene locus_tag LOCUS_24220 1553 1059 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123033.1 protein_id gnl|my_center|LOCUS_24220 >Feature sequence0941 >Feature sequence0942 >Feature sequence0943 <1 557 gene locus_tag LOCUS_24230 <1 557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124950.1:homoserine/choline kinase 554 1243 gene locus_tag LOCUS_24240 554 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 2267 1563 gene locus_tag LOCUS_24250 2267 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 >Feature sequence0944 1511 795 gene locus_tag LOCUS_24260 1511 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 >Feature sequence0945 <1 504 gene locus_tag LOCUS_24270 <1 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8ED46:signal peptidase I >Feature sequence0946 352 975 gene locus_tag LOCUS_24280 352 975 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249198.1 protein_id gnl|my_center|LOCUS_24280 1140 2450 gene locus_tag LOCUS_24290 gene hisD 1140 2450 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5V1 protein_id gnl|my_center|LOCUS_24290 >Feature sequence0947 3 761 gene locus_tag LOCUS_24300 3 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 793 2313 gene locus_tag LOCUS_24310 gene merA 793 2313 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123134.1 protein_id gnl|my_center|LOCUS_24310 >Feature sequence0948 1743 1102 gene locus_tag LOCUS_24320 1743 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 1994 2070 gene locus_tag LOCUS_t00260 1994 2070 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0949 <1 2517 gene locus_tag LOCUS_24330 <1 2517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546673.1:outer membrane protein, OMP85 family >Feature sequence0950 457 774 gene locus_tag LOCUS_24340 457 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 897 2228 gene locus_tag LOCUS_24350 897 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 >Feature sequence0951 1893 667 gene locus_tag LOCUS_24360 1893 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 >Feature sequence0952 1740 151 gene locus_tag LOCUS_24370 1740 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 2249 2324 gene locus_tag LOCUS_t00270 2249 2324 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0953 445 876 gene locus_tag LOCUS_24380 445 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 864 1466 gene locus_tag LOCUS_24390 864 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 1460 1894 gene locus_tag LOCUS_24400 1460 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 >Feature sequence0954 381 2483 gene locus_tag LOCUS_24410 381 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 >Feature sequence0955 833 87 gene locus_tag LOCUS_24420 833 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 870 1097 gene locus_tag LOCUS_24430 870 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 2551 1175 gene locus_tag LOCUS_24440 2551 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 >Feature sequence0956 >Feature sequence0957 >Feature sequence0958 <1 1016 gene locus_tag LOCUS_24450 <1 1016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UFB7:ATP synthase subunit alpha 2 1082 1957 gene locus_tag LOCUS_24460 gene atpG 1082 1957 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFB6 protein_id gnl|my_center|LOCUS_24460 >Feature sequence0959 2547 427 gene locus_tag LOCUS_24470 2547 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 >Feature sequence0960 >Feature sequence0961 603 1235 gene locus_tag LOCUS_24480 603 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 1327 1719 gene locus_tag LOCUS_24490 1327 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 >Feature sequence0962 <1 1749 gene locus_tag LOCUS_24500 <1 1749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027613.1:helicase 2540 1950 gene locus_tag LOCUS_24510 2540 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 >Feature sequence0963 2366 1941 gene locus_tag LOCUS_24520 2366 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 >Feature sequence0964 230 1849 gene locus_tag LOCUS_24530 230 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 1935 2093 gene locus_tag LOCUS_24540 1935 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 >Feature sequence0965 >Feature sequence0966 64 1038 gene locus_tag LOCUS_24550 64 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 1055 1684 gene locus_tag LOCUS_24560 1055 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 <2536 1629 gene locus_tag LOCUS_24570 <2536 1629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144078.1:tetratricopeptide repeat protein >Feature sequence0967 59 814 gene locus_tag LOCUS_24580 59 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 875 1408 gene locus_tag LOCUS_24590 875 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 2334 1537 gene locus_tag LOCUS_24600 gene trpA 2334 1537 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AI3 protein_id gnl|my_center|LOCUS_24600 >Feature sequence0968 23 235 gene locus_tag LOCUS_24610 23 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 425 2128 gene locus_tag LOCUS_24620 425 2128 CDS product electron transfer flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947007.1 protein_id gnl|my_center|LOCUS_24620 >Feature sequence0969 >Feature sequence0970 1189 395 gene locus_tag LOCUS_24630 1189 395 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393019.1 protein_id gnl|my_center|LOCUS_24630 2175 1234 gene locus_tag LOCUS_24640 2175 1234 CDS product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_24640 >Feature sequence0971 >Feature sequence0972 <1 1876 gene locus_tag LOCUS_24650 <1 1876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141986.1:penicillin amidase >Feature sequence0973 1901 453 gene locus_tag LOCUS_24660 gene dacB 1901 453 CDS product peptidase M15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404492.1 protein_id gnl|my_center|LOCUS_24660 >Feature sequence0974 2011 236 gene locus_tag LOCUS_24670 gene sopT 2011 236 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722319.1 protein_id gnl|my_center|LOCUS_24670 >Feature sequence0975 767 1192 gene locus_tag LOCUS_24680 767 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 1189 2313 gene locus_tag LOCUS_24690 1189 2313 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015557.1 protein_id gnl|my_center|LOCUS_24690 >Feature sequence0976 >Feature sequence0977 <1 2035 gene locus_tag LOCUS_24700 <1 2035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226013.1:peptidase M14 >Feature sequence0978 514 1467 gene locus_tag LOCUS_24710 514 1467 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 protein_id gnl|my_center|LOCUS_24710 <2513 1563 gene locus_tag LOCUS_24720 <2513 1563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258974.1:2-oxoisovalerate dehydrogenase subunit beta >Feature sequence0979 <1 2300 gene locus_tag LOCUS_24730 <1 2300 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038432.1:GGDEF domain-containing protein >Feature sequence0980 >Feature sequence0981 >Feature sequence0982 1813 410 gene locus_tag LOCUS_24740 gene allB 1813 410 CDS product allantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RKU5 protein_id gnl|my_center|LOCUS_24740 >Feature sequence0983 1692 1183 gene locus_tag LOCUS_24750 1692 1183 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561349.1 protein_id gnl|my_center|LOCUS_24750 >Feature sequence0984 <2505 314 gene locus_tag LOCUS_24760 <2505 314 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RLU9:UvrABC system protein A >Feature sequence0985 2433 1171 gene locus_tag LOCUS_24770 gene ribBA 2433 1171 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHZ1 protein_id gnl|my_center|LOCUS_24770 >Feature sequence0986 665 1663 gene locus_tag LOCUS_24780 665 1663 CDS product rhizopine catabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090585.1 protein_id gnl|my_center|LOCUS_24780 <2503 1884 gene locus_tag LOCUS_24790 <2503 1884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038470.1:amidohydrolase >Feature sequence0987 >Feature sequence0988 963 220 gene locus_tag LOCUS_24800 gene hisA 963 220 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA6 protein_id gnl|my_center|LOCUS_24800 1594 941 gene locus_tag LOCUS_24810 gene hisH 1594 941 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGW0 protein_id gnl|my_center|LOCUS_24810 2226 1591 gene locus_tag LOCUS_24820 2226 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 >Feature sequence0989 <1 1537 gene locus_tag LOCUS_24830 <1 1537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008769027.1:TonB-dependent receptor 1808 2344 gene locus_tag LOCUS_24840 1808 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 >Feature sequence0990 2 862 gene locus_tag LOCUS_24850 2 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 859 2475 gene locus_tag LOCUS_24860 859 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 >Feature sequence0991 <1 1171 gene locus_tag LOCUS_24870 <1 1171 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122247.1:fibrinogen-binding protein >Feature sequence0992 >Feature sequence0993 <1 1268 gene locus_tag LOCUS_24880 <1 1268 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584135.1:protein kinase 1366 2046 gene locus_tag LOCUS_24890 gene rpoE 1366 2046 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224545.1 protein_id gnl|my_center|LOCUS_24890 >Feature sequence0994 178 486 gene locus_tag LOCUS_24900 178 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 793 473 gene locus_tag LOCUS_24910 793 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 1180 800 gene locus_tag LOCUS_24920 1180 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 1806 1177 gene locus_tag LOCUS_24930 1806 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 >Feature sequence0995 1457 498 gene locus_tag LOCUS_24940 1457 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224517.1 protein_id gnl|my_center|LOCUS_24940 1693 1547 gene locus_tag LOCUS_24950 1693 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 >Feature sequence0996 >Feature sequence0997 366 1652 gene locus_tag LOCUS_24960 366 1652 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478826.1 protein_id gnl|my_center|LOCUS_24960 >Feature sequence0998 1734 661 gene locus_tag LOCUS_24970 gene ldh 1734 661 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091859.1 protein_id gnl|my_center|LOCUS_24970 >Feature sequence0999 2038 1271 gene locus_tag LOCUS_24980 2038 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 2469 2035 gene locus_tag LOCUS_24990 2469 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 >Feature sequence1000 1933 935 gene locus_tag LOCUS_25000 gene ddl 1933 935 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG68 protein_id gnl|my_center|LOCUS_25000 2475 2077 gene locus_tag LOCUS_25010 2475 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 >Feature sequence1001 850 158 gene locus_tag LOCUS_25020 850 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070688.1 protein_id gnl|my_center|LOCUS_25020 2011 935 gene locus_tag LOCUS_25030 2011 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 >Feature sequence1002 >Feature sequence1003 104 1441 gene locus_tag LOCUS_25040 104 1441 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201931.1 protein_id gnl|my_center|LOCUS_25040 1696 2367 gene locus_tag LOCUS_25050 1696 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 >Feature sequence1004 1113 1460 gene locus_tag LOCUS_25060 1113 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 2460 1564 gene locus_tag LOCUS_25070 2460 1564 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532977.1 protein_id gnl|my_center|LOCUS_25070 >Feature sequence1005 2110 587 gene locus_tag LOCUS_25080 2110 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 >Feature sequence1006 1 201 gene locus_tag LOCUS_25090 1 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 1338 334 gene locus_tag LOCUS_25100 1338 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 2009 1452 gene locus_tag LOCUS_25110 2009 1452 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929688.1 protein_id gnl|my_center|LOCUS_25110 >Feature sequence1007 596 2086 gene locus_tag LOCUS_25120 596 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405182.1 protein_id gnl|my_center|LOCUS_25120 >Feature sequence1008 329 1099 gene locus_tag LOCUS_25130 329 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 1115 2395 gene locus_tag LOCUS_25140 1115 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 >Feature sequence1009 >Feature sequence1010 >Feature sequence1011 577 1662 gene locus_tag LOCUS_25150 gene aroC 577 1662 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WI34 protein_id gnl|my_center|LOCUS_25150 1857 2183 gene locus_tag LOCUS_25160 1857 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 >Feature sequence1012 2134 593 gene locus_tag LOCUS_25170 2134 593 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110040.1 protein_id gnl|my_center|LOCUS_25170 >Feature sequence1013 >Feature sequence1014 1238 480 gene locus_tag LOCUS_25180 1238 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 >Feature sequence1015 1388 1221 gene locus_tag LOCUS_25190 1388 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 >Feature sequence1016 <2441 205 gene locus_tag LOCUS_25200 <2441 205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258810.1:protein kinase >Feature sequence1017 1216 2262 gene locus_tag LOCUS_25210 1216 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 >Feature sequence1018 674 1921 gene