>Feature sequence01 1692 2006 gene locus_tag LOCUS_00010 1692 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 3840 2071 gene locus_tag LOCUS_00020 3840 2071 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140963.1 protein_id gnl|my_center|LOCUS_00020 7620 3847 gene locus_tag LOCUS_00030 7620 3847 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096802.1 protein_id gnl|my_center|LOCUS_00030 8284 7625 gene locus_tag LOCUS_00040 8284 7625 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096803.1 protein_id gnl|my_center|LOCUS_00040 9174 8404 gene locus_tag LOCUS_00050 9174 8404 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096804.1 protein_id gnl|my_center|LOCUS_00050 10059 9196 gene locus_tag LOCUS_00060 10059 9196 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140178.1 protein_id gnl|my_center|LOCUS_00060 10883 10089 gene locus_tag LOCUS_00070 10883 10089 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392004.1 protein_id gnl|my_center|LOCUS_00070 12091 10979 gene locus_tag LOCUS_00080 12091 10979 CDS product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143100.1 protein_id gnl|my_center|LOCUS_00080 12434 12613 gene locus_tag LOCUS_00090 12434 12613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 12939 13283 gene locus_tag LOCUS_00100 12939 13283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 14067 14768 gene locus_tag LOCUS_00110 14067 14768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 16766 17323 gene locus_tag LOCUS_00120 16766 17323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 17895 18932 gene locus_tag LOCUS_00130 17895 18932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 19796 21523 gene locus_tag LOCUS_00140 19796 21523 CDS product guanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691480.1 protein_id gnl|my_center|LOCUS_00140 22797 21904 gene locus_tag LOCUS_00150 22797 21904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 22946 23890 gene locus_tag LOCUS_00160 22946 23890 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886895.1 protein_id gnl|my_center|LOCUS_00160 24158 24379 gene locus_tag LOCUS_00170 24158 24379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039029.1 protein_id gnl|my_center|LOCUS_00170 25631 24513 gene locus_tag LOCUS_00180 25631 24513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 27356 25722 gene locus_tag LOCUS_00190 27356 25722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 28769 30127 gene locus_tag LOCUS_00200 28769 30127 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227543.1 protein_id gnl|my_center|LOCUS_00200 31384 30389 gene locus_tag LOCUS_00210 31384 30389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 33015 31819 gene locus_tag LOCUS_00220 33015 31819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 34143 33535 gene locus_tag LOCUS_00230 34143 33535 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029392.1 protein_id gnl|my_center|LOCUS_00230 34361 35338 gene locus_tag LOCUS_00240 34361 35338 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643856.1 protein_id gnl|my_center|LOCUS_00240 35540 37693 gene locus_tag LOCUS_00250 35540 37693 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086964.1 protein_id gnl|my_center|LOCUS_00250 37928 38083 gene locus_tag LOCUS_00260 37928 38083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 38637 38182 gene locus_tag LOCUS_00270 38637 38182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 38927 40156 gene locus_tag LOCUS_00280 38927 40156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 40491 41867 gene locus_tag LOCUS_00290 40491 41867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 41902 44706 gene locus_tag LOCUS_00300 41902 44706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 44963 45394 gene locus_tag LOCUS_00310 44963 45394 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762011.1 protein_id gnl|my_center|LOCUS_00310 46433 45492 gene locus_tag LOCUS_00320 46433 45492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 46551 49817 gene locus_tag LOCUS_00330 46551 49817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459091.1 protein_id gnl|my_center|LOCUS_00330 50645 49872 gene locus_tag LOCUS_00340 gene caiD 50645 49872 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947682.1 protein_id gnl|my_center|LOCUS_00340 50746 51294 gene locus_tag LOCUS_00350 50746 51294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 51757 52356 gene locus_tag LOCUS_00360 51757 52356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 52356 53483 gene locus_tag LOCUS_00370 52356 53483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 53777 54265 gene locus_tag LOCUS_00380 53777 54265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 54407 55378 gene locus_tag LOCUS_00390 54407 55378 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338139.1 protein_id gnl|my_center|LOCUS_00390 55641 58319 gene locus_tag LOCUS_00400 55641 58319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 58840 58406 gene locus_tag LOCUS_00410 58840 58406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 58907 59698 gene locus_tag LOCUS_00420 58907 59698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392265.1 protein_id gnl|my_center|LOCUS_00420 60589 59708 gene locus_tag LOCUS_00430 60589 59708 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676765.1 protein_id gnl|my_center|LOCUS_00430 64011 60586 gene locus_tag LOCUS_00440 64011 60586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 65035 64025 gene locus_tag LOCUS_00450 65035 64025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 65240 66340 gene locus_tag LOCUS_00460 65240 66340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 66625 67377 gene locus_tag LOCUS_00470 66625 67377 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391756.1 protein_id gnl|my_center|LOCUS_00470 67897 67523 gene locus_tag LOCUS_00480 67897 67523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 69508 67988 gene locus_tag LOCUS_00490 69508 67988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 69867 69505 gene locus_tag LOCUS_00500 69867 69505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 72588 69913 gene locus_tag LOCUS_00510 gene citB 72588 69913 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWD2 protein_id gnl|my_center|LOCUS_00510 72965 72744 gene locus_tag LOCUS_00520 72965 72744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 74725 72968 gene locus_tag LOCUS_00530 74725 72968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 75503 74922 gene locus_tag LOCUS_00540 gene cheW 75503 74922 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114482.1 protein_id gnl|my_center|LOCUS_00540 77175 75508 gene locus_tag LOCUS_00550 gene mcp 77175 75508 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037458.1 protein_id gnl|my_center|LOCUS_00550 79447 77282 gene locus_tag LOCUS_00560 gene cheA-1 79447 77282 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704965.1 protein_id gnl|my_center|LOCUS_00560 79818 79450 gene locus_tag LOCUS_00570 79818 79450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 80269 79841 gene locus_tag LOCUS_00580 80269 79841 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704967.1 protein_id gnl|my_center|LOCUS_00580 80912 80385 gene locus_tag LOCUS_00590 gene cheW 80912 80385 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114482.1 protein_id gnl|my_center|LOCUS_00590 82596 80929 gene locus_tag LOCUS_00600 gene mcp34H-4 82596 80929 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941954.1 protein_id gnl|my_center|LOCUS_00600 84180 83095 gene locus_tag LOCUS_00610 gene cheB3 84180 83095 CDS product chemotaxis response regulator protein-glutamate methylesterase of group 3 operon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3H4 protein_id gnl|my_center|LOCUS_00610 84674 84177 gene locus_tag LOCUS_00620 gene cheD1 84674 84177 CDS product putative chemoreceptor glutamine deamidase CheD 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3H5 protein_id gnl|my_center|LOCUS_00620 85389 84718 gene locus_tag LOCUS_00630 gene mtnB 85389 84718 CDS product methylthioribulose-1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884P3 protein_id gnl|my_center|LOCUS_00630 86336 85422 gene locus_tag LOCUS_00640 86336 85422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 86414 86794 gene locus_tag LOCUS_00650 86414 86794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 86950 89208 gene locus_tag LOCUS_00660 gene recJ 86950 89208 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615880.1 protein_id gnl|my_center|LOCUS_00660 90065 89562 gene locus_tag LOCUS_00670 90065 89562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 90794 90126 gene locus_tag LOCUS_00680 90794 90126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 92298 90814 gene locus_tag LOCUS_00690 92298 90814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 92897 92328 gene locus_tag LOCUS_00700 92897 92328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 94168 92927 gene locus_tag LOCUS_00710 94168 92927 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453372.1 protein_id gnl|my_center|LOCUS_00710 94831 94187 gene locus_tag LOCUS_00720 94831 94187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00720 95533 94844 gene locus_tag LOCUS_00730 95533 94844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277765.1 protein_id gnl|my_center|LOCUS_00730 96952 95558 gene locus_tag LOCUS_00740 96952 95558 CDS product Fe-S-cluster-containing hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063680.1 protein_id gnl|my_center|LOCUS_00740 100097 96975 gene locus_tag LOCUS_00750 100097 96975 CDS product Fe-S-cluster-containing hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372295.1 protein_id gnl|my_center|LOCUS_00750 100699 100127 gene locus_tag LOCUS_00760 100699 100127 CDS product class III cytochrome C domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064927.1 protein_id gnl|my_center|LOCUS_00760 101167 103734 gene locus_tag LOCUS_00770 gene clpB 101167 103734 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F509 protein_id gnl|my_center|LOCUS_00770 103740 104954 gene locus_tag LOCUS_00780 103740 104954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 105248 106360 gene locus_tag LOCUS_00790 105248 106360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 107732 106485 gene locus_tag LOCUS_00800 107732 106485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 108632 107901 gene locus_tag LOCUS_00810 108632 107901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 110829 108688 gene locus_tag LOCUS_00820 110829 108688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 111062 112039 gene locus_tag LOCUS_00830 111062 112039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 112085 112498 gene locus_tag LOCUS_00840 112085 112498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034818.1 protein_id gnl|my_center|LOCUS_00840 114432 112483 gene locus_tag LOCUS_00850 114432 112483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 115792 114407 gene locus_tag LOCUS_00860 115792 114407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 116761 115808 gene locus_tag LOCUS_00870 116761 115808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 118401 116821 gene locus_tag LOCUS_00880 gene pckA 118401 116821 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F9E4 protein_id gnl|my_center|LOCUS_00880 118589 118515 gene locus_tag LOCUS_t00010 118589 118515 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 118723 120858 gene locus_tag LOCUS_00890 118723 120858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 122616 121018 gene locus_tag LOCUS_00900 gene serA 122616 121018 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKK8 protein_id gnl|my_center|LOCUS_00900 124034 123249 gene locus_tag LOCUS_00910 124034 123249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 124192 124016 gene locus_tag LOCUS_00920 124192 124016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 124937 125173 gene locus_tag LOCUS_00930 124937 125173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 125091 125567 gene locus_tag LOCUS_00940 125091 125567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 125564 126070 gene locus_tag LOCUS_00950 125564 126070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 126192 126620 gene locus_tag LOCUS_00960 126192 126620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 126797 127090 gene locus_tag LOCUS_00970 126797 127090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 128078 127092 gene locus_tag LOCUS_00980 128078 127092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939111.1 protein_id gnl|my_center|LOCUS_00980 128180 128458 gene locus_tag LOCUS_00990 128180 128458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 128455 128874 gene locus_tag LOCUS_01000 128455 128874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 129559 129005 gene locus_tag LOCUS_01010 129559 129005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 130057 129560 gene locus_tag LOCUS_01020 130057 129560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 129942 130247 gene locus_tag LOCUS_01030 129942 130247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 130291 130983 gene locus_tag LOCUS_01040 130291 130983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390247.1 protein_id gnl|my_center|LOCUS_01040 131222 131917 gene locus_tag LOCUS_01050 131222 131917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 134461 131984 gene locus_tag LOCUS_01060 134461 131984 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863352.1 protein_id gnl|my_center|LOCUS_01060 135210 134494 gene locus_tag LOCUS_01070 135210 134494 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538451.1 protein_id gnl|my_center|LOCUS_01070 135729 135211 gene locus_tag LOCUS_01080 135729 135211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 135906 136886 gene locus_tag LOCUS_01090 gene sppA 135906 136886 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440816.1 protein_id gnl|my_center|LOCUS_01090 136883 137515 gene locus_tag LOCUS_01100 136883 137515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 137628 138371 gene locus_tag LOCUS_01110 gene surE 137628 138371 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZH9 protein_id gnl|my_center|LOCUS_01110 138347 138988 gene locus_tag LOCUS_01120 138347 138988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280575.1 protein_id gnl|my_center|LOCUS_01120 140049 139126 gene locus_tag LOCUS_01130 140049 139126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 143719 140351 gene locus_tag LOCUS_01140 gene carB 143719 140351 CDS product carbamoyl-phosphate synthase large chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F832 protein_id gnl|my_center|LOCUS_01140 143911 144177 gene locus_tag LOCUS_01150 143911 144177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 145112 144165 gene locus_tag LOCUS_01160 gene nlpD 145112 144165 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409996.1 protein_id gnl|my_center|LOCUS_01160 145479 147110 gene locus_tag LOCUS_01170 gene lysS 145479 147110 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4P5 protein_id gnl|my_center|LOCUS_01170 151179 147511 gene locus_tag LOCUS_01180 gene nrdJ 151179 147511 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3P1 protein_id gnl|my_center|LOCUS_01180 152779 151979 gene locus_tag LOCUS_01190 152779 151979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 153607 153855 gene locus_tag LOCUS_01200 153607 153855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 153855 154766 gene locus_tag LOCUS_01210 gene rpsB 153855 154766 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F140 protein_id gnl|my_center|LOCUS_01210 154766 155359 gene locus_tag LOCUS_01220 gene tsf 154766 155359 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F141 protein_id gnl|my_center|LOCUS_01220 155364 156101 gene locus_tag LOCUS_01230 gene pyrH 155364 156101 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F142 protein_id gnl|my_center|LOCUS_01230 156094 156657 gene locus_tag LOCUS_01240 gene frr 156094 156657 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P81101 protein_id gnl|my_center|LOCUS_01240 156784 157404 gene locus_tag LOCUS_01250 gene uppS 156784 157404 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F144 protein_id gnl|my_center|LOCUS_01250 157405 157575 gene locus_tag LOCUS_01260 157405 157575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 157539 158438 gene locus_tag LOCUS_01270 gene cdsA 157539 158438 CDS product CDP-diglyceride synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504834.1 protein_id gnl|my_center|LOCUS_01270 158440 159663 gene locus_tag LOCUS_01280 gene dxr 158440 159663 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F146 protein_id gnl|my_center|LOCUS_01280 159731 161332 gene locus_tag LOCUS_01290 159731 161332 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906630.1 protein_id gnl|my_center|LOCUS_01290 161369 163135 gene locus_tag LOCUS_01300 gene proS 161369 163135 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F148 protein_id gnl|my_center|LOCUS_01300 163209 164558 gene locus_tag LOCUS_01310 gene trpB 163209 164558 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F149 protein_id gnl|my_center|LOCUS_01310 164696 165325 gene locus_tag LOCUS_01320 164696 165325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 166125 165349 gene locus_tag LOCUS_01330 166125 165349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466324.1 protein_id gnl|my_center|LOCUS_01330 167239 166196 gene locus_tag LOCUS_01340 167239 166196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 167299 168645 gene locus_tag LOCUS_01350 167299 168645 CDS product acyl-CoA--6-aminopenicillanic acid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332932.1 protein_id gnl|my_center|LOCUS_01350 170266 168914 gene locus_tag LOCUS_01360 170266 168914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810942.1 protein_id gnl|my_center|LOCUS_01360 171044 170559 gene locus_tag LOCUS_01370 171044 170559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 171252 171103 gene locus_tag LOCUS_01380 171252 171103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 171298 171813 gene locus_tag LOCUS_01390 171298 171813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 171850 172935 gene locus_tag LOCUS_01400 171850 172935 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276589.1 protein_id gnl|my_center|LOCUS_01400 174101 173028 gene locus_tag LOCUS_01410 174101 173028 CDS product heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051000.1 protein_id gnl|my_center|LOCUS_01410 174724 174104 gene locus_tag LOCUS_01420 174724 174104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964557.1 protein_id gnl|my_center|LOCUS_01420 175562 174765 gene locus_tag LOCUS_01430 gene proC 175562 174765 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK62 protein_id gnl|my_center|LOCUS_01430 175760 176125 gene locus_tag LOCUS_01440 175760 176125 CDS product DUF962 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206200.1 protein_id gnl|my_center|LOCUS_01440 177303 176182 gene locus_tag LOCUS_01450 gene ddlA 177303 176182 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N8T2 protein_id gnl|my_center|LOCUS_01450 178460 177450 gene locus_tag LOCUS_01460 178460 177450 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877313.1 protein_id gnl|my_center|LOCUS_01460 180769 178748 gene locus_tag LOCUS_01470 gene mcm2 180769 178748 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428541.1 protein_id gnl|my_center|LOCUS_01470 180986 181561 gene locus_tag LOCUS_01480 180986 181561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 181999 181649 gene locus_tag LOCUS_01490 181999 181649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 182519 182178 gene locus_tag LOCUS_01500 182519 182178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 184294 182585 gene locus_tag LOCUS_01510 gene ilvD 184294 182585 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF68 protein_id gnl|my_center|LOCUS_01510 185829 184351 gene locus_tag LOCUS_01520 185829 184351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 186991 186059 gene locus_tag LOCUS_01530 186991 186059 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033982.1 protein_id gnl|my_center|LOCUS_01530 189510 187111 gene locus_tag LOCUS_01540 189510 187111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 190170 189511 gene locus_tag LOCUS_01550 gene purQ 190170 189511 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F0I2 protein_id gnl|my_center|LOCUS_01550 190473 190189 gene locus_tag LOCUS_01560 gene purS 190473 190189 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92AN7 protein_id gnl|my_center|LOCUS_01560 190539 191543 gene locus_tag LOCUS_01570 190539 191543 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954148.1 protein_id gnl|my_center|LOCUS_01570 191624 192712 gene locus_tag LOCUS_01580 191624 192712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 193355 192753 gene locus_tag LOCUS_01590 193355 192753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 193359 193514 gene locus_tag LOCUS_01600 193359 193514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 194643 193597 gene locus_tag LOCUS_01610 gene fabH-2 194643 193597 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CS1 protein_id gnl|my_center|LOCUS_01610 194824 196029 gene locus_tag LOCUS_01620 gene adhP 194824 196029 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078168.1 protein_id gnl|my_center|LOCUS_01620 196260 197177 gene locus_tag LOCUS_01630 gene fabH 196260 197177 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJX8 protein_id gnl|my_center|LOCUS_01630 197230 198783 gene locus_tag LOCUS_01640 197230 198783 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085732.1 protein_id gnl|my_center|LOCUS_01640 199975 198824 gene locus_tag LOCUS_01650 199975 198824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981104.1 protein_id gnl|my_center|LOCUS_01650 201521 200067 gene locus_tag LOCUS_01660 gene dltB 201521 200067 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898568.1 protein_id gnl|my_center|LOCUS_01660 202453 201536 gene locus_tag LOCUS_01670 gene purC 202453 201536 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F0I0 protein_id gnl|my_center|LOCUS_01670 203021 202530 gene locus_tag LOCUS_01680 203021 202530 CDS product zinc/iron-chelating domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869889.1 protein_id gnl|my_center|LOCUS_01680 203457 205289 gene locus_tag LOCUS_01690 203457 205289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 205402 206496 gene locus_tag LOCUS_01700 205402 206496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 206512 207903 gene locus_tag LOCUS_01710 gene flgE 206512 207903 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F2C6 protein_id gnl|my_center|LOCUS_01710 208255 209322 gene locus_tag LOCUS_01720 208255 209322 CDS product type II secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069708.1 protein_id gnl|my_center|LOCUS_01720 209378 211039 gene locus_tag LOCUS_01730 209378 211039 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471275.1 protein_id gnl|my_center|LOCUS_01730 211039 211554 gene locus_tag LOCUS_01740 211039 211554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459773.1 protein_id gnl|my_center|LOCUS_01740 211554 212573 gene locus_tag LOCUS_01750 211554 212573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 212530 212991 gene locus_tag LOCUS_01760 gene smpB 212530 212991 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLS9 protein_id gnl|my_center|LOCUS_01760 213007 214677 gene locus_tag LOCUS_01770 213007 214677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 214677 215270 gene locus_tag LOCUS_01780 214677 215270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 215248 216351 gene locus_tag LOCUS_01790 gene mtnA 215248 216351 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X013 protein_id gnl|my_center|LOCUS_01790 217953 216487 gene locus_tag LOCUS_01800 217953 216487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 218030 219238 gene locus_tag LOCUS_01810 gene sucC 218030 219238 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F746 protein_id gnl|my_center|LOCUS_01810 219356 220231 gene locus_tag LOCUS_01820 gene sucD 219356 220231 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F747 protein_id gnl|my_center|LOCUS_01820 220652 221086 gene locus_tag LOCUS_01830 220652 221086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 221132 221614 gene locus_tag LOCUS_01840 221132 221614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 221690 222733 gene locus_tag LOCUS_01850 221690 222733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 223042 222857 gene locus_tag LOCUS_01860 223042 222857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 223907 223065 gene locus_tag LOCUS_01870 223907 223065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 224313 223933 gene locus_tag LOCUS_01880 224313 223933 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707113.1 protein_id gnl|my_center|LOCUS_01880 225650 224823 gene locus_tag LOCUS_01890 225650 224823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 226236 225853 gene locus_tag LOCUS_01900 226236 225853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 227127 226510 gene locus_tag LOCUS_01910 227127 226510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 231645 227227 gene locus_tag LOCUS_01920 231645 227227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 232213 234018 gene locus_tag LOCUS_01930 gene lepA 232213 234018 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F500 protein_id gnl|my_center|LOCUS_01930 234294 235001 gene locus_tag LOCUS_01940 234294 235001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 235070 236248 gene locus_tag LOCUS_01950 235070 236248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 237791 236418 gene locus_tag LOCUS_01960 237791 236418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 238058 240019 gene locus_tag LOCUS_01970 gene uvrD 238058 240019 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F763 protein_id gnl|my_center|LOCUS_01970 240016 240426 gene locus_tag LOCUS_01980 240016 240426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 240693 240472 gene locus_tag LOCUS_01990 240693 240472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080917.1 protein_id gnl|my_center|LOCUS_01990 241780 240833 gene locus_tag LOCUS_02000 241780 240833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949351.1 protein_id gnl|my_center|LOCUS_02000 241905 247658 gene locus_tag LOCUS_02010 241905 247658 CDS product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947392.1 protein_id gnl|my_center|LOCUS_02010 247816 250341 gene locus_tag LOCUS_02020 247816 250341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 251759 250461 gene locus_tag LOCUS_02030 gene lysA 251759 250461 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67262 protein_id gnl|my_center|LOCUS_02030 251857 252768 gene locus_tag LOCUS_02040 251857 252768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867010.1 protein_id gnl|my_center|LOCUS_02040 253609 253010 gene locus_tag LOCUS_02050 253609 253010 CDS product type II secretory pathway inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053413.1 protein_id gnl|my_center|LOCUS_02050 254439 253759 gene locus_tag LOCUS_02060 254439 253759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 255098 254439 gene locus_tag LOCUS_02070 255098 254439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 255650 255153 gene locus_tag LOCUS_02080 255650 255153 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085349.1 protein_id gnl|my_center|LOCUS_02080 256921 255695 gene locus_tag LOCUS_02090 gene gspF 256921 255695 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029466.1 protein_id gnl|my_center|LOCUS_02090 258594 256921 gene locus_tag LOCUS_02100 gene gspE 258594 256921 CDS product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853744.1 protein_id gnl|my_center|LOCUS_02100 260588 258645 gene locus_tag LOCUS_02110 gene gspD 260588 258645 CDS product type II secretion system protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017090.1 protein_id gnl|my_center|LOCUS_02110 261882 261016 gene locus_tag LOCUS_02120 gene gspC 261882 261016 CDS product general secretion pathway protein GspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991320.1 protein_id gnl|my_center|LOCUS_02120 262964 261882 gene locus_tag LOCUS_02130 262964 261882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 263436 263044 gene locus_tag LOCUS_02140 263436 263044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 263503 265005 gene locus_tag LOCUS_02150 263503 265005 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870091.1 protein_id gnl|my_center|LOCUS_02150 265159 264962 gene locus_tag LOCUS_02160 265159 264962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836436.1 protein_id gnl|my_center|LOCUS_02160 267083 265881 gene locus_tag LOCUS_02170 267083 265881 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712870.1 protein_id gnl|my_center|LOCUS_02170 267441 267232 gene locus_tag LOCUS_02180 267441 267232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 268334 267567 gene locus_tag LOCUS_02190 268334 267567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 269104 268442 gene locus_tag LOCUS_02200 gene rnhB 269104 268442 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2G1 protein_id gnl|my_center|LOCUS_02200 269759 269193 gene locus_tag LOCUS_02210 269759 269193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 270344 269871 gene locus_tag LOCUS_02220 270344 269871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 271252 270668 gene locus_tag LOCUS_02230 271252 270668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 271492 271253 gene locus_tag LOCUS_02240 271492 271253 CDS product UPF0109 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3L2 protein_id gnl|my_center|LOCUS_02240 271755 271513 gene locus_tag LOCUS_02250 gene rpsP 271755 271513 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FJK5 protein_id gnl|my_center|LOCUS_02250 272435 271767 gene locus_tag LOCUS_02260 gene rpe 272435 271767 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3K8 protein_id gnl|my_center|LOCUS_02260 273458 272469 gene locus_tag LOCUS_02270 273458 272469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 274443 273460 gene locus_tag LOCUS_02280 gene fmt 274443 273460 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3K6 protein_id gnl|my_center|LOCUS_02280 276469 274484 gene locus_tag LOCUS_02290 gene priA 276469 274484 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3K4 protein_id gnl|my_center|LOCUS_02290 277428 276481 gene locus_tag LOCUS_02300 277428 276481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 278794 277439 gene locus_tag LOCUS_02310 gene atoC 278794 277439 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688483.1 protein_id gnl|my_center|LOCUS_02310 280611 278791 gene locus_tag LOCUS_02320 280611 278791 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997519.1 protein_id gnl|my_center|LOCUS_02320 280868 280608 gene locus_tag LOCUS_02330 gene ptsH 280868 280608 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65877 protein_id gnl|my_center|LOCUS_02330 281866 280868 gene locus_tag LOCUS_02340 gene hprK 281866 280868 CDS product HPr kinase/phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3J9 protein_id gnl|my_center|LOCUS_02340 282176 281877 gene locus_tag LOCUS_02350 282176 281877 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094359.1 protein_id gnl|my_center|LOCUS_02350 283610 282207 gene locus_tag LOCUS_02360 gene rpoN 283610 282207 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054367.1 protein_id gnl|my_center|LOCUS_02360 284324 283617 gene locus_tag LOCUS_02370 gene yhbG 284324 283617 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369327.1 protein_id gnl|my_center|LOCUS_02370 286253 284640 gene locus_tag LOCUS_02380 286253 284640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 287058 286297 gene locus_tag LOCUS_02390 287058 286297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 287906 287055 gene locus_tag LOCUS_02400 gene kdsA 287906 287055 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3J4 protein_id gnl|my_center|LOCUS_02400 289627 288008 gene locus_tag LOCUS_02410 gene pyrG 289627 288008 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3J3 protein_id gnl|my_center|LOCUS_02410 290477 289818 gene locus_tag LOCUS_02420 290477 289818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 290717 292126 gene locus_tag LOCUS_02430 290717 292126 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055092.1 protein_id gnl|my_center|LOCUS_02430 294041 292251 gene locus_tag LOCUS_02440 294041 292251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523287.1 protein_id gnl|my_center|LOCUS_02440 294312 295232 gene locus_tag LOCUS_02450 294312 295232 CDS product acetylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087057.1 protein_id gnl|my_center|LOCUS_02450 295918 295397 gene locus_tag LOCUS_02460 295918 295397 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016760.1 protein_id gnl|my_center|LOCUS_02460 296060 295911 gene locus_tag LOCUS_02470 296060 295911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 297133 296153 gene locus_tag LOCUS_02480 gene rfaE 297133 296153 CDS product ADP-heptose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291586.1 protein_id gnl|my_center|LOCUS_02480 298014 297130 gene locus_tag LOCUS_02490 298014 297130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 300324 298018 gene locus_tag LOCUS_02500 300324 298018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 300757 300272 gene locus_tag LOCUS_02510 300757 300272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418044.1 protein_id gnl|my_center|LOCUS_02510 302744 300819 gene locus_tag LOCUS_02520 gene dxs 302744 300819 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F153 protein_id gnl|my_center|LOCUS_02520 305520 302737 gene locus_tag LOCUS_02530 305520 302737 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291001.1 protein_id gnl|my_center|LOCUS_02530 306643 305759 gene locus_tag LOCUS_02540 gene trpA 306643 305759 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F150 protein_id gnl|my_center|LOCUS_02540 307065 306640 gene locus_tag LOCUS_02550 307065 306640 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 protein_id gnl|my_center|LOCUS_02550 307166 307531 gene locus_tag LOCUS_02560 307166 307531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 308879 307533 gene locus_tag LOCUS_02570 308879 307533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 309936 309112 gene locus_tag LOCUS_02580 309936 309112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 310906 309950 gene locus_tag LOCUS_02590 310906 309950 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250976.1 protein_id gnl|my_center|LOCUS_02590 312060 310903 gene locus_tag LOCUS_02600 312060 310903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 313563 312151 gene locus_tag LOCUS_02610 313563 312151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 314329 313541 gene locus_tag LOCUS_02620 gene coaX 314329 313541 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7V9 protein_id gnl|my_center|LOCUS_02620 315195 314419 gene locus_tag LOCUS_02630 gene birA 315195 314419 