locus_tag LOCUS_25220 674 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 >Feature sequence1019 <1 1489 gene locus_tag LOCUS_25230 <1 1489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141952.1:polyketide synthase >Feature sequence1020 >Feature sequence1021 <1 721 gene locus_tag LOCUS_25240 <1 721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764308.1:beta-mannosidase 868 1914 gene locus_tag LOCUS_25250 868 1914 CDS product glucosamine--fructose-6-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256998.1 protein_id gnl|my_center|LOCUS_25250 >Feature sequence1022 1164 148 gene locus_tag LOCUS_25260 1164 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 1962 1387 gene locus_tag LOCUS_25270 1962 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 >Feature sequence1023 1793 1401 gene locus_tag LOCUS_25280 1793 1401 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316407.1 protein_id gnl|my_center|LOCUS_25280 >Feature sequence1024 507 1706 gene locus_tag LOCUS_25290 507 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258647.1 protein_id gnl|my_center|LOCUS_25290 2262 1747 gene locus_tag LOCUS_25300 2262 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 >Feature sequence1025 1896 241 gene locus_tag LOCUS_25310 1896 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141209.1 protein_id gnl|my_center|LOCUS_25310 >Feature sequence1026 <1 1797 gene locus_tag LOCUS_25320 <1 1797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121339.1:leucine/isoleucine/valine-binding protein precursor 2055 1894 gene locus_tag LOCUS_25330 2055 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 >Feature sequence1027 1571 849 gene locus_tag LOCUS_25340 1571 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 2205 1564 gene locus_tag LOCUS_25350 2205 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 >Feature sequence1028 1899 1267 gene locus_tag LOCUS_25360 1899 1267 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_25360 >Feature sequence1029 2060 1695 gene locus_tag LOCUS_25370 2060 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 >Feature sequence1030 >Feature sequence1031 <1 1361 gene locus_tag LOCUS_25380 <1 1361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266274.1:type II secretion system protein E >Feature sequence1032 1696 164 gene locus_tag LOCUS_25390 gene cafA 1696 164 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_25390 <2412 1707 gene locus_tag LOCUS_25400 <2412 1707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938086.1:rod shape-determining protein RodA >Feature sequence1033 <1 1629 gene locus_tag LOCUS_25410 <1 1629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122586.1:oxidoreductase >Feature sequence1034 >Feature sequence1035 <1 944 gene locus_tag LOCUS_25420 <1 944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877529.1:proline permease 1087 2007 gene locus_tag LOCUS_25430 1087 2007 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_25430 2037 2336 gene locus_tag LOCUS_25440 2037 2336 CDS product stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728084.1 protein_id gnl|my_center|LOCUS_25440 >Feature sequence1036 1214 486 gene locus_tag LOCUS_25450 1214 486 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206203.1 protein_id gnl|my_center|LOCUS_25450 2403 1237 gene locus_tag LOCUS_25460 2403 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 >Feature sequence1037 437 1702 gene locus_tag LOCUS_25470 gene murA 437 1702 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748B3 protein_id gnl|my_center|LOCUS_25470 >Feature sequence1038 2069 1392 gene locus_tag LOCUS_25480 2069 1392 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390663.1 protein_id gnl|my_center|LOCUS_25480 2400 2239 gene locus_tag LOCUS_25490 2400 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 >Feature sequence1039 >Feature sequence1040 1820 333 gene locus_tag LOCUS_25500 1820 333 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123361.1 protein_id gnl|my_center|LOCUS_25500 >Feature sequence1041 1747 1040 gene locus_tag LOCUS_25510 1747 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028520.1 protein_id gnl|my_center|LOCUS_25510 2233 1778 gene locus_tag LOCUS_25520 2233 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 2397 2230 gene locus_tag LOCUS_25530 2397 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 >Feature sequence1042 584 285 gene locus_tag LOCUS_25540 584 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 >Feature sequence1043 >Feature sequence1044 287 778 gene locus_tag LOCUS_25550 287 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 >Feature sequence1045 153 1082 gene locus_tag LOCUS_25560 153 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 1567 1118 gene locus_tag LOCUS_25570 1567 1118 CDS product acyl-CoA thioester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811622.1 protein_id gnl|my_center|LOCUS_25570 2314 1691 gene locus_tag LOCUS_25580 2314 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 >Feature sequence1046 >Feature sequence1047 >Feature sequence1048 >Feature sequence1049 1826 372 gene locus_tag LOCUS_25590 1826 372 CDS product sodium:calcium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869470.1 protein_id gnl|my_center|LOCUS_25590 <2392 1823 gene locus_tag LOCUS_25600 <2392 1823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022682.1:thiamine phosphate synthase >Feature sequence1050 >Feature sequence1051 807 977 gene locus_tag LOCUS_25610 807 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 1128 1649 gene locus_tag LOCUS_25620 1128 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 >Feature sequence1052 398 1999 gene locus_tag LOCUS_25630 398 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071951.1 protein_id gnl|my_center|LOCUS_25630 >Feature sequence1053 766 1215 gene locus_tag LOCUS_25640 766 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 1396 1187 gene locus_tag LOCUS_25650 1396 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 >Feature sequence1054 118 1416 gene locus_tag LOCUS_25660 118 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 1413 2048 gene locus_tag LOCUS_25670 1413 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 >Feature sequence1055 <2385 1598 gene locus_tag LOCUS_25680 <2385 1598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090038.1:GTPase >Feature sequence1056 >Feature sequence1057 2303 930 gene locus_tag LOCUS_25690 2303 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120362.1 protein_id gnl|my_center|LOCUS_25690 >Feature sequence1058 >Feature sequence1059 >Feature sequence1060 1762 647 gene locus_tag LOCUS_25700 gene queA 1762 647 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFD9 protein_id gnl|my_center|LOCUS_25700 <2378 1749 gene locus_tag LOCUS_25710 <2378 1749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014538206.1:peptide ABC transporter permease >Feature sequence1061 1396 467 gene locus_tag LOCUS_25720 1396 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 1704 2255 gene locus_tag LOCUS_25730 1704 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 >Feature sequence1062 >Feature sequence1063 >Feature sequence1064 826 1302 gene locus_tag LOCUS_25740 826 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 >Feature sequence1065 165 2147 gene locus_tag LOCUS_25750 165 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 >Feature sequence1066 1565 1218 gene locus_tag LOCUS_25760 1565 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 1975 2331 gene locus_tag LOCUS_25770 1975 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 >Feature sequence1067 1028 417 gene locus_tag LOCUS_25780 1028 417 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388643.1 protein_id gnl|my_center|LOCUS_25780 1109 1273 gene locus_tag LOCUS_25790 1109 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 1273 1860 gene locus_tag LOCUS_25800 1273 1860 CDS product RNAse inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962725.1 protein_id gnl|my_center|LOCUS_25800 >Feature sequence1068 3 680 gene locus_tag LOCUS_25810 3 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 >Feature sequence1069 1668 1015 gene locus_tag LOCUS_25820 1668 1015 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254056.1 protein_id gnl|my_center|LOCUS_25820 1935 2327 gene locus_tag LOCUS_25830 1935 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 >Feature sequence1070 2330 1257 gene locus_tag LOCUS_25840 2330 1257 CDS product selenium metabolism hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393148.1 protein_id gnl|my_center|LOCUS_25840 >Feature sequence1071 79 507 gene locus_tag LOCUS_25850 79 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 597 1694 gene locus_tag LOCUS_25860 597 1694 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RTQ8 protein_id gnl|my_center|LOCUS_25860 >Feature sequence1072 >Feature sequence1073 1409 438 gene locus_tag LOCUS_25870 1409 438 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257839.1 protein_id gnl|my_center|LOCUS_25870 2261 1413 gene locus_tag LOCUS_25880 gene rmlD 2261 1413 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943001.1 protein_id gnl|my_center|LOCUS_25880 >Feature sequence1074 1646 1026 gene locus_tag LOCUS_25890 1646 1026 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941339.1 protein_id gnl|my_center|LOCUS_25890 >Feature sequence1075 1011 2285 gene locus_tag LOCUS_25900 1011 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 >Feature sequence1076 >Feature sequence1077 >Feature sequence1078 >Feature sequence1079 619 1779 gene locus_tag LOCUS_25910 619 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 >Feature sequence1080 1356 139 gene locus_tag LOCUS_25920 1356 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890489.1 protein_id gnl|my_center|LOCUS_25920 2187 1372 gene locus_tag LOCUS_25930 2187 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 >Feature sequence1081 1404 550 gene locus_tag LOCUS_25940 1404 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 >Feature sequence1082 1530 742 gene locus_tag LOCUS_25950 1530 742 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875851.1 protein_id gnl|my_center|LOCUS_25950 >Feature sequence1083 23 769 gene locus_tag LOCUS_25960 23 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 >Feature sequence1084 >Feature sequence1085 747 304 gene locus_tag LOCUS_25970 747 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 1383 772 gene locus_tag LOCUS_25980 1383 772 CDS product RNA polymerase sigma24 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405466.1 protein_id gnl|my_center|LOCUS_25980 >Feature sequence1086 <2331 657 gene locus_tag LOCUS_25990 <2331 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C7MBM9:DNA helicase >Feature sequence1087 >Feature sequence1088 662 1300 gene locus_tag LOCUS_26000 662 1300 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_26000 1934 1443 gene locus_tag LOCUS_26010 gene purE 1934 1443 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SKX9 protein_id gnl|my_center|LOCUS_26010 >Feature sequence1089 826 1338 gene locus_tag LOCUS_26020 826 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 1508 1762 gene locus_tag LOCUS_26030 1508 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 >Feature sequence1090 651 1112 gene locus_tag LOCUS_26040 651 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 2300 1176 gene locus_tag LOCUS_26050 2300 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 >Feature sequence1091 1567 80 gene locus_tag LOCUS_26060 1567 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 >Feature sequence1092 >Feature sequence1093 192 518 gene locus_tag LOCUS_26070 192 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 >Feature sequence1094 <1 1074 gene locus_tag LOCUS_26080 <1 1074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WAH5:putative glutamate--cysteine ligase 2 1084 1515 gene locus_tag LOCUS_26090 1084 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 2269 1613 gene locus_tag LOCUS_26100 2269 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 >Feature sequence1095 <1 501 gene locus_tag LOCUS_26110 <1 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121231.1:ABC transporter permease 596 1048 gene locus_tag LOCUS_26120 596 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 1824 2279 gene locus_tag LOCUS_26130 1824 2279 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_26130 >Feature sequence1096 1032 40 gene locus_tag LOCUS_26140 1032 40 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963819.1 protein_id gnl|my_center|LOCUS_26140 >Feature sequence1097 1310 39 gene locus_tag LOCUS_26150 1310 39 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987007.1 protein_id gnl|my_center|LOCUS_26150 >Feature sequence1098 >Feature sequence1099 >Feature sequence1100 >Feature sequence1101 <1 746 gene locus_tag LOCUS_26160 <1 746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227167.1:imidazolonepropionase 743 2011 gene locus_tag LOCUS_26170 743 2011 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919033.1 protein_id gnl|my_center|LOCUS_26170 >Feature sequence1102 68 1165 gene locus_tag LOCUS_26180 gene mnmA 68 1165 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51625 protein_id gnl|my_center|LOCUS_26180 1448 1636 gene locus_tag LOCUS_26190 1448 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 1700 1906 gene locus_tag LOCUS_26200 1700 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 >Feature sequence1103 1840 971 gene locus_tag LOCUS_26210 1840 971 