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181792.1 protein_id gnl|my_center|LOCUS_02630 316377 315253 gene locus_tag LOCUS_02640 gene degQ 316377 315253 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001976240.1 protein_id gnl|my_center|LOCUS_02640 317546 316413 gene locus_tag LOCUS_02650 gene rnd 317546 316413 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166720.1 protein_id gnl|my_center|LOCUS_02650 317635 318207 gene locus_tag LOCUS_02660 317635 318207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 319994 318186 gene locus_tag LOCUS_02670 319994 318186 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199929.1 protein_id gnl|my_center|LOCUS_02670 320156 322192 gene locus_tag LOCUS_02680 320156 322192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 322306 322896 gene locus_tag LOCUS_02690 322306 322896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 323053 324222 gene locus_tag LOCUS_02700 323053 324222 CDS product acyl dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161599.1 protein_id gnl|my_center|LOCUS_02700 324219 326189 gene locus_tag LOCUS_02710 324219 326189 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_600860.1 protein_id gnl|my_center|LOCUS_02710 327043 326345 gene locus_tag LOCUS_02720 327043 326345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001971487.1 protein_id gnl|my_center|LOCUS_02720 328094 327309 gene locus_tag LOCUS_02730 328094 327309 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058012.1 protein_id gnl|my_center|LOCUS_02730 328437 329771 gene locus_tag LOCUS_02740 328437 329771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 329838 330719 gene locus_tag LOCUS_02750 329838 330719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 331298 330843 gene locus_tag LOCUS_02760 331298 330843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 331248 332174 gene locus_tag LOCUS_02770 gene pyrB 331248 332174 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F812 protein_id gnl|my_center|LOCUS_02770 333163 332213 gene locus_tag LOCUS_02780 333163 332213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 333332 334102 gene locus_tag LOCUS_02790 gene pldB 333332 334102 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142701.1 protein_id gnl|my_center|LOCUS_02790 334229 334648 gene locus_tag LOCUS_02800 334229 334648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414808.1 protein_id gnl|my_center|LOCUS_02800 334905 335321 gene locus_tag LOCUS_02810 gene queF 334905 335321 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F719 protein_id gnl|my_center|LOCUS_02810 336022 335498 gene locus_tag LOCUS_02820 336022 335498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 337076 336249 gene locus_tag LOCUS_02830 337076 336249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 337132 337977 gene locus_tag LOCUS_02840 337132 337977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 338035 338106 gene locus_tag LOCUS_t00020 338035 338106 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 341985 338158 gene locus_tag LOCUS_02850 341985 338158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 342944 342048 gene locus_tag LOCUS_02860 342944 342048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 343213 342947 gene locus_tag LOCUS_02870 343213 342947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 344327 343386 gene locus_tag LOCUS_02880 344327 343386 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534696.1 protein_id gnl|my_center|LOCUS_02880 346105 344327 gene locus_tag LOCUS_02890 gene caiA 346105 344327 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572082.1 protein_id gnl|my_center|LOCUS_02890 346524 347918 gene locus_tag LOCUS_02900 346524 347918 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068650.1 protein_id gnl|my_center|LOCUS_02900 347953 348396 gene locus_tag LOCUS_02910 347953 348396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 348434 349495 gene locus_tag LOCUS_02920 348434 349495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 349524 351224 gene locus_tag LOCUS_02930 gene gpmI 349524 351224 CDS product putative 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59173 protein_id gnl|my_center|LOCUS_02930 352604 351567 gene locus_tag LOCUS_02940 352604 351567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 353715 352717 gene locus_tag LOCUS_02950 gene hemH 353715 352717 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYE7 protein_id gnl|my_center|LOCUS_02950 353884 355047 gene locus_tag LOCUS_02960 gene pgk 353884 355047 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F5H8 protein_id gnl|my_center|LOCUS_02960 355073 355432 gene locus_tag LOCUS_02970 355073 355432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 355530 356450 gene locus_tag LOCUS_02980 355530 356450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 356511 357698 gene locus_tag LOCUS_02990 gene baeS 356511 357698 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096813.1 protein_id gnl|my_center|LOCUS_02990 357695 358648 gene locus_tag LOCUS_03000 357695 358648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282348.1 protein_id gnl|my_center|LOCUS_03000 359727 358621 gene locus_tag LOCUS_03010 359727 358621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 360725 359838 gene locus_tag LOCUS_03020 gene rpoD 360725 359838 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_03020 360855 362111 gene locus_tag LOCUS_03030 360855 362111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 362172 363263 gene locus_tag LOCUS_03040 gene lysS2 362172 363263 CDS product EF-P lysine aminoacylase GenX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561026.1 protein_id gnl|my_center|LOCUS_03040 363528 363226 gene locus_tag LOCUS_03050 363528 363226 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VD93 protein_id gnl|my_center|LOCUS_03050 364589 363555 gene locus_tag LOCUS_03060 gene adhP 364589 363555 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002067912.1 protein_id gnl|my_center|LOCUS_03060 365000 364605 gene locus_tag LOCUS_03070 365000 364605 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944750.1 protein_id gnl|my_center|LOCUS_03070 365711 365034 gene locus_tag LOCUS_03080 365711 365034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 366453 365815 gene locus_tag LOCUS_03090 366453 365815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 366619 367329 gene locus_tag LOCUS_03100 gene mqnA 366619 367329 CDS product chorismate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4K1 protein_id gnl|my_center|LOCUS_03100 368008 367238 gene locus_tag LOCUS_03110 368008 367238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017889.1 protein_id gnl|my_center|LOCUS_03110 367989 368918 gene locus_tag LOCUS_03120 gene ubiA 367989 368918 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156605.1 protein_id gnl|my_center|LOCUS_03120 368891 369538 gene locus_tag LOCUS_03130 368891 369538 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125812.1 protein_id gnl|my_center|LOCUS_03130 369571 370215 gene locus_tag LOCUS_03140 gene ubiX 369571 370215 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3R5 protein_id gnl|my_center|LOCUS_03140 370331 371590 gene locus_tag LOCUS_03150 gene tyrS 370331 371590 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67632 protein_id gnl|my_center|LOCUS_03150 371691 372131 gene locus_tag LOCUS_03160 371691 372131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 373695 372220 gene locus_tag LOCUS_03170 gene gatA 373695 372220 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3A1 protein_id gnl|my_center|LOCUS_03170 374088 373792 gene locus_tag LOCUS_03180 gene gatC 374088 373792 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3A0 protein_id gnl|my_center|LOCUS_03180 374167 374430 gene locus_tag LOCUS_03190 374167 374430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 374494 376419 gene locus_tag LOCUS_03200 374494 376419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 376458 377876 gene locus_tag LOCUS_03210 gene chlI 376458 377876 CDS product magnesium protoporphyrin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117844.1 protein_id gnl|my_center|LOCUS_03210 378159 380495 gene locus_tag LOCUS_03220 378159 380495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 380492 381466 gene locus_tag LOCUS_03230 380492 381466 CDS product putative ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WKX5 protein_id gnl|my_center|LOCUS_03230 381470 382660 gene locus_tag LOCUS_03240 381470 382660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 383428 382706 gene locus_tag LOCUS_03250 383428 382706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 384029 383544 gene locus_tag LOCUS_03260 384029 383544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 384182 385780 gene locus_tag LOCUS_03270 gene prfC 384182 385780 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F2N6 protein_id gnl|my_center|LOCUS_03270 385841 386437 gene locus_tag LOCUS_03280 385841 386437 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392363.1 protein_id gnl|my_center|LOCUS_03280 387837 386458 gene locus_tag LOCUS_03290 387837 386458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 390662 387837 gene locus_tag LOCUS_03300 gene secA 390662 387837 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4S9 protein_id gnl|my_center|LOCUS_03300 392181 390688 gene locus_tag LOCUS_03310 392181 390688 CDS product ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004000.1 protein_id gnl|my_center|LOCUS_03310 392284 392988 gene locus_tag LOCUS_03320 392284 392988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 392979 394895 gene locus_tag LOCUS_03330 392979 394895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 396180 394867 gene locus_tag LOCUS_03340 396180 394867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 397201 396353 gene locus_tag LOCUS_03350 397201 396353 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886850.1 protein_id gnl|my_center|LOCUS_03350 398088 397306 gene locus_tag LOCUS_03360 398088 397306 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804600.1 protein_id gnl|my_center|LOCUS_03360 399022 398090 gene locus_tag LOCUS_03370 399022 398090 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028651.1 protein_id gnl|my_center|LOCUS_03370 399403 401001 gene locus_tag LOCUS_03380 399403 401001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 400998 402542 gene locus_tag LOCUS_03390 gene ppx 400998 402542 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249635.1 protein_id gnl|my_center|LOCUS_03390 402972 402595 gene locus_tag LOCUS_03400 gene acpS 402972 402595 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZCP5 protein_id gnl|my_center|LOCUS_03400 404012 402969 gene locus_tag LOCUS_03410 404012 402969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 404815 404009 gene locus_tag LOCUS_03420 404815 404009 CDS product TIGR00159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464749.1 protein_id gnl|my_center|LOCUS_03420 405612 404815 gene locus_tag LOCUS_03430 gene dapB 405612 404815 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GT5 protein_id gnl|my_center|LOCUS_03430 406493 405609 gene locus_tag LOCUS_03440 gene dapA 406493 405609 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F132 protein_id gnl|my_center|LOCUS_03440 406995 406537 gene locus_tag LOCUS_03450 406995 406537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 408059 407001 gene locus_tag LOCUS_03460 gene pdxA 408059 407001 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079893.1 protein_id gnl|my_center|LOCUS_03460 408438 408001 gene locus_tag LOCUS_03470 408438 408001 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229815.1 protein_id gnl|my_center|LOCUS_03470 409432 408611 gene locus_tag LOCUS_03480 409432 408611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008019.1 protein_id gnl|my_center|LOCUS_03480 411515 409476 gene locus_tag LOCUS_03490 411515 409476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 411601 413889 gene locus_tag LOCUS_03500 411601 413889 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712697.1 protein_id gnl|my_center|LOCUS_03500 413924 415567 gene locus_tag LOCUS_03510 gene cysS 413924 415567 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F525 protein_id gnl|my_center|LOCUS_03510 415552 416364 gene locus_tag LOCUS_03520 415552 416364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 418389 416536 gene locus_tag LOCUS_03530 418389 416536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 418869 420608 gene locus_tag LOCUS_03540 418869 420608 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879591.1 protein_id gnl|my_center|LOCUS_03540 420605 421675 gene locus_tag LOCUS_03550 gene galE 420605 421675 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222403.1 protein_id gnl|my_center|LOCUS_03550 421672 422421 gene locus_tag LOCUS_03560 421672 422421 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971753.1 protein_id gnl|my_center|LOCUS_03560 423476 422718 gene locus_tag LOCUS_03570 423476 422718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 424156 423476 gene locus_tag LOCUS_03580 424156 423476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 424989 424153 gene locus_tag LOCUS_03590 424989 424153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 425647 425426 gene locus_tag LOCUS_03600 425647 425426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 426163 425822 gene locus_tag LOCUS_03610 426163 425822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 426488 426174 gene locus_tag LOCUS_03620 426488 426174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000720240.1 protein_id gnl|my_center|LOCUS_03620 426922 426527 gene locus_tag LOCUS_03630 426922 426527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 427150 428022 gene locus_tag LOCUS_03640 427150 428022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 429039 428194 gene locus_tag LOCUS_03650 gene folD 429039 428194 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLU9 protein_id gnl|my_center|LOCUS_03650 429287 429036 gene locus_tag LOCUS_03660 429287 429036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 430257 429625 gene locus_tag LOCUS_03670 gene leuD 430257 429625 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4E5 protein_id gnl|my_center|LOCUS_03670 431684 430254 gene locus_tag LOCUS_03680 gene leuC 431684 430254 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4E6 protein_id gnl|my_center|LOCUS_03680 431996 432388 gene locus_tag LOCUS_03690 431996 432388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 432876 434003 gene locus_tag LOCUS_03700 432876 434003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 434072 434656 gene locus_tag LOCUS_03710 434072 434656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 436190 434817 gene locus_tag LOCUS_03720 gene cyaA 436190 434817 CDS product guanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069661.1 protein_id gnl|my_center|LOCUS_03720 436408 436728 gene locus_tag LOCUS_03730 436408 436728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 437429 437028 gene locus_tag LOCUS_03740 437429 437028 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939136.1 protein_id gnl|my_center|LOCUS_03740 439223 437586 gene locus_tag LOCUS_03750 439223 437586 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625288.1 protein_id gnl|my_center|LOCUS_03750 439271 440131 gene locus_tag LOCUS_03760 439271 440131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 440536 440138 gene locus_tag LOCUS_03770 440536 440138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 440608 441648 gene locus_tag LOCUS_03780 440608 441648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 442621 441746 gene locus_tag LOCUS_03790 442621 441746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 442860 443804 gene locus_tag LOCUS_03800 442860 443804 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049610.1 protein_id gnl|my_center|LOCUS_03800 444329 443865 gene locus_tag LOCUS_03810 444329 443865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084560.1 protein_id gnl|my_center|LOCUS_03810 444832 444302 gene locus_tag LOCUS_03820 444832 444302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 445979 444891 gene locus_tag LOCUS_03830 445979 444891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 446067 446576 gene locus_tag LOCUS_03840 446067 446576 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186182.1 protein_id gnl|my_center|LOCUS_03840 446736 447866 gene locus_tag LOCUS_03850 446736 447866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 450870 448057 gene locus_tag LOCUS_03860 450870 448057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 452170 451073 gene locus_tag LOCUS_03870 gene thiH 452170 451073 CDS product cyclic dehypoxanthine futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F2R2 protein_id gnl|my_center|LOCUS_03870 452285 454582 gene locus_tag LOCUS_03880 452285 454582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 454740 455066 gene locus_tag LOCUS_03890 454740 455066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 455170 455541 gene locus_tag LOCUS_03900 455170 455541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 459437 455649 gene locus_tag LOCUS_03910 459437 455649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 459484 460494 gene locus_tag LOCUS_03920 459484 460494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 460531 462735 gene locus_tag LOCUS_03930 460531 462735 CDS product bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763077.1 protein_id gnl|my_center|LOCUS_03930 463161 464468 gene locus_tag LOCUS_03940 463161 464468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488656.1 protein_id gnl|my_center|LOCUS_03940 464578 465246 gene locus_tag LOCUS_03950 464578 465246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 465257 466834 gene locus_tag LOCUS_03960 465257 466834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236205.1 protein_id gnl|my_center|LOCUS_03960 466986 469028 gene locus_tag LOCUS_03970 466986 469028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 469025 470473 gene locus_tag LOCUS_03980 469025 470473 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668604.1 protein_id gnl|my_center|LOCUS_03980 470569 471951 gene locus_tag LOCUS_03990 470569 471951 CDS product PmbA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545326.1 protein_id gnl|my_center|LOCUS_03990 473103 472105 gene locus_tag LOCUS_04000 473103 472105 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448524.1 protein_id gnl|my_center|LOCUS_04000 474140 473103 gene locus_tag LOCUS_04010 474140 473103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 475064 474156 gene locus_tag LOCUS_04020 475064 474156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 475186 475112 gene locus_tag LOCUS_t00030 475186 475112 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 475287 476156 gene locus_tag LOCUS_04030 gene yneD 475287 476156 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905879.1 protein_id gnl|my_center|LOCUS_04030 476095 476394 gene locus_tag LOCUS_04040 476095 476394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 476432 480511 gene locus_tag LOCUS_04050 476432 480511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 480641 480871 gene locus_tag LOCUS_04060 480641 480871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 481299 482126 gene locus_tag LOCUS_04070 481299 482126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 482129 483403 gene locus_tag LOCUS_04080 gene mauG 482129 483403 CDS product di-heme enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211849.1 protein_id gnl|my_center|LOCUS_04080 483490 484269 gene locus_tag LOCUS_04090 483490 484269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 484254 485276 gene locus_tag LOCUS_04100 484254 485276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 486656 485451 gene locus_tag LOCUS_04110 486656 485451 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230594.1 protein_id gnl|my_center|LOCUS_04110 487516 488034 gene locus_tag LOCUS_04120 487516 488034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 488281 488208 gene locus_tag LOCUS_t00040 488281 488208 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 488912 488379 gene locus_tag LOCUS_04130 488912 488379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 490417 489215 gene locus_tag LOCUS_04140 490417 489215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 492309 490417 gene locus_tag LOCUS_04150 492309 490417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 492416 493045 gene locus_tag LOCUS_04160 492416 493045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 494621 493215 gene locus_tag LOCUS_04170 gene miaB 494621 493215 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000555988.1 protein_id gnl|my_center|LOCUS_04170 495397 494618 gene locus_tag LOCUS_04180 495397 494618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 495949 495437 gene locus_tag LOCUS_04190 495949 495437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 498552 495946 gene locus_tag LOCUS_04200 gene clpA 498552 495946 CDS product ATP-dependent Clp protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889239.1 protein_id gnl|my_center|LOCUS_04200 499677 498661 gene locus_tag LOCUS_04210 499677 498661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 500429 499743 gene locus_tag LOCUS_04220 500429 499743 CDS product lipoprotein releasing system ATPase LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052667.1 protein_id gnl|my_center|LOCUS_04220 501738 500470 gene locus_tag LOCUS_04230 gene lolE 501738 500470 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867620.1 protein_id gnl|my_center|LOCUS_04230 501963 502937 gene locus_tag LOCUS_04240 501963 502937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 504227 503046 gene locus_tag LOCUS_04250 504227 503046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 504425 506446 gene locus_tag LOCUS_04260 504425 506446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 506690 507049 gene locus_tag LOCUS_04270 506690 507049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 507037 507726 gene locus_tag LOCUS_04280 507037 507726 CDS product murein peptide amidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816358.1 protein_id gnl|my_center|LOCUS_04280 507861 508682 gene locus_tag LOCUS_04290 gene dapD 507861 508682 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_04290 508847 509803 gene locus_tag LOCUS_04300 508847 509803 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582519.1 protein_id gnl|my_center|LOCUS_04300 509800 511143 gene locus_tag LOCUS_04310 509800 511143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 511255 512556 gene locus_tag LOCUS_04320 511255 512556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 513175 512588 gene locus_tag LOCUS_04330 513175 512588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 513320 513832 gene locus_tag LOCUS_04340 513320 513832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 515832 514039 gene locus_tag LOCUS_04350 gene rpoD 515832 514039 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59117 protein_id gnl|my_center|LOCUS_04350 517941 515851 gene locus_tag LOCUS_04360 gene dnaG 517941 515851 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F416 protein_id gnl|my_center|LOCUS_04360 518387 517938 gene locus_tag LOCUS_04370 518387 517938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058095.1 protein_id gnl|my_center|LOCUS_04370 518621 518412 gene locus_tag LOCUS_04380 gene rpsU 518621 518412 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F418 protein_id gnl|my_center|LOCUS_04380 518807 519250 gene locus_tag LOCUS_04390 518807 519250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 519393 520487 gene locus_tag LOCUS_04400 519393 520487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 521318 520554 gene locus_tag LOCUS_04410 521318 520554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 522149 522364 gene locus_tag LOCUS_04420 522149 522364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372884.1 protein_id gnl|my_center|LOCUS_04420 523417 522467 gene locus_tag LOCUS_04430 523417 522467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 524650 523682 gene locus_tag LOCUS_04440 524650 523682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 525792 524782 gene locus_tag LOCUS_04450 525792 524782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 525972 529433 gene locus_tag LOCUS_04460 gene dnaE 525972 529433 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F9D7 protein_id gnl|my_center|LOCUS_04460 531713 531051 gene locus_tag LOCUS_04470 531713 531051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 532531 532145 gene locus_tag LOCUS_04480 532531 532145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 532704 532522 gene locus_tag LOCUS_04490 532704 532522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 533726 533172 gene locus_tag LOCUS_04500 533726 533172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 534315 533818 gene locus_tag LOCUS_04510 534315 533818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 534630 534442 gene locus_tag LOCUS_04520 534630 534442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 535668 535360 gene locus_tag LOCUS_04530 535668 535360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 536368 535979 gene locus_tag LOCUS_04540 536368 535979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 537611 536910 gene locus_tag LOCUS_04550 537611 536910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 538614 537667 gene locus_tag LOCUS_04560 538614 537667 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054050.1 protein_id gnl|my_center|LOCUS_04560 538756 539661 gene locus_tag LOCUS_04570 gene nlpD 538756 539661 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387040.1 protein_id gnl|my_center|LOCUS_04570 541682 539658 gene locus_tag LOCUS_04580 541682 539658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 543788 541794 gene locus_tag LOCUS_04590 543788 541794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 543787 543993 gene locus_tag LOCUS_04600 543787 543993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 544922 544083 gene locus_tag LOCUS_04610 544922 544083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095155.1 protein_id gnl|my_center|LOCUS_04610 546760 545147 gene locus_tag LOCUS_04620 546760 545147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 546881 547816 gene locus_tag LOCUS_04630 gene rfaF 546881 547816 CDS product ADP-heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001967602.1 protein_id gnl|my_center|LOCUS_04630 547994 549661 gene locus_tag LOCUS_04640 547994 549661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 550924 549749 gene locus_tag LOCUS_04650 550924 549749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 551819 550980 gene locus_tag LOCUS_04660 551819 550980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 552832 551834 gene locus_tag LOCUS_04670 552832 551834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 553400 552813 gene locus_tag LOCUS_04680 553400 552813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 553395 553637 gene locus_tag LOCUS_04690 553395 553637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 553650 555107 gene locus_tag LOCUS_04700 gene gatB 553650 555107 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F9D9 protein_id gnl|my_center|LOCUS_04700 555239 555853 gene locus_tag LOCUS_04710 555239 555853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 556016 556215 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cataagccgaactcggcggg 557151 556234 gene locus_tag LOCUS_04720 557151 556234 CDS product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808357.1 protein_id gnl|my_center|LOCUS_04720 558880 557243 gene locus_tag LOCUS_04730 gene glpA 558880 557243 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142835.1 protein_id gnl|my_center|LOCUS_04730 560513 558864 gene locus_tag LOCUS_04740 560513 558864 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681003.1 protein_id gnl|my_center|LOCUS_04740 560667 561404 gene locus_tag LOCUS_04750 560667 561404 CDS product dolichyl-phosphate mannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123928.1 protein_id gnl|my_center|LOCUS_04750 561451 561999 gene locus_tag LOCUS_04760 561451 561999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 562011 562085 gene locus_tag LOCUS_t00050 562011 562085 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 564005 562557 gene locus_tag LOCUS_04770 564005 562557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 565012 566289 gene locus_tag LOCUS_04780 565012 566289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 566325 566663 gene locus_tag LOCUS_04790 566325 566663 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WE11 protein_id gnl|my_center|LOCUS_04790 566850 567602 gene locus_tag LOCUS_04800 566850 567602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 568404 567679 gene locus_tag LOCUS_04810 568404 567679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 568603 569523 gene locus_tag LOCUS_04820 568603 569523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 569667 570218 gene locus_tag LOCUS_04830 569667 570218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 570920 570450 gene locus_tag LOCUS_04840 570920 570450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943062.1 protein_id gnl|my_center|LOCUS_04840 571262 570942 gene locus_tag LOCUS_04850 571262 570942 CDS product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459007.1 protein_id gnl|my_center|LOCUS_04850 572480 571281 gene locus_tag LOCUS_04860 572480 571281 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461847.1 protein_id gnl|my_center|LOCUS_04860 572777 573610 gene locus_tag LOCUS_04870 gene ghr 572777 573610 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942022.1 protein_id gnl|my_center|LOCUS_04870 574603 573641 gene locus_tag LOCUS_04880 574603 573641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 574734 575675 gene locus_tag LOCUS_04890 gene apaH 574734 575675 CDS product diadenosine tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124047.1 protein_id gnl|my_center|LOCUS_04890 578106 575698 gene locus_tag LOCUS_04900 578106 575698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 580953 578191 gene locus_tag LOCUS_04910 gene pepN 580953 578191 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 protein_id gnl|my_center|LOCUS_04910 581243 583177 gene locus_tag LOCUS_04920 581243 583177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 583517 583221 gene locus_tag LOCUS_04930 583517 583221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 583659 584156 gene locus_tag LOCUS_04940 583659 584156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 584499 584768 gene locus_tag LOCUS_04950 584499 584768 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582790.1 protein_id gnl|my_center|LOCUS_04950 584838 585641 gene locus_tag LOCUS_04960 584838 585641 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388698.1 protein_id gnl|my_center|LOCUS_04960 585702 586181 gene locus_tag LOCUS_04970 585702 586181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121836.1 protein_id gnl|my_center|LOCUS_04970 586304 587596 gene locus_tag LOCUS_04980 586304 587596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113892.1 protein_id gnl|my_center|LOCUS_04980 587882 588010 gene locus_tag LOCUS_04990 587882 588010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 588007 588366 gene locus_tag LOCUS_05000 588007 588366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 588363 588593 gene locus_tag LOCUS_05010 588363 588593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 588590 589849 gene locus_tag LOCUS_05020 588590 589849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056396.1 protein_id gnl|my_center|LOCUS_05020 589857 592007 gene locus_tag LOCUS_05030 589857 592007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 592054 593532 gene locus_tag LOCUS_05040 592054 593532 CDS product phospholipase D/transphosphatidylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003668.1 protein_id gnl|my_center|LOCUS_05040 593544 594371 gene locus_tag LOCUS_05050 593544 594371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 595556 594435 gene locus_tag LOCUS_05060 595556 594435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 595738 596319 gene locus_tag LOCUS_05070 595738 596319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 597453 596380 gene locus_tag LOCUS_05080 597453 596380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 598851 597571 gene locus_tag LOCUS_05090 598851 597571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 599040 600248 gene locus_tag LOCUS_05100 599040 600248 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026893.1 protein_id gnl|my_center|LOCUS_05100 600815 601240 gene locus_tag LOCUS_05110 600815 601240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 601338 601877 gene locus_tag LOCUS_05120 601338 601877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 602005 602688 gene locus_tag LOCUS_05130 602005 602688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030520.1 protein_id gnl|my_center|LOCUS_05130 603194 602889 gene locus_tag LOCUS_05140 603194 602889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 603934 603581 gene locus_tag LOCUS_05150 603934 603581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 604359 605291 gene locus_tag LOCUS_05160 604359 605291 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102328.1 protein_id gnl|my_center|LOCUS_05160 605615 605543 gene locus_tag LOCUS_t00060 605615 605543 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 605708 605636 gene locus_tag LOCUS_t00070 605708 605636 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 606252 605761 gene locus_tag LOCUS_05170 gene cheW 606252 605761 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093551.1 protein_id gnl|my_center|LOCUS_05170 607036 606293 gene locus_tag LOCUS_05180 607036 606293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534539.1 protein_id gnl|my_center|LOCUS_05180 607130 607447 gene locus_tag LOCUS_05190 607130 607447 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278842.1 protein_id gnl|my_center|LOCUS_05190 607454 608371 gene locus_tag LOCUS_05200 gene thrB 607454 608371 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67332 protein_id gnl|my_center|LOCUS_05200 608395 609294 gene locus_tag LOCUS_05210 gene dsbG 608395 609294 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651714.1 protein_id gnl|my_center|LOCUS_05210 610479 609532 gene locus_tag LOCUS_05220 gene mdh 610479 609532 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDP3 protein_id gnl|my_center|LOCUS_05220 610686 613025 gene locus_tag LOCUS_05230 610686 613025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 613043 615412 gene locus_tag LOCUS_05240 613043 615412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 615809 615447 gene locus_tag LOCUS_05250 615809 615447 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083943.1 protein_id gnl|my_center|LOCUS_05250 617061 615787 gene locus_tag LOCUS_05260 617061 615787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 618119 617058 gene locus_tag LOCUS_05270 gene cheB 618119 617058 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C3R5 protein_id gnl|my_center|LOCUS_05270 620029 618173 gene locus_tag LOCUS_05280 gene cheA64H 620029 618173 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940968.1 protein_id gnl|my_center|LOCUS_05280 620565 620035 gene locus_tag LOCUS_05290 620565 620035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 622481 620580 gene locus_tag LOCUS_05300 622481 620580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 623545 622871 gene locus_tag LOCUS_05310 623545 622871 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215708.1 protein_id gnl|my_center|LOCUS_05310 624803 623706 gene locus_tag LOCUS_05320 624803 623706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042628.1 protein_id gnl|my_center|LOCUS_05320 624861 624936 gene locus_tag LOCUS_t00080 624861 624936 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 624956 625038 gene locus_tag LOCUS_t00090 624956 625038 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 625636 625172 gene locus_tag LOCUS_05330 625636 625172 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247259.1 protein_id gnl|my_center|LOCUS_05330 625665 626576 gene locus_tag LOCUS_05340 gene speE2 625665 626576 CDS product polyamine aminopropyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EXA3 protein_id gnl|my_center|LOCUS_05340 628596 626707 gene locus_tag LOCUS_05350 gene guaA 628596 626707 CDS product putative GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4F4 protein_id gnl|my_center|LOCUS_05350 629271 628738 gene locus_tag LOCUS_05360 629271 628738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 629311 629634 gene locus_tag LOCUS_05370 629311 629634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 630288 629779 gene locus_tag LOCUS_05380 630288 629779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 631860 630652 gene locus_tag LOCUS_05390 gene ribB 631860 630652 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F701 protein_id gnl|my_center|LOCUS_05390 632700 631897 gene locus_tag LOCUS_05400 632700 631897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 635906 632718 gene locus_tag LOCUS_05410 635906 632718 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450798.1 protein_id gnl|my_center|LOCUS_05410 636298 637449 gene locus_tag LOCUS_05420 636298 637449 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F6L0 protein_id gnl|my_center|LOCUS_05420 637476 638348 gene locus_tag LOCUS_05430 637476 638348 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000909038.1 protein_id gnl|my_center|LOCUS_05430 639226 638345 gene locus_tag LOCUS_05440 639226 638345 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842287.1 protein_id gnl|my_center|LOCUS_05440 641401 639230 gene locus_tag LOCUS_05450 641401 639230 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910893.1 protein_id gnl|my_center|LOCUS_05450 641551 641817 gene locus_tag LOCUS_05460 641551 641817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 642214 641903 gene locus_tag LOCUS_05470 642214 641903 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4W0 protein_id gnl|my_center|LOCUS_05470 643105 642296 gene locus_tag LOCUS_05480 643105 642296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 643182 643418 gene locus_tag LOCUS_05490 643182 643418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 643422 644366 gene locus_tag LOCUS_05500 gene ycf43 643422 644366 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJC0 protein_id gnl|my_center|LOCUS_05500 644600 645421 gene locus_tag LOCUS_05510 644600 645421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 646993 645698 gene locus_tag LOCUS_05520 gene clpX 646993 645698 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F353 protein_id gnl|my_center|LOCUS_05520 647665 647036 gene locus_tag LOCUS_05530 gene clpP 647665 647036 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F352 protein_id gnl|my_center|LOCUS_05530 649232 647901 gene locus_tag LOCUS_05540 gene tig 649232 647901 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HD53 protein_id gnl|my_center|LOCUS_05540 649327 649255 gene locus_tag LOCUS_t00100 649327 649255 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 649412 649331 gene locus_tag LOCUS_t00110 649412 649331 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 649574 649501 gene locus_tag LOCUS_t00120 649574 649501 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence02 3755 69 gene locus_tag LOCUS_05550 gene rpoB 3755 69 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F0S2 protein_id gnl|my_center|LOCUS_05550 4253 3867 gene locus_tag LOCUS_05560 gene rplL 4253 3867 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F0S1 protein_id gnl|my_center|LOCUS_05560 4838 4302 gene locus_tag LOCUS_05570 4838 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 5547 4867 gene locus_tag LOCUS_05580 gene rplA 5547 4867 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F0R9 protein_id gnl|my_center|LOCUS_05580 5977 5549 gene locus_tag LOCUS_05590 gene rplK 5977 5549 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F0R8 protein_id gnl|my_center|LOCUS_05590 6632 6099 gene locus_tag LOCUS_05600 gene nusG 6632 6099 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F0R7 protein_id gnl|my_center|LOCUS_05600 6820 6638 gene locus_tag LOCUS_05610 6820 6638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 6909 6837 gene locus_tag LOCUS_t00130 6909 6837 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 7011 6938 gene locus_tag LOCUS_t00140 7011 6938 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 7450 8181 gene locus_tag LOCUS_05620 7450 8181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 8267 9145 gene locus_tag LOCUS_05630 8267 9145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 10792 9221 gene locus_tag LOCUS_05640 10792 9221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 11186 10881 gene locus_tag LOCUS_05650 11186 10881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 11915 11226 gene locus_tag LOCUS_05660 11915 11226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 12220 12918 gene locus_tag LOCUS_05670 12220 12918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 13435 13004 gene locus_tag LOCUS_05680 13435 13004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 15091 13532 gene locus_tag LOCUS_05690 15091 13532 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128566.1 protein_id gnl|my_center|LOCUS_05690 16571 15327 gene locus_tag LOCUS_05700 16571 15327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 17579 16773 gene locus_tag LOCUS_05710 17579 16773 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087254.1 protein_id gnl|my_center|LOCUS_05710 18540 17683 gene locus_tag LOCUS_05720 18540 17683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 21132 18712 gene locus_tag LOCUS_05730 21132 18712 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112940.1 protein_id gnl|my_center|LOCUS_05730 22039 21206 gene locus_tag LOCUS_05740 22039 21206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 22154 22567 gene locus_tag LOCUS_05750 22154 22567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 22765 23316 gene locus_tag LOCUS_05760 22765 23316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 24552 23371 gene locus_tag LOCUS_05770 24552 23371 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391942.1 protein_id gnl|my_center|LOCUS_05770 25274 24636 gene locus_tag LOCUS_05780 25274 24636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 25371 25811 gene locus_tag LOCUS_05790 gene cueR 25371 25811 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635698.1 protein_id gnl|my_center|LOCUS_05790 26936 26001 gene locus_tag LOCUS_05800 26936 26001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 27099 29336 gene locus_tag LOCUS_05810 27099 29336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 31515 29416 gene locus_tag LOCUS_05820 31515 29416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 31809 31552 gene locus_tag LOCUS_05830 31809 31552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 32929 31931 gene locus_tag LOCUS_05840 32929 31931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 33909 32926 gene locus_tag LOCUS_05850 33909 32926 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946695.1 protein_id gnl|my_center|LOCUS_05850 34023 36263 gene locus_tag LOCUS_05860 34023 36263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 36233 37111 gene locus_tag LOCUS_05870 36233 37111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 37181 38506 gene locus_tag LOCUS_05880 37181 38506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 38503 39186 gene locus_tag LOCUS_05890 38503 39186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 41188 39242 gene locus_tag LOCUS_05900 41188 39242 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930674.1 protein_id gnl|my_center|LOCUS_05900 41261 43045 gene locus_tag LOCUS_05910 41261 43045 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001970104.1 protein_id gnl|my_center|LOCUS_05910 43075 44088 gene locus_tag LOCUS_05920 43075 44088 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759810.1 protein_id gnl|my_center|LOCUS_05920 44085 45140 gene locus_tag LOCUS_05930 44085 45140 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603891.1 protein_id gnl|my_center|LOCUS_05930 46621 45266 gene locus_tag LOCUS_05940 gene leuA-2 46621 45266 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAP9 protein_id gnl|my_center|LOCUS_05940 47133 49808 gene locus_tag LOCUS_05950 47133 49808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 51781 49853 gene locus_tag LOCUS_05960 51781 49853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 53815 52244 gene locus_tag LOCUS_05970 53815 52244 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895957.1 protein_id gnl|my_center|LOCUS_05970 54836 53934 gene locus_tag LOCUS_05980 gene mmsB 54836 53934 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069700.1 protein_id gnl|my_center|LOCUS_05980 54876 55187 gene locus_tag LOCUS_05990 54876 55187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 55184 56137 gene locus_tag LOCUS_06000 55184 56137 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257499.1 protein_id gnl|my_center|LOCUS_06000 56134 57093 gene locus_tag LOCUS_06010 56134 57093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 57225 57728 gene locus_tag LOCUS_06020 57225 57728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 57811 58263 gene locus_tag LOCUS_06030 57811 58263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419733.1 protein_id gnl|my_center|LOCUS_06030 58328 58897 gene locus_tag LOCUS_06040 58328 58897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 59029 61188 gene locus_tag LOCUS_06050 59029 61188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 62072 61440 gene locus_tag LOCUS_06060 gene pgm6 62072 61440 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640836.1 protein_id gnl|my_center|LOCUS_06060 62151 62381 gene locus_tag LOCUS_06070 62151 62381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 62386 63324 gene locus_tag LOCUS_06080 gene hisN 62386 63324 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_06080 63450 64271 gene locus_tag LOCUS_06090 63450 64271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 64782 64459 gene locus_tag LOCUS_06100 64782 64459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 66271 64814 gene locus_tag LOCUS_06110 66271 64814 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142346.1 protein_id gnl|my_center|LOCUS_06110 67212 66271 gene locus_tag LOCUS_06120 gene ilvE 67212 66271 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841027.1 protein_id gnl|my_center|LOCUS_06120 67325 68437 gene locus_tag LOCUS_06130 gene hemN 67325 68437 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582256.1 protein_id gnl|my_center|LOCUS_06130 68873 68547 gene locus_tag LOCUS_06140 68873 68547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 69072 70376 gene locus_tag LOCUS_06150 gene erg3 69072 70376 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 protein_id gnl|my_center|LOCUS_06150 71030 70530 gene locus_tag LOCUS_06160 71030 70530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 71792 72907 gene locus_tag LOCUS_06170 71792 72907 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966652.1 protein_id gnl|my_center|LOCUS_06170 73689 73249 gene locus_tag LOCUS_06180 73689 73249 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259124.1 protein_id gnl|my_center|LOCUS_06180 75004 73718 gene locus_tag LOCUS_06190 75004 73718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 76426 75014 gene locus_tag LOCUS_06200 gene dltB 76426 75014 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898568.1 protein_id gnl|my_center|LOCUS_06200 76633 77163 gene locus_tag LOCUS_06210 76633 77163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 77209 77988 gene locus_tag LOCUS_06220 gene adh2 77209 77988 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880787.1 protein_id gnl|my_center|LOCUS_06220 78254 78454 gene locus_tag LOCUS_06230 78254 78454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 79111 78563 gene locus_tag LOCUS_06240 gene thiJ 79111 78563 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127205.1 protein_id gnl|my_center|LOCUS_06240 79649 79410 gene locus_tag LOCUS_06250 79649 79410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 80712 79708 gene locus_tag LOCUS_06260 gene asd 80712 79708 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L61 protein_id gnl|my_center|LOCUS_06260 80800 81546 gene locus_tag LOCUS_06270 80800 81546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 81938 81564 gene locus_tag LOCUS_06280 81938 81564 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948047.1 protein_id gnl|my_center|LOCUS_06280 82634 81966 gene locus_tag LOCUS_06290 82634 81966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 82757 82833 gene locus_tag LOCUS_t00150 82757 82833 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 82836 82919 gene locus_tag LOCUS_t00160 82836 82919 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 83438 84187 gene locus_tag LOCUS_06300 83438 84187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 84540 86255 gene locus_tag LOCUS_06310 84540 86255 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066587.1 protein_id gnl|my_center|LOCUS_06310 86326 87279 gene locus_tag LOCUS_06320 86326 87279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 87448 88299 gene locus_tag LOCUS_06330 87448 88299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 88570 89496 gene locus_tag LOCUS_06340 88570 89496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 90613 89552 gene locus_tag LOCUS_06350 gene aroF 90613 89552 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AR1 protein_id gnl|my_center|LOCUS_06350 92465 90738 gene locus_tag LOCUS_06360 92465 90738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 93070 92621 gene locus_tag LOCUS_06370 gene codA 93070 92621 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038585.1 protein_id gnl|my_center|LOCUS_06370 93619 93278 gene locus_tag LOCUS_06380 93619 93278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 94662 93631 gene locus_tag LOCUS_06390 94662 93631 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698132.1 protein_id gnl|my_center|LOCUS_06390 94744 97089 gene locus_tag LOCUS_06400 94744 97089 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140201.1 protein_id gnl|my_center|LOCUS_06400 97144 97596 gene locus_tag LOCUS_06410 97144 97596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403898.1 protein_id gnl|my_center|LOCUS_06410 98582 97731 gene locus_tag LOCUS_06420 98582 97731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 99029 98781 gene locus_tag LOCUS_06430 99029 98781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 99826 99185 gene locus_tag LOCUS_06440 99826 99185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 100304 99864 gene locus_tag LOCUS_06450 100304 99864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 100596 100306 gene locus_tag LOCUS_06460 100596 100306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 101500 100721 gene locus_tag LOCUS_06470 gene lpxA 101500 100721 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZA6 protein_id gnl|my_center|LOCUS_06470 101704 103479 gene locus_tag LOCUS_06480 gene manB 101704 103479 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015897.1 protein_id gnl|my_center|LOCUS_06480 103822 103469 gene locus_tag LOCUS_06490 103822 103469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_06490 104085 105332 gene locus_tag LOCUS_06500 gene argD 104085 105332 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24087 protein_id gnl|my_center|LOCUS_06500 106302 105355 gene locus_tag LOCUS_06510 106302 105355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 107639 106362 gene locus_tag LOCUS_06520 107639 106362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 107841 108074 gene locus_tag LOCUS_06530 107841 108074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 108188 108820 gene locus_tag LOCUS_06540 108188 108820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 109897 108860 gene locus_tag LOCUS_06550 109897 108860 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140671.1 protein_id gnl|my_center|LOCUS_06550 110509 109910 gene locus_tag LOCUS_06560 110509 109910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 110749 112176 gene locus_tag LOCUS_06570 gene lpd 110749 112176 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F290 protein_id gnl|my_center|LOCUS_06570 112269 113534 gene locus_tag LOCUS_06580 gene ispH 112269 113534 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404617.1 protein_id gnl|my_center|LOCUS_06580 113765 116509 gene locus_tag LOCUS_06590 gene lon 113765 116509 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O84348 protein_id gnl|my_center|LOCUS_06590 116487 117638 gene locus_tag LOCUS_06600 116487 117638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 118082 117654 gene locus_tag LOCUS_06610 118082 117654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393936.1 protein_id gnl|my_center|LOCUS_06610 120041 118086 gene locus_tag LOCUS_06620 120041 118086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 121381 120038 gene locus_tag LOCUS_06630 121381 120038 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651487.1 protein_id gnl|my_center|LOCUS_06630 121459 122277 gene locus_tag LOCUS_06640 121459 122277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 122274 124064 gene locus_tag LOCUS_06650 122274 124064 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404982.1 protein_id gnl|my_center|LOCUS_06650 124139 124588 gene locus_tag LOCUS_06660 124139 124588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 125155 124610 gene locus_tag LOCUS_06670 125155 124610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 128677 125393 gene locus_tag LOCUS_06680 128677 125393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 130483 128936 gene locus_tag LOCUS_06690 gene leuA 130483 128936 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169689.1 protein_id gnl|my_center|LOCUS_06690 130784 131557 gene locus_tag LOCUS_06700 130784 131557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 131554 133980 gene locus_tag LOCUS_06710 gene gpsA 131554 133980 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391162.1 protein_id gnl|my_center|LOCUS_06710 134218 135219 gene locus_tag LOCUS_06720 gene adhP 134218 135219 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053082.1 protein_id gnl|my_center|LOCUS_06720 136701 135361 gene locus_tag LOCUS_06730 136701 135361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 136880 137335 gene locus_tag LOCUS_06740 136880 137335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 140521 137399 gene locus_tag LOCUS_06750 140521 137399 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952670.1 protein_id gnl|my_center|LOCUS_06750 141833 140511 gene locus_tag LOCUS_06760 141833 140511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 142001 142540 gene locus_tag LOCUS_06770 142001 142540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 142785 143657 gene locus_tag LOCUS_06780 142785 143657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 143670 145226 gene locus_tag LOCUS_06790 143670 145226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 145682 145278 gene locus_tag LOCUS_06800 145682 145278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 145888 147195 gene locus_tag LOCUS_06810 gene fadB 145888 147195 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206943.1 protein_id gnl|my_center|LOCUS_06810 147497 149146 gene locus_tag LOCUS_06820 147497 149146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 149957 149175 gene locus_tag LOCUS_06830 149957 149175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 150962 149976 gene locus_tag LOCUS_06840 150962 149976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 151008 152114 gene locus_tag LOCUS_06850 gene hslI 151008 152114 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816352.1 protein_id gnl|my_center|LOCUS_06850 152305 152964 gene locus_tag LOCUS_06860 152305 152964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 153140 153622 gene locus_tag LOCUS_06870 gene slyD 153140 153622 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5A3 protein_id gnl|my_center|LOCUS_06870 153643 154266 gene locus_tag LOCUS_06880 153643 154266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 154788 154240 gene locus_tag LOCUS_06890 154788 154240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 155740 154940 gene locus_tag LOCUS_06900 155740 154940 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965525.1 protein_id gnl|my_center|LOCUS_06900 156167 155793 gene locus_tag LOCUS_06910 156167 155793 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771057.1 protein_id gnl|my_center|LOCUS_06910 157520 156507 gene locus_tag LOCUS_06920 157520 156507 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962832.1 protein_id gnl|my_center|LOCUS_06920 159500 157740 gene locus_tag LOCUS_06930 159500 157740 CDS product acetyl-CoA carboxylase carboxyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678775.1 protein_id gnl|my_center|LOCUS_06930 159487 160746 gene locus_tag LOCUS_06940 159487 160746 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642921.1 protein_id gnl|my_center|LOCUS_06940 160889 162538 gene locus_tag LOCUS_06950 160889 162538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601206.1 protein_id gnl|my_center|LOCUS_06950 163907 162666 gene locus_tag LOCUS_06960 163907 162666 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642921.1 protein_id gnl|my_center|LOCUS_06960 164184 166094 gene locus_tag LOCUS_06970 164184 166094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 166246 167715 gene locus_tag LOCUS_06980 166246 167715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503606.1 protein_id gnl|my_center|LOCUS_06980 167712 168488 gene locus_tag LOCUS_06990 gene ttg2B 167712 168488 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147518.1 protein_id gnl|my_center|LOCUS_06990 168547 169389 gene locus_tag LOCUS_07000 168547 169389 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087254.1 protein_id gnl|my_center|LOCUS_07000 169423 170265 gene locus_tag LOCUS_07010 gene ttg2A 169423 170265 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433117.1 protein_id gnl|my_center|LOCUS_07010 170923 170399 gene locus_tag LOCUS_07020 170923 170399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103866.1 protein_id gnl|my_center|LOCUS_07020 171508 171047 gene locus_tag LOCUS_07030 171508 171047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 protein_id gnl|my_center|LOCUS_07030 173069 171489 gene locus_tag LOCUS_07040 gene hutH 173069 171489 CDS product tyrosine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IWB0 protein_id gnl|my_center|LOCUS_07040 173682 173176 gene locus_tag LOCUS_07050 173682 173176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 175225 173675 gene locus_tag LOCUS_07060 175225 173675 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405083.1 protein_id gnl|my_center|LOCUS_07060 175663 175235 gene locus_tag LOCUS_07070 175663 175235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 175973 175722 gene locus_tag LOCUS_07080 175973 175722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 177287 175995 gene locus_tag LOCUS_07090 gene cfaA 177287 175995 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636703.2 protein_id gnl|my_center|LOCUS_07090 178194 177274 gene locus_tag LOCUS_07100 178194 177274 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971978.1 protein_id gnl|my_center|LOCUS_07100 179576 178293 gene locus_tag LOCUS_07110 179576 178293 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036523.1 protein_id gnl|my_center|LOCUS_07110 180496 179618 gene locus_tag LOCUS_07120 180496 179618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 182359 180506 gene locus_tag LOCUS_07130 182359 180506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 183837 182356 gene locus_tag LOCUS_07140 183837 182356 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257654.1 protein_id gnl|my_center|LOCUS_07140 184055 185107 gene locus_tag LOCUS_07150 184055 185107 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942955.1 protein_id gnl|my_center|LOCUS_07150 185145 188342 gene locus_tag LOCUS_07160 185145 188342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 188488 190497 gene locus_tag LOCUS_07170 188488 190497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 192864 190633 gene locus_tag LOCUS_07180 192864 190633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 193542 192865 gene locus_tag LOCUS_07190 gene pdxH 193542 192865 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VU72 protein_id gnl|my_center|LOCUS_07190 195595 193553 gene locus_tag LOCUS_07200 195595 193553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 195637 197091 gene locus_tag LOCUS_07210 gene purF 195637 197091 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYX2 protein_id gnl|my_center|LOCUS_07210 198057 197326 gene locus_tag LOCUS_07220 198057 197326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 198280 199290 gene locus_tag LOCUS_07230 gene sppA 198280 199290 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682856.1 protein_id gnl|my_center|LOCUS_07230 199287 199730 gene locus_tag LOCUS_07240 199287 199730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 200341 199832 gene locus_tag LOCUS_07250 200341 199832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 200675 201715 gene locus_tag LOCUS_07260 200675 201715 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114821.1 protein_id gnl|my_center|LOCUS_07260 201815 202561 gene locus_tag LOCUS_07270 201815 202561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 203240 202644 gene locus_tag LOCUS_07280 gene sodB 203240 202644 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD44 protein_id gnl|my_center|LOCUS_07280 203343 204362 gene locus_tag LOCUS_07290 203343 204362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 205606 204326 gene locus_tag LOCUS_07300 gene purK 205606 204326 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQS2 protein_id gnl|my_center|LOCUS_07300 206160 205630 gene locus_tag LOCUS_07310 gene purE 206160 205630 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P12044 protein_id gnl|my_center|LOCUS_07310 206942 206157 gene locus_tag LOCUS_07320 206942 206157 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976991.1 protein_id gnl|my_center|LOCUS_07320 208065 207127 gene locus_tag LOCUS_07330 208065 207127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785351.1 protein_id gnl|my_center|LOCUS_07330 208268 208089 gene locus_tag LOCUS_07340 208268 208089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 209823 208261 gene locus_tag LOCUS_07350 209823 208261 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975674.1 protein_id gnl|my_center|LOCUS_07350 210608 209820 gene locus_tag LOCUS_07360 210608 209820 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001977544.1 protein_id gnl|my_center|LOCUS_07360 210701 211537 gene locus_tag LOCUS_07370 gene crt 210701 211537 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52046 protein_id gnl|my_center|LOCUS_07370 211883 215086 gene locus_tag LOCUS_07380 211883 215086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 215198 215959 gene locus_tag LOCUS_07390 215198 215959 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 protein_id gnl|my_center|LOCUS_07390 215969 217279 gene locus_tag LOCUS_07400 215969 217279 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482694.1 protein_id gnl|my_center|LOCUS_07400 217276 218685 gene locus_tag LOCUS_07410 217276 218685 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482694.1 protein_id gnl|my_center|LOCUS_07410 218728 219429 gene locus_tag LOCUS_07420 218728 219429 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865188.1 protein_id gnl|my_center|LOCUS_07420 219782 219585 gene locus_tag LOCUS_07430 219782 219585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 219883 221148 gene locus_tag LOCUS_07440 219883 221148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 221286 221717 gene locus_tag LOCUS_07450 221286 221717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228322.1 protein_id gnl|my_center|LOCUS_07450 224971 221750 gene locus_tag LOCUS_07460 224971 221750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 225736 224975 gene locus_tag LOCUS_07470 225736 224975 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747Z9 protein_id gnl|my_center|LOCUS_07470 226456 225818 gene locus_tag LOCUS_07480 gene hycB 226456 225818 CDS product Fe-S-cluster-containing hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080163.1 protein_id gnl|my_center|LOCUS_07480 226511 227392 gene locus_tag LOCUS_07490 226511 227392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402846.1 protein_id gnl|my_center|LOCUS_07490 227448 228077 gene locus_tag LOCUS_07500 gene cynT 227448 228077 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H168 protein_id gnl|my_center|LOCUS_07500 228074 228892 gene locus_tag LOCUS_07510 228074 228892 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939274.1 protein_id gnl|my_center|LOCUS_07510 229049 230053 gene locus_tag LOCUS_07520 229049 230053 CDS product K+-dependent Na+/Ca+ exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767297.1 protein_id gnl|my_center|LOCUS_07520 230133 231182 gene locus_tag LOCUS_07530 gene adhP 230133 231182 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189850.1 protein_id gnl|my_center|LOCUS_07530 231271 232074 gene locus_tag LOCUS_07540 231271 232074 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001987267.1 protein_id gnl|my_center|LOCUS_07540 233377 232160 gene locus_tag LOCUS_07550 233377 232160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 234117 233374 gene locus_tag LOCUS_07560 gene kdsB 234117 233374 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F0C3 protein_id gnl|my_center|LOCUS_07560 234873 234148 gene locus_tag LOCUS_07570 gene queC 234873 234148 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Z2 protein_id gnl|my_center|LOCUS_07570 235254 234874 gene locus_tag LOCUS_07580 235254 234874 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F965 protein_id gnl|my_center|LOCUS_07580 235988 235257 gene locus_tag LOCUS_07590 gene queE 235988 235257 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFK8 protein_id gnl|my_center|LOCUS_07590 236035 236271 gene locus_tag LOCUS_07600 236035 236271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 237789 236473 gene locus_tag LOCUS_07610 gene xseA 237789 236473 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3P5 protein_id gnl|my_center|LOCUS_07610 238978 237782 gene locus_tag LOCUS_07620 238978 237782 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572375.1 protein_id gnl|my_center|LOCUS_07620 239599 239042 gene locus_tag LOCUS_07630 239599 239042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 241650 239674 gene locus_tag LOCUS_07640 241650 239674 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063951.1 protein_id gnl|my_center|LOCUS_07640 241649 242554 gene locus_tag LOCUS_07650 241649 242554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 242606 244444 gene locus_tag LOCUS_07660 gene ftsI 242606 244444 CDS product penicillin-binding protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088499.1 protein_id gnl|my_center|LOCUS_07660 245588 244413 gene locus_tag LOCUS_07670 gene prfB 245588 244413 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZT4 protein_id gnl|my_center|LOCUS_07670 246279 245800 gene locus_tag LOCUS_07680 246279 245800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 247241 246369 gene locus_tag LOCUS_07690 247241 246369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 248407 247244 gene locus_tag LOCUS_07700 248407 247244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 249050 248517 gene locus_tag LOCUS_07710 249050 248517 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032646.1 protein_id gnl|my_center|LOCUS_07710 249104 249337 gene locus_tag LOCUS_07720 249104 249337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876121.1 protein_id gnl|my_center|LOCUS_07720 249422 249349 gene locus_tag LOCUS_t00170 249422 249349 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 249811 249461 gene locus_tag LOCUS_07730 gene arsC 249811 249461 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218967.1 protein_id gnl|my_center|LOCUS_07730 249861 250409 gene locus_tag LOCUS_07740 249861 250409 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054459.1 protein_id gnl|my_center|LOCUS_07740 251599 250529 gene locus_tag LOCUS_07750 251599 250529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 252336 251767 gene locus_tag LOCUS_07760 252336 251767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 254035 252623 gene locus_tag LOCUS_07770 254035 252623 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786864.1 protein_id gnl|my_center|LOCUS_07770 254742 254053 gene locus_tag LOCUS_07780 254742 254053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 255406 256326 gene locus_tag LOCUS_07790 255406 256326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834729.1 protein_id gnl|my_center|LOCUS_07790 257100 256384 gene locus_tag LOCUS_07800 257100 256384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135390.1 protein_id gnl|my_center|LOCUS_07800 257129 258019 gene locus_tag LOCUS_07810 257129 258019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 258021 258644 gene locus_tag LOCUS_07820 258021 258644 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144004.1 protein_id gnl|my_center|LOCUS_07820 258644 260842 gene locus_tag LOCUS_07830 gene uvrB 258644 260842 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F8A9 protein_id gnl|my_center|LOCUS_07830 261268 260906 gene locus_tag LOCUS_07840 261268 260906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 261349 263184 gene locus_tag LOCUS_07850 261349 263184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807168.1 protein_id gnl|my_center|LOCUS_07850 263181 264071 gene locus_tag LOCUS_07860 gene prmA 263181 264071 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F6B7 protein_id gnl|my_center|LOCUS_07860 264068 265066 gene locus_tag LOCUS_07870 264068 265066 CDS product putative 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67619 protein_id gnl|my_center|LOCUS_07870 