CDS product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703807.1 protein_id gnl|my_center|LOCUS_26210 >Feature sequence1104 385 1443 gene locus_tag LOCUS_26220 385 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 >Feature sequence1105 >Feature sequence1106 2305 1109 gene locus_tag LOCUS_26230 2305 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 >Feature sequence1107 >Feature sequence1108 803 1603 gene locus_tag LOCUS_26240 803 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 <2301 1634 gene locus_tag LOCUS_26250 <2301 1634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5SJA1:L-lactate dehydrogenase >Feature sequence1109 <2301 2 gene locus_tag LOCUS_26260 <2301 2 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001700789.1:putative serine/threonine-protein kinase PknB >Feature sequence1110 621 256 gene locus_tag LOCUS_26270 621 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 1025 618 gene locus_tag LOCUS_26280 1025 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 1549 1142 gene locus_tag LOCUS_26290 1549 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 >Feature sequence1111 <1 842 gene locus_tag LOCUS_26300 <1 842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P58730:2-succinylbenzoate--CoA ligase 1005 868 gene locus_tag LOCUS_26310 1005 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 >Feature sequence1112 >Feature sequence1113 >Feature sequence1114 >Feature sequence1115 >Feature sequence1116 1289 156 gene locus_tag LOCUS_26320 1289 156 CDS product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727205.1 protein_id gnl|my_center|LOCUS_26320 1998 1297 gene locus_tag LOCUS_26330 1998 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 >Feature sequence1117 60 133 gene locus_tag LOCUS_t00280 60 133 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 365 532 gene locus_tag LOCUS_26340 365 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 1552 569 gene locus_tag LOCUS_26350 1552 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 2092 1847 gene locus_tag LOCUS_26360 2092 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 >Feature sequence1118 >Feature sequence1119 <1 1284 gene locus_tag LOCUS_26370 <1 1284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257672.1:glycosyl transferase family 1 1297 2064 gene locus_tag LOCUS_26380 gene rfbF 1297 2064 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545825.1 protein_id gnl|my_center|LOCUS_26380 >Feature sequence1120 616 266 gene locus_tag LOCUS_26390 616 266 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888710.1 protein_id gnl|my_center|LOCUS_26390 1875 784 gene locus_tag LOCUS_26400 1875 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 2120 1923 gene locus_tag LOCUS_26410 2120 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 >Feature sequence1121 1131 127 gene locus_tag LOCUS_26420 1131 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 >Feature sequence1122 529 1749 gene locus_tag LOCUS_26430 529 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 >Feature sequence1123 271 2022 gene locus_tag LOCUS_26440 271 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 >Feature sequence1124 885 1235 gene locus_tag LOCUS_26450 885 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 2280 1723 gene locus_tag LOCUS_26460 2280 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 >Feature sequence1125 1113 1844 gene locus_tag LOCUS_26470 gene xapG 1113 1844 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D15 protein_id gnl|my_center|LOCUS_26470 >Feature sequence1126 >Feature sequence1127 694 2070 gene locus_tag LOCUS_26480 694 2070 CDS product capsular polysaccharide biosynthesis protein CapK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257994.1 protein_id gnl|my_center|LOCUS_26480 >Feature sequence1128 456 1022 gene locus_tag LOCUS_26490 456 1022 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_26490 >Feature sequence1129 >Feature sequence1130 738 1526 gene locus_tag LOCUS_26500 738 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 >Feature sequence1131 96 467 gene locus_tag LOCUS_26510 96 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 2140 476 gene locus_tag LOCUS_26520 2140 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 >Feature sequence1132 323 691 gene locus_tag LOCUS_26530 323 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 2124 688 gene locus_tag LOCUS_26540 2124 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868303.1 protein_id gnl|my_center|LOCUS_26540 >Feature sequence1133 1144 956 gene locus_tag LOCUS_26550 1144 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 1095 2240 gene locus_tag LOCUS_26560 1095 2240 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIE0 protein_id gnl|my_center|LOCUS_26560 >Feature sequence1134 >Feature sequence1135 >Feature sequence1136 458 1315 gene locus_tag LOCUS_26570 458 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 >Feature sequence1137 1163 222 gene locus_tag LOCUS_26580 1163 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 1288 1464 gene locus_tag LOCUS_26590 1288 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 >Feature sequence1138 494 1273 gene locus_tag LOCUS_26600 gene tatC 494 1273 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25701 protein_id gnl|my_center|LOCUS_26600 >Feature sequence1139 2030 1020 gene locus_tag LOCUS_26610 2030 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 >Feature sequence1140 969 1442 gene locus_tag LOCUS_26620 969 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 1504 2166 gene locus_tag LOCUS_26630 gene trmH 1504 2166 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z2I1 protein_id gnl|my_center|LOCUS_26630 >Feature sequence1141 829 1644 gene locus_tag LOCUS_26640 829 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 >Feature sequence1142 1952 102 gene locus_tag LOCUS_26650 1952 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 >Feature sequence1143 >Feature sequence1144 359 54 gene locus_tag LOCUS_26660 359 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 521 940 gene locus_tag LOCUS_26670 521 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 >Feature sequence1145 140 472 gene locus_tag LOCUS_26680 140 472 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389329.1 protein_id gnl|my_center|LOCUS_26680 469 1125 gene locus_tag LOCUS_26690 469 1125 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389328.1 protein_id gnl|my_center|LOCUS_26690 1122 1568 gene locus_tag LOCUS_26700 1122 1568 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389327.1 protein_id gnl|my_center|LOCUS_26700 1588 1944 gene locus_tag LOCUS_26710 1588 1944 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_26710 >Feature sequence1146 543 1154 gene locus_tag LOCUS_26720 543 1154 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_26720 >Feature sequence1147 >Feature sequence1148 >Feature sequence1149 1788 1198 gene locus_tag LOCUS_26730 1788 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 >Feature sequence1150 >Feature sequence1151 1513 59 gene locus_tag LOCUS_26740 1513 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 >Feature sequence1152 2207 1851 gene locus_tag LOCUS_26750 2207 1851 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331456.1 protein_id gnl|my_center|LOCUS_26750 >Feature sequence1153 <2238 1567 gene locus_tag LOCUS_26760 <2238 1567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118092.1:multidrug transporter note possible pseudo, frameshifted >Feature sequence1154 >Feature sequence1155 2140 1577 gene locus_tag LOCUS_26770 2140 1577 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_26770 >Feature sequence1156 <1 1155 gene locus_tag LOCUS_26780 <1 1155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011970838.1:molybdopterin biosynthesis protein MoeB 1383 1925 gene locus_tag LOCUS_26790 1383 1925 CDS product macrodomain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545295.1 protein_id gnl|my_center|LOCUS_26790 >Feature sequence1157 759 2105 gene locus_tag LOCUS_26800 759 2105 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SMG8 protein_id gnl|my_center|LOCUS_26800 >Feature sequence1158 <2232 1115 gene locus_tag LOCUS_26810 <2232 1115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002263541.1:carboxylate--amine ligase >Feature sequence1159 <2232 163 gene locus_tag LOCUS_26820 <2232 163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64ZY5:beta-galactosidase >Feature sequence1160 <1 540 gene locus_tag LOCUS_26830 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121996.1:aerotolerance regulator BatA 551 766 gene locus_tag LOCUS_26840 551 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 799 1563 gene locus_tag LOCUS_26850 799 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 >Feature sequence1161 16 420 gene locus_tag LOCUS_26860 16 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 486 1418 gene locus_tag LOCUS_26870 486 1418 CDS product ribonucleotide-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259170.1 protein_id gnl|my_center|LOCUS_26870 >Feature sequence1162 1009 461 gene locus_tag LOCUS_26880 gene folA 1009 461 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNL5 protein_id gnl|my_center|LOCUS_26880 1800 1006 gene locus_tag LOCUS_26890 gene thyA 1800 1006 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F732 protein_id gnl|my_center|LOCUS_26890 >Feature sequence1163 <1 839 gene locus_tag LOCUS_26900 <1 839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261049.1:UDP-N-acetyl glucosamine 2-epimerase 2095 887 gene locus_tag LOCUS_26910 2095 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 >Feature sequence1164 <2227 1591 gene locus_tag LOCUS_26920 <2227 1591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005807926.1:mechanosensitive ion channel protein >Feature sequence1165 1057 677 gene locus_tag LOCUS_26930 1057 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 1604 1101 gene locus_tag LOCUS_26940 1604 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 >Feature sequence1166 >Feature sequence1167 >Feature sequence1168 >Feature sequence1169 >Feature sequence1170 1322 57 gene locus_tag LOCUS_26950 1322 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 2213 1332 gene locus_tag LOCUS_26960 2213 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 >Feature sequence1171 >Feature sequence1172 1467 763 gene locus_tag LOCUS_26970 gene colR 1467 763 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003490678.1 protein_id gnl|my_center|LOCUS_26970 >Feature sequence1173 61 417 gene locus_tag LOCUS_26980 61 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 438 737 gene locus_tag LOCUS_26990 438 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 734 1066 gene locus_tag LOCUS_27000 734 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 >Feature sequence1174 >Feature sequence1175 >Feature sequence1176 >Feature sequence1177 923 1273 gene locus_tag LOCUS_27010 923 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529095.1 protein_id gnl|my_center|LOCUS_27010 >Feature sequence1178 <1 790 gene locus_tag LOCUS_27020 <1 790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263461.1:aspartate racemase 1545 793 gene locus_tag LOCUS_27030 1545 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 >Feature sequence1179 >Feature sequence1180 445 1650 gene locus_tag LOCUS_27040 gene argG 445 1650 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59846 protein_id gnl|my_center|LOCUS_27040 >Feature sequence1181 1552 35 gene locus_tag LOCUS_27050 1552 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 >Feature sequence1182 377 1000 gene locus_tag LOCUS_27060 377 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 >Feature sequence1183 1296 163 gene locus_tag LOCUS_27070 1296 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27070 1502 1293 gene locus_tag LOCUS_27080 1502 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 >Feature sequence1184 <1 1829 gene locus_tag LOCUS_27090 <1 1829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941191.1:aminodeoxychorismate synthase, component I 2113 1850 gene locus_tag LOCUS_27100 2113 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 >Feature sequence1185 1393 122 gene locus_tag LOCUS_27110 1393 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 >Feature sequence1186 303 52 gene locus_tag LOCUS_27120 303 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 613 1617 gene locus_tag LOCUS_27130 613 1617 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IVT8 protein_id gnl|my_center|LOCUS_27130 >Feature sequence1187 471 1619 gene locus_tag LOCUS_27140 471 1619 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039199.1 protein_id gnl|my_center|LOCUS_27140 >Feature sequence1188 281 1243 gene locus_tag LOCUS_27150 281 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 1639 2010 gene locus_tag LOCUS_27160 1639 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 >Feature sequence1189 1169 609 gene locus_tag LOCUS_27170 1169 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 <2198 1207 gene locus_tag LOCUS_27180 <2198 1207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CH42:chemotaxis response regulator protein-glutamate methylesterase >Feature sequence1190 1989 1801 gene locus_tag LOCUS_27190 1989 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 >Feature sequence1191 >Feature sequence1192 >Feature sequence1193 584 225 gene locus_tag LOCUS_27200 584 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 1065 604 gene locus_tag LOCUS_27210 