265100 266179 gene locus_tag LOCUS_07880 265100 266179 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000539776.1 protein_id gnl|my_center|LOCUS_07880 268285 266261 gene locus_tag LOCUS_07890 gene mnmC 268285 266261 CDS product tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886E0 protein_id gnl|my_center|LOCUS_07890 268247 269206 gene locus_tag LOCUS_07900 268247 269206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 269350 270279 gene locus_tag LOCUS_07910 gene wcaG 269350 270279 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744700.1 protein_id gnl|my_center|LOCUS_07910 270292 271377 gene locus_tag LOCUS_07920 270292 271377 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604524.1 protein_id gnl|my_center|LOCUS_07920 273307 271340 gene locus_tag LOCUS_07930 gene lnt2 273307 271340 CDS product apolipoprotein N-acyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYY4 protein_id gnl|my_center|LOCUS_07930 274350 273313 gene locus_tag LOCUS_07940 274350 273313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854849.1 protein_id gnl|my_center|LOCUS_07940 275404 274466 gene locus_tag LOCUS_07950 275404 274466 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738680.1 protein_id gnl|my_center|LOCUS_07950 276528 275581 gene locus_tag LOCUS_07960 gene ribF 276528 275581 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F0P3 protein_id gnl|my_center|LOCUS_07960 276992 276528 gene locus_tag LOCUS_07970 gene bcp-2 276992 276528 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933657.1 protein_id gnl|my_center|LOCUS_07970 279619 277214 gene locus_tag LOCUS_07980 279619 277214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 280338 279790 gene locus_tag LOCUS_07990 280338 279790 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H57 protein_id gnl|my_center|LOCUS_07990 281065 280367 gene locus_tag LOCUS_08000 gene ispD 281065 280367 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7A0 protein_id gnl|my_center|LOCUS_08000 282129 281062 gene locus_tag LOCUS_08010 282129 281062 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103009.1 protein_id gnl|my_center|LOCUS_08010 282200 282763 gene locus_tag LOCUS_08020 gene efp 282200 282763 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EXB9 protein_id gnl|my_center|LOCUS_08020 282793 283953 gene locus_tag LOCUS_08030 282793 283953 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951973.1 protein_id gnl|my_center|LOCUS_08030 284071 284667 gene locus_tag LOCUS_08040 284071 284667 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749H7 protein_id gnl|my_center|LOCUS_08040 285351 284677 gene locus_tag LOCUS_08050 285351 284677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 285681 286394 gene locus_tag LOCUS_08060 285681 286394 CDS product putative TetR-family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703684.1 protein_id gnl|my_center|LOCUS_08060 286427 287593 gene locus_tag LOCUS_08070 286427 287593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 287668 288714 gene locus_tag LOCUS_08080 287668 288714 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886860.1 protein_id gnl|my_center|LOCUS_08080 289788 288847 gene locus_tag LOCUS_08090 289788 288847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765761.1 protein_id gnl|my_center|LOCUS_08090 290370 289822 gene locus_tag LOCUS_08100 290370 289822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 291953 290700 gene locus_tag LOCUS_08110 291953 290700 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000485071.1 protein_id gnl|my_center|LOCUS_08110 292115 292822 gene locus_tag LOCUS_08120 292115 292822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 293093 293632 gene locus_tag LOCUS_08130 293093 293632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 294704 293634 gene locus_tag LOCUS_08140 gene corA-1 294704 293634 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DB7 protein_id gnl|my_center|LOCUS_08140 294833 295321 gene locus_tag LOCUS_08150 294833 295321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 295363 295812 gene locus_tag LOCUS_08160 295363 295812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 297721 295832 gene locus_tag LOCUS_08170 297721 295832 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869219.1 protein_id gnl|my_center|LOCUS_08170 297742 298662 gene locus_tag LOCUS_08180 297742 298662 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943921.1 protein_id gnl|my_center|LOCUS_08180 298691 300730 gene locus_tag LOCUS_08190 298691 300730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940971.1 protein_id gnl|my_center|LOCUS_08190 301115 300825 gene locus_tag LOCUS_08200 301115 300825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 301615 301112 gene locus_tag LOCUS_08210 301615 301112 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898860.1 protein_id gnl|my_center|LOCUS_08210 301878 302300 gene locus_tag LOCUS_08220 301878 302300 CDS product TIGR00701 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113170.1 protein_id gnl|my_center|LOCUS_08220 303942 302368 gene locus_tag LOCUS_08230 303942 302368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 304908 304015 gene locus_tag LOCUS_08240 304908 304015 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462055.1 protein_id gnl|my_center|LOCUS_08240 305004 306686 gene locus_tag LOCUS_08250 gene srmB 305004 306686 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667199.1 protein_id gnl|my_center|LOCUS_08250 307919 306888 gene locus_tag LOCUS_08260 307919 306888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 308906 307992 gene locus_tag LOCUS_08270 308906 307992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 311247 309037 gene locus_tag LOCUS_08280 311247 309037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 311555 311340 gene locus_tag LOCUS_08290 311555 311340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 313017 311827 gene locus_tag LOCUS_08300 313017 311827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 313329 313099 gene locus_tag LOCUS_08310 313329 313099 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538231.1 protein_id gnl|my_center|LOCUS_08310 313461 313703 gene locus_tag LOCUS_08320 gene rpmB 313461 313703 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F483 protein_id gnl|my_center|LOCUS_08320 313844 314356 gene locus_tag LOCUS_08330 313844 314356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 314388 316580 gene locus_tag LOCUS_08340 gene recG 314388 316580 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZB0 protein_id gnl|my_center|LOCUS_08340 316591 316980 gene locus_tag LOCUS_08350 gene crcB 316591 316980 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLF8 protein_id gnl|my_center|LOCUS_08350 317014 318579 gene locus_tag LOCUS_08360 gene pepA 317014 318579 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67868 protein_id gnl|my_center|LOCUS_08360 318576 319622 gene locus_tag LOCUS_08370 318576 319622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 320251 319658 gene locus_tag LOCUS_08380 320251 319658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 320294 321115 gene locus_tag LOCUS_08390 gene caiD 320294 321115 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848056.1 protein_id gnl|my_center|LOCUS_08390 321942 321322 gene locus_tag LOCUS_08400 321942 321322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 323185 321989 gene locus_tag LOCUS_08410 323185 321989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 323946 323182 gene locus_tag LOCUS_08420 323946 323182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 324079 324705 gene locus_tag LOCUS_08430 324079 324705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 324946 325599 gene locus_tag LOCUS_08440 gene lipB 324946 325599 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F5F1 protein_id gnl|my_center|LOCUS_08440 327854 325542 gene locus_tag LOCUS_08450 gene lldD 327854 325542 CDS product glycolate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058907.1 protein_id gnl|my_center|LOCUS_08450 328318 330219 gene locus_tag LOCUS_08460 gene mnmG 328318 330219 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EY59 protein_id gnl|my_center|LOCUS_08460 332574 330259 gene locus_tag LOCUS_08470 gene yprA 332574 330259 CDS product putative ATP-dependent helicase YprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50830 protein_id gnl|my_center|LOCUS_08470 333988 332576 gene locus_tag LOCUS_08480 gene yprB 333988 332576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50837 protein_id gnl|my_center|LOCUS_08480 335001 334066 gene locus_tag LOCUS_08490 335001 334066 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239224.1 protein_id gnl|my_center|LOCUS_08490 335713 335024 gene locus_tag LOCUS_08500 335713 335024 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425174.1 protein_id gnl|my_center|LOCUS_08500 335801 336280 gene locus_tag LOCUS_08510 335801 336280 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691324.1 protein_id gnl|my_center|LOCUS_08510 339060 336379 gene locus_tag LOCUS_08520 339060 336379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 339350 339057 gene locus_tag LOCUS_08530 339350 339057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 339424 340770 gene locus_tag LOCUS_08540 gene argG 339424 340770 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EP51 protein_id gnl|my_center|LOCUS_08540 342048 341044 gene locus_tag LOCUS_08550 gene ilvC 342048 341044 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYH2 protein_id gnl|my_center|LOCUS_08550 343499 342342 gene locus_tag LOCUS_08560 gene eutG 343499 342342 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122024.1 protein_id gnl|my_center|LOCUS_08560 343437 345290 gene locus_tag LOCUS_08570 343437 345290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 346571 345471 gene locus_tag LOCUS_08580 346571 345471 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698728.1 protein_id gnl|my_center|LOCUS_08580 346673 347656 gene locus_tag LOCUS_08590 346673 347656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 347691 348209 gene locus_tag LOCUS_08600 347691 348209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 348456 349949 gene locus_tag LOCUS_08610 348456 349949 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742439.1 protein_id gnl|my_center|LOCUS_08610 349956 350744 gene locus_tag LOCUS_08620 349956 350744 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977024.1 protein_id gnl|my_center|LOCUS_08620 350803 352626 gene locus_tag LOCUS_08630 350803 352626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399260.1 protein_id gnl|my_center|LOCUS_08630 353743 352700 gene locus_tag LOCUS_08640 353743 352700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 354875 353994 gene locus_tag LOCUS_08650 354875 353994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420355.1 protein_id gnl|my_center|LOCUS_08650 355431 354877 gene locus_tag LOCUS_08660 355431 354877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 356084 355428 gene locus_tag LOCUS_08670 356084 355428 CDS product heme exporter protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702045.1 protein_id gnl|my_center|LOCUS_08670 356788 356087 gene locus_tag LOCUS_08680 356788 356087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 356857 357642 gene locus_tag LOCUS_08690 356857 357642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 358581 357706 gene locus_tag LOCUS_08700 gene parB 358581 357706 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185518.1 protein_id gnl|my_center|LOCUS_08700 359365 358574 gene locus_tag LOCUS_08710 gene parA 359365 358574 CDS product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516556.1 protein_id gnl|my_center|LOCUS_08710 360018 359320 gene locus_tag LOCUS_08720 gene rsmG 360018 359320 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EY69 protein_id gnl|my_center|LOCUS_08720 360124 360870 gene locus_tag LOCUS_08730 360124 360870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 362459 360963 gene locus_tag LOCUS_08740 362459 360963 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546778.1 protein_id gnl|my_center|LOCUS_08740 364081 362633 gene locus_tag LOCUS_08750 gene pntB 364081 362633 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL03 protein_id gnl|my_center|LOCUS_08750 364420 364097 gene locus_tag LOCUS_08760 364420 364097 CDS product pyridine nucleotide transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056542.1 protein_id gnl|my_center|LOCUS_08760 365586 364438 gene locus_tag LOCUS_08770 gene pntA 365586 364438 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125393.1 protein_id gnl|my_center|LOCUS_08770 366667 365858 gene locus_tag LOCUS_08780 366667 365858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 367427 366909 gene locus_tag LOCUS_08790 gene trmL 367427 366909 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181394.1 protein_id gnl|my_center|LOCUS_08790 367568 368785 gene locus_tag LOCUS_08800 367568 368785 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4B1 protein_id gnl|my_center|LOCUS_08800 368772 369818 gene locus_tag LOCUS_08810 368772 369818 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027025.1 protein_id gnl|my_center|LOCUS_08810 369815 370630 gene locus_tag LOCUS_08820 369815 370630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 370603 371745 gene locus_tag LOCUS_08830 370603 371745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 372970 371936 gene locus_tag LOCUS_08840 372970 371936 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898092.1 protein_id gnl|my_center|LOCUS_08840 373973 373104 gene locus_tag LOCUS_08850 373973 373104 CDS product sigma factor regulatory protein FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833301.1 protein_id gnl|my_center|LOCUS_08850 374074 375525 gene locus_tag LOCUS_08860 374074 375525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 377555 375711 gene locus_tag LOCUS_08870 377555 375711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760152.1 protein_id gnl|my_center|LOCUS_08870 378415 377840 gene locus_tag LOCUS_08880 378415 377840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 380063 378495 gene locus_tag LOCUS_08890 380063 378495 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576229.1 protein_id gnl|my_center|LOCUS_08890 380817 380065 gene locus_tag LOCUS_08900 380817 380065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 381513 380830 gene locus_tag LOCUS_08910 gene dfp 381513 380830 CDS product DNA/pantothenate metabolism flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506979.1 protein_id gnl|my_center|LOCUS_08910 382049 381510 gene locus_tag LOCUS_08920 382049 381510 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067294.1 protein_id gnl|my_center|LOCUS_08920 384050 382098 gene locus_tag LOCUS_08930 gene hexB 384050 382098 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DWW4 protein_id gnl|my_center|LOCUS_08930 384107 384373 gene locus_tag LOCUS_08940 384107 384373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 384370 385467 gene locus_tag LOCUS_08950 384370 385467 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613385.1 protein_id gnl|my_center|LOCUS_08950 385882 385613 gene locus_tag LOCUS_08960 385882 385613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 386033 387145 gene locus_tag LOCUS_08970 386033 387145 CDS product mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512781.1 protein_id gnl|my_center|LOCUS_08970 387867 387466 gene locus_tag LOCUS_08980 387867 387466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 388299 387868 gene locus_tag LOCUS_08990 388299 387868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 388398 388311 gene locus_tag LOCUS_t00180 388398 388311 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 388492 388406 gene locus_tag LOCUS_t00190 388492 388406 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 389632 388523 gene locus_tag LOCUS_09000 gene lpxD 389632 388523 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ME7 protein_id gnl|my_center|LOCUS_09000 391567 389873 gene locus_tag LOCUS_09010 391567 389873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123969.1 protein_id gnl|my_center|LOCUS_09010 391566 392279 gene locus_tag LOCUS_09020 391566 392279 CDS product EEP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704807.1 protein_id gnl|my_center|LOCUS_09020 393300 392383 gene locus_tag LOCUS_09030 393300 392383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 393371 394225 gene locus_tag LOCUS_09040 393371 394225 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249930.1 protein_id gnl|my_center|LOCUS_09040 394788 394417 gene locus_tag LOCUS_09050 394788 394417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 395271 394798 gene locus_tag LOCUS_09060 395271 394798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 396397 395297 gene locus_tag LOCUS_09070 gene recF 396397 395297 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8FA32 protein_id gnl|my_center|LOCUS_09070 397525 396410 gene locus_tag LOCUS_09080 gene dnaN 397525 396410 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8FA33 protein_id gnl|my_center|LOCUS_09080 399069 397780 gene locus_tag LOCUS_09090 gene dnaA 399069 397780 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HXP7 protein_id gnl|my_center|LOCUS_09090 399346 399501 gene locus_tag LOCUS_09100 gene rpmH 399346 399501 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F9L6 protein_id gnl|my_center|LOCUS_09100 400117 402051 gene locus_tag LOCUS_09110 gene yidC 400117 402051 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P97041 protein_id gnl|my_center|LOCUS_09110 402074 402754 gene locus_tag LOCUS_09120 gene jag 402074 402754 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432936.1 protein_id gnl|my_center|LOCUS_09120 403000 404259 gene locus_tag LOCUS_09130 gene mnmE 403000 404259 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P97043 protein_id gnl|my_center|LOCUS_09130 404730 404206 gene locus_tag LOCUS_09140 404730 404206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 404749 405177 gene locus_tag LOCUS_09150 gene maoC 404749 405177 CDS product dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276952.1 protein_id gnl|my_center|LOCUS_09150 406504 405179 gene locus_tag LOCUS_09160 gene rsbU 406504 405179 CDS product serine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219857.1 protein_id gnl|my_center|LOCUS_09160 406636 406860 gene locus_tag LOCUS_09170 406636 406860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 407166 406903 gene locus_tag LOCUS_09180 gene csrA 407166 406903 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYB0 protein_id gnl|my_center|LOCUS_09180 407605 407168 gene locus_tag LOCUS_09190 gene fliW 407605 407168 CDS product flagellar assembly factor FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYA9 protein_id gnl|my_center|LOCUS_09190 408878 407610 gene locus_tag LOCUS_09200 408878 407610 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223330.1 protein_id gnl|my_center|LOCUS_09200 410978 409041 gene locus_tag LOCUS_09210 gene flgK 410978 409041 CDS product flagellar hook protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535890.1 protein_id gnl|my_center|LOCUS_09210 411827 411315 gene locus_tag LOCUS_09220 411827 411315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 412073 413218 gene locus_tag LOCUS_09230 412073 413218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079033.1 protein_id gnl|my_center|LOCUS_09230 413215 413733 gene locus_tag LOCUS_09240 413215 413733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 414982 413924 gene locus_tag LOCUS_09250 414982 413924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 416571 415492 gene locus_tag LOCUS_09260 416571 415492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 419306 417108 gene locus_tag LOCUS_09270 419306 417108 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545101.1 protein_id gnl|my_center|LOCUS_09270 420051 419308 gene locus_tag LOCUS_09280 420051 419308 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676765.1 protein_id gnl|my_center|LOCUS_09280 420545 420048 gene locus_tag LOCUS_09290 420545 420048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 421239 420712 gene locus_tag LOCUS_09300 421239 420712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 422577 421369 gene locus_tag LOCUS_09310 gene paaJ 422577 421369 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063746.1 protein_id gnl|my_center|LOCUS_09310 424901 422733 gene locus_tag LOCUS_09320 424901 422733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 427498 424898 gene locus_tag LOCUS_09330 427498 424898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 428618 427845 gene locus_tag LOCUS_09340 428618 427845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 429523 428756 gene locus_tag LOCUS_09350 429523 428756 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536473.1 protein_id gnl|my_center|LOCUS_09350 429962 430630 gene locus_tag LOCUS_09360 429962 430630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 430700 431152 gene locus_tag LOCUS_09370 430700 431152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 431550 432797 gene locus_tag LOCUS_09380 431550 432797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 432790 434106 gene locus_tag LOCUS_09390 432790 434106 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941985.1 protein_id gnl|my_center|LOCUS_09390 434099 437395 gene locus_tag LOCUS_09400 434099 437395 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946830.1 protein_id gnl|my_center|LOCUS_09400 437525 437713 gene locus_tag LOCUS_09410 437525 437713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 437710 439644 gene locus_tag LOCUS_09420 437710 439644 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877664.1 protein_id gnl|my_center|LOCUS_09420 439762 440280 gene locus_tag LOCUS_09430 439762 440280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 441005 440376 gene locus_tag LOCUS_09440 441005 440376 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528999.1 protein_id gnl|my_center|LOCUS_09440 441190 441663 gene locus_tag LOCUS_09450 441190 441663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 441897 442820 gene locus_tag LOCUS_09460 441897 442820 CDS product phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63IV9 protein_id gnl|my_center|LOCUS_09460 443190 442948 gene locus_tag LOCUS_09470 443190 442948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 443173 443355 gene locus_tag LOCUS_09480 443173 443355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 444103 443408 gene locus_tag LOCUS_09490 444103 443408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 444165 444563 gene locus_tag LOCUS_09500 444165 444563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 445499 444639 gene locus_tag LOCUS_09510 445499 444639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 445857 446417 gene locus_tag LOCUS_09520 445857 446417 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118368.1 protein_id gnl|my_center|LOCUS_09520 446414 446689 gene locus_tag LOCUS_09530 446414 446689 CDS product pH regulation protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389330.1 protein_id gnl|my_center|LOCUS_09530 446682 447014 gene locus_tag LOCUS_09540 446682 447014 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118366.1 protein_id gnl|my_center|LOCUS_09540 447066 447311 gene locus_tag LOCUS_09550 447066 447311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 447308 447613 gene locus_tag LOCUS_09560 447308 447613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 447610 448050 gene locus_tag LOCUS_09570 447610 448050 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389327.1 protein_id gnl|my_center|LOCUS_09570 448043 448411 gene locus_tag LOCUS_09580 448043 448411 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_09580 448408 449922 gene locus_tag LOCUS_09590 448408 449922 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_09590 449919 451403 gene locus_tag LOCUS_09600 449919 451403 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902375.1 protein_id gnl|my_center|LOCUS_09600 451400 451612 gene locus_tag LOCUS_09610 451400 451612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 451605 453359 gene locus_tag LOCUS_09620 gene nuoM2 451605 453359 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708738.1 protein_id gnl|my_center|LOCUS_09620 454890 453628 gene locus_tag LOCUS_09630 gene purD 454890 453628 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZT7 protein_id gnl|my_center|LOCUS_09630 455224 457581 gene locus_tag LOCUS_09640 455224 457581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 458464 457583 gene locus_tag LOCUS_09650 458464 457583 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKP2 protein_id gnl|my_center|LOCUS_09650 458553 460010 gene locus_tag LOCUS_09660 458553 460010 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392746.1 protein_id gnl|my_center|LOCUS_09660 460007 460834 gene locus_tag LOCUS_09670 460007 460834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 460978 461754 gene locus_tag LOCUS_09680 gene cah 460978 461754 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083956.1 protein_id gnl|my_center|LOCUS_09680 462507 461842 gene locus_tag LOCUS_09690 462507 461842 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384710.1 protein_id gnl|my_center|LOCUS_09690 462623 463081 gene locus_tag LOCUS_09700 462623 463081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 463078 463902 gene locus_tag LOCUS_09710 463078 463902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 463981 464478 gene locus_tag LOCUS_09720 463981 464478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 464475 465125 gene locus_tag LOCUS_09730 gene clpP 464475 465125 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4T6 protein_id gnl|my_center|LOCUS_09730 465908 465135 gene locus_tag LOCUS_09740 465908 465135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 468821 465912 gene locus_tag LOCUS_09750 468821 465912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 469273 468857 gene locus_tag LOCUS_09760 469273 468857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 469559 469332 gene locus_tag LOCUS_09770 469559 469332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 469758 470708 gene locus_tag LOCUS_09780 469758 470708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 471223 470810 gene locus_tag LOCUS_09790 471223 470810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 472077 471286 gene locus_tag LOCUS_09800 472077 471286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 472157 472975 gene locus_tag LOCUS_09810 472157 472975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 474761 473121 gene locus_tag LOCUS_09820 gene truD 474761 473121 CDS product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545670.1 protein_id gnl|my_center|LOCUS_09820 476071 474758 gene locus_tag LOCUS_09830 476071 474758 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258472.1 protein_id gnl|my_center|LOCUS_09830 476489 476265 gene locus_tag LOCUS_09840 476489 476265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 477432 476974 gene locus_tag LOCUS_09850 477432 476974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 478014 477481 gene locus_tag LOCUS_09860 gene sigW 478014 477481 CDS product ECF RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45585 protein_id gnl|my_center|LOCUS_09860 478413 478021 gene locus_tag LOCUS_09870 478413 478021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680234.1 protein_id gnl|my_center|LOCUS_09870 479730 478633 gene locus_tag LOCUS_09880 479730 478633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 479863 481998 gene locus_tag LOCUS_09890 479863 481998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 482039 482320 gene locus_tag LOCUS_09900 482039 482320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 483434 482343 gene locus_tag LOCUS_09910 gene prfA 483434 482343 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748B1 protein_id gnl|my_center|LOCUS_09910 483507 483436 gene locus_tag LOCUS_t00200 483507 483436 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 483721 484152 gene locus_tag LOCUS_09920 483721 484152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 484849 484250 gene locus_tag LOCUS_09930 484849 484250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 485523 484960 gene locus_tag LOCUS_09940 485523 484960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688791.1 protein_id gnl|my_center|LOCUS_09940 486647 485520 gene locus_tag LOCUS_09950 486647 485520 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235370.1 protein_id gnl|my_center|LOCUS_09950 487465 486818 gene locus_tag LOCUS_09960 gene engB 487465 486818 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F9P7 protein_id gnl|my_center|LOCUS_09960 487568 488644 gene locus_tag LOCUS_09970 487568 488644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 490704 488674 gene locus_tag LOCUS_09980 gene asnB 490704 488674 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124141.1 protein_id gnl|my_center|LOCUS_09980 491590 490817 gene locus_tag LOCUS_09990 491590 490817 CDS product N-carbamoylsarcosine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333956.1 protein_id gnl|my_center|LOCUS_09990 492857 491616 gene locus_tag LOCUS_10000 gene amaB 492857 491616 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124142.1 protein_id gnl|my_center|LOCUS_10000 493039 492854 gene locus_tag LOCUS_10010 493039 492854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 494183 493077 gene locus_tag LOCUS_10020 gene pyrB 494183 493077 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329097.1 protein_id gnl|my_center|LOCUS_10020 496017 494596 gene locus_tag LOCUS_10030 gene dur3 496017 494596 CDS product urea transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124139.1 protein_id gnl|my_center|LOCUS_10030 496508 496014 gene locus_tag LOCUS_10040 496508 496014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 496953 496609 gene locus_tag LOCUS_10050 gene glnB 496953 496609 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073353.1 protein_id gnl|my_center|LOCUS_10050 498394 497342 gene locus_tag LOCUS_10060 498394 497342 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407635.1 protein_id gnl|my_center|LOCUS_10060 499294 498428 gene locus_tag LOCUS_10070 gene panC 499294 498428 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F394 protein_id gnl|my_center|LOCUS_10070 500242 499343 gene locus_tag LOCUS_10080 500242 499343 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403254.1 protein_id gnl|my_center|LOCUS_10080 500970 500239 gene locus_tag LOCUS_10090 500970 500239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 501526 501011 gene locus_tag LOCUS_10100 gene amsI 501526 501011 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228998.1 protein_id gnl|my_center|LOCUS_10100 502450 501593 gene locus_tag LOCUS_10110 gene trx 502450 501593 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037752.1 protein_id gnl|my_center|LOCUS_10110 502555 504552 gene locus_tag LOCUS_10120 502555 504552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 505282 504533 gene locus_tag LOCUS_10130 gene tpi 505282 504533 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I7EP62 protein_id gnl|my_center|LOCUS_10130 506234 505308 gene locus_tag LOCUS_10140 gene prmC 506234 505308 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9UQS4 protein_id gnl|my_center|LOCUS_10140 506347 508158 gene locus_tag LOCUS_10150 gene eriC 506347 508158 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002749.1 protein_id gnl|my_center|LOCUS_10150 508213 509118 gene locus_tag LOCUS_10160 508213 509118 CDS product fructosamine-3-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234629.1 protein_id gnl|my_center|LOCUS_10160 510774 509332 gene locus_tag LOCUS_10170 510774 509332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 511490 510774 gene locus_tag LOCUS_10180 gene ompR 511490 510774 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459027.1 protein_id gnl|my_center|LOCUS_10180 512024 511566 gene locus_tag LOCUS_10190 512024 511566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 512151 512927 gene locus_tag LOCUS_10200 512151 512927 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401743.1 protein_id gnl|my_center|LOCUS_10200 513656 512988 gene locus_tag LOCUS_10210 513656 512988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 514186 514593 gene locus_tag LOCUS_10220 514186 514593 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080643.1 protein_id gnl|my_center|LOCUS_10220 515126 514686 gene locus_tag LOCUS_10230 515126 514686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 516720 515326 gene locus_tag LOCUS_10240 516720 515326 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918539.1 protein_id gnl|my_center|LOCUS_10240 517194 516739 gene locus_tag LOCUS_10250 517194 516739 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125898.1 protein_id gnl|my_center|LOCUS_10250 517371 518729 gene locus_tag LOCUS_10260 517371 518729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 518782 519798 gene locus_tag LOCUS_10270 518782 519798 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403765.1 protein_id gnl|my_center|LOCUS_10270 519843 521366 gene locus_tag LOCUS_10280 gene dltB 519843 521366 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898533.1 protein_id gnl|my_center|LOCUS_10280 521491 522651 gene locus_tag LOCUS_10290 521491 522651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 523512 522667 gene locus_tag LOCUS_10300 gene sulII 523512 522667 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q935I3 protein_id gnl|my_center|LOCUS_10300 525539 523605 gene locus_tag LOCUS_10310 525539 523605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 525711 526466 gene locus_tag LOCUS_10320 525711 526466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 526463 527194 gene locus_tag LOCUS_10330 526463 527194 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487316.1 protein_id gnl|my_center|LOCUS_10330 527195 529240 gene locus_tag LOCUS_10340 527195 529240 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849195.1 protein_id gnl|my_center|LOCUS_10340 529237 530322 gene locus_tag LOCUS_10350 529237 530322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 530319 530855 gene locus_tag LOCUS_10360 530319 530855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 530988 531293 gene locus_tag LOCUS_10370 530988 531293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 531294 532277 gene locus_tag LOCUS_10380 gene pleD 531294 532277 CDS product diguanylate cyclase response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377275.1 protein_id gnl|my_center|LOCUS_10380 533428 532253 gene locus_tag LOCUS_10390 533428 532253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056995.1 protein_id gnl|my_center|LOCUS_10390 534734 533403 gene locus_tag LOCUS_10400 534734 533403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 536679 535150 gene locus_tag LOCUS_10410 536679 535150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 536834 537418 gene locus_tag LOCUS_10420 gene lipL21 536834 537418 CDS product LipL21 lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610519.1 protein_id gnl|my_center|LOCUS_10420 537514 537951 gene locus_tag LOCUS_10430 537514 537951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 538640 538020 gene locus_tag LOCUS_10440 538640 538020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 539217 538651 gene locus_tag LOCUS_10450 539217 538651 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870074.1 protein_id gnl|my_center|LOCUS_10450 539260 540504 gene locus_tag LOCUS_10460 539260 540504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 541218 540520 gene locus_tag LOCUS_10470 gene lolD 541218 540520 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F6L8 protein_id gnl|my_center|LOCUS_10470 542456 541218 gene locus_tag LOCUS_10480 gene lolE 542456 541218 CDS product lipoprotein releasing system permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264232.1 protein_id gnl|my_center|LOCUS_10480 543260 542460 gene locus_tag LOCUS_10490 543260 542460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100379.1 protein_id gnl|my_center|LOCUS_10490 544281 543307 gene locus_tag LOCUS_10500 544281 543307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 544319 544915 gene locus_tag LOCUS_10510 544319 544915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550955.1 protein_id gnl|my_center|LOCUS_10510 545133 545624 gene locus_tag LOCUS_10520 545133 545624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204785.1 protein_id gnl|my_center|LOCUS_10520 545634 546554 gene locus_tag LOCUS_10530 545634 546554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 546681 547532 gene locus_tag LOCUS_10540 546681 547532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 547525 548325 gene locus_tag LOCUS_10550 547525 548325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 548554 548880 gene locus_tag LOCUS_10560 548554 548880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 549885 549145 gene locus_tag LOCUS_10570 549885 549145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 551657 550137 gene locus_tag LOCUS_10580 551657 550137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 552544 551648 gene locus_tag LOCUS_10590 552544 551648 CDS product type 11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258363.1 protein_id gnl|my_center|LOCUS_10590 552915 552769 gene locus_tag LOCUS_10600 552915 552769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 554022 552952 gene locus_tag LOCUS_10610 554022 552952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 554611 554159 gene locus_tag LOCUS_10620 554611 554159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 555016 555255 gene locus_tag LOCUS_10630 555016 555255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786366.1 protein_id gnl|my_center|LOCUS_10630 556001 555336 gene locus_tag LOCUS_10640 556001 555336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 556229 557008 gene locus_tag LOCUS_10650 556229 557008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 557155 557793 gene locus_tag LOCUS_10660 557155 557793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 559585 557867 gene locus_tag LOCUS_10670 559585 557867 CDS product acetyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028579.1 protein_id gnl|my_center|LOCUS_10670 561100 559682 gene locus_tag LOCUS_10680 561100 559682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 561734 561339 gene locus_tag LOCUS_10690 561734 561339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 562983 561946 gene locus_tag LOCUS_10700 gene degQ 562983 561946 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798837.1 protein_id gnl|my_center|LOCUS_10700 563328 565724 gene locus_tag LOCUS_10710 gene lon 563328 565724 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q817Q4 protein_id gnl|my_center|LOCUS_10710 566082 567149 gene locus_tag LOCUS_10720 566082 567149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 568615 567506 gene locus_tag LOCUS_10730 568615 567506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825590.1 protein_id gnl|my_center|LOCUS_10730 568910 569809 gene locus_tag LOCUS_10740 568910 569809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127192.1 protein_id gnl|my_center|LOCUS_10740 569889 570716 gene locus_tag LOCUS_10750 gene truA 569889 570716 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P70973 protein_id gnl|my_center|LOCUS_10750 570795 571388 gene locus_tag LOCUS_10760 570795 571388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 571431 572693 gene locus_tag LOCUS_10770 571431 572693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464604.1 protein_id gnl|my_center|LOCUS_10770 574908 572923 gene locus_tag LOCUS_10780 574908 572923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 575687 577351 gene locus_tag LOCUS_10790 575687 577351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 578184 577399 gene locus_tag LOCUS_10800 578184 577399 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973653.1 protein_id gnl|my_center|LOCUS_10800 578857 578282 gene locus_tag LOCUS_10810 578857 578282 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107293.1 protein_id gnl|my_center|LOCUS_10810 578989 579909 gene locus_tag LOCUS_10820 578989 579909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 579928 580272 gene locus_tag LOCUS_10830 gene spoIIAA 579928 580272 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3G9 protein_id gnl|my_center|LOCUS_10830 580278 580712 gene locus_tag LOCUS_10840 580278 580712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 580712 583597 gene locus_tag LOCUS_10850 580712 583597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 583642 583797 gene locus_tag LOCUS_10860 583642 583797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 583787 584080 gene locus_tag LOCUS_10870 583787 584080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 585125 584292 gene locus_tag LOCUS_10880 585125 584292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 586015 585389 gene locus_tag LOCUS_10890 586015 585389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 587333 586131 gene locus_tag LOCUS_10900 587333 586131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 587469 588644 gene locus_tag LOCUS_10910 587469 588644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 588790 589110 gene locus_tag LOCUS_10920 588790 589110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 589889 589293 gene locus_tag LOCUS_10930 589889 589293 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379289.1 protein_id gnl|my_center|LOCUS_10930 590140 592785 gene locus_tag LOCUS_10940 gene gyrA 590140 592785 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CM44 protein_id gnl|my_center|LOCUS_10940 592962 593588 gene locus_tag LOCUS_10950 592962 593588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 593609 594274 gene locus_tag LOCUS_10960 593609 594274 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_10960 596624 594255 gene locus_tag LOCUS_10970 596624 594255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 597277 598260 gene locus_tag LOCUS_10980 597277 598260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 599182 598337 gene locus_tag LOCUS_10990 599182 598337 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256279.1 protein_id gnl|my_center|LOCUS_10990 599264 600565 gene locus_tag LOCUS_11000 gene murA 599264 600565 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYY3 protein_id gnl|my_center|LOCUS_11000 600930 601700 gene locus_tag LOCUS_11010 600930 601700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 601789 602295 gene locus_tag LOCUS_11020 601789 602295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 603060 602242 gene locus_tag LOCUS_11030 603060 602242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 603433 604197 gene locus_tag LOCUS_11040 603433 604197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 605304 604360 gene locus_tag LOCUS_11050 605304 604360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 605920 605402 gene locus_tag LOCUS_11060 605920 605402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 606898 605996 gene locus_tag LOCUS_11070 606898 605996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 607448 606909 gene locus_tag LOCUS_11080 gene lipL21 607448 606909 CDS product LipL21 lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610519.1 protein_id gnl|my_center|LOCUS_11080 607618 607692 gene locus_tag LOCUS_t00210 607618 607692 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 608253 608489 gene locus_tag LOCUS_11090 608253 608489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 >Feature sequence03 2314 290 gene locus_tag LOCUS_11100 2314 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 3943 2429 gene locus_tag LOCUS_11110 3943 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 4697 4296 gene locus_tag LOCUS_11120 4697 4296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 6117 4699 gene locus_tag LOCUS_11130 gene atpD 6117 4699 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F2J5 protein_id gnl|my_center|LOCUS_11130 7083 6160 gene locus_tag LOCUS_11140 gene atpG 7083 6160 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F2J4 protein_id gnl|my_center|LOCUS_11140 8672 7131 gene locus_tag LOCUS_11150 gene atpA 8672 7131 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F2J2 protein_id gnl|my_center|LOCUS_11150 9225 8662 gene locus_tag LOCUS_11160 gene atpH 9225 8662 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV21 protein_id gnl|my_center|LOCUS_11160 9844 9317 gene locus_tag LOCUS_11170 gene atpF 9844 9317 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F2J0 protein_id gnl|my_center|LOCUS_11170 10160 9873 gene locus_tag LOCUS_11180 gene atpE 10160 9873 CDS product ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394249.1 protein_id gnl|my_center|LOCUS_11180 11338 10241 gene locus_tag LOCUS_11190 gene atpB 11338 10241 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F2I8 protein_id gnl|my_center|LOCUS_11190 11988 11569 gene locus_tag LOCUS_11200 11988 11569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 12363 11995 gene locus_tag LOCUS_11210 12363 11995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 12511 12783 gene locus_tag LOCUS_11220 12511 12783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 13821 12724 gene locus_tag LOCUS_11230 gene lepB 13821 12724 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F2I3 protein_id gnl|my_center|LOCUS_11230 16448 13878 gene locus_tag LOCUS_11240 16448 13878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 16496 17233 gene locus_tag LOCUS_11250 16496 17233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 17333 17974 gene locus_tag LOCUS_11260 17333 17974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 18074 18436 gene locus_tag LOCUS_11270 18074 18436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 21395 18477 gene locus_tag LOCUS_11280 21395 18477 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103180.1 protein_id gnl|my_center|LOCUS_11280 21693 21484 gene locus_tag LOCUS_11290 21693 21484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 22146 22844 gene locus_tag LOCUS_11300 22146 22844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 22841 23206 gene locus_tag LOCUS_11310 22841 23206 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141564.1 protein_id gnl|my_center|LOCUS_11310 24768 23374 gene locus_tag LOCUS_11320 24768 23374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 25231 24803 gene locus_tag LOCUS_11330 25231 24803 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905438.1 protein_id gnl|my_center|LOCUS_11330 25616 25834 gene locus_tag LOCUS_11340 25616 25834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 28278 25978 gene locus_tag LOCUS_11350 28278 25978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 31158 28582 gene locus_tag LOCUS_11360 31158 28582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 31488 32291 gene locus_tag LOCUS_11370 31488 32291 CDS product putative dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704240.1 protein_id gnl|my_center|LOCUS_11370 32530 33432 gene locus_tag LOCUS_11380 32530 33432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 34276 33473 gene locus_tag LOCUS_11390 34276 33473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 35785 34478 gene locus_tag LOCUS_11400 gene cyaA 35785 34478 CDS product guanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449386.1 protein_id gnl|my_center|LOCUS_11400 35973 36287 gene locus_tag LOCUS_11410 35973 36287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 36566 36402 gene locus_tag LOCUS_11420 36566 36402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 36603 36971 gene locus_tag LOCUS_11430 36603 36971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 37349 38185 gene locus_tag LOCUS_11440 37349 38185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 39625 38297 gene locus_tag LOCUS_11450 39625 38297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 39986 39630 gene locus_tag LOCUS_11460 gene cheY 39986 39630 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008142319.1 protein_id gnl|my_center|LOCUS_11460 40851 39991 gene locus_tag LOCUS_11470 gene cheR1 40851 39991 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89XC4 protein_id gnl|my_center|LOCUS_11470 41894 40839 gene locus_tag LOCUS_11480 gene cheB 41894 40839 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q05522 protein_id gnl|my_center|LOCUS_11480 43908 41938 gene locus_tag LOCUS_11490 43908 41938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 44448 44008 gene locus_tag LOCUS_11500 gene cheW 44448 44008 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200285.1 protein_id gnl|my_center|LOCUS_11500 47054 44445 gene locus_tag LOCUS_11510 47054 44445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 47359 47057 gene locus_tag LOCUS_11520 47359 47057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 48248 47568 gene locus_tag LOCUS_11530 48248 47568 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 protein_id gnl|my_center|LOCUS_11530 48925 48698 gene locus_tag LOCUS_11540 48925 48698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 50263 48926 gene locus_tag LOCUS_11550 50263 48926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 50724 51164 gene locus_tag LOCUS_11560 50724 51164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 51151 51399 gene locus_tag LOCUS_11570 51151 51399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 53249 52779 gene locus_tag LOCUS_11580 53249 52779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 54006 53251 gene locus_tag LOCUS_11590 54006 53251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 54908 54357 gene locus_tag LOCUS_11600 54908 54357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 55012 55776 gene locus_tag LOCUS_11610 55012 55776 CDS product electron transporter SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258006.1 protein_id gnl|my_center|LOCUS_11610 55878 56891 gene locus_tag LOCUS_11620 gene ctaC 55878 56891 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UI92 protein_id gnl|my_center|LOCUS_11620 57002 58636 gene locus_tag LOCUS_11630 gene cyoB 57002 58636 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F9F2 protein_id gnl|my_center|LOCUS_11630 58837 59529 gene locus_tag LOCUS_11640 58837 59529 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404826.1 protein_id gnl|my_center|LOCUS_11640 59578 59955 gene locus_tag LOCUS_11650 59578 59955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 60419 61333 gene locus_tag LOCUS_11660 60419 61333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118999.1 protein_id gnl|my_center|LOCUS_11660 61400 63523 gene locus_tag LOCUS_11670 61400 63523 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228905.1 protein_id gnl|my_center|LOCUS_11670 63822 65513 gene locus_tag LOCUS_11680 63822 65513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 66744 65623 gene locus_tag LOCUS_11690 66744 65623 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600562.1 protein_id gnl|my_center|LOCUS_11690 67736 66741 gene locus_tag LOCUS_11700 gene rbsK 67736 66741 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683574.1 protein_id gnl|my_center|LOCUS_11700 68011 69975 gene locus_tag LOCUS_11710 68011 69975 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487747.1 protein_id gnl|my_center|LOCUS_11710 70112 71329 gene locus_tag LOCUS_11720 70112 71329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 71326 71850 gene locus_tag LOCUS_11730 71326 71850 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033731.1 protein_id gnl|my_center|LOCUS_11730 71873 72769 gene locus_tag LOCUS_11740 71873 72769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 72750 73592 gene locus_tag LOCUS_11750 72750 73592 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYD1 protein_id gnl|my_center|LOCUS_11750 73737 74609 gene locus_tag LOCUS_11760 73737 74609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 74636 75454 gene locus_tag LOCUS_11770 gene panB 74636 75454 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZ98 protein_id gnl|my_center|LOCUS_11770 75679 75500 gene locus_tag LOCUS_11780 75679 75500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 75794 76255 gene locus_tag LOCUS_11790 75794 76255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 76753 76280 gene locus_tag LOCUS_11800 76753 76280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 78017 76902 gene locus_tag LOCUS_11810 gene flgI 78017 76902 CDS product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F2V3 protein_id gnl|my_center|LOCUS_11810 78760 78014 gene locus_tag LOCUS_11820 78760 78014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 79817 78750 gene locus_tag LOCUS_11830 79817 78750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 80723 79926 gene locus_tag LOCUS_11840 gene flgG 80723 79926 CDS product flagellar basal body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257272.1 protein_id gnl|my_center|LOCUS_11840 82427 81102 gene locus_tag LOCUS_11850 82427 81102 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100874.1 protein_id gnl|my_center|LOCUS_11850 82670 82891 gene locus_tag LOCUS_11860 gene fer 82670 82891 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201605.1 protein_id gnl|my_center|LOCUS_11860 83281 84129 gene locus_tag LOCUS_11870 83281 84129 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3I5 protein_id gnl|my_center|LOCUS_11870 85417 84134 gene locus_tag LOCUS_11880 85417 84134 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HZD9 protein_id gnl|my_center|LOCUS_11880 85660 87780 gene locus_tag LOCUS_11890 85660 87780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 87806 88192 gene locus_tag LOCUS_11900 87806 88192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 89285 88269 gene locus_tag LOCUS_11910 89285 88269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 89415 90476 gene locus_tag LOCUS_11920 89415 90476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 90654 91190 gene locus_tag LOCUS_11930 90654 91190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 94224 91222 gene locus_tag LOCUS_11940 gene uvrA 94224 91222 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F435 protein_id gnl|my_center|LOCUS_11940 94317 95405 gene locus_tag LOCUS_11950 94317 95405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963223.1 protein_id gnl|my_center|LOCUS_11950 95562 96674 gene locus_tag LOCUS_11960 95562 96674 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963224.1 protein_id gnl|my_center|LOCUS_11960 99433 96806 gene locus_tag LOCUS_11970 99433 96806 CDS product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464922.1 protein_id gnl|my_center|LOCUS_11970 99638 99844 gene locus_tag LOCUS_11980 99638 99844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 100992 99841 gene locus_tag LOCUS_11990 gene apbA 100992 99841 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F083 protein_id gnl|my_center|LOCUS_11990 102192 101086 gene locus_tag LOCUS_12000 102192 101086 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957890.1 protein_id gnl|my_center|LOCUS_12000 103065 102349 gene locus_tag LOCUS_12010 103065 102349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 103090 103317 gene locus_tag LOCUS_12020 103090 103317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 103700 104467 gene locus_tag LOCUS_12030 103700 104467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 104498 106369 gene locus_tag LOCUS_12040 104498 106369 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927003.1 protein_id gnl|my_center|LOCUS_12040 107608 106550 gene locus_tag LOCUS_12050 107608 106550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702854.1 protein_id gnl|my_center|LOCUS_12050 109132 107612 gene locus_tag LOCUS_12060 109132 107612 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DKK9 protein_id gnl|my_center|LOCUS_12060 110747 109164 gene locus_tag LOCUS_12070 gene mviN 110747 109164 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F5E7 protein_id gnl|my_center|LOCUS_12070 111772 110744 gene locus_tag LOCUS_12080 111772 110744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 112803 111769 gene locus_tag LOCUS_12090 112803 111769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 112943 113908 gene locus_tag LOCUS_12100 gene hisZ 112943 113908 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGV6 protein_id gnl|my_center|LOCUS_12100 113970 115232 gene locus_tag LOCUS_12110 gene purA 113970 115232 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F738 protein_id gnl|my_center|LOCUS_12110 115703 115329 gene locus_tag LOCUS_12120 115703 115329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993823.1 protein_id gnl|my_center|LOCUS_12120 116250 115765 gene locus_tag LOCUS_12130 116250 115765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939462.1 protein_id gnl|my_center|LOCUS_12130 117134 116667 gene locus_tag LOCUS_12140 gene marR 117134 116667 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536657.1 protein_id gnl|my_center|LOCUS_12140 117315 118136 gene locus_tag LOCUS_12150 117315 118136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 119845 118268 gene locus_tag LOCUS_12160 119845 118268 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455081.1 protein_id gnl|my_center|LOCUS_12160 121554 119857 gene locus_tag LOCUS_12170 121554 119857 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405033.1 protein_id gnl|my_center|LOCUS_12170 121716 122921 gene locus_tag LOCUS_12180 121716 122921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088279.1 protein_id gnl|my_center|LOCUS_12180 123563 122952 gene locus_tag LOCUS_12190 123563 122952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 123677 124246 gene locus_tag LOCUS_12200 123677 124246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 124782 124297 gene locus_tag LOCUS_12210 gene ilvH 124782 124297 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680556.1 protein_id gnl|my_center|LOCUS_12210 124866 126953 gene locus_tag LOCUS_12220 124866 126953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 126988 127992 gene locus_tag LOCUS_12230 126988 127992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 128047 129396 gene locus_tag LOCUS_12240 gene nqrA 128047 129396 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS5 protein_id gnl|my_center|LOCUS_12240 129423 130658 gene locus_tag LOCUS_12250 gene nqrB 129423 130658 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS4 protein_id gnl|my_center|LOCUS_12250 130642 131502 gene locus_tag LOCUS_12260 gene nqrC 130642 131502 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C6E0 protein_id gnl|my_center|LOCUS_12260 131499 132179 gene locus_tag LOCUS_12270 gene nqrD 131499 132179 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR8 protein_id gnl|my_center|LOCUS_12270 132189 132797 gene locus_tag LOCUS_12280 gene nqrE 132189 132797 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL0 protein_id gnl|my_center|LOCUS_12280 132816 134048 gene locus_tag LOCUS_12290 gene nqrF 132816 134048 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS0 protein_id gnl|my_center|LOCUS_12290 134226 135497 gene locus_tag LOCUS_12300 134226 135497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 135928 135728 gene locus_tag LOCUS_12310 135928 135728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 139197 136159 gene locus_tag LOCUS_12320 139197 136159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 139232 141394 gene locus_tag LOCUS_12330 139232 141394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 141422 141835 gene locus_tag LOCUS_12340 141422 141835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 142044 142472 gene locus_tag LOCUS_12350 142044 142472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 142520 143152 gene locus_tag LOCUS_12360 gene pgsA 142520 143152 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636905.1 protein_id gnl|my_center|LOCUS_12360 143410 144534 gene locus_tag LOCUS_12370 gene recA 143410 144534 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52277 protein_id gnl|my_center|LOCUS_12370 144531 145568 gene locus_tag LOCUS_12380 gene argC 144531 145568 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59307 protein_id gnl|my_center|LOCUS_12380 146317 145634 gene locus_tag LOCUS_12390 146317 145634 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985723.1 protein_id gnl|my_center|LOCUS_12390 148090 146399 gene locus_tag LOCUS_12400 gene trkG 148090 146399 CDS product portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084504.1 protein_id gnl|my_center|LOCUS_12400 148311 150482 gene locus_tag LOCUS_12410 gene spoT 148311 150482 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508136.1 protein_id gnl|my_center|LOCUS_12410 152404 150719 gene locus_tag LOCUS_12420 152404 150719 CDS product polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626057.1 protein_id gnl|my_center|LOCUS_12420 153820 152438 gene locus_tag LOCUS_12430 gene aroA 153820 152438 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QX9 protein_id gnl|my_center|LOCUS_12430 153850 154350 gene locus_tag LOCUS_12440 153850 154350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 155272 154301 gene locus_tag LOCUS_12450 gene hemB 155272 154301 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLQ6 protein_id gnl|my_center|LOCUS_12450 156158 155448 gene locus_tag LOCUS_12460 156158 155448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 158242 156341 gene locus_tag LOCUS_12470 158242 156341 CDS product acetoacetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113499.1 protein_id gnl|my_center|LOCUS_12470 158350 158559 gene locus_tag LOCUS_12480 158350 158559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 160299 158488 gene locus_tag LOCUS_12490 160299 158488 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069732.1 protein_id gnl|my_center|LOCUS_12490 161245 160379 gene locus_tag LOCUS_12500 161245 160379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898918.1 protein_id gnl|my_center|LOCUS_12500 161397 165017 gene locus_tag LOCUS_12510 161397 165017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 165977 165117 gene locus_tag LOCUS_12520 gene wecG 165977 165117 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742874.1 protein_id gnl|my_center|LOCUS_12520 166978 166214 gene locus_tag LOCUS_12530 166978 166214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 167160 166975 gene locus_tag LOCUS_12540 167160 166975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 167272 168069 gene locus_tag LOCUS_12550 gene tolQ 167272 168069 CDS product biopolymer transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668013.1 protein_id gnl|my_center|LOCUS_12550 168069 168476 gene locus_tag LOCUS_12560 168069 168476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 168550 168972 gene locus_tag LOCUS_12570 gene exbD 168550 168972 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053705.1 protein_id gnl|my_center|LOCUS_12570 169037 169603 gene locus_tag LOCUS_12580 169037 169603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 169606 171300 gene locus_tag LOCUS_12590 169606 171300 CDS product ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004000.1 protein_id gnl|my_center|LOCUS_12590 172112 171330 gene locus_tag LOCUS_12600 172112 171330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 174103 172139 gene locus_tag LOCUS_12610 174103 172139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070604.1 protein_id gnl|my_center|LOCUS_12610 174311 175531 gene locus_tag LOCUS_12620 174311 175531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 175534 176676 gene locus_tag LOCUS_12630 gene nifS 175534 176676 CDS product cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037901.1 protein_id gnl|my_center|LOCUS_12630 177501 176767 gene locus_tag LOCUS_12640 177501 176767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 181317 177610 gene locus_tag LOCUS_12650 gene mfd 181317 177610 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F395 protein_id gnl|my_center|LOCUS_12650 182018 181323 gene locus_tag LOCUS_12660 182018 181323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 182542 184209 gene locus_tag LOCUS_12670 182542 184209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488504.1 protein_id gnl|my_center|LOCUS_12670 184332 184838 gene locus_tag LOCUS_12680 184332 184838 CDS product ketosteroid isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103491.1 protein_id gnl|my_center|LOCUS_12680 185168 184866 gene locus_tag LOCUS_12690 185168 184866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 185416 185691 gene locus_tag LOCUS_12700 185416 185691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 185876 186103 gene locus_tag LOCUS_12710 185876 186103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 186360 186109 gene locus_tag LOCUS_12720 186360 186109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 186532 186753 gene locus_tag LOCUS_12730 186532 186753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 188414 186657 gene locus_tag LOCUS_12740 188414 186657 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083824.1 protein_id gnl|my_center|LOCUS_12740 188646 189572 gene locus_tag LOCUS_12750 188646 189572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 192017 191169 gene locus_tag LOCUS_12760 192017 191169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 192170 192030 gene locus_tag LOCUS_12770 192170 192030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 192268 192480 gene locus_tag LOCUS_12780 192268 192480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 192477 192734 gene locus_tag LOCUS_12790 192477 192734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 194062 193049 gene locus_tag LOCUS_12800 194062 193049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 194447 194085 gene locus_tag LOCUS_12810 194447 194085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 196749 194749 gene locus_tag LOCUS_12820 196749 194749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 197024 197743 gene locus_tag LOCUS_12830 197024 197743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 197925 198713 gene locus_tag LOCUS_12840 197925 198713 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_12840 198758 199912 gene locus_tag LOCUS_12850 gene mtfA 198758 199912 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122447.1 protein_id gnl|my_center|LOCUS_12850 199955 201889 gene locus_tag LOCUS_12860 199955 201889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 201886 203355 gene locus_tag LOCUS_12870 201886 203355 CDS product NmrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485467.1 protein_id gnl|my_center|LOCUS_12870 204105 203464 gene locus_tag LOCUS_12880 204105 203464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 205444 204458 gene locus_tag LOCUS_12890 gene citE 205444 204458 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041092.1 protein_id gnl|my_center|LOCUS_12890 207585 205636 gene locus_tag LOCUS_12900 207585 205636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675225.1 protein_id gnl|my_center|LOCUS_12900 208169 207792 gene locus_tag LOCUS_12910 208169 207792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 209048 208404 gene locus_tag LOCUS_12920 209048 208404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 209698 209075 gene locus_tag LOCUS_12930 209698 209075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 210016 209738 gene locus_tag LOCUS_12940 gene hisE 210016 209738 CDS product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EXX8 protein_id gnl|my_center|LOCUS_12940 210894 210130 gene locus_tag LOCUS_12950 gene hisF 210894 210130 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59119 protein_id gnl|my_center|LOCUS_12950 212195 211140 gene locus_tag LOCUS_12960 212195 211140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 212548 215271 gene locus_tag LOCUS_12970 212548 215271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 215271 216947 gene locus_tag LOCUS_12980 215271 216947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 216963 218777 gene locus_tag LOCUS_12990 216963 218777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 218777 219961 gene locus_tag LOCUS_13000 218777 219961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 220006 220614 gene locus_tag LOCUS_13010 gene coaE 220006 220614 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RT73 protein_id gnl|my_center|LOCUS_13010 220611 221381 gene locus_tag LOCUS_13020 220611 221381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 221442 222089 gene locus_tag LOCUS_13030 221442 222089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372768.1 protein_id gnl|my_center|LOCUS_13030 222120 224387 gene locus_tag LOCUS_13040 gene ppk 222120 224387 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F0N2 protein_id gnl|my_center|LOCUS_13040 224976 224647 gene locus_tag LOCUS_13050 224976 224647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 226192 225299 gene locus_tag LOCUS_13060 226192 225299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 227056 226511 gene locus_tag LOCUS_13070 227056 226511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 227182 227952 gene locus_tag LOCUS_13080 227182 227952 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404709.1 protein_id gnl|my_center|LOCUS_13080 229003 227918 gene locus_tag LOCUS_13090 229003 227918 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056913.1 protein_id gnl|my_center|LOCUS_13090 230406 229003 gene locus_tag LOCUS_13100 230406 229003 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 protein_id gnl|my_center|LOCUS_13100 233798 230403 gene locus_tag LOCUS_13110 233798 230403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 235241 233829 gene locus_tag LOCUS_13120 235241 233829 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_13120 235638 238409 gene locus_tag LOCUS_13130 235638 238409 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F0W3 protein_id gnl|my_center|LOCUS_13130 238605 239027 gene locus_tag LOCUS_13140 238605 239027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 239188 240186 gene locus_tag LOCUS_13150 239188 240186 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688696.1 protein_id gnl|my_center|LOCUS_13150 241214 240285 gene locus_tag LOCUS_13160 241214 240285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 241779 241198 gene locus_tag LOCUS_13170 gene rpoE 241779 241198 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F6U5 protein_id gnl|my_center|LOCUS_13170 242503 241781 gene locus_tag LOCUS_13180 