1065 604 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZTY3 protein_id gnl|my_center|LOCUS_27210 1206 1598 gene locus_tag LOCUS_27220 1206 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 >Feature sequence1194 >Feature sequence1195 1636 1418 gene locus_tag LOCUS_27230 1636 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 >Feature sequence1196 >Feature sequence1197 >Feature sequence1198 1006 1728 gene locus_tag LOCUS_27240 1006 1728 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143097.1 protein_id gnl|my_center|LOCUS_27240 >Feature sequence1199 173 1423 gene locus_tag LOCUS_27250 173 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 >Feature sequence1200 <1 1607 gene locus_tag LOCUS_27260 <1 1607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942518.1:oligoendopeptidase F >Feature sequence1201 <2186 824 gene locus_tag LOCUS_27270 <2186 824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_599478.1:di- and tricarboxylate transporter >Feature sequence1202 >Feature sequence1203 >Feature sequence1204 519 1226 gene locus_tag LOCUS_27280 519 1226 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528184.1 protein_id gnl|my_center|LOCUS_27280 >Feature sequence1205 1506 322 gene locus_tag LOCUS_27290 1506 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 >Feature sequence1206 <1 1907 gene locus_tag LOCUS_27300 <1 1907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3MDD7:nuclease SbcCD subunit C >Feature sequence1207 187 2097 gene locus_tag LOCUS_27310 187 2097 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113783.1 protein_id gnl|my_center|LOCUS_27310 >Feature sequence1208 1265 57 gene locus_tag LOCUS_27320 1265 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 1974 1255 gene locus_tag LOCUS_27330 1974 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 >Feature sequence1209 1124 66 gene locus_tag LOCUS_27340 1124 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 >Feature sequence1210 1363 461 gene locus_tag LOCUS_27350 1363 461 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088611.1 protein_id gnl|my_center|LOCUS_27350 >Feature sequence1211 2165 1329 gene locus_tag LOCUS_27360 2165 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 >Feature sequence1212 155 1099 gene locus_tag LOCUS_27370 155 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 1567 1283 gene locus_tag LOCUS_27380 1567 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 >Feature sequence1213 >Feature sequence1214 1508 744 gene locus_tag LOCUS_27390 1508 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 2132 1512 gene locus_tag LOCUS_27400 2132 1512 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGE6 protein_id gnl|my_center|LOCUS_27400 >Feature sequence1215 3 689 gene locus_tag LOCUS_27410 3 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 <2157 816 gene locus_tag LOCUS_27420 <2157 816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257124.1:hybrid sensor histidine kinase/response regulator >Feature sequence1216 665 1531 gene locus_tag LOCUS_27430 665 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121246.1 protein_id gnl|my_center|LOCUS_27430 >Feature sequence1217 1723 437 gene locus_tag LOCUS_27440 gene dnaA 1723 437 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HXP7 protein_id gnl|my_center|LOCUS_27440 >Feature sequence1218 >Feature sequence1219 <1 1945 gene locus_tag LOCUS_27450 <1 1945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011975826.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence1220 1001 42 gene locus_tag LOCUS_27460 1001 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 2149 1130 gene locus_tag LOCUS_27470 2149 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 >Feature sequence1221 532 846 gene locus_tag LOCUS_27480 532 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 985 860 gene locus_tag LOCUS_27490 985 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 1545 1174 gene locus_tag LOCUS_27500 1545 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 <2151 1542 gene locus_tag LOCUS_27510 <2151 1542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030349.1:ATP-binding protein >Feature sequence1222 105 1697 gene locus_tag LOCUS_27520 105 1697 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122586.1 protein_id gnl|my_center|LOCUS_27520 >Feature sequence1223 >Feature sequence1224 >Feature sequence1225 71 1210 gene locus_tag LOCUS_27530 71 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 >Feature sequence1226 >Feature sequence1227 >Feature sequence1228 >Feature sequence1229 <1 1669 gene locus_tag LOCUS_27540 <1 1669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RH96:phosphoenolpyruvate carboxykinase [ATP] 2 >Feature sequence1230 782 1804 gene locus_tag LOCUS_27550 782 1804 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 protein_id gnl|my_center|LOCUS_27550 >Feature sequence1231 1625 2056 gene locus_tag LOCUS_27560 1625 2056 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567242.1 protein_id gnl|my_center|LOCUS_27560 >Feature sequence1232 >Feature sequence1233 1215 664 gene locus_tag LOCUS_27570 1215 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 1625 1212 gene locus_tag LOCUS_27580 1625 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 2137 1658 gene locus_tag LOCUS_27590 2137 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 >Feature sequence1234 3 200 gene locus_tag LOCUS_27600 3 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 >Feature sequence1235 <2134 230 gene locus_tag LOCUS_27610 <2134 230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804276.1:iron ABC transporter ATP-binding protein >Feature sequence1236 1000 389 gene locus_tag LOCUS_27620 1000 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 1695 997 gene locus_tag LOCUS_27630 1695 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 2133 1726 gene locus_tag LOCUS_27640 2133 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 >Feature sequence1237 304 870 gene locus_tag LOCUS_27650 304 870 CDS product thiol:disulfide interchange protein tlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269072.1 protein_id gnl|my_center|LOCUS_27650 <2132 1035 gene locus_tag LOCUS_27660 <2132 1035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S1L9:glutamine--tRNA ligase >Feature sequence1238 <1 1119 gene locus_tag LOCUS_27670 <1 1119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057549.1:iron(III) ABC transporter permease 1123 1944 gene locus_tag LOCUS_27680 1123 1944 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228241.1 protein_id gnl|my_center|LOCUS_27680 >Feature sequence1239 >Feature sequence1240 >Feature sequence1241 1523 144 gene locus_tag LOCUS_27690 1523 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 >Feature sequence1242 2125 653 gene locus_tag LOCUS_27700 gene murD 2125 653 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK81 protein_id gnl|my_center|LOCUS_27700 >Feature sequence1243 <2126 1095 gene locus_tag LOCUS_27710 <2126 1095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8U9L4:protein TolB >Feature sequence1244 647 75 gene locus_tag LOCUS_27720 647 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 <2124 758 gene locus_tag LOCUS_27730 <2124 758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706261.1:hybrid sensor histidine kinase/response regulator >Feature sequence1245 454 1185 gene locus_tag LOCUS_27740 454 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 1182 1718 gene locus_tag LOCUS_27750 1182 1718 CDS product cys-tRNA(pro)/cys-tRNA(cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929250.1 protein_id gnl|my_center|LOCUS_27750 >Feature sequence1246 1189 893 gene locus_tag LOCUS_27760 1189 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 <2115 1083 gene locus_tag LOCUS_27770 <2115 1083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3FLX1:polyribonucleotide nucleotidyltransferase >Feature sequence1247 >Feature sequence1248 1228 713 gene locus_tag LOCUS_27780 1228 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 >Feature sequence1249 1268 93 gene locus_tag LOCUS_27790 1268 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 >Feature sequence1250 207 875 gene locus_tag LOCUS_27800 207 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 1052 1837 gene locus_tag LOCUS_27810 gene soj 1052 1837 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403290.1 protein_id gnl|my_center|LOCUS_27810 >Feature sequence1251 <1 996 gene locus_tag LOCUS_27820 <1 996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073002.1:peptidase S8 1161 2057 gene locus_tag LOCUS_27830 1161 2057 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096571.1 protein_id gnl|my_center|LOCUS_27830 >Feature sequence1252 <2109 346 gene locus_tag LOCUS_27840 <2109 346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056720.1:hybrid sensor histidine kinase/response regulator >Feature sequence1253 >Feature sequence1254 >Feature sequence1255 >Feature sequence1256 >Feature sequence1257 2001 1318 gene locus_tag LOCUS_27850 2001 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 >Feature sequence1258 >Feature sequence1259 97 1350 gene locus_tag LOCUS_27860 97 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 >Feature sequence1260 523 438 gene locus_tag LOCUS_t00290 523 438 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1532 735 gene locus_tag LOCUS_27870 1532 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 >Feature sequence1261 >Feature sequence1262 176 955 gene locus_tag LOCUS_27880 176 955 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141371.1 protein_id gnl|my_center|LOCUS_27880 >Feature sequence1263 110 1255 gene locus_tag LOCUS_27890 gene rsgA 110 1255 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45339 protein_id gnl|my_center|LOCUS_27890 >Feature sequence1264 <2100 203 gene locus_tag LOCUS_27900 <2100 203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942659.1:GGDEF domain-containing protein >Feature sequence1265 2100 1015 gene locus_tag LOCUS_27910 2100 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 >Feature sequence1266 >Feature sequence1267 >Feature sequence1268 435 1598 gene locus_tag LOCUS_27920 435 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 >Feature sequence1269 >Feature sequence1270 698 1396 gene locus_tag LOCUS_27930 698 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100680.1 protein_id gnl|my_center|LOCUS_27930 >Feature sequence1271 1561 185 gene locus_tag LOCUS_27940 gene dhs1 1561 185 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC31 protein_id gnl|my_center|LOCUS_27940 >Feature sequence1272 >Feature sequence1273 >Feature sequence1274 741 953 gene locus_tag LOCUS_27950 741 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 956 1750 gene locus_tag LOCUS_27960 956 1750 CDS product prophage P3 protein 7, DNA replication inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102136.1 protein_id gnl|my_center|LOCUS_27960 >Feature sequence1275 <2087 1586 gene locus_tag LOCUS_27970 <2087 1586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073002.1:peptidase S8 >Feature sequence1276 1786 1097 gene locus_tag LOCUS_27980 gene nth 1786 1097 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGP4 protein_id gnl|my_center|LOCUS_27980 >Feature sequence1277 >Feature sequence1278 >Feature sequence1279 <2084 552 gene locus_tag LOCUS_27990 <2084 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975932.1:4-aminobutyrate aminotransferase >Feature sequence1280 94 438 gene locus_tag LOCUS_28000 94 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 1028 627 gene locus_tag LOCUS_28010 1028 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 1577 1164 gene locus_tag LOCUS_28020 1577 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 >Feature sequence1281 1956 1555 gene locus_tag LOCUS_28030 1956 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 >Feature sequence1282 >Feature sequence1283 >Feature sequence1284 >Feature sequence1285 >Feature sequence1286 <1 609 gene locus_tag LOCUS_28040 <1 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942406.1:lipoprotein >Feature sequence1287 661 1944 gene locus_tag LOCUS_28050 661 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 >Feature sequence1288 >Feature sequence1289 1074 1484 gene locus_tag LOCUS_28060 1074 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 >Feature sequence1290 1246 776 gene locus_tag LOCUS_28070 1246 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 <2065 1268 gene locus_tag LOCUS_28080 <2065 1268 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727955.1:ATPase AAA >Feature sequence1291 <1 511 gene locus_tag LOCUS_28090 <1 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74A46:Maf-like protein 761 892 gene locus_tag LOCUS_28100 761 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 <2062 1270 gene locus_tag LOCUS_28110 <2062 1270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942951.1:histidine kinase >Feature sequence1292 1223 468 gene locus_tag LOCUS_28120 1223 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 >Feature sequence1293 <1 528 gene locus_tag LOCUS_28130 <1 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8UJK7:DNA polymerase IV 2 1769 1023 gene locus_tag LOCUS_28140 1769 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 2060 1875 gene locus_tag LOCUS_28150 2060 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 >Feature sequence1294 1273 1398 gene locus_tag LOCUS_28160 1273 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 >Feature sequence1295 149 