242503 241781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 242766 244094 gene locus_tag LOCUS_13190 242766 244094 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454161.1 protein_id gnl|my_center|LOCUS_13190 244787 244233 gene locus_tag LOCUS_13200 244787 244233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 244923 246110 gene locus_tag LOCUS_13210 244923 246110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120868.1 protein_id gnl|my_center|LOCUS_13210 246211 246537 gene locus_tag LOCUS_13220 246211 246537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093963.1 protein_id gnl|my_center|LOCUS_13220 247775 246771 gene locus_tag LOCUS_13230 247775 246771 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F0E1 protein_id gnl|my_center|LOCUS_13230 249217 248177 gene locus_tag LOCUS_13240 249217 248177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 251475 249625 gene locus_tag LOCUS_13250 gene ilvD-2 251475 249625 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_274214.1 protein_id gnl|my_center|LOCUS_13250 252021 252275 gene locus_tag LOCUS_13260 252021 252275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 253261 252380 gene locus_tag LOCUS_13270 253261 252380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 253440 253661 gene locus_tag LOCUS_13280 253440 253661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 254913 255068 gene locus_tag LOCUS_13290 254913 255068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 255437 255114 gene locus_tag LOCUS_13300 255437 255114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 255689 256123 gene locus_tag LOCUS_13310 255689 256123 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968167.1 protein_id gnl|my_center|LOCUS_13310 256837 256160 gene locus_tag LOCUS_13320 256837 256160 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_13320 257194 258411 gene locus_tag LOCUS_13330 257194 258411 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259711.1 protein_id gnl|my_center|LOCUS_13330 259825 258455 gene locus_tag LOCUS_13340 259825 258455 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526748.1 protein_id gnl|my_center|LOCUS_13340 260120 260275 gene locus_tag LOCUS_13350 260120 260275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 260269 261408 gene locus_tag LOCUS_13360 260269 261408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118452.1 protein_id gnl|my_center|LOCUS_13360 261472 262380 gene locus_tag LOCUS_13370 261472 262380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 265505 262563 gene locus_tag LOCUS_13380 265505 262563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 266381 267145 gene locus_tag LOCUS_13390 266381 267145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 267353 267637 gene locus_tag LOCUS_13400 gene groS 267353 267637 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61437 protein_id gnl|my_center|LOCUS_13400 267660 269345 gene locus_tag LOCUS_13410 gene groL 267660 269345 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61439 protein_id gnl|my_center|LOCUS_13410 270979 270014 gene locus_tag LOCUS_13420 270979 270014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 271505 271059 gene locus_tag LOCUS_13430 271505 271059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 271843 272904 gene locus_tag LOCUS_13440 gene gcvT 271843 272904 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F935 protein_id gnl|my_center|LOCUS_13440 272966 273355 gene locus_tag LOCUS_13450 gene gcvH 272966 273355 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RH47 protein_id gnl|my_center|LOCUS_13450 274021 273767 gene locus_tag LOCUS_13460 274021 273767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 274074 275399 gene locus_tag LOCUS_13470 gene gcvPA 274074 275399 CDS product putative glycine dehydrogenase (decarboxylating) subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2E7 protein_id gnl|my_center|LOCUS_13470 275441 276967 gene locus_tag LOCUS_13480 gene gcvPB 275441 276967 CDS product putative glycine dehydrogenase (decarboxylating) subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RH49 protein_id gnl|my_center|LOCUS_13480 276994 277275 gene locus_tag LOCUS_13490 276994 277275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454661.1 protein_id gnl|my_center|LOCUS_13490 277277 277705 gene locus_tag LOCUS_13500 277277 277705 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942658.1 protein_id gnl|my_center|LOCUS_13500 278818 277889 gene locus_tag LOCUS_13510 278818 277889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132138.1 protein_id gnl|my_center|LOCUS_13510 278948 279961 gene locus_tag LOCUS_13520 278948 279961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 279963 280925 gene locus_tag LOCUS_13530 279963 280925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 281043 282035 gene locus_tag LOCUS_13540 gene xerC 281043 282035 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ZAM8 protein_id gnl|my_center|LOCUS_13540 282306 282467 gene locus_tag LOCUS_13550 282306 282467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288293.1 protein_id gnl|my_center|LOCUS_13550 282990 282640 gene locus_tag LOCUS_13560 282990 282640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 283271 283083 gene locus_tag LOCUS_13570 283271 283083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 284591 283320 gene locus_tag LOCUS_13580 284591 283320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 285125 284616 gene locus_tag LOCUS_13590 gene aroQ 285125 284616 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGI2 protein_id gnl|my_center|LOCUS_13590 286308 285172 gene locus_tag LOCUS_13600 gene aroB 286308 285172 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EXX1 protein_id gnl|my_center|LOCUS_13600 287288 286563 gene locus_tag LOCUS_13610 gene rnc 287288 286563 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73NX5 protein_id gnl|my_center|LOCUS_13610 287712 287476 gene locus_tag LOCUS_13620 gene acpP 287712 287476 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EXX4 protein_id gnl|my_center|LOCUS_13620 288587 287835 gene locus_tag LOCUS_13630 288587 287835 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566240.1 protein_id gnl|my_center|LOCUS_13630 288798 288580 gene locus_tag LOCUS_13640 288798 288580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 288891 291584 gene locus_tag LOCUS_13650 288891 291584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 291565 293601 gene locus_tag LOCUS_13660 291565 293601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 293604 294944 gene locus_tag LOCUS_13670 293604 294944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 295720 295280 gene locus_tag LOCUS_13680 295720 295280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206964.1 protein_id gnl|my_center|LOCUS_13680 297012 295921 gene locus_tag LOCUS_13690 297012 295921 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981084.1 protein_id gnl|my_center|LOCUS_13690 297513 297106 gene locus_tag LOCUS_13700 297513 297106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 298609 297605 gene locus_tag LOCUS_13710 gene plsX 298609 297605 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F6N9 protein_id gnl|my_center|LOCUS_13710 299127 300164 gene locus_tag LOCUS_13720 gene pheS 299127 300164 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYR3 protein_id gnl|my_center|LOCUS_13720 300411 303095 gene locus_tag LOCUS_13730 300411 303095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 303160 304080 gene locus_tag LOCUS_13740 303160 304080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189178.1 protein_id gnl|my_center|LOCUS_13740 304092 304361 gene locus_tag LOCUS_13750 304092 304361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 304351 304881 gene locus_tag LOCUS_13760 304351 304881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 304979 305356 gene locus_tag LOCUS_13770 304979 305356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 305535 307466 gene locus_tag LOCUS_13780 305535 307466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 308668 307676 gene locus_tag LOCUS_13790 308668 307676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 309834 308905 gene locus_tag LOCUS_13800 309834 308905 CDS product stomatin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404954.1 protein_id gnl|my_center|LOCUS_13800 310794 309856 gene locus_tag LOCUS_13810 gene hflC 310794 309856 CDS product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272390.1 protein_id gnl|my_center|LOCUS_13810 311257 310796 gene locus_tag LOCUS_13820 311257 310796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671223.1 protein_id gnl|my_center|LOCUS_13820 312666 311260 gene locus_tag LOCUS_13830 312666 311260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 314036 312816 gene locus_tag LOCUS_13840 gene ftsA 314036 312816 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F8E6 protein_id gnl|my_center|LOCUS_13840 314773 314033 gene locus_tag LOCUS_13850 314773 314033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 316448 314934 gene locus_tag LOCUS_13860 gene murC 316448 314934 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4J0 protein_id gnl|my_center|LOCUS_13860 316568 317272 gene locus_tag LOCUS_13870 316568 317272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472806.1 protein_id gnl|my_center|LOCUS_13870 318459 317311 gene locus_tag LOCUS_13880 gene murG 318459 317311 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WY5 protein_id gnl|my_center|LOCUS_13880 319929 318466 gene locus_tag LOCUS_13890 319929 318466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 321275 319926 gene locus_tag LOCUS_13900 gene murD 321275 319926 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3Y2H7 protein_id gnl|my_center|LOCUS_13900 322387 321278 gene locus_tag LOCUS_13910 gene mraY 322387 321278 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4J3 protein_id gnl|my_center|LOCUS_13910 324320 322380 gene locus_tag LOCUS_13920 324320 322380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 325801 324317 gene locus_tag LOCUS_13930 gene murE 325801 324317 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4J4 protein_id gnl|my_center|LOCUS_13930 326412 325798 gene locus_tag LOCUS_13940 326412 325798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 327478 326402 gene locus_tag LOCUS_13950 gene rsmH 327478 326402 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P62477 protein_id gnl|my_center|LOCUS_13950 329105 327486 gene locus_tag LOCUS_13960 329105 327486 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001111376.1 protein_id gnl|my_center|LOCUS_13960 331010 329316 gene locus_tag LOCUS_13970 331010 329316 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230747.1 protein_id gnl|my_center|LOCUS_13970 331456 336852 gene locus_tag LOCUS_13980 331456 336852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 336830 339325 gene locus_tag LOCUS_13990 336830 339325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 339322 340863 gene locus_tag LOCUS_14000 339322 340863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055448.1 protein_id gnl|my_center|LOCUS_14000 340902 341846 gene locus_tag LOCUS_14010 340902 341846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 341846 342622 gene locus_tag LOCUS_14020 341846 342622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 343346 342636 gene locus_tag LOCUS_14030 gene citB 343346 342636 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805069.1 protein_id gnl|my_center|LOCUS_14030 344386 343343 gene locus_tag LOCUS_14040 344386 343343 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153181.1 protein_id gnl|my_center|LOCUS_14040 345699 344446 gene locus_tag LOCUS_14050 345699 344446 CDS product LruC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218040.1 protein_id gnl|my_center|LOCUS_14050 346624 345845 gene locus_tag LOCUS_14060 346624 345845 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083961.1 protein_id gnl|my_center|LOCUS_14060 348537 346669 gene locus_tag LOCUS_14070 348537 346669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P41395 protein_id gnl|my_center|LOCUS_14070 349741 348578 gene locus_tag LOCUS_14080 349741 348578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 350190 349738 gene locus_tag LOCUS_14090 350190 349738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 350588 350187 gene locus_tag LOCUS_14100 350588 350187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 350807 351856 gene locus_tag LOCUS_14110 350807 351856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 352073 352372 gene locus_tag LOCUS_14120 352073 352372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 352669 355458 gene locus_tag LOCUS_14130 gene sucA 352669 355458 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F6S7 protein_id gnl|my_center|LOCUS_14130 355461 356762 gene locus_tag LOCUS_14140 gene aceF 355461 356762 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F6S9 protein_id gnl|my_center|LOCUS_14140 356778 358187 gene locus_tag LOCUS_14150 gene lpd 356778 358187 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F6S8 protein_id gnl|my_center|LOCUS_14150 358403 358849 gene locus_tag LOCUS_14160 358403 358849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973407.1 protein_id gnl|my_center|LOCUS_14160 359613 358810 gene locus_tag LOCUS_14170 359613 358810 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND55 protein_id gnl|my_center|LOCUS_14170 359659 359744 gene locus_tag LOCUS_t00220 359659 359744 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 359924 359751 gene locus_tag LOCUS_14180 359924 359751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 361118 360027 gene locus_tag LOCUS_14190 361118 360027 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623742.1 protein_id gnl|my_center|LOCUS_14190 361367 361439 gene locus_tag LOCUS_t00230 361367 361439 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 361477 361553 gene locus_tag LOCUS_t00240 361477 361553 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 361694 362557 gene locus_tag LOCUS_14200 361694 362557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 362702 363934 gene locus_tag LOCUS_14210 362702 363934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 365945 364107 gene locus_tag LOCUS_14220 365945 364107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 366048 366617 gene locus_tag LOCUS_14230 366048 366617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 368477 366774 gene locus_tag LOCUS_14240 gene kefB 368477 366774 CDS product potassium transporter Kef inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399950.1 protein_id gnl|my_center|LOCUS_14240 368714 368502 gene locus_tag LOCUS_14250 368714 368502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 369329 368748 gene locus_tag LOCUS_14260 gene ppa 369329 368748 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S122 protein_id gnl|my_center|LOCUS_14260 370451 369522 gene locus_tag LOCUS_14270 gene fliH 370451 369522 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096786.1 protein_id gnl|my_center|LOCUS_14270 370632 371426 gene locus_tag LOCUS_14280 gene caiD 370632 371426 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001943.1 protein_id gnl|my_center|LOCUS_14280 371428 371949 gene locus_tag LOCUS_14290 gene dcd 371428 371949 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F9W5 protein_id gnl|my_center|LOCUS_14290 371989 372399 gene locus_tag LOCUS_14300 371989 372399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 372561 373082 gene locus_tag LOCUS_14310 372561 373082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 373113 373817 gene locus_tag LOCUS_14320 373113 373817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667222.1 protein_id gnl|my_center|LOCUS_14320 373814 375376 gene locus_tag LOCUS_14330 373814 375376 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067929.1 protein_id gnl|my_center|LOCUS_14330 375412 375630 gene locus_tag LOCUS_14340 375412 375630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622506.1 protein_id gnl|my_center|LOCUS_14340 375714 376079 gene locus_tag LOCUS_14350 375714 376079 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039429.1 protein_id gnl|my_center|LOCUS_14350 377432 376194 gene locus_tag LOCUS_14360 377432 376194 CDS product mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225795.1 protein_id gnl|my_center|LOCUS_14360 377711 377463 gene locus_tag LOCUS_14370 377711 377463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 378840 377989 gene locus_tag LOCUS_14380 gene cysQ 378840 377989 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084702.1 protein_id gnl|my_center|LOCUS_14380 379284 378859 gene locus_tag LOCUS_14390 379284 378859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 381735 379552 gene locus_tag LOCUS_14400 gene uvrD 381735 379552 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3T3 protein_id gnl|my_center|LOCUS_14400 383359 381821 gene locus_tag LOCUS_14410 383359 381821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 384338 383352 gene locus_tag LOCUS_14420 gene secF 384338 383352 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F705 protein_id gnl|my_center|LOCUS_14420 386248 384335 gene locus_tag LOCUS_14430 gene secD 386248 384335 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F706 protein_id gnl|my_center|LOCUS_14430 386649 386257 gene locus_tag LOCUS_14440 386649 386257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 387112 386663 gene locus_tag LOCUS_14450 387112 386663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 388196 387153 gene locus_tag LOCUS_14460 388196 387153 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774558.1 protein_id gnl|my_center|LOCUS_14460 388945 388217 gene locus_tag LOCUS_14470 gene pgsA 388945 388217 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045091.1 protein_id gnl|my_center|LOCUS_14470 390237 388942 gene locus_tag LOCUS_14480 gene rimO 390237 388942 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F710 protein_id gnl|my_center|LOCUS_14480 391386 390301 gene locus_tag LOCUS_14490 391386 390301 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072287.1 protein_id gnl|my_center|LOCUS_14490 392113 391433 gene locus_tag LOCUS_14500 392113 391433 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196651.1 protein_id gnl|my_center|LOCUS_14500 395359 392156 gene locus_tag LOCUS_14510 395359 392156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 395988 395533 gene locus_tag LOCUS_14520 gene dut 395988 395533 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UFD9 protein_id gnl|my_center|LOCUS_14520 398320 396077 gene locus_tag LOCUS_14530 gene pnp 398320 396077 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7J8 protein_id gnl|my_center|LOCUS_14530 398617 398351 gene locus_tag LOCUS_14540 gene rpsO 398617 398351 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMR7 protein_id gnl|my_center|LOCUS_14540 399691 398726 gene locus_tag LOCUS_14550 399691 398726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 399998 399657 gene locus_tag LOCUS_14560 gene rbfA 399998 399657 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q819Y8 protein_id gnl|my_center|LOCUS_14560 402507 400030 gene locus_tag LOCUS_14570 402507 400030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 403890 402523 gene locus_tag LOCUS_14580 gene nusA 403890 402523 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7K2 protein_id gnl|my_center|LOCUS_14580 404423 403893 gene locus_tag LOCUS_14590 gene rimP 404423 403893 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7K3 protein_id gnl|my_center|LOCUS_14590 404701 405726 gene locus_tag LOCUS_14600 404701 405726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 405713 407326 gene locus_tag LOCUS_14610 405713 407326 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817435.1 protein_id gnl|my_center|LOCUS_14610 407323 407874 gene locus_tag LOCUS_14620 407323 407874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 408064 409473 gene locus_tag LOCUS_14630 408064 409473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 410459 409554 gene locus_tag LOCUS_14640 410459 409554 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878750.1 protein_id gnl|my_center|LOCUS_14640 411964 410456 gene locus_tag LOCUS_14650 411964 410456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 412824 411961 gene locus_tag LOCUS_14660 412824 411961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517125.1 protein_id gnl|my_center|LOCUS_14660 414165 413227 gene locus_tag LOCUS_14670 414165 413227 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272439.1 protein_id gnl|my_center|LOCUS_14670 414306 415295 gene locus_tag LOCUS_14680 414306 415295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 416875 415325 gene locus_tag LOCUS_14690 416875 415325 CDS product channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291493.1 protein_id gnl|my_center|LOCUS_14690 417294 417761 gene locus_tag LOCUS_14700 417294 417761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 417960 419594 gene locus_tag LOCUS_14710 417960 419594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 419642 423007 gene locus_tag LOCUS_14720 gene icmF 419642 423007 CDS product Fused isobutyryl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F222 protein_id gnl|my_center|LOCUS_14720 423023 423745 gene locus_tag LOCUS_14730 423023 423745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120331.1 protein_id gnl|my_center|LOCUS_14730 424199 424348 gene locus_tag LOCUS_14740 424199 424348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 424384 426345 gene locus_tag LOCUS_14750 424384 426345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 427137 426589 gene locus_tag LOCUS_14760 427137 426589 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872605.1 protein_id gnl|my_center|LOCUS_14760 427375 427653 gene locus_tag LOCUS_14770 427375 427653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 427960 427745 gene locus_tag LOCUS_14780 427960 427745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 429266 427983 gene locus_tag LOCUS_14790 429266 427983 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390621.1 protein_id gnl|my_center|LOCUS_14790 429899 429375 gene locus_tag LOCUS_14800 429899 429375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 430869 430036 gene locus_tag LOCUS_14810 430869 430036 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879249.1 protein_id gnl|my_center|LOCUS_14810 430960 432141 gene locus_tag LOCUS_14820 430960 432141 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277803.1 protein_id gnl|my_center|LOCUS_14820 432138 433187 gene locus_tag LOCUS_14830 432138 433187 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692533.1 protein_id gnl|my_center|LOCUS_14830 433217 433915 gene locus_tag LOCUS_14840 433217 433915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155756.1 protein_id gnl|my_center|LOCUS_14840 434009 434803 gene locus_tag LOCUS_14850 434009 434803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 434945 435457 gene locus_tag LOCUS_14860 gene msrA 434945 435457 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F024 protein_id gnl|my_center|LOCUS_14860 436110 435613 gene locus_tag LOCUS_14870 436110 435613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723340.1 protein_id gnl|my_center|LOCUS_14870 437105 436245 gene locus_tag LOCUS_14880 437105 436245 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113769.1 protein_id gnl|my_center|LOCUS_14880 437983 437342 gene locus_tag LOCUS_14890 gene opuB 437983 437342 CDS product choline ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644316.1 protein_id gnl|my_center|LOCUS_14890 439053 437980 gene locus_tag LOCUS_14900 439053 437980 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728694.1 protein_id gnl|my_center|LOCUS_14900 439681 439037 gene locus_tag LOCUS_14910 439681 439037 CDS product choline ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006808875.1 protein_id gnl|my_center|LOCUS_14910 441097 439961 gene locus_tag LOCUS_14920 441097 439961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 441140 442105 gene locus_tag LOCUS_14930 441140 442105 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688696.1 protein_id gnl|my_center|LOCUS_14930 442331 443131 gene locus_tag LOCUS_14940 442331 443131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 444533 443286 gene locus_tag LOCUS_14950 444533 443286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405216.1 protein_id gnl|my_center|LOCUS_14950 446075 444546 gene locus_tag LOCUS_14960 gene clpY 446075 444546 CDS product ATP-dependent protease ATPase subunit ClpY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39778 protein_id gnl|my_center|LOCUS_14960 446646 446104 gene locus_tag LOCUS_14970 gene hslV 446646 446104 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3Q4 protein_id gnl|my_center|LOCUS_14970 447678 446935 gene locus_tag LOCUS_14980 447678 446935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 447862 448095 gene locus_tag LOCUS_14990 447862 448095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 448475 448050 gene locus_tag LOCUS_15000 448475 448050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 448554 451382 gene locus_tag LOCUS_15010 gene alaS 448554 451382 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E226 protein_id gnl|my_center|LOCUS_15010 451483 451971 gene locus_tag LOCUS_15020 451483 451971 CDS product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F0T5 protein_id gnl|my_center|LOCUS_15020 451978 452931 gene locus_tag LOCUS_15030 451978 452931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 454053 452953 gene locus_tag LOCUS_15040 454053 452953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 454242 455306 gene locus_tag LOCUS_15050 454242 455306 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036137.1 protein_id gnl|my_center|LOCUS_15050 456483 455431 gene locus_tag LOCUS_15060 456483 455431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 456789 456508 gene locus_tag LOCUS_15070 456789 456508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 456795 459113 gene locus_tag LOCUS_15080 456795 459113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 459132 460067 gene locus_tag LOCUS_15090 459132 460067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001975788.1 protein_id gnl|my_center|LOCUS_15090 462457 460190 gene locus_tag LOCUS_15100 462457 460190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 463709 462738 gene locus_tag LOCUS_15110 463709 462738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919309.1 protein_id gnl|my_center|LOCUS_15110 464203 465036 gene locus_tag LOCUS_15120 464203 465036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 465229 465684 gene locus_tag LOCUS_15130 465229 465684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 465681 466301 gene locus_tag LOCUS_15140 465681 466301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 472215 466438 gene locus_tag LOCUS_15150 472215 466438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 472694 472293 gene locus_tag LOCUS_15160 gene acpS 472694 472293 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MMN7 protein_id gnl|my_center|LOCUS_15160 482830 472691 gene locus_tag LOCUS_15170 482830 472691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 482867 483058 gene locus_tag LOCUS_15180 482867 483058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 484205 483147 gene locus_tag LOCUS_15190 484205 483147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 484538 484293 gene locus_tag LOCUS_15200 484538 484293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 485225 484635 gene locus_tag LOCUS_15210 485225 484635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 500398 485198 gene locus_tag LOCUS_15220 500398 485198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 501978 501412 gene locus_tag LOCUS_15230 501978 501412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 502571 501978 gene locus_tag LOCUS_15240 502571 501978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 503353 502616 gene locus_tag LOCUS_15250 503353 502616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 503572 504261 gene locus_tag LOCUS_15260 503572 504261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 504251 505729 gene locus_tag LOCUS_15270 504251 505729 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107656.1 protein_id gnl|my_center|LOCUS_15270 505758 507152 gene locus_tag LOCUS_15280 505758 507152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 507152 508684 gene locus_tag LOCUS_15290 507152 508684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 508684 510255 gene locus_tag LOCUS_15300 508684 510255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 510255 513437 gene locus_tag LOCUS_15310 510255 513437 CDS product multidrug ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_15310 513566 516616 gene locus_tag LOCUS_15320 513566 516616 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072023.1 protein_id gnl|my_center|LOCUS_15320 516676 517545 gene locus_tag LOCUS_15330 516676 517545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 517578 517784 gene locus_tag LOCUS_15340 517578 517784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 519801 521867 gene locus_tag LOCUS_15350 519801 521867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003159898.1 protein_id gnl|my_center|LOCUS_15350 521944 522501 gene locus_tag LOCUS_15360 521944 522501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 524301 523435 gene locus_tag LOCUS_15370 524301 523435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919309.1 protein_id gnl|my_center|LOCUS_15370 524444 524671 gene locus_tag LOCUS_15380 524444 524671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 525598 524612 gene locus_tag LOCUS_15390 525598 524612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 526326 526511 gene locus_tag LOCUS_15400 526326 526511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 526811 526554 gene locus_tag LOCUS_15410 526811 526554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 527778 526978 gene locus_tag LOCUS_15420 527778 526978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 528777 528031 gene locus_tag LOCUS_15430 528777 528031 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938991.1 protein_id gnl|my_center|LOCUS_15430 531975 528784 gene locus_tag LOCUS_15440 531975 528784 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938992.1 protein_id gnl|my_center|LOCUS_15440 533193 531976 gene locus_tag LOCUS_15450 533193 531976 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072627.1 protein_id gnl|my_center|LOCUS_15450 534680 533190 gene locus_tag LOCUS_15460 gene hsdM 534680 533190 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938997.1 protein_id gnl|my_center|LOCUS_15460 537369 537521 gene locus_tag LOCUS_15470 537369 537521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 537969 537796 gene locus_tag LOCUS_15480 537969 537796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 540839 541072 gene locus_tag LOCUS_15490 540839 541072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 543481 544284 gene locus_tag LOCUS_15500 543481 544284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 545289 545068 gene locus_tag LOCUS_15510 545289 545068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 547970 545682 gene locus_tag LOCUS_15520 547970 545682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 548326 548135 gene locus_tag LOCUS_15530 548326 548135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 549812 548679 gene locus_tag LOCUS_15540 549812 548679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 550131 549889 gene locus_tag LOCUS_15550 550131 549889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 550248 550508 gene locus_tag LOCUS_15560 550248 550508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 550629 550814 gene locus_tag LOCUS_15570 550629 550814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 550811 551509 gene locus_tag LOCUS_15580 550811 551509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 >Feature sequence04 3040 2486 gene locus_tag LOCUS_15590 3040 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 4136 3618 gene locus_tag LOCUS_15600 4136 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 4435 4752 gene locus_tag LOCUS_15610 4435 4752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 5990 4854 gene locus_tag LOCUS_15620 5990 4854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 6306 6007 gene locus_tag LOCUS_15630 6306 6007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 6469 7278 gene locus_tag LOCUS_15640 6469 7278 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970116.1 protein_id gnl|my_center|LOCUS_15640 8037 7444 gene locus_tag LOCUS_15650 8037 7444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 8583 9344 gene locus_tag LOCUS_15660 gene hsp31 8583 9344 CDS product protease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206883.1 protein_id gnl|my_center|LOCUS_15660 11232 9436 gene locus_tag LOCUS_15670 11232 9436 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315309.1 protein_id gnl|my_center|LOCUS_15670 11983 11420 gene locus_tag LOCUS_15680 gene ahpC 11983 11420 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071237.1 protein_id gnl|my_center|LOCUS_15680 12587 12138 gene locus_tag LOCUS_15690 12587 12138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 13676 12759 gene locus_tag LOCUS_15700 gene oxyR 13676 12759 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963848.1 protein_id gnl|my_center|LOCUS_15700 13882 14739 gene locus_tag LOCUS_15710 13882 14739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 15729 14749 gene locus_tag LOCUS_15720 15729 14749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 15851 16417 gene locus_tag LOCUS_15730 15851 16417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 17188 16457 gene locus_tag LOCUS_15740 17188 16457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 18126 17332 gene locus_tag LOCUS_15750 18126 17332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 18237 18530 gene locus_tag LOCUS_15760 18237 18530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 18695 19465 gene locus_tag LOCUS_15770 18695 19465 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707495.1 protein_id gnl|my_center|LOCUS_15770 19469 19858 gene locus_tag LOCUS_15780 19469 19858 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215151.1 protein_id gnl|my_center|LOCUS_15780 20251 20006 gene locus_tag LOCUS_15790 20251 20006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 20340 21746 gene locus_tag LOCUS_15800 20340 21746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 22895 21912 gene locus_tag LOCUS_15810 22895 21912 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266995.1 protein_id gnl|my_center|LOCUS_15810 23190 23579 gene locus_tag LOCUS_15820 23190 23579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 23682 23485 gene locus_tag LOCUS_15830 23682 23485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 24159 23761 gene locus_tag LOCUS_15840 24159 23761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 24378 25580 gene locus_tag LOCUS_15850 24378 25580 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403786.1 protein_id gnl|my_center|LOCUS_15850 25577 25867 gene locus_tag LOCUS_15860 25577 25867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 26198 30133 gene locus_tag LOCUS_15870 26198 30133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 30135 30671 gene locus_tag LOCUS_15880 30135 30671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 30668 31033 gene locus_tag LOCUS_15890 30668 31033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 31660 32805 gene locus_tag LOCUS_15900 31660 32805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088279.1 protein_id gnl|my_center|LOCUS_15900 33348 32968 gene locus_tag LOCUS_15910 33348 32968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 34358 33345 gene locus_tag LOCUS_15920 34358 33345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 34704 36368 gene locus_tag LOCUS_15930 gene cht1 34704 36368 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121872.1 protein_id gnl|my_center|LOCUS_15930 36369 37880 gene locus_tag LOCUS_15940 gene betB 36369 37880 CDS product NAD/NADP-dependent betaine aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87H52 protein_id gnl|my_center|LOCUS_15940 37930 39609 gene locus_tag LOCUS_15950 gene betA 37930 39609 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DGN2 protein_id gnl|my_center|LOCUS_15950 39703 41118 gene locus_tag LOCUS_15960 39703 41118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 42853 41330 gene locus_tag LOCUS_15970 gene metC 42853 41330 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910561.1 protein_id gnl|my_center|LOCUS_15970 43554 42853 gene locus_tag LOCUS_15980 gene rpiA 43554 42853 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJF2 protein_id gnl|my_center|LOCUS_15980 45840 43603 gene locus_tag LOCUS_15990 45840 43603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 45917 48127 gene locus_tag LOCUS_16000 gene cyaA18 45917 48127 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849131.1 protein_id gnl|my_center|LOCUS_16000 48925 48323 gene locus_tag LOCUS_16010 48925 48323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 50110 49073 gene locus_tag LOCUS_16020 50110 49073 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784891.1 protein_id gnl|my_center|LOCUS_16020 52290 50110 gene locus_tag LOCUS_16030 gene mcm3 52290 50110 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828556.1 protein_id gnl|my_center|LOCUS_16030 54290 52287 gene locus_tag LOCUS_16040 gene mcm2 54290 52287 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013245.1 protein_id gnl|my_center|LOCUS_16040 60962 55077 gene locus_tag LOCUS_16050 60962 55077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 62949 61738 gene locus_tag LOCUS_16060 gene crp 62949 61738 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103068.1 protein_id gnl|my_center|LOCUS_16060 63894 63031 gene locus_tag LOCUS_16070 63894 63031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 64589 63975 gene locus_tag LOCUS_16080 64589 63975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381195.1 protein_id gnl|my_center|LOCUS_16080 66504 64753 gene locus_tag LOCUS_16090 66504 64753 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166984.1 protein_id gnl|my_center|LOCUS_16090 68246 66597 gene locus_tag LOCUS_16100 68246 66597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 69127 68369 gene locus_tag LOCUS_16110 69127 68369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 69817 69170 gene locus_tag LOCUS_16120 69817 69170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 71003 69870 gene locus_tag LOCUS_16130 71003 69870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725569.1 protein_id gnl|my_center|LOCUS_16130 72474 71050 gene locus_tag LOCUS_16140 gene dltB 72474 71050 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009414.1 protein_id gnl|my_center|LOCUS_16140 74183 72474 gene locus_tag LOCUS_16150 74183 72474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 74845 74180 gene locus_tag LOCUS_16160 74845 74180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 76064 74949 gene locus_tag LOCUS_16170 76064 74949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 77152 76583 gene locus_tag LOCUS_16180 77152 76583 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771339.1 protein_id gnl|my_center|LOCUS_16180 77402 79057 gene locus_tag LOCUS_16190 gene caiA 77402 79057 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274139.1 protein_id gnl|my_center|LOCUS_16190 79980 80702 gene locus_tag LOCUS_16200 79980 80702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 80766 81494 gene locus_tag LOCUS_16210 80766 81494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 82374 81586 gene locus_tag LOCUS_16220 82374 81586 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926674.1 protein_id gnl|my_center|LOCUS_16220 83728 82625 gene locus_tag LOCUS_16230 83728 82625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002109366.1 protein_id gnl|my_center|LOCUS_16230 83856 84062 gene locus_tag LOCUS_16240 83856 84062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 84727 84362 gene locus_tag LOCUS_16250 84727 84362 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587664.1 protein_id gnl|my_center|LOCUS_16250 84818 86140 gene locus_tag LOCUS_16260 84818 86140 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681866.1 protein_id gnl|my_center|LOCUS_16260 86821 86231 gene locus_tag LOCUS_16270 86821 86231 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188046.1 protein_id gnl|my_center|LOCUS_16270 88016 86802 gene locus_tag LOCUS_16280 gene metX 88016 86802 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4I0 protein_id gnl|my_center|LOCUS_16280 89414 88119 gene locus_tag LOCUS_16290 gene met17 89414 88119 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137848.1 protein_id gnl|my_center|LOCUS_16290 90913 89588 gene locus_tag LOCUS_16300 90913 89588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 91340 90930 gene locus_tag LOCUS_16310 91340 90930 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546534.1 protein_id gnl|my_center|LOCUS_16310 92065 91466 gene locus_tag LOCUS_16320 92065 91466 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015860.1 protein_id gnl|my_center|LOCUS_16320 92388 92155 gene locus_tag LOCUS_16330 92388 92155 CDS product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247796.1 protein_id gnl|my_center|LOCUS_16330 93760 92615 gene locus_tag LOCUS_16340 gene lipL45 93760 92615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714030.1 protein_id gnl|my_center|LOCUS_16340 94884 93874 gene locus_tag LOCUS_16350 94884 93874 CDS product sigma factor regulatory protein FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792401.1 protein_id gnl|my_center|LOCUS_16350 95561 95004 gene locus_tag LOCUS_16360 95561 95004 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951509.1 protein_id gnl|my_center|LOCUS_16360 95885 95610 gene locus_tag LOCUS_16370 95885 95610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 97908 96976 gene locus_tag LOCUS_16380 gene pssA 97908 96976 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769017.1 protein_id gnl|my_center|LOCUS_16380 98954 97956 gene locus_tag LOCUS_16390 gene tsaD 98954 97956 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F661 protein_id gnl|my_center|LOCUS_16390 100493 99159 gene locus_tag LOCUS_16400 gene prc 100493 99159 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790723.1 protein_id gnl|my_center|LOCUS_16400 100917 100597 gene locus_tag LOCUS_16410 100917 100597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 102369 100921 gene locus_tag LOCUS_16420 gene radA 102369 100921 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F261 protein_id gnl|my_center|LOCUS_16420 102892 102371 gene locus_tag LOCUS_16430 102892 102371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 104345 102972 gene locus_tag LOCUS_16440 gene dnaB 104345 102972 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F5K2 protein_id gnl|my_center|LOCUS_16440 104932 104357 gene locus_tag LOCUS_16450 104932 104357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 105462 104968 gene locus_tag LOCUS_16460 gene ssb 105462 104968 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F5K5 protein_id gnl|my_center|LOCUS_16460 105740 105465 gene locus_tag LOCUS_16470 105740 105465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 106218 107327 gene locus_tag LOCUS_16480 106218 107327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101595.1 protein_id gnl|my_center|LOCUS_16480 107321 107734 gene locus_tag LOCUS_16490 107321 107734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 108922 108020 gene locus_tag LOCUS_16500 108922 108020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026144.1 protein_id gnl|my_center|LOCUS_16500 109722 109201 gene locus_tag LOCUS_16510 109722 109201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 112145 109722 gene locus_tag LOCUS_16520 112145 109722 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097924.1 protein_id gnl|my_center|LOCUS_16520 113263 112148 gene locus_tag LOCUS_16530 113263 112148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 115252 113435 gene locus_tag LOCUS_16540 gene aspS 115252 113435 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F5K1 protein_id gnl|my_center|LOCUS_16540 115396 116529 gene locus_tag LOCUS_16550 115396 116529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 116552 117187 gene locus_tag LOCUS_16560 116552 117187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 117200 118354 gene locus_tag LOCUS_16570 117200 118354 CDS product dolichol monophosphate mannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088385.1 protein_id gnl|my_center|LOCUS_16570 118526 118329 gene locus_tag LOCUS_16580 118526 118329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 118525 119529 gene locus_tag LOCUS_16590 118525 119529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 120467 119526 gene locus_tag LOCUS_16600 120467 119526 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694733.1 protein_id gnl|my_center|LOCUS_16600 120559 121245 gene locus_tag LOCUS_16610 gene trmB 120559 121245 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F9Q1 protein_id gnl|my_center|LOCUS_16610 121226 121492 gene locus_tag LOCUS_16620 121226 121492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 121489 123387 gene locus_tag LOCUS_16630 121489 123387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 123726 123463 gene locus_tag LOCUS_16640 123726 123463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 124014 124412 gene locus_tag LOCUS_16650 124014 124412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 124481 124900 gene locus_tag LOCUS_16660 124481 124900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 124897 125577 gene locus_tag LOCUS_16670 124897 125577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 127300 125567 gene locus_tag LOCUS_16680 127300 125567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 127974 127297 gene locus_tag LOCUS_16690 127974 127297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 129984 128536 gene locus_tag LOCUS_16700 gene wcaJ 129984 128536 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910880.1 protein_id gnl|my_center|LOCUS_16700 132809 129981 gene locus_tag LOCUS_16710 132809 129981 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131037.1 protein_id gnl|my_center|LOCUS_16710 132942 134720 gene locus_tag LOCUS_16720 132942 134720 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022802.1 protein_id gnl|my_center|LOCUS_16720 135286 134939 gene locus_tag LOCUS_16730 135286 134939 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061392.1 protein_id gnl|my_center|LOCUS_16730 136487 135477 gene locus_tag LOCUS_16740 136487 135477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 137697 136588 gene locus_tag LOCUS_16750 137697 136588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 138635 137790 gene locus_tag LOCUS_16760 138635 137790 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4M3 protein_id gnl|my_center|LOCUS_16760 139681 139103 gene locus_tag LOCUS_16770 139681 139103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 139745 140863 gene locus_tag LOCUS_16780 139745 140863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 140850 142181 gene locus_tag LOCUS_16790 140850 142181 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207121.1 protein_id gnl|my_center|LOCUS_16790 142984 142343 gene locus_tag LOCUS_16800 142984 142343 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FJS0 protein_id gnl|my_center|LOCUS_16800 143369 143013 gene locus_tag LOCUS_16810 143369 143013 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F032 protein_id gnl|my_center|LOCUS_16810 143736 143371 gene locus_tag LOCUS_16820 143736 143371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 144037 144750 gene locus_tag LOCUS_16830 144037 144750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 145612 144758 gene locus_tag LOCUS_16840 145612 144758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 146012 145668 gene locus_tag LOCUS_16850 146012 145668 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F6H9 protein_id gnl|my_center|LOCUS_16850 146206 146012 gene locus_tag LOCUS_16860 146206 146012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 147047 146247 gene locus_tag LOCUS_16870 147047 146247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115248.1 protein_id gnl|my_center|LOCUS_16870 148635 147067 gene locus_tag LOCUS_16880 gene guaB 148635 147067 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4Q4 protein_id gnl|my_center|LOCUS_16880 149951 148677 gene locus_tag LOCUS_16890 gene caiB 149951 148677 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071499.1 protein_id gnl|my_center|LOCUS_16890 150520 150146 gene locus_tag LOCUS_16900 150520 150146 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166988.1 protein_id gnl|my_center|LOCUS_16900 151624 150620 gene locus_tag LOCUS_16910 gene lpxK 151624 150620 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBV6 protein_id gnl|my_center|LOCUS_16910 153528 151621 gene locus_tag LOCUS_16920 gene mdlB 153528 151621 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172203.1 protein_id gnl|my_center|LOCUS_16920 156792 153640 gene locus_tag LOCUS_16930 156792 153640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 158772 157036 gene locus_tag LOCUS_16940 gene recN 158772 157036 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3Y2G9 protein_id gnl|my_center|LOCUS_16940 158852 159838 gene locus_tag LOCUS_16950 gene ctaA 158852 159838 CDS product cytochrome oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087694.1 protein_id gnl|my_center|LOCUS_16950 159813 160691 gene locus_tag LOCUS_16960 gene ctaB 159813 160691 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F9F8 protein_id gnl|my_center|LOCUS_16960 160711 162159 gene locus_tag LOCUS_16970 160711 162159 CDS product di- and tricarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_599478.1 protein_id gnl|my_center|LOCUS_16970 162393 162926 gene locus_tag LOCUS_16980 162393 162926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 165123 163057 gene locus_tag LOCUS_16990 165123 163057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 166090 165473 gene locus_tag LOCUS_17000 166090 165473 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722834.1 protein_id gnl|my_center|LOCUS_17000 166443 167246 gene locus_tag LOCUS_17010 166443 167246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 167609 168796 gene locus_tag LOCUS_17020 167609 168796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029784.1 protein_id gnl|my_center|LOCUS_17020 168793 169629 gene locus_tag LOCUS_17030 168793 169629 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600052.1 protein_id gnl|my_center|LOCUS_17030 171253 169712 gene locus_tag LOCUS_17040 171253 169712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 172381 171347 gene locus_tag LOCUS_17050 172381 171347 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083636.1 protein_id gnl|my_center|LOCUS_17050 172566 175208 gene locus_tag LOCUS_17060 172566 175208 CDS product signal transduction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002071771.1 protein_id gnl|my_center|LOCUS_17060 176155 175430 gene locus_tag LOCUS_17070 176155 175430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 176358 177362 gene locus_tag LOCUS_17080 176358 177362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 178086 177379 gene locus_tag LOCUS_17090 178086 177379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 179091 178282 gene locus_tag LOCUS_17100 gene sfsA 179091 178282 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV77 protein_id gnl|my_center|LOCUS_17100 179301 181181 gene locus_tag LOCUS_17110 gene korA 179301 181181 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324152.1 protein_id gnl|my_center|LOCUS_17110 181178 182188 gene locus_tag LOCUS_17120 181178 182188 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029750.1 protein_id gnl|my_center|LOCUS_17120 182344 182763 gene locus_tag LOCUS_17130 182344 182763 CDS product S-adenosylmethionine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460188.1 protein_id gnl|my_center|LOCUS_17130 182775 183677 gene locus_tag LOCUS_17140 gene speD 182775 183677 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EXA2 protein_id gnl|my_center|LOCUS_17140 186246 183814 gene locus_tag LOCUS_17150 186246 183814 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103180.1 protein_id gnl|my_center|LOCUS_17150 186808 186335 gene locus_tag LOCUS_17160 186808 186335 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288999.1 protein_id gnl|my_center|LOCUS_17160 187450 186821 gene locus_tag LOCUS_17170 187450 186821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 187566 188231 gene locus_tag LOCUS_17180 187566 188231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 188231 189073 gene locus_tag LOCUS_17190 188231 189073 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MBG0 protein_id gnl|my_center|LOCUS_17190 189070 189651 gene locus_tag LOCUS_17200 189070 189651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 190647 189817 gene locus_tag LOCUS_17210 gene trpC 190647 189817 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT48 protein_id gnl|my_center|LOCUS_17210 190978 190649 gene locus_tag LOCUS_17220 gene spoIIAA 190978 190649 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7V3 protein_id gnl|my_center|LOCUS_17220 191092 193884 gene locus_tag LOCUS_17230 191092 193884 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478619.1 protein_id gnl|my_center|LOCUS_17230 194516 193980 gene locus_tag LOCUS_17240 194516 193980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 195411 194656 gene locus_tag LOCUS_17250 195411 194656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 196105 195617 gene locus_tag LOCUS_17260 196105 195617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 196212 197951 gene locus_tag LOCUS_17270 196212 197951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 200253 198118 gene locus_tag LOCUS_17280 200253 198118 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_17280 201813 200740 gene locus_tag LOCUS_17290 201813 200740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 202950 201844 gene locus_tag LOCUS_17300 gene uvrD 202950 201844 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F8R6 protein_id gnl|my_center|LOCUS_17300 203509 203868 gene locus_tag LOCUS_17310 gene ssb 203509 203868 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F052 protein_id gnl|my_center|LOCUS_17310 206678 204003 gene locus_tag LOCUS_17320 206678 204003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 207393 207019 gene locus_tag LOCUS_17330 207393 207019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24086 protein_id gnl|my_center|LOCUS_17330 208517 207423 gene locus_tag LOCUS_17340 gene leuB 208517 207423 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24015 protein_id gnl|my_center|LOCUS_17340 209005 208574 gene locus_tag LOCUS_17350 209005 208574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 210346 209183 gene locus_tag LOCUS_17360 210346 209183 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3X5 protein_id gnl|my_center|LOCUS_17360 210437 210889 gene locus_tag LOCUS_17370 210437 210889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 212186 211107 gene locus_tag LOCUS_17380 212186 211107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 212675 212241 gene locus_tag LOCUS_17390 212675 212241 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750243.1 protein_id gnl|my_center|LOCUS_17390 214745 212739 gene locus_tag LOCUS_17400 gene mdlB 214745 212739 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010679382.1 protein_id gnl|my_center|LOCUS_17400 216065 214809 gene locus_tag LOCUS_17410 gene adhP 216065 214809 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078168.1 protein_id gnl|my_center|LOCUS_17410 216150 217622 gene locus_tag LOCUS_17420 216150 217622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339988.1 protein_id gnl|my_center|LOCUS_17420 217594 220068 gene locus_tag LOCUS_17430 217594 220068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 221399 220113 gene locus_tag LOCUS_17440 221399 220113 CDS product 4-hydroxybutyrate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228689.1 protein_id gnl|my_center|LOCUS_17440 223335 221479 gene locus_tag LOCUS_17450 223335 221479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 225337 224111 gene locus_tag LOCUS_17460 225337 224111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 226182 225388 gene locus_tag LOCUS_17470 226182 225388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 227698 226184 gene locus_tag LOCUS_17480 gene hemL 227698 226184 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FRE3 protein_id gnl|my_center|LOCUS_17480 228572 227928 gene locus_tag LOCUS_17490 228572 227928 CDS product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870936.1 protein_id gnl|my_center|LOCUS_17490 230247 228649 gene locus_tag LOCUS_17500 230247 228649 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878821.1 protein_id gnl|my_center|LOCUS_17500 230441 231136 gene locus_tag LOCUS_17510 gene aguR 230441 231136 CDS product transcriptional regulator AguR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112936.1 protein_id gnl|my_center|LOCUS_17510 231356 233608 gene locus_tag LOCUS_17520 231356 233608 CDS product neutral ceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I596 protein_id gnl|my_center|LOCUS_17520 235264 234227 gene locus_tag LOCUS_17530 235264 234227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 236553 235261 gene locus_tag LOCUS_17540 gene avtA 236553 235261 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260902.1 protein_id gnl|my_center|LOCUS_17540 236608 238476 gene locus_tag LOCUS_17550 gene uvrC 236608 238476 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F479 protein_id gnl|my_center|LOCUS_17550 238712 238506 gene locus_tag LOCUS_17560 238712 238506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 238626 239060 gene locus_tag LOCUS_17570 238626 239060 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451642.1 protein_id gnl|my_center|LOCUS_17570 240514 239318 gene locus_tag LOCUS_17580 240514 239318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 242306 240507 gene locus_tag LOCUS_17590 242306 240507 CDS product gliding motility ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623945.1 protein_id gnl|my_center|LOCUS_17590 243022 242303 gene locus_tag LOCUS_17600 243022 242303 CDS product gliding motility ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237713.1 protein_id gnl|my_center|LOCUS_17600 244056 243019 gene locus_tag LOCUS_17610 244056 243019 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_17610 244150 245037 gene locus_tag LOCUS_17620 gene petH 244150 245037 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142292.1 protein_id gnl|my_center|LOCUS_17620 245255 245980 gene locus_tag LOCUS_17630 245255 245980 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286976.1 protein_id gnl|my_center|LOCUS_17630 246958 246011 gene locus_tag LOCUS_17640 246958 246011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 249111 247159 gene locus_tag LOCUS_17650 gene fadD 249111 247159 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845063.1 protein_id gnl|my_center|LOCUS_17650 250568 249267 gene locus_tag LOCUS_17660 250568 249267 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013994.1 protein_id gnl|my_center|LOCUS_17660 250988 250659 gene locus_tag LOCUS_17670 250988 250659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 255470 251049 gene locus_tag LOCUS_17680 255470 251049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 255620 256939 gene locus_tag LOCUS_17690 255620 256939 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767983.1 protein_id gnl|my_center|LOCUS_17690 256936 258147 gene locus_tag LOCUS_17700 256936 258147 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023945.1 protein_id gnl|my_center|LOCUS_17700 258131 259153 gene locus_tag LOCUS_17710 258131 259153 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937475.1 protein_id gnl|my_center|LOCUS_17710 259433 261487 gene locus_tag LOCUS_17720 259433 261487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 262239 261613 gene locus_tag LOCUS_17730 262239 261613 CDS product photosynthetic protein synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664418.1 protein_id gnl|my_center|LOCUS_17730 263504 262275 gene locus_tag LOCUS_17740 263504 262275 CDS product multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931520.1 protein_id gnl|my_center|LOCUS_17740 263812 263501 gene locus_tag LOCUS_17750 263812 263501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 266064 263989 gene locus_tag LOCUS_17760 266064 263989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698487.1 protein_id gnl|my_center|LOCUS_17760 269503 266081 gene locus_tag LOCUS_17770 269503 266081 CDS product trehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257046.1 protein_id gnl|my_center|LOCUS_17770 269473 269652 gene locus_tag LOCUS_17780 269473 269652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 269657 272152 gene locus_tag LOCUS_17790 gene glgP 269657 272152 CDS product alpha-1,4 glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BH5 protein_id gnl|my_center|LOCUS_17790 272265 273161 gene locus_tag LOCUS_17800 272265 273161 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704730.1 protein_id gnl|my_center|LOCUS_17800 273188 275128 gene locus_tag LOCUS_17810 273188 275128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 276121 275327 gene locus_tag LOCUS_17820 276121 275327 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390203.1 protein_id gnl|my_center|LOCUS_17820 276232 277152 gene locus_tag LOCUS_17830 276232 277152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 278658 277300 gene locus_tag LOCUS_17840 gene paaJ 278658 277300 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778965.1 protein_id gnl|my_center|LOCUS_17840 279743 278853 gene locus_tag LOCUS_17850 279743 278853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 279872 281596 gene locus_tag LOCUS_17860 gene mcp40H-9 279872 281596 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941697.1 protein_id gnl|my_center|LOCUS_17860 282275 281625 gene locus_tag LOCUS_17870 282275 281625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 284405 282465 gene locus_tag LOCUS_17880 284405 282465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 285091 284402 gene locus_tag LOCUS_17890 285091 284402 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660871.1 protein_id gnl|my_center|LOCUS_17890 285327 285088 gene locus_tag LOCUS_17900 285327 285088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 285296 286183 gene locus_tag LOCUS_17910 285296 286183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 286180 286899 gene locus_tag LOCUS_17920 286180 286899 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJN7 protein_id gnl|my_center|LOCUS_17920 286999 287814 gene locus_tag LOCUS_17930 286999 287814 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147802.1 protein_id gnl|my_center|LOCUS_17930 288624 287881 gene locus_tag LOCUS_17940 288624 287881 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_835017.2 protein_id gnl|my_center|LOCUS_17940 289481 288747 gene locus_tag LOCUS_17950 289481 288747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 290376 289636 gene locus_tag LOCUS_17960 290376 289636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 290708 292474 gene locus_tag LOCUS_17970 gene caiA 290708 292474 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587238.1 protein_id gnl|my_center|LOCUS_17970 292870 294234 gene locus_tag LOCUS_17980 292870 294234 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257389.1 protein_id gnl|my_center|LOCUS_17980 294294 294860 gene locus_tag LOCUS_17990 294294 294860 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403689.1 protein_id gnl|my_center|LOCUS_17990 295419 294943 gene locus_tag LOCUS_18000 295419 294943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 297359 295416 gene locus_tag LOCUS_18010 297359 295416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 297537 298259 gene locus_tag LOCUS_18020 297537 298259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 299002 298427 gene locus_tag LOCUS_18030 299002 298427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 299407 300399 gene locus_tag LOCUS_18040 gene cysK 299407 300399 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VDH3 protein_id gnl|my_center|LOCUS_18040 300517 301398 gene locus_tag LOCUS_18050 300517 301398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 301395 302801 gene locus_tag LOCUS_18060 gene argH 301395 302801 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4G5 protein_id gnl|my_center|LOCUS_18060 303039 302827 gene locus_tag LOCUS_18070 303039 302827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 303083 304036 gene locus_tag LOCUS_18080 303083 304036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 304029 304637 gene locus_tag LOCUS_18090 304029 304637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 306187 304922 gene locus_tag LOCUS_18100 gene pcnB 306187 304922 CDS product poly(A) polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F1X6 protein_id gnl|my_center|LOCUS_18100 306399 307364 gene locus_tag LOCUS_18110 gene nlpD 306399 307364 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625244.1 protein_id gnl|my_center|LOCUS_18110 309982 307817 gene locus_tag LOCUS_18120 gene topA 309982 307817 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CG80 protein_id gnl|my_center|LOCUS_18120 311184 310183 gene locus_tag LOCUS_18130 311184 310183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 311991 311185 gene locus_tag LOCUS_18140 311991 311185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 312229 312951 gene locus_tag LOCUS_18150 312229 312951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 312941 313300 gene locus_tag LOCUS_18160 312941 313300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 314266 313793 gene locus_tag LOCUS_18170 314266 313793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117815.1 protein_id gnl|my_center|LOCUS_18170 315758 314667 gene locus_tag LOCUS_18180 gene murB 315758 314667 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L0L7 protein_id gnl|my_center|LOCUS_18180 316747 315755 gene locus_tag LOCUS_18190 316747 315755 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531500.1 protein_id gnl|my_center|LOCUS_18190 316776 317375 gene locus_tag LOCUS_18200 316776 317375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 317561 317409 gene locus_tag LOCUS_18210 317561 317409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 318080 317604 gene locus_tag LOCUS_18220 318080 317604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 319773 318169 gene locus_tag LOCUS_18230 gene nadB 319773 318169 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F601 protein_id gnl|my_center|LOCUS_18230 321613 319775 gene locus_tag LOCUS_18240 gene prc 321613 319775 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927328.1 protein_id gnl|my_center|LOCUS_18240 321871 322638 gene locus_tag LOCUS_18250 321871 322638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 322662 322895 gene locus_tag LOCUS_18260 322662 322895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 323695 323093 gene locus_tag LOCUS_18270 323695 323093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 323807 324850 gene locus_tag LOCUS_18280 323807 324850 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822893.1 protein_id gnl|my_center|LOCUS_18280 325699 326439 gene locus_tag LOCUS_18290 325699 326439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 329644 326630 gene locus_tag LOCUS_18300 329644 326630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 330681 329833 gene locus_tag LOCUS_18310 330681 329833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 331031 330660 gene locus_tag LOCUS_18320 331031 330660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 333363 331105 gene locus_tag LOCUS_18330 gene purL 333363 331105 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F6I3 protein_id gnl|my_center|LOCUS_18330 333458 335092 gene locus_tag LOCUS_18340 333458 335092 CDS product choline transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606001.1 protein_id gnl|my_center|LOCUS_18340 336292 335459 gene locus_tag LOCUS_18350 336292 335459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 337119 336289 gene locus_tag LOCUS_18360 337119 336289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 337972 337697 gene locus_tag LOCUS_18370 337972 337697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 338146 338709 gene locus_tag LOCUS_18380 338146 338709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 340181 338787 gene locus_tag LOCUS_18390 gene fumC 340181 338787 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F9L0 protein_id gnl|my_center|LOCUS_18390 341589 340204 gene locus_tag LOCUS_18400 341589 340204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 342641 341589 gene locus_tag LOCUS_18410 342641 341589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 342709 343449 gene locus_tag LOCUS_18420 342709 343449 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410308.1 protein_id gnl|my_center|LOCUS_18420 343475 345928 gene locus_tag LOCUS_18430 343475 345928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 346008 346721 gene locus_tag LOCUS_18440 346008 346721 CDS product amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057804.1 protein_id gnl|my_center|LOCUS_18440 346772 347320 gene locus_tag LOCUS_18450 346772 347320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 348378 347317 gene locus_tag LOCUS_18460 348378 347317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 348362 348517 gene locus_tag LOCUS_18470 348362 348517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 349964 348522 gene locus_tag LOCUS_18480 gene gltD 349964 348522 CDS product glutamate synthase [NADPH] small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WN19 protein_id gnl|my_center|LOCUS_18480 354554 349986 gene locus_tag LOCUS_18490 gene gltB 354554 349986 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090468.1 protein_id gnl|my_center|LOCUS_18490 354763 355122 gene locus_tag LOCUS_18500 354763 355122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 