1822 gene locus_tag LOCUS_28170 149 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 >Feature sequence1296 658 245 gene locus_tag LOCUS_28180 658 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 907 1239 gene locus_tag LOCUS_28190 907 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28190 >Feature sequence1297 539 1582 gene locus_tag LOCUS_28200 539 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 >Feature sequence1298 1011 19 gene locus_tag LOCUS_28210 1011 19 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390231.1 protein_id gnl|my_center|LOCUS_28210 <2045 1008 gene locus_tag LOCUS_28220 <2045 1008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222826.1:methylmalonyl-CoA mutase >Feature sequence1299 1882 1055 gene locus_tag LOCUS_28230 1882 1055 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089986.1 protein_id gnl|my_center|LOCUS_28230 >Feature sequence1300 >Feature sequence1301 173 565 gene locus_tag LOCUS_28240 173 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28240 569 691 gene locus_tag LOCUS_28250 569 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 1236 802 gene locus_tag LOCUS_28260 1236 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 >Feature sequence1302 <1 1926 gene locus_tag LOCUS_28270 <1 1926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109117.1:hybrid sensor histidine kinase/response regulator >Feature sequence1303 1798 1166 gene locus_tag LOCUS_28280 1798 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 >Feature sequence1304 2038 1124 gene locus_tag LOCUS_28290 2038 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 >Feature sequence1305 >Feature sequence1306 844 1782 gene locus_tag LOCUS_28300 844 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 >Feature sequence1307 <1 909 gene locus_tag LOCUS_28310 <1 909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74D56:aspartate--tRNA(Asp/Asn) ligase >Feature sequence1308 872 1975 gene locus_tag LOCUS_28320 872 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 >Feature sequence1309 874 269 gene locus_tag LOCUS_28330 874 269 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_28330 >Feature sequence1310 1201 179 gene locus_tag LOCUS_28340 1201 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 <2029 1224 gene locus_tag LOCUS_28350 <2029 1224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003408279.1:molybdopterin biosynthesis protein MoeX >Feature sequence1311 >Feature sequence1312 1340 828 gene locus_tag LOCUS_28360 1340 828 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089251.1 protein_id gnl|my_center|LOCUS_28360 >Feature sequence1313 1488 481 gene locus_tag LOCUS_28370 1488 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 >Feature sequence1314 1108 1791 gene locus_tag LOCUS_28380 1108 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040262.1 protein_id gnl|my_center|LOCUS_28380 >Feature sequence1315 >Feature sequence1316 >Feature sequence1317 1919 327 gene locus_tag LOCUS_28390 1919 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 >Feature sequence1318 545 1162 gene locus_tag LOCUS_28400 545 1162 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143815.1 protein_id gnl|my_center|LOCUS_28400 1314 1883 gene locus_tag LOCUS_28410 1314 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 >Feature sequence1319 862 1182 gene locus_tag LOCUS_28420 862 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 >Feature sequence1320 <1 771 gene locus_tag LOCUS_28430 <1 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730645.1:pyruvate oxidase >Feature sequence1321 38 314 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gggttcaattccaaagcccagggtaagc >Feature sequence1322 >Feature sequence1323 432 1766 gene locus_tag LOCUS_28440 432 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 >Feature sequence1324 >Feature sequence1325 <1 920 gene locus_tag LOCUS_28450 <1 920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NE10:biosynthetic arginine decarboxylase 992 1990 gene locus_tag LOCUS_28460 992 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 >Feature sequence1326 <2017 1424 gene locus_tag LOCUS_28470 <2017 1424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943835.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence1327 >Feature sequence1328 1210 563 gene locus_tag LOCUS_28480 1210 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 <2006 1347 gene locus_tag LOCUS_28490 <2006 1347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036499.1:RNA polymerase sigma factor >Feature sequence1329 >Feature sequence1330 >Feature sequence1331 >Feature sequence1332 <2003 387 gene locus_tag LOCUS_28500 <2003 387 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J348:DNA gyrase subunit A >Feature sequence1333 <2003 631 gene locus_tag LOCUS_28510 <2003 631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973247.1:non-ribosomal peptide synthetase note possible pseudo, internal stop codon, frameshifted >Feature sequence1334 424 1323 gene locus_tag LOCUS_28520 424 1323 CDS product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393993.1 protein_id gnl|my_center|LOCUS_28520 >Feature sequence1335 >Feature sequence1336 >Feature sequence1337 1727 495 gene locus_tag LOCUS_28530 1727 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 >Feature sequence1338 977 585 gene locus_tag LOCUS_28540 977 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 1274 1131 gene locus_tag LOCUS_28550 1274 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 >Feature sequence1339 190 1056 gene locus_tag LOCUS_28560 190 1056 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249195.1 protein_id gnl|my_center|LOCUS_28560 >Feature sequence1340 1366 302 gene locus_tag LOCUS_28570 1366 302 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143092.1 protein_id gnl|my_center|LOCUS_28570 >Feature sequence1341 <1 593 gene locus_tag LOCUS_28580 <1 593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942202.1:histidine kinase 869 1198 gene locus_tag LOCUS_28590 869 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 >Feature sequence1342 1865 1746 gene locus_tag LOCUS_28600 1865 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 >Feature sequence1343 <1994 962 gene locus_tag LOCUS_28610 <1994 962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001108817.1:amino oxidase >Feature sequence1344 793 338 gene locus_tag LOCUS_28620 793 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263462.1 protein_id gnl|my_center|LOCUS_28620 <1993 1097 gene locus_tag LOCUS_28630 <1993 1097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011106349.1:glutamate synthase >Feature sequence1345 544 1116 gene locus_tag LOCUS_28640 544 1116 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_28640 >Feature sequence1346 >Feature sequence1347 >Feature sequence1348 >Feature sequence1349 <1 607 gene locus_tag LOCUS_28650 <1 607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007598495.1:methyltransferase 666 1379 gene locus_tag LOCUS_28660 666 1379 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530243.1 protein_id gnl|my_center|LOCUS_28660 >Feature sequence1350 >Feature sequence1351 1750 746 gene locus_tag LOCUS_28670 1750 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 >Feature sequence1352 418 1719 gene locus_tag LOCUS_28680 418 1719 CDS product 3-hydroxy-3-methylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876201.1 protein_id gnl|my_center|LOCUS_28680 >Feature sequence1353 >Feature sequence1354 140 1558 gene locus_tag LOCUS_28690 140 1558 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889505.1 protein_id gnl|my_center|LOCUS_28690 >Feature sequence1355 >Feature sequence1356 218 1378 gene locus_tag LOCUS_28700 218 1378 CDS product zinc ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256103.1 protein_id gnl|my_center|LOCUS_28700 >Feature sequence1357 610 1623 gene locus_tag LOCUS_28710 gene mauG 610 1623 CDS product di-heme enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211849.1 protein_id gnl|my_center|LOCUS_28710 >Feature sequence1358 3 1076 gene locus_tag LOCUS_28720 3 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 >Feature sequence1359 >Feature sequence1360 335 967 gene locus_tag LOCUS_28730 335 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 1555 986 gene locus_tag LOCUS_28740 1555 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 >Feature sequence1361 1903 848 gene locus_tag LOCUS_28750 1903 848 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942235.1 protein_id gnl|my_center|LOCUS_28750 >Feature sequence1362 3 332 gene locus_tag LOCUS_28760 3 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 395 1261 gene locus_tag LOCUS_28770 395 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 1286 1828 gene locus_tag LOCUS_28780 1286 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 >Feature sequence1363 572 93 gene locus_tag LOCUS_28790 572 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 1122 622 gene locus_tag LOCUS_28800 1122 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 1606 1127 gene locus_tag LOCUS_28810 1606 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 1977 1816 gene locus_tag LOCUS_28820 1977 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 >Feature sequence1364 <1 580 gene locus_tag LOCUS_28830 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DUV4:putative RNA methyltransferase 682 1173 gene locus_tag LOCUS_28840 682 1173 CDS product 6-pyruvoyl tetrahydrobiopterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122012.1 protein_id gnl|my_center|LOCUS_28840 >Feature sequence1365 >Feature sequence1366 1740 907 gene locus_tag LOCUS_28850 1740 907 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730403.1 protein_id gnl|my_center|LOCUS_28850 >Feature sequence1367 677 249 gene locus_tag LOCUS_28860 677 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 876 1442 gene locus_tag LOCUS_28870 876 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 >Feature sequence1368 713 1333 gene locus_tag LOCUS_28880 713 1333 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_28880 >Feature sequence1369 >Feature sequence1370 1529 852 gene locus_tag LOCUS_28890 1529 852 CDS product acetamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256581.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28890 >Feature sequence1371 >Feature sequence1372 >Feature sequence1373 <1967 1124 gene locus_tag LOCUS_28900 <1967 1124 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q83CJ2:curved DNA-binding protein >Feature sequence1374 1495 1881 gene locus_tag LOCUS_28910 1495 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 >Feature sequence1375 1297 434 gene locus_tag LOCUS_28920 1297 434 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9W9Y9 protein_id gnl|my_center|LOCUS_28920 >Feature sequence1376 1513 344 gene locus_tag LOCUS_28930 1513 344 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403493.1 protein_id gnl|my_center|LOCUS_28930 >Feature sequence1377 385 642 gene locus_tag LOCUS_28940 385 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 646 978 gene locus_tag LOCUS_28950 646 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 >Feature sequence1378 1420 611 gene locus_tag LOCUS_28960 1420 611 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404226.1 protein_id gnl|my_center|LOCUS_28960 1767 1417 gene locus_tag LOCUS_28970 1767 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389227.1 protein_id gnl|my_center|LOCUS_28970 >Feature sequence1379 <1 815 gene locus_tag LOCUS_28980 <1 815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009879844.1:DNA internalization-related competence protein ComEC/Rec2 921 1874 gene locus_tag LOCUS_28990 gene miaA 921 1874 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BP1 protein_id gnl|my_center|LOCUS_28990 >Feature sequence1380 <1962 1100 gene locus_tag LOCUS_29000 <1962 1100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B8E0A6:glutamate--tRNA ligase >Feature sequence1381 >Feature sequence1382 1606 1070 gene locus_tag LOCUS_29010 gene nfi 1606 1070 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123255.1 protein_id gnl|my_center|LOCUS_29010 >Feature sequence1383 >Feature sequence1384 33 863 gene locus_tag LOCUS_29020 33 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 1043 1837 gene locus_tag LOCUS_29030 1043 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 >Feature sequence1385 1346 1071 gene locus_tag LOCUS_29040 1346 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 >Feature sequence1386 338 742 gene locus_tag LOCUS_29050 338 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 982 1368 gene locus_tag LOCUS_29060 982 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29060 1396 1917 gene locus_tag LOCUS_29070 1396 1917 CDS product alkylated DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479964.1 protein_id gnl|my_center|LOCUS_29070 >Feature sequence1387 1313 282 gene locus_tag LOCUS_29080 gene rbsR 1313 282 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405541.1 protein_id gnl|my_center|LOCUS_29080 >Feature sequence1388 31 1410 gene locus_tag LOCUS_29090 31 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 >Feature sequence1389 126 353 gene locus_tag LOCUS_29100 126 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 880 398 gene locus_tag LOCUS_29110 880 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 1531 881 gene locus_tag LOCUS_29120 1531 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 1693 1532 gene locus_tag LOCUS_29130 1693 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 >Feature sequence1390 <1 1422 gene locus_tag LOCUS_29140 <1 1422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257013.1:adenylate cyclase >Feature sequence1391 286 1542 gene locus_tag LOCUS_29150 286 1542 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339255.1 protein_id gnl|my_center|LOCUS_29150 >Feature sequence1392 <1930 84 gene locus_tag LOCUS_29160 <1930 84 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257229.1:sulfatase >Feature sequence1393 497 976 gene locus_tag LOCUS_29170 gene coaD 497 976 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHB8 protein_id gnl|my_center|LOCUS_29170 1029 1790 gene locus_tag LOCUS_29180 1029 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 >Feature sequence1394 1231 155 gene locus_tag LOCUS_29190 1231 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635555.2 protein_id gnl|my_center|LOCUS_29190 >Feature sequence1395 89 1273 gene locus_tag LOCUS_29200 89 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 >Feature sequence1396 >Feature sequence1397 709 287 gene locus_tag LOCUS_29210 709 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 >Feature sequence1398 >Feature sequence1399 <1928 1067 gene locus_tag LOCUS_29220 <1928 1067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to G5EBD4:chromosome partition protein Smc >Feature sequence1400 <1 649 gene locus_tag LOCUS_29230 <1 649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143374.1:methyltransferase type 11 1501 659 gene locus_tag LOCUS_29240 1501 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945959.1 protein_id gnl|my_center|LOCUS_29240 >Feature sequence1401 581 1198 gene locus_tag LOCUS_29250 581 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 <1924 1298 gene locus_tag LOCUS_29260 <1924 1298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249636.1:NAD-dependent deacylase >Feature sequence1402 <1 958 gene locus_tag LOCUS_29270 <1 958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3D8Y7:beta-galactosidase 964 1542 gene locus_tag LOCUS_29280 964 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 >Feature sequence1403 650 919 gene locus_tag LOCUS_29290 650 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 <1922 1101 gene locus_tag LOCUS_29300 <1922 1101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5F9R2:tyrosine recombinase XerD >Feature sequence1404 672 256 gene locus_tag LOCUS_29310 672 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 >Feature sequence1405 >Feature sequence1406 >Feature sequence1407 >Feature sequence1408 1215 904 gene locus_tag LOCUS_29320 1215 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 1607 1682 gene locus_tag LOCUS_t00300 1607 1682 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1708 1782 gene locus_tag LOCUS_t00310 1708 1782 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1409 <1913 547 gene locus_tag LOCUS_29330 <1913 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460677.1:isoleucine--tRNA ligase >Feature sequence1410 871 1098 gene locus_tag LOCUS_29340 871 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 1095 1394 gene locus_tag LOCUS_29350 1095 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 >Feature sequence1411 1634 1413 gene locus_tag LOCUS_29360 1634 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 >Feature sequence1412 125 523 gene locus_tag LOCUS_29370 125 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 1861 650 gene locus_tag LOCUS_29380 1861 650 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545925.1 protein_id gnl|my_center|LOCUS_29380 >Feature sequence1413 >Feature sequence1414 >Feature sequence1415 <1906 717 gene locus_tag LOCUS_29390 <1906 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056474.1:diguanylate cyclase >Feature sequence1416 >Feature sequence1417 348 1349 gene locus_tag LOCUS_29400 gene argF 348 1349 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQG4 protein_id gnl|my_center|LOCUS_29400 >Feature sequence1418 1354 755 gene locus_tag LOCUS_29410 1354 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 >Feature sequence1419 738 64 gene locus_tag LOCUS_29420 738 64 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114053.1 protein_id gnl|my_center|LOCUS_29420 >Feature sequence1420 281 1015 gene locus_tag LOCUS_29430 281 1015 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888106.1 protein_id gnl|my_center|LOCUS_29430 1281 1733 gene locus_tag LOCUS_29440 1281 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 >Feature sequence1421 >Feature sequence1422 >Feature sequence1423 960 334 gene locus_tag LOCUS_29450 960 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 <1897 1072 gene locus_tag LOCUS_29460 <1897 1072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388879.1:lactate dehydrogenase >Feature sequence1424 1575 148 gene locus_tag LOCUS_29470 1575 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 >Feature sequence1425 1629 1333 gene locus_tag LOCUS_29480 1629 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 >Feature sequence1426 1001 522 gene locus_tag LOCUS_29490 1001 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 1190 1357 gene locus_tag LOCUS_29500 1190 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 1361 1783 gene locus_tag LOCUS_29510 1361 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 >Feature sequence1427 1158 394 gene locus_tag LOCUS_29520 1158 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 1892 1155 gene locus_tag LOCUS_29530 1892 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 >Feature sequence1428 1755 418 gene locus_tag LOCUS_29540 1755 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 >Feature sequence1429 >Feature sequence1430 1250 216 gene locus_tag LOCUS_29550 1250 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 >Feature sequence1431 805 1737 gene locus_tag LOCUS_29560 805 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 >Feature sequence1432 3 140 gene locus_tag LOCUS_29570 3 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 140 445 gene locus_tag LOCUS_29580 140 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 445 849 gene locus_tag LOCUS_29590 445 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 >Feature sequence1433 >Feature sequence1434 361 1827 gene locus_tag LOCUS_29600 361 1827 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902502.1 protein_id gnl|my_center|LOCUS_29600 >Feature sequence1435 <1881 625 gene locus_tag LOCUS_29610 <1881 625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267825.1:non-ribosomal peptide synthetase >Feature sequence1436 <1 1323 gene locus_tag LOCUS_29620 <1 1323 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RK42:dihydroorotase >Feature sequence1437 >Feature sequence1438 >Feature sequence1439 1041 214 gene locus_tag LOCUS_29630 1041 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 1454 1203 gene locus_tag LOCUS_29640 1454 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 >Feature sequence1440 904 71 gene locus_tag LOCUS_29650 gene apaH 904 71 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CGJ2 protein_id gnl|my_center|LOCUS_29650 1802 924 gene locus_tag LOCUS_29660 1802 924 CDS product polyphosphate--nucleotide phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932760.1 protein_id gnl|my_center|LOCUS_29660 >Feature sequence1441 1669 1241 gene locus_tag LOCUS_29670 1669 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 >Feature sequence1442 94 318 gene locus_tag LOCUS_29680 94 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 728 1759 gene locus_tag LOCUS_29690 728 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 >Feature sequence1443 1 630 gene locus_tag LOCUS_29700 1 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 >Feature sequence1444 505 1476 gene locus_tag LOCUS_29710 505 1476 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933295.1 protein_id gnl|my_center|LOCUS_29710 >Feature sequence1445 1349 1711 gene locus_tag LOCUS_29720 1349 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 >Feature sequence1446 <1867 1128 gene locus_tag LOCUS_29730 <1867 1128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104858.1:AraC family transcriptional regulator >Feature sequence1447 >Feature sequence1448 683 1303 gene locus_tag LOCUS_29740 683 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 >Feature sequence1449 >Feature sequence1450 >Feature sequence1451 1407 934 gene locus_tag LOCUS_29750 1407 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 >Feature sequence1452 <1 865 gene locus_tag LOCUS_29760 <1 865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583888.1:beta-glucuronidase 1637 873 gene locus_tag LOCUS_29770 1637 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 >Feature sequence1453 >Feature sequence1454 31 999 gene locus_tag LOCUS_29780 gene moxR 31 999 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336577.1 protein_id gnl|my_center|LOCUS_29780 >Feature sequence1455 655 840 gene locus_tag LOCUS_29790 655 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 >Feature sequence1456 >Feature sequence1457 <1852 127 gene locus_tag LOCUS_29800 <1852 127 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8RIK8:endonuclease MutS2 >Feature sequence1458 344 1078 gene locus_tag LOCUS_29810 344 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931010.1 protein_id gnl|my_center|LOCUS_29810 <1851 1101 gene locus_tag LOCUS_29820 <1851 1101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081258.1:basic amino acid ABC transporter substrate-binding protein >Feature sequence1459 >Feature sequence1460 378 1331 gene locus_tag LOCUS_29830 378 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 >Feature sequence1461 664 59 gene locus_tag LOCUS_29840 664 59 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405010.1 protein_id gnl|my_center|LOCUS_29840 1205 1792 gene locus_tag LOCUS_29850 1205 1792 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_29850 >Feature sequence1462 1542 1354 gene locus_tag LOCUS_29860 1542 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 >Feature sequence1463 >Feature sequence1464 >Feature sequence1465 >Feature sequence1466 694 146 gene locus_tag LOCUS_29870 694 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 >Feature sequence1467 >Feature sequence1468 551 1606 gene locus_tag LOCUS_29880 gene pdxA 551 1606 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3V8D3 protein_id gnl|my_center|LOCUS_29880 >Feature sequence1469 999 511 gene locus_tag LOCUS_29890 999 511 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958244.1 protein_id gnl|my_center|LOCUS_29890 <1836 1002 gene locus_tag LOCUS_29900 <1836 1002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258875.1:ribokinase >Feature sequence1470 >Feature sequence1471 1385 1816 gene locus_tag LOCUS_29910 1385 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 >Feature sequence1472 1308 1015 gene locus_tag LOCUS_29920 1308 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 >Feature sequence1473 3 749 gene locus_tag LOCUS_29930 3 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 >Feature sequence1474 864 1454 gene locus_tag LOCUS_29940 864 1454 CDS product putative RNA polymerase sigma E protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_145450.2 protein_id gnl|my_center|LOCUS_29940 >Feature sequence1475 >Feature sequence1476 <1 850 gene locus_tag LOCUS_29950 <1 850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081378.1:peptide ABC transporter substrate-binding protein 868 1452 gene locus_tag LOCUS_29960 868 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 >Feature sequence1477 1824 364 gene locus_tag LOCUS_29970 1824 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 >Feature sequence1478 >Feature sequence1479 >Feature sequence1480 >Feature sequence1481 <1 738 gene locus_tag LOCUS_29980 <1 738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q81GM5:chaperone protein ClpB 856 1554 gene locus_tag LOCUS_29990 856 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 >Feature sequence1482 1744 1169 gene locus_tag LOCUS_30000 1744 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 >Feature sequence1483 <1822 1068 gene locus_tag LOCUS_30010 <1822 1068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003106828.1:short chain dehydrogenase >Feature sequence1484 2 1426 gene locus_tag LOCUS_30020 gene lepA2 2 1426 CDS product elongation factor 4 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UE01 protein_id gnl|my_center|LOCUS_30020 >Feature sequence1485 >Feature sequence1486 1030 1665 gene locus_tag LOCUS_30030 1030 1665 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929914.1 protein_id gnl|my_center|LOCUS_30030 >Feature sequence1487 <1 665 gene locus_tag LOCUS_30040 <1 665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144318.1:IS3 family transposase >Feature sequence1488 >Feature sequence1489 101 493 gene locus_tag LOCUS_30050 101 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 1815 595 gene locus_tag LOCUS_30060 1815 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 >Feature sequence1490 >Feature sequence1491 >Feature sequence1492 737 1405 gene locus_tag LOCUS_30070 737 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 1390 1614 gene locus_tag LOCUS_30080 1390 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 >Feature sequence1493 <1807 472 gene locus_tag LOCUS_30090 <1807 472 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902151.1:nucleotide pyrophosphatase >Feature sequence1494 1448 912 gene locus_tag LOCUS_30100 1448 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 >Feature sequence1495 >Feature sequence1496 <1 528 gene locus_tag LOCUS_30110 <1 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YG96:protein-L-isoaspartate O-methyltransferase 525 818 gene locus_tag LOCUS_30120 525 818 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878321.1 protein_id gnl|my_center|LOCUS_30120 975 1490 gene locus_tag LOCUS_30130 gene apt 975 1490 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGH9 protein_id gnl|my_center|LOCUS_30130 >Feature sequence1497 >Feature sequence1498 <1 803 gene locus_tag LOCUS_30140 <1 803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015923343.1:peptidase M3 <1801 1005 gene locus_tag LOCUS_30150 <1801 1005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123734.1:O-GlcNAc transferase >Feature sequence1499 680 1318 gene locus_tag LOCUS_30160 680 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 >Feature sequence1500 <1799 597 gene locus_tag LOCUS_30170 <1799 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085648.1:adenylate/guanylate cyclase domain-containing response regulator >Feature sequence1501 872 1471 gene locus_tag LOCUS_30180 872 1471 CDS product putative cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48636 protein_id gnl|my_center|LOCUS_30180 >Feature sequence1502 1141 134 gene locus_tag LOCUS_30190 1141 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 >Feature sequence1503 >Feature sequence1504 >Feature sequence1505 <1 1000 gene locus_tag LOCUS_30200 <1 1000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140720.1:hybrid sensor histidine kinase/response regulator >Feature sequence1506 <1 1538 gene locus_tag LOCUS_30210 <1 1538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012709186.1:ethanolamine ammonia lyase large subunit >Feature sequence1507 >Feature sequence1508 >Feature sequence1509 <1785 1179 gene locus_tag LOCUS_30220 <1785 1179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144059.1:DNA-directed RNA polymerase sigma-70 factor >Feature sequence1510 >Feature sequence1511 682 1359 gene locus_tag LOCUS_30230 682 1359 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257751.1 protein_id gnl|my_center|LOCUS_30230 >Feature sequence1512 745 308 gene locus_tag LOCUS_30240 745 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 <1778 745 gene locus_tag LOCUS_30250 <1778 745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WC70:tRNA-dihydrouridine synthase >Feature sequence1513 >Feature sequence1514 479 667 gene locus_tag LOCUS_30260 479 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 >Feature sequence1515 783 532 gene locus_tag LOCUS_30270 783 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 961 1686 gene locus_tag LOCUS_30280 gene smuG1 961 1686 CDS product single-strand selective monofunctional uracil DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122744.1 protein_id gnl|my_center|LOCUS_30280 >Feature sequence1516 >Feature sequence1517 1560 436 gene locus_tag LOCUS_30290 1560 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 >Feature sequence1518 <1766 449 gene locus_tag LOCUS_30300 <1766 449 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140057.1:alpha/beta hydrolase >Feature sequence1519 1273 605 gene locus_tag LOCUS_30310 1273 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 >Feature sequence1520 >Feature sequence1521 <1 1002 gene locus_tag LOCUS_30320 <1 1002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391170.1:histidine kinase 1019 1207 gene locus_tag LOCUS_30330 1019 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 >Feature sequence1522 1 867 gene locus_tag LOCUS_30340 1 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 >Feature sequence1523 588 1352 gene locus_tag LOCUS_30350 588 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 >Feature sequence1524 125 829 gene locus_tag LOCUS_30360 125 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 >Feature sequence1525 <1760 961 gene locus_tag LOCUS_30370 <1760 961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262307.1:isocitrate dehydrogenase, NADP-dependent >Feature sequence1526 506 1315 gene locus_tag LOCUS_30380 506 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 >Feature sequence1527 >Feature sequence1528 >Feature sequence1529 >Feature sequence1530 1330 842 gene locus_tag LOCUS_30390 1330 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 1734 1327 gene locus_tag LOCUS_30400 1734 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 >Feature sequence1531 1492 764 gene locus_tag LOCUS_30410 1492 764 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528337.1 protein_id gnl|my_center|LOCUS_30410 >Feature sequence1532 453 1061 gene locus_tag LOCUS_30420 453 1061 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_30420 1733 1065 gene locus_tag LOCUS_30430 1733 1065 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_30430 >Feature sequence1533 1745 489 gene locus_tag LOCUS_30440 1745 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 >Feature sequence1534 >Feature sequence1535 <1 544 gene locus_tag LOCUS_30450 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000940283.1:DNA polymerase I >Feature sequence1536 >Feature sequence1537 <1 1025 gene locus_tag LOCUS_30460 <1 1025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027082.1:peptidase M28 >Feature sequence1538 1398 1559 gene locus_tag LOCUS_30470 1398 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 >Feature sequence1539 309 1493 gene locus_tag LOCUS_30480 309 1493 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942417.1 protein_id gnl|my_center|LOCUS_30480 >Feature sequence1540 >Feature sequence1541 1064 705 gene locus_tag LOCUS_30490 1064 705 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529121.1 protein_id gnl|my_center|LOCUS_30490 >Feature sequence1542 >Feature sequence1543 >Feature sequence1544 780 950 gene locus_tag LOCUS_30500 780 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 >Feature sequence1545 1514 741 gene locus_tag LOCUS_30510 1514 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 >Feature sequence1546 330 986 gene locus_tag LOCUS_30520 gene tal 330 986 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYD1 protein_id gnl|my_center|LOCUS_30520 1039 1557 gene locus_tag LOCUS_30530 1039 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 >Feature sequence1547 <1735 903 gene locus_tag LOCUS_30540 <1735 903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011402869.1:cation efflux system protein >Feature sequence1548 55 129 gene locus_tag LOCUS_t00320 55 129 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 213 290 gene locus_tag LOCUS_t00330 213 290 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 307 380 gene locus_tag LOCUS_t00340 307 380 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 418 491 gene locus_tag LOCUS_t00350 418 491 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 522 595 gene locus_tag LOCUS_t00360 522 595 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1447 692 gene locus_tag LOCUS_30550 1447 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 >Feature sequence1549 1132 188 gene locus_tag LOCUS_30560 1132 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405285.1 protein_id gnl|my_center|LOCUS_30560 <1733 1148 gene locus_tag LOCUS_30570 <1733 1148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007330234.1:ATPase AAA >Feature sequence1550 489 1397 gene locus_tag LOCUS_30580 gene glsA 489 1397 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MD81 protein_id gnl|my_center|LOCUS_30580 1733 1455 gene locus_tag LOCUS_30590 1733 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 >Feature sequence1551 1185 487 gene locus_tag LOCUS_30600 1185 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 >Feature sequence1552 <1 1509 gene locus_tag LOCUS_30610 <1 1509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F9YAL6:histidine--tRNA ligase >Feature sequence1553 190 1284 gene locus_tag LOCUS_30620 190 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_30620 >Feature sequence1554 >Feature sequence1555 >Feature sequence1556 >Feature sequence1557 479 1357 gene locus_tag LOCUS_30630 479 1357 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256410.1 protein_id gnl|my_center|LOCUS_30630 >Feature sequence1558 >Feature sequence1559 >Feature sequence1560 877 404 gene locus_tag LOCUS_30640 877 404 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057647.1 protein_id gnl|my_center|LOCUS_30640 >Feature sequence1561 >Feature sequence1562 1416 826 gene locus_tag LOCUS_30650 1416 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 >Feature sequence1563 >Feature sequence1564 802 440 gene locus_tag LOCUS_30660 802 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 1494 850 gene locus_tag LOCUS_30670 1494 850 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259074.1 protein_id gnl|my_center|LOCUS_30670 >Feature sequence1565 546 1346 gene locus_tag LOCUS_30680 546 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 >Feature sequence1566 311 667 gene locus_tag LOCUS_30690 311 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 1019 684 gene locus_tag LOCUS_30700 1019 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 1261 1716 gene locus_tag LOCUS_30710 1261 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 >Feature sequence1567 >Feature sequence1568 >Feature sequence1569 >Feature sequence1570 367 131 gene locus_tag LOCUS_30720 367 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 1582 641 gene locus_tag LOCUS_30730 1582 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 >Feature sequence1571 >Feature sequence1572 461 631 gene locus_tag LOCUS_30740 461 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 >Feature sequence1573 <1714 739 gene locus_tag LOCUS_30750 <1714 739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003433818.1:ATPase >Feature sequence1574 1484 96 gene locus_tag LOCUS_30760 1484 96 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLK6 protein_id gnl|my_center|LOCUS_30760 >Feature sequence1575 >Feature sequence1576 >Feature sequence1577 1287 229 gene locus_tag LOCUS_30770 1287 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 >Feature sequence1578 <1 1091 gene locus_tag LOCUS_30780 <1 1091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119569.1:alginate O-acetyltransferase >Feature sequence1579 1343 363 gene locus_tag LOCUS_30790 1343 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 >Feature sequence1580 >Feature sequence1581 280 813 gene locus_tag LOCUS_30800 280 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 <1707 852 gene locus_tag LOCUS_30810 <1707 852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011971049.1:integrase >Feature sequence1582 <1703 371 gene locus_tag LOCUS_30820 <1703 371 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74BZ1:RNA polymerase sigma-54 factor >Feature sequence1583 <1700 1018 gene locus_tag LOCUS_30830 <1700 1018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941157.1:ATP-dependent protease >Feature sequence1584 503 1633 gene locus_tag LOCUS_30840 gene arcT 503 1633 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I0R6 protein_id gnl|my_center|LOCUS_30840 >Feature sequence1585 >Feature sequence1586 761 685 gene locus_tag LOCUS_t00370 761 685 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 917 841 gene locus_tag LOCUS_t00380 917 841 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1587 1696 785 gene locus_tag LOCUS_30850 1696 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 >Feature sequence1588 352 53 gene locus_tag LOCUS_30860 352 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 >Feature sequence1589 396 677 gene locus_tag LOCUS_30870 396 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 >Feature sequence1590 >Feature sequence1591 <1 562 gene locus_tag LOCUS_30880 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038655.1:oxidoreductase 664 1683 gene locus_tag LOCUS_30890 664 1683 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_30890 >Feature sequence1592 681 1505 gene locus_tag LOCUS_30900 681 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 >Feature sequence1593 5 727 gene locus_tag LOCUS_30910 5 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 737 1615 gene locus_tag LOCUS_30920 737 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 >Feature sequence1594 >Feature sequence1595 234 1442 gene locus_tag LOCUS_30930 234 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 >Feature sequence1596 >Feature sequence1597 >Feature sequence1598 >Feature sequence1599 <1678 594 gene locus_tag LOCUS_30940 <1678 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003531053.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence1600 >Feature sequence1601 <1676 1004 gene locus_tag LOCUS_30950 <1676 1004 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118658.1:amidohydrolase >Feature sequence1602 542 75 gene locus_tag LOCUS_30960 542 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096359.1 protein_id gnl|my_center|LOCUS_30960 <1675 579 gene locus_tag LOCUS_30970 <1675 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000738812.1:permease >Feature sequence1603 1367 96 gene locus_tag LOCUS_30980 1367 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208114.1 protein_id gnl|my_center|LOCUS_30980 >Feature sequence1604 >Feature sequence1605 <1673 1148 gene locus_tag LOCUS_30990 <1673 1148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403990.1:hydroxymethylpyrimidine/phosphomethylpyrimidine kinase >Feature sequence1606 <1 655 gene locus_tag LOCUS_31000 <1 655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WDU6:bifunctional protein PyrR 652 1602 gene locus_tag LOCUS_31010 gene pyrB 652 1602 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2K5 protein_id gnl|my_center|LOCUS_31010 >Feature sequence1607 1227 277 gene locus_tag LOCUS_31020 gene hprK 1227 277 CDS product HPr kinase/phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61323 protein_id gnl|my_center|LOCUS_31020 1671 1228 gene locus_tag LOCUS_31030 1671 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 >Feature sequence1608 >Feature sequence1609 >Feature sequence1610 >Feature sequence1611 >Feature sequence1612 >Feature sequence1613 >Feature sequence1614 >Feature sequence1615 <1661 215 gene locus_tag LOCUS_31040 <1661 215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966627.1:polyketide synthase >Feature sequence1616 1351 461 gene locus_tag LOCUS_31050 1351 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 >Feature sequence1617 <1660 218 gene locus_tag LOCUS_31060 <1660 218 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937806.1:selenocysteine-specific translation factor >Feature sequence1618 >Feature sequence1619 >Feature sequence1620 371 1159 gene locus_tag LOCUS_31070 371 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31070 >Feature sequence1621 1588 266 gene locus_tag LOCUS_31080 1588 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 >Feature sequence1622 >Feature sequence1623 <1653 769 gene locus_tag LOCUS_31090 <1653 769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011974222.1:coproporphyrinogen III oxidase >Feature sequence1624 679 38 gene locus_tag LOCUS_31100 679 38 CDS product peptidase S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391457.1 protein_id gnl|my_center|LOCUS_31100 1413 679 gene locus_tag LOCUS_31110 gene cinA 1413 679 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088357.1 protein_id gnl|my_center|LOCUS_31110 >Feature sequence1625 >Feature sequence1626 339 1430 gene locus_tag LOCUS_31120 339 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860887.1 protein_id gnl|my_center|LOCUS_31120 >Feature sequence1627 1409 879 gene locus_tag LOCUS_31130 1409 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 >Feature sequence1628 >Feature sequence1629 1312 977 gene locus_tag LOCUS_31140 1312 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 >Feature sequence1630 >Feature sequence1631 590 1156 gene locus_tag LOCUS_31150 590 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 >Feature sequence1632 771 1208 gene locus_tag LOCUS_31160 771 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 1205 1405 gene locus_tag LOCUS_31170 1205 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 >Feature sequence1633 >Feature sequence1634 >Feature sequence1635 >Feature sequence1636 >Feature sequence1637 <1 1350 gene locus_tag LOCUS_31180 <1 1350 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74C72:bifunctional NAD(P)H-hydrate repair enzyme >Feature sequence1638 <1 827 gene locus_tag LOCUS_31190 <1 827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S2A0:pyrroline-5-carboxylate reductase >Feature sequence1639 >Feature sequence1640 >Feature sequence1641 >Feature sequence1642 >Feature sequence1643 453 887 gene locus_tag LOCUS_31200 453 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 >Feature sequence1644 >Feature sequence1645 <1 934 gene locus_tag LOCUS_31210 <1 934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020622.1:heme b synthase >Feature sequence1646 1432 740 gene locus_tag LOCUS_31220 1432 740 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094039.1 protein_id gnl|my_center|LOCUS_31220 >Feature sequence1647 <1 1185 gene locus_tag LOCUS_31230 <1 1185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144235.1:galactose oxidase >Feature sequence1648 479 282 gene locus_tag LOCUS_31240 479 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 >Feature sequence1649 1039 1317 gene locus_tag LOCUS_31250 1039 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 >Feature sequence1650 >Feature sequence1651 130 945 gene locus_tag LOCUS_31260 130 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 >Feature sequence1652 >Feature sequence1653 964 539 gene locus_tag LOCUS_31270 gene speH 964 539 CDS product S-adenosylmethionine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIZ3 protein_id gnl|my_center|LOCUS_31270 >Feature sequence1654 1605 205 gene locus_tag LOCUS_31280 1605 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 >Feature sequence1655 1526 717 gene locus_tag LOCUS_31290 1526 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 >Feature sequence1656 >Feature sequence1657 >Feature sequence1658 <1 1051 gene locus_tag LOCUS_31300 <1 1051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9JXY2:formate--tetrahydrofolate ligase 1619 1230 gene locus_tag LOCUS_31310 1619 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 >Feature sequence1659 1621 176 gene locus_tag LOCUS_31320 1621 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 >Feature sequence1660 <1 1239 gene locus_tag LOCUS_31330 <1 1239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007329291.1:NADH dehydrogenase >Feature sequence1661 >Feature sequence1662 >Feature sequence1663 <1616 120 gene locus_tag LOCUS_31340 <1616 120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942202.1:histidine kinase >Feature sequence1664 >Feature sequence1665 1465 272 gene locus_tag LOCUS_31350 1465 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 >Feature sequence1666 1001 666 gene locus_tag LOCUS_31360 1001 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 >Feature sequence1667 >Feature sequence1668 >Feature sequence1669 <1 1249 gene locus_tag LOCUS_31370 <1 1249 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706272.1:ATP-dependent DNA helicase RecQ >Feature sequence1670 >Feature sequence1671 <1603 1053 gene locus_tag LOCUS_31380 <1603 1053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337885.1:peptidase M23 >Feature sequence1672 >Feature sequence1673 >Feature sequence1674 591 136 gene locus_tag LOCUS_31390 591 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 783 1286 gene locus_tag LOCUS_31400 783 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 1279 1557 gene locus_tag LOCUS_31410 1279 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 >Feature sequence1675 <1598 214 gene locus_tag LOCUS_31420 <1598 214 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123429.1:aggregation factor core protein MAFp3, isoform C >Feature sequence1676 >Feature sequence1677 >Feature sequence1678 754 1230 gene locus_tag LOCUS_31430 754 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 >Feature sequence1679 >Feature sequence1680 328 1233 gene locus_tag LOCUS_31440 gene uppS 328 1233 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SH15 protein_id gnl|my_center|LOCUS_31440 >Feature sequence1681 682 598 gene locus_tag LOCUS_t00390 682 598 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 950 875 gene locus_tag LOCUS_t00400 950 875 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1270 1052 gene locus_tag LOCUS_31450 1270 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 >Feature sequence1682 64 426 gene locus_tag LOCUS_31460 64 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 1449 433 gene locus_tag LOCUS_31470 1449 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 >Feature sequence1683 >Feature sequence1684 >Feature sequence1685 >Feature sequence1686 89 769 gene locus_tag LOCUS_31480 89 769 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761529.1 protein_id gnl|my_center|LOCUS_31480 >Feature sequence1687 >Feature sequence1688 <1585 226 gene locus_tag LOCUS_31490 <1585 226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868797.1:MFS transporter >Feature sequence1689 1504 191 gene locus_tag LOCUS_31500 1504 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 >Feature sequence1690 >Feature sequence1691 <1579 501 gene locus_tag LOCUS_31510 <1579 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030349.1:ATP-binding protein >Feature sequence1692 >Feature sequence1693 290 952 gene locus_tag LOCUS_31520 290 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 936 1415 gene locus_tag LOCUS_31530 936 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 >Feature sequence1694 >Feature sequence1695 >Feature sequence1696 278 1435 gene locus_tag LOCUS_31540 278 1435 CDS product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222805.1 protein_id gnl|my_center|LOCUS_31540 >Feature sequence1697 >Feature sequence1698 29 1027 gene locus_tag LOCUS_31550 29 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 1344 1168 gene locus_tag LOCUS_31560 1344 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 >Feature sequence1699 685 107 gene locus_tag LOCUS_31570 685 107 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_31570 >Feature sequence1700 440 652 gene locus_tag LOCUS_31580 440 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 1347 859 gene locus_tag LOCUS_31590 1347 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 >Feature sequence1701 >Feature sequence1702 >Feature sequence1703 100 948 gene locus_tag LOCUS_31600 100 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31600 >Feature sequence1704 >Feature sequence1705 <1 1149 gene locus_tag LOCUS_31610 <1 1149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582658.1:ABC transporter permease >Feature sequence1706 647 231 gene locus_tag LOCUS_31620 647 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 804 649 gene locus_tag LOCUS_31630 804 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 1225 806 gene locus_tag LOCUS_31640 1225 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 >Feature sequence1707 1344 154 gene locus_tag LOCUS_31650 1344 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 >Feature sequence1708 >Feature sequence1709 <1545 699 gene locus_tag LOCUS_31660 <1545 699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003729641.1:aminopeptidase >Feature sequence1710 >Feature sequence1711 >Feature sequence1712 >Feature sequence1713 <1 501 gene locus_tag LOCUS_31670 <1 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404646.1:amidohydrolase >Feature sequence1714 >Feature sequence1715 <1 837 gene locus_tag LOCUS_31680 <1 837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068525.1:coenzyme F390 synthetase 945 1292 gene locus_tag LOCUS_31690 gene spoIIAA 945 1292 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F1N6 protein_id gnl|my_center|LOCUS_31690 >Feature sequence1716 462 277 gene locus_tag LOCUS_31700 462 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 <1532 534 gene locus_tag LOCUS_31710 <1532 534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003096975.1:EEP domain-containing protein >Feature sequence1717 1395 616 gene locus_tag LOCUS_31720 1395 616 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085673.1 protein_id gnl|my_center|LOCUS_31720 >Feature sequence1718 224 793 gene locus_tag LOCUS_31730 224 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 1212 817 gene locus_tag LOCUS_31740 1212 817 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969399.1 protein_id gnl|my_center|LOCUS_31740 >Feature sequence1719 >Feature sequence1720 360 1031 gene locus_tag LOCUS_31750 gene msrA 360 1031 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S284 protein_id gnl|my_center|LOCUS_31750 >Feature sequence1721 434 1159 gene locus_tag LOCUS_31760 gene ate 434 1159 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PNQ6 protein_id gnl|my_center|LOCUS_31760 >Feature sequence1722 1166 402 gene locus_tag LOCUS_31770 1166 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 >Feature sequence1723 >Feature sequence1724 >Feature sequence1725 2 151 gene locus_tag LOCUS_31780 2 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 159 1349 gene locus_tag LOCUS_31790 159 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 >Feature sequence1726 >Feature sequence1727 >Feature sequence1728 735 406 gene locus_tag LOCUS_31800 735 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 1221 892 gene locus_tag LOCUS_31810 1221 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 1509 1285 gene locus_tag LOCUS_31820 1509 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 >Feature sequence1729 >Feature sequence1730 73 957 gene locus_tag LOCUS_31830 73 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392409.1 protein_id gnl|my_center|LOCUS_31830 >Feature sequence1731 296 1333 gene locus_tag LOCUS_31840 296 1333 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_31840 >Feature sequence1732 >Feature sequence1733 837 346 gene locus_tag LOCUS_31850 837 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 >Feature sequence1734 >Feature sequence1735 1407 805 gene locus_tag LOCUS_31860 1407 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 >Feature sequence1736 471 647 gene locus_tag LOCUS_31870 471 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 >Feature sequence1737 >Feature sequence1738 >Feature sequence1739 >Feature sequence1740 >Feature sequence1741 <1 694 gene locus_tag LOCUS_31880 <1 694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NI93:2-isopropylmalate synthase >Feature sequence1742 <1502 425 gene locus_tag LOCUS_31890 <1502 425 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962407.1:metalloprotease Fpp1 >Feature sequence1743 1500 412 gene locus_tag LOCUS_31900 1500 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900