355603 355298 gene locus_tag LOCUS_18510 355603 355298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 355890 355597 gene locus_tag LOCUS_18520 355890 355597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 356403 357359 gene locus_tag LOCUS_18530 356403 357359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 357729 357445 gene locus_tag LOCUS_18540 357729 357445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 358440 357874 gene locus_tag LOCUS_18550 gene mntP 358440 357874 CDS product putative manganese efflux pump MntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89Z16 protein_id gnl|my_center|LOCUS_18550 358577 359278 gene locus_tag LOCUS_18560 358577 359278 CDS product DUF4386 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022315.1 protein_id gnl|my_center|LOCUS_18560 359635 359324 gene locus_tag LOCUS_18570 359635 359324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 360291 360569 gene locus_tag LOCUS_18580 360291 360569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 361579 360662 gene locus_tag LOCUS_18590 gene glsA 361579 360662 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9M7 protein_id gnl|my_center|LOCUS_18590 362743 361643 gene locus_tag LOCUS_18600 362743 361643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 363905 362937 gene locus_tag LOCUS_18610 363905 362937 CDS product arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZX92 protein_id gnl|my_center|LOCUS_18610 364492 363902 gene locus_tag LOCUS_18620 364492 363902 CDS product transcriptional antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572205.1 protein_id gnl|my_center|LOCUS_18620 365581 364568 gene locus_tag LOCUS_18630 gene neuB 365581 364568 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289361.1 protein_id gnl|my_center|LOCUS_18630 366324 365725 gene locus_tag LOCUS_18640 gene pabA 366324 365725 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601862.1 protein_id gnl|my_center|LOCUS_18640 367841 366321 gene locus_tag LOCUS_18650 367841 366321 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877263.1 protein_id gnl|my_center|LOCUS_18650 369109 367841 gene locus_tag LOCUS_18660 369109 367841 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932439.1 protein_id gnl|my_center|LOCUS_18660 370499 369096 gene locus_tag LOCUS_18670 370499 369096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144183.1 protein_id gnl|my_center|LOCUS_18670 370546 371196 gene locus_tag LOCUS_18680 gene tmk 370546 371196 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7Y6 protein_id gnl|my_center|LOCUS_18680 371261 371914 gene locus_tag LOCUS_18690 371261 371914 CDS product ATP:cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708720.1 protein_id gnl|my_center|LOCUS_18690 371922 372581 gene locus_tag LOCUS_18700 371922 372581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 373180 372584 gene locus_tag LOCUS_18710 373180 372584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366622.1 protein_id gnl|my_center|LOCUS_18710 373796 373182 gene locus_tag LOCUS_18720 373796 373182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 374365 373832 gene locus_tag LOCUS_18730 374365 373832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880223.1 protein_id gnl|my_center|LOCUS_18730 374434 375744 gene locus_tag LOCUS_18740 gene spoVK 374434 375744 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098167.1 protein_id gnl|my_center|LOCUS_18740 376447 379329 gene locus_tag LOCUS_18750 376447 379329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 379341 382736 gene locus_tag LOCUS_18760 379341 382736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 382901 384157 gene locus_tag LOCUS_18770 382901 384157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 384389 385108 gene locus_tag LOCUS_18780 384389 385108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 385123 386136 gene locus_tag LOCUS_18790 385123 386136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 386890 386231 gene locus_tag LOCUS_18800 386890 386231 CDS product dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001967625.1 protein_id gnl|my_center|LOCUS_18800 388652 386892 gene locus_tag LOCUS_18810 388652 386892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 389194 388652 gene locus_tag LOCUS_18820 389194 388652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962860.1 protein_id gnl|my_center|LOCUS_18820 389942 389238 gene locus_tag LOCUS_18830 389942 389238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 390528 389929 gene locus_tag LOCUS_18840 gene SigD 390528 389929 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087693.1 protein_id gnl|my_center|LOCUS_18840 390746 391864 gene locus_tag LOCUS_18850 gene fliG 390746 391864 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412659.1 protein_id gnl|my_center|LOCUS_18850 393427 391868 gene locus_tag LOCUS_18860 393427 391868 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895957.1 protein_id gnl|my_center|LOCUS_18860 394683 393556 gene locus_tag LOCUS_18870 394683 393556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259338.1 protein_id gnl|my_center|LOCUS_18870 397018 394877 gene locus_tag LOCUS_18880 397018 394877 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517762.1 protein_id gnl|my_center|LOCUS_18880 397694 398962 gene locus_tag LOCUS_18890 397694 398962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 398959 400689 gene locus_tag LOCUS_18900 398959 400689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 400853 403336 gene locus_tag LOCUS_18910 gene mrcA 400853 403336 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835640.1 protein_id gnl|my_center|LOCUS_18910 404736 403672 gene locus_tag LOCUS_18920 404736 403672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361891.1 protein_id gnl|my_center|LOCUS_18920 405718 404738 gene locus_tag LOCUS_18930 gene ruvB 405718 404738 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32055 protein_id gnl|my_center|LOCUS_18930 406573 405887 gene locus_tag LOCUS_18940 406573 405887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 407687 406761 gene locus_tag LOCUS_18950 407687 406761 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176746.1 protein_id gnl|my_center|LOCUS_18950 408475 407684 gene locus_tag LOCUS_18960 gene nlpD 408475 407684 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824202.1 protein_id gnl|my_center|LOCUS_18960 408848 409990 gene locus_tag LOCUS_18970 408848 409990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113995.1 protein_id gnl|my_center|LOCUS_18970 410903 410007 gene locus_tag LOCUS_18980 gene nlpD 410903 410007 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804809.1 protein_id gnl|my_center|LOCUS_18980 410927 411559 gene locus_tag LOCUS_18990 410927 411559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 411537 412280 gene locus_tag LOCUS_19000 411537 412280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 412340 412852 gene locus_tag LOCUS_19010 412340 412852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 412883 413635 gene locus_tag LOCUS_19020 412883 413635 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810083.1 protein_id gnl|my_center|LOCUS_19020 414951 413776 gene locus_tag LOCUS_19030 gene caiA 414951 413776 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000232010.1 protein_id gnl|my_center|LOCUS_19030 416410 415097 gene locus_tag LOCUS_19040 416410 415097 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941517.1 protein_id gnl|my_center|LOCUS_19040 416766 417524 gene locus_tag LOCUS_19050 gene map 416766 417524 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3E9 protein_id gnl|my_center|LOCUS_19050 417527 418093 gene locus_tag LOCUS_19060 417527 418093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 418263 418664 gene locus_tag LOCUS_19070 418263 418664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083857.1 protein_id gnl|my_center|LOCUS_19070 418714 418980 gene locus_tag LOCUS_19080 418714 418980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 419128 419925 gene locus_tag LOCUS_19090 419128 419925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 420739 420077 gene locus_tag LOCUS_19100 420739 420077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 421152 421697 gene locus_tag LOCUS_19110 421152 421697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 422941 421874 gene locus_tag LOCUS_19120 422941 421874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141711.1 protein_id gnl|my_center|LOCUS_19120 424335 422944 gene locus_tag LOCUS_19130 gene cfa 424335 422944 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881127.1 protein_id gnl|my_center|LOCUS_19130 424684 426918 gene locus_tag LOCUS_19140 424684 426918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 427576 427022 gene locus_tag LOCUS_19150 427576 427022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 428589 427573 gene locus_tag LOCUS_19160 428589 427573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 428865 429149 gene locus_tag LOCUS_19170 428865 429149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 430207 429215 gene locus_tag LOCUS_19180 430207 429215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 431777 430422 gene locus_tag LOCUS_19190 gene lipL71 431777 430422 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843317.1 protein_id gnl|my_center|LOCUS_19190 432218 431880 gene locus_tag LOCUS_19200 gene spoIIAA 432218 431880 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F1N6 protein_id gnl|my_center|LOCUS_19200 433369 432305 gene locus_tag LOCUS_19210 gene tgt 433369 432305 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CXS3 protein_id gnl|my_center|LOCUS_19210 433515 434510 gene locus_tag LOCUS_19220 433515 434510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 435754 434507 gene locus_tag LOCUS_19230 435754 434507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 435919 438603 gene locus_tag LOCUS_19240 gene leuS 435919 438603 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P36430 protein_id gnl|my_center|LOCUS_19240 438729 439328 gene locus_tag LOCUS_19250 438729 439328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 441240 439372 gene locus_tag LOCUS_19260 441240 439372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 442426 441407 gene locus_tag LOCUS_19270 gene adhP 442426 441407 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870126.1 protein_id gnl|my_center|LOCUS_19270 442439 442903 gene locus_tag LOCUS_19280 gene rnhA 442439 442903 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628813.1 protein_id gnl|my_center|LOCUS_19280 443095 444021 gene locus_tag LOCUS_19290 443095 444021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620707.1 protein_id gnl|my_center|LOCUS_19290 444657 444175 gene locus_tag LOCUS_19300 444657 444175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 444741 445715 gene locus_tag LOCUS_19310 444741 445715 CDS product putative RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45826 protein_id gnl|my_center|LOCUS_19310 447359 445680 gene locus_tag LOCUS_19320 447359 445680 CDS product phosphoenolpyruvate-protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMI3 protein_id gnl|my_center|LOCUS_19320 448276 447362 gene locus_tag LOCUS_19330 448276 447362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 448486 449808 gene locus_tag LOCUS_19340 gene fliI 448486 449808 CDS product flagellum-specific ATP synthase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570583.1 protein_id gnl|my_center|LOCUS_19340 449864 450415 gene locus_tag LOCUS_19350 449864 450415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 450418 451062 gene locus_tag LOCUS_19360 450418 451062 CDS product flagellar protein FlbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157730.1 protein_id gnl|my_center|LOCUS_19360 451655 451308 gene locus_tag LOCUS_19370 451655 451308 CDS product ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968151.1 protein_id gnl|my_center|LOCUS_19370 451942 451652 gene locus_tag LOCUS_19380 451942 451652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 452239 453393 gene locus_tag LOCUS_19390 gene aroC 452239 453393 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F9N4 protein_id gnl|my_center|LOCUS_19390 453546 454796 gene locus_tag LOCUS_19400 453546 454796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 455228 454872 gene locus_tag LOCUS_19410 455228 454872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 457027 455414 gene locus_tag LOCUS_19420 gene purH 457027 455414 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3W6 protein_id gnl|my_center|LOCUS_19420 457835 457209 gene locus_tag LOCUS_19430 gene purN 457835 457209 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3W7 protein_id gnl|my_center|LOCUS_19430 458257 457835 gene locus_tag LOCUS_19440 458257 457835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 >Feature sequence05 936 1475 gene locus_tag LOCUS_19450 936 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 1785 2813 gene locus_tag LOCUS_19460 1785 2813 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021053.1 protein_id gnl|my_center|LOCUS_19460 3087 3329 gene locus_tag LOCUS_19470 3087 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 3372 3647 gene locus_tag LOCUS_19480 3372 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 3774 4640 gene locus_tag LOCUS_19490 3774 4640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 4681 5346 gene locus_tag LOCUS_19500 4681 5346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 5267 5653 gene locus_tag LOCUS_19510 5267 5653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 5894 7234 gene locus_tag LOCUS_19520 5894 7234 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021346.1 protein_id gnl|my_center|LOCUS_19520 7556 7861 gene locus_tag LOCUS_19530 7556 7861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 8234 8848 gene locus_tag LOCUS_19540 8234 8848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 9101 8892 gene locus_tag LOCUS_19550 9101 8892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 9100 10281 gene locus_tag LOCUS_19560 9100 10281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 10398 11072 gene locus_tag LOCUS_19570 10398 11072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19570 11073 11411 gene locus_tag LOCUS_19580 11073 11411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 11585 12142 gene locus_tag LOCUS_19590 11585 12142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 12480 13154 gene locus_tag LOCUS_19600 12480 13154 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544852.1 protein_id gnl|my_center|LOCUS_19600 13528 13872 gene locus_tag LOCUS_19610 13528 13872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089353.1 protein_id gnl|my_center|LOCUS_19610 13882 15165 gene locus_tag LOCUS_19620 gene rpoE 13882 15165 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226524.1 protein_id gnl|my_center|LOCUS_19620 15589 16830 gene locus_tag LOCUS_19630 15589 16830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 17789 17103 gene locus_tag LOCUS_19640 17789 17103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 19228 18251 gene locus_tag LOCUS_19650 19228 18251 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643856.1 protein_id gnl|my_center|LOCUS_19650 20200 19496 gene locus_tag LOCUS_19660 20200 19496 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090590.1 protein_id gnl|my_center|LOCUS_19660 21429 20197 gene locus_tag LOCUS_19670 gene acd 21429 20197 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225003.1 protein_id gnl|my_center|LOCUS_19670 22349 21597 gene locus_tag LOCUS_19680 22349 21597 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_19680 22705 23748 gene locus_tag LOCUS_19690 22705 23748 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000995968.1 protein_id gnl|my_center|LOCUS_19690 23748 24146 gene locus_tag LOCUS_19700 23748 24146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153016.1 protein_id gnl|my_center|LOCUS_19700 24082 24297 gene locus_tag LOCUS_19710 24082 24297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 24397 25134 gene locus_tag LOCUS_19720 gene fabG 24397 25134 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998676.1 protein_id gnl|my_center|LOCUS_19720 27969 25303 gene locus_tag LOCUS_19730 27969 25303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 29065 28136 gene locus_tag LOCUS_19740 29065 28136 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738680.1 protein_id gnl|my_center|LOCUS_19740 29411 29698 gene locus_tag LOCUS_19750 29411 29698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 29731 31044 gene locus_tag LOCUS_19760 29731 31044 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106962.1 protein_id gnl|my_center|LOCUS_19760 32952 31072 gene locus_tag LOCUS_19770 32952 31072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 34438 33569 gene locus_tag LOCUS_19780 gene lipZ 34438 33569 CDS product putative hydrolase LipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WLR1 protein_id gnl|my_center|LOCUS_19780 34695 34982 gene locus_tag LOCUS_19790 34695 34982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 38482 35147 gene locus_tag LOCUS_19800 38482 35147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 40316 38886 gene locus_tag LOCUS_19810 40316 38886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 40829 41896 gene locus_tag LOCUS_19820 40829 41896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 42628 42125 gene locus_tag LOCUS_19830 42628 42125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 44321 42834 gene locus_tag LOCUS_19840 44321 42834 CDS product flavin-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226334.1 protein_id gnl|my_center|LOCUS_19840 44460 44281 gene locus_tag LOCUS_19850 44460 44281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 44535 45380 gene locus_tag LOCUS_19860 44535 45380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 45452 46567 gene locus_tag LOCUS_19870 45452 46567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 46991 47896 gene locus_tag LOCUS_19880 46991 47896 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738680.1 protein_id gnl|my_center|LOCUS_19880 48936 48133 gene locus_tag LOCUS_19890 gene merR 48936 48133 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123119.1 protein_id gnl|my_center|LOCUS_19890 49234 48929 gene locus_tag LOCUS_19900 49234 48929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 50119 49589 gene locus_tag LOCUS_19910 50119 49589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 50309 50947 gene locus_tag LOCUS_19920 50309 50947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701028.1 protein_id gnl|my_center|LOCUS_19920 51219 52862 gene locus_tag LOCUS_19930 51219 52862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702605.1 protein_id gnl|my_center|LOCUS_19930 52924 53508 gene locus_tag LOCUS_19940 52924 53508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 53505 53933 gene locus_tag LOCUS_19950 53505 53933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 54219 56450 gene locus_tag LOCUS_19960 gene icd 54219 56450 CDS product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942111.1 protein_id gnl|my_center|LOCUS_19960 56954 56661 gene locus_tag LOCUS_19970 56954 56661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 57146 57352 gene locus_tag LOCUS_19980 57146 57352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 58454 57456 gene locus_tag LOCUS_19990 58454 57456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 59428 58649 gene locus_tag LOCUS_20000 59428 58649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 60219 59560 gene locus_tag LOCUS_20010 60219 59560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 60206 60364 gene locus_tag LOCUS_20020 60206 60364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 62677 60428 gene locus_tag LOCUS_20030 gene rssA 62677 60428 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826015.1 protein_id gnl|my_center|LOCUS_20030 62828 63712 gene locus_tag LOCUS_20040 62828 63712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114815.1 protein_id gnl|my_center|LOCUS_20040 63828 64913 gene locus_tag LOCUS_20050 63828 64913 CDS product mechanosensitive ion channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496414.1 protein_id gnl|my_center|LOCUS_20050 65000 65947 gene locus_tag LOCUS_20060 65000 65947 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030232.1 protein_id gnl|my_center|LOCUS_20060 66537 65938 gene locus_tag LOCUS_20070 66537 65938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 67156 66821 gene locus_tag LOCUS_20080 67156 66821 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223037.1 protein_id gnl|my_center|LOCUS_20080 67409 67690 gene locus_tag LOCUS_20090 67409 67690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 67903 68934 gene locus_tag LOCUS_20100 67903 68934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 69115 70143 gene locus_tag LOCUS_20110 69115 70143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 71104 70166 gene locus_tag LOCUS_20120 71104 70166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762383.1 protein_id gnl|my_center|LOCUS_20120 72075 71104 gene locus_tag LOCUS_20130 72075 71104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104214.1 protein_id gnl|my_center|LOCUS_20130 73013 72072 gene locus_tag LOCUS_20140 73013 72072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 73326 73610 gene locus_tag LOCUS_20150 73326 73610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 73709 74725 gene locus_tag LOCUS_20160 73709 74725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 74924 75832 gene locus_tag LOCUS_20170 74924 75832 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104216.1 protein_id gnl|my_center|LOCUS_20170 77512 75896 gene locus_tag LOCUS_20180 77512 75896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104215.1 protein_id gnl|my_center|LOCUS_20180 78237 77506 gene locus_tag LOCUS_20190 78237 77506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206816.1 protein_id gnl|my_center|LOCUS_20190 79272 78262 gene locus_tag LOCUS_20200 79272 78262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 79728 81767 gene locus_tag LOCUS_20210 79728 81767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 81779 82870 gene locus_tag LOCUS_20220 81779 82870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 83083 84771 gene locus_tag LOCUS_20230 83083 84771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205552.1 protein_id gnl|my_center|LOCUS_20230 85085 87880 gene locus_tag LOCUS_20240 85085 87880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 88537 88016 gene locus_tag LOCUS_20250 88537 88016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 89028 88633 gene locus_tag LOCUS_20260 89028 88633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 89632 89156 gene locus_tag LOCUS_20270 89632 89156 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656267.1 protein_id gnl|my_center|LOCUS_20270 90050 89796 gene locus_tag LOCUS_20280 90050 89796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 92797 90068 gene locus_tag LOCUS_20290 92797 90068 CDS product biotin carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564921.1 protein_id gnl|my_center|LOCUS_20290 94533 92983 gene locus_tag LOCUS_20300 94533 92983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 94824 95204 gene locus_tag LOCUS_20310 94824 95204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 96797 95331 gene locus_tag LOCUS_20320 96797 95331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 97402 97064 gene locus_tag LOCUS_20330 97402 97064 CDS product high-potential iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYR1 protein_id gnl|my_center|LOCUS_20330 99270 97564 gene locus_tag LOCUS_20340 gene bglX 99270 97564 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069714.1 protein_id gnl|my_center|LOCUS_20340 99932 99252 gene locus_tag LOCUS_20350 99932 99252 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999543.1 protein_id gnl|my_center|LOCUS_20350 100665 99934 gene locus_tag LOCUS_20360 100665 99934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 100801 101136 gene locus_tag LOCUS_20370 100801 101136 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F8A5 protein_id gnl|my_center|LOCUS_20370 101852 101193 gene locus_tag LOCUS_20380 101852 101193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 102578 101907 gene locus_tag LOCUS_20390 102578 101907 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_20390 102695 103048 gene locus_tag LOCUS_20400 102695 103048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854884.1 protein_id gnl|my_center|LOCUS_20400 103273 103701 gene locus_tag LOCUS_20410 103273 103701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 104475 103714 gene locus_tag LOCUS_20420 gene ttcA 104475 103714 CDS product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ35 protein_id gnl|my_center|LOCUS_20420 104623 105054 gene locus_tag LOCUS_20430 104623 105054 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002069572.1 protein_id gnl|my_center|LOCUS_20430 105054 105497 gene locus_tag LOCUS_20440 105054 105497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 105904 105506 gene locus_tag LOCUS_20450 105904 105506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 106690 106118 gene locus_tag LOCUS_20460 106690 106118 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020839.1 protein_id gnl|my_center|LOCUS_20460 106727 106644 gene locus_tag LOCUS_t00250 106727 106644 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 106919 108295 gene locus_tag LOCUS_20470 gene manB 106919 108295 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092954.1 protein_id gnl|my_center|LOCUS_20470 109466 108468 gene locus_tag LOCUS_20480 109466 108468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 109698 111530 gene locus_tag LOCUS_20490 gene glmS 109698 111530 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZQ1 protein_id gnl|my_center|LOCUS_20490 111551 112768 gene locus_tag LOCUS_20500 111551 112768 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127234.1 protein_id gnl|my_center|LOCUS_20500 112858 113112 gene locus_tag LOCUS_20510 112858 113112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 113326 114516 gene locus_tag LOCUS_20520 113326 114516 CDS product putative RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F9U1 protein_id gnl|my_center|LOCUS_20520 114607 115233 gene locus_tag LOCUS_20530 114607 115233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 115230 115637 gene locus_tag LOCUS_20540 115230 115637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 115644 117179 gene locus_tag LOCUS_20550 gene gltX 115644 117179 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYM3 protein_id gnl|my_center|LOCUS_20550 117360 118145 gene locus_tag LOCUS_20560 gene caiD 117360 118145 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947682.1 protein_id gnl|my_center|LOCUS_20560 118222 119442 gene locus_tag LOCUS_20570 118222 119442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208114.1 protein_id gnl|my_center|LOCUS_20570 119489 119869 gene locus_tag LOCUS_20580 119489 119869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 119877 121001 gene locus_tag LOCUS_20590 119877 121001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 122062 121037 gene locus_tag LOCUS_20600 122062 121037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047667.1 protein_id gnl|my_center|LOCUS_20600 122359 125325 gene locus_tag LOCUS_20610 122359 125325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 125358 128870 gene locus_tag LOCUS_20620 125358 128870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 128867 130291 gene locus_tag LOCUS_20630 128867 130291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 130468 131730 gene locus_tag LOCUS_20640 gene dinB 130468 131730 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7USY7 protein_id gnl|my_center|LOCUS_20640 132745 131864 gene locus_tag LOCUS_20650 132745 131864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 133024 132854 gene locus_tag LOCUS_20660 133024 132854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 134358 133027 gene locus_tag LOCUS_20670 134358 133027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 134561 135301 gene locus_tag LOCUS_20680 134561 135301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946129.1 protein_id gnl|my_center|LOCUS_20680 135301 136785 gene locus_tag LOCUS_20690 135301 136785 CDS product ribosomal protein S6 modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946128.1 protein_id gnl|my_center|LOCUS_20690 136998 136843 gene locus_tag LOCUS_20700 136998 136843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 137539 137018 gene locus_tag LOCUS_20710 137539 137018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 137683 138921 gene locus_tag LOCUS_20720 137683 138921 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946127.1 protein_id gnl|my_center|LOCUS_20720 138971 139639 gene locus_tag LOCUS_20730 138971 139639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946126.1 protein_id gnl|my_center|LOCUS_20730 139654 140532 gene locus_tag LOCUS_20740 139654 140532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 140708 142366 gene locus_tag LOCUS_20750 140708 142366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 142363 145413 gene locus_tag LOCUS_20760 gene acrB 142363 145413 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947422.1 protein_id gnl|my_center|LOCUS_20760 145821 145390 gene locus_tag LOCUS_20770 145821 145390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 145897 146406 gene locus_tag LOCUS_20780 145897 146406 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAE4 protein_id gnl|my_center|LOCUS_20780 146555 147703 gene locus_tag LOCUS_20790 146555 147703 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545327.1 protein_id gnl|my_center|LOCUS_20790 149567 147828 gene locus_tag LOCUS_20800 149567 147828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 151052 149853 gene locus_tag LOCUS_20810 151052 149853 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581182.1 protein_id gnl|my_center|LOCUS_20810 151774 151163 gene locus_tag LOCUS_20820 151774 151163 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729197.1 protein_id gnl|my_center|LOCUS_20820 154187 151866 gene locus_tag LOCUS_20830 154187 151866 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069784.1 protein_id gnl|my_center|LOCUS_20830 155596 154262 gene locus_tag LOCUS_20840 155596 154262 CDS product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214763.1 protein_id gnl|my_center|LOCUS_20840 157434 155656 gene locus_tag LOCUS_20850 157434 155656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 157690 158517 gene locus_tag LOCUS_20860 157690 158517 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869527.1 protein_id gnl|my_center|LOCUS_20860 158523 159611 gene locus_tag LOCUS_20870 158523 159611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 161254 159608 gene locus_tag LOCUS_20880 gene gltB2 161254 159608 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181592.1 protein_id gnl|my_center|LOCUS_20880 161630 161265 gene locus_tag LOCUS_20890 161630 161265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524281.1 protein_id gnl|my_center|LOCUS_20890 163018 161759 gene locus_tag LOCUS_20900 163018 161759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 163331 163552 gene locus_tag LOCUS_20910 163331 163552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 163865 164059 gene locus_tag LOCUS_20920 163865 164059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 166886 164259 gene locus_tag LOCUS_20930 166886 164259 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002081021.1 protein_id gnl|my_center|LOCUS_20930 169400 166899 gene locus_tag LOCUS_20940 169400 166899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 170739 169642 gene locus_tag LOCUS_20950 170739 169642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 171228 170749 gene locus_tag LOCUS_20960 171228 170749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 172465 171278 gene locus_tag LOCUS_20970 gene bioF 172465 171278 CDS product putative 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HE48 protein_id gnl|my_center|LOCUS_20970 172622 173497 gene locus_tag LOCUS_20980 gene acuC 172622 173497 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141968.1 protein_id gnl|my_center|LOCUS_20980 176790 173494 gene locus_tag LOCUS_20990 176790 173494 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112417.1 protein_id gnl|my_center|LOCUS_20990 177136 176825 gene locus_tag LOCUS_21000 177136 176825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 177543 177196 gene locus_tag LOCUS_21010 177543 177196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 179669 177651 gene locus_tag LOCUS_21020 179669 177651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 179755 180636 gene locus_tag LOCUS_21030 179755 180636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 181383 180691 gene locus_tag LOCUS_21040 gene lytT 181383 180691 CDS product sensory transduction protein LytT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q82Z76 protein_id gnl|my_center|LOCUS_21040 181716 182672 gene locus_tag LOCUS_21050 181716 182672 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978337.1 protein_id gnl|my_center|LOCUS_21050 183815 182799 gene locus_tag LOCUS_21060 gene rfaD 183815 182799 CDS product ADP-L-glycero-D-manno-heptose-6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHY3 protein_id gnl|my_center|LOCUS_21060 184024 184341 gene locus_tag LOCUS_21070 184024 184341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 184494 185405 gene locus_tag LOCUS_21080 184494 185405 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267092.1 protein_id gnl|my_center|LOCUS_21080 185566 185862 gene locus_tag LOCUS_21090 185566 185862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 185859 186266 gene locus_tag LOCUS_21100 185859 186266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 187256 186366 gene locus_tag LOCUS_21110 187256 186366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 188110 187400 gene locus_tag LOCUS_21120 gene gufA 188110 187400 CDS product divalent cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123018.1 protein_id gnl|my_center|LOCUS_21120 188653 188183 gene locus_tag LOCUS_21130 gene ypeA 188653 188183 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804508.1 protein_id gnl|my_center|LOCUS_21130 189026 188691 gene locus_tag LOCUS_21140 189026 188691 CDS product dksA/traR C4-type zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937600.1 protein_id gnl|my_center|LOCUS_21140 189122 191203 gene locus_tag LOCUS_21150 189122 191203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 191764 191300 gene locus_tag LOCUS_21160 gene mscL 191764 191300 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD14 protein_id gnl|my_center|LOCUS_21160 191881 193659 gene locus_tag LOCUS_21170 191881 193659 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144121.1 protein_id gnl|my_center|LOCUS_21170 193659 194243 gene locus_tag LOCUS_21180 193659 194243 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088324.1 protein_id gnl|my_center|LOCUS_21180 194320 197010 gene locus_tag LOCUS_21190 194320 197010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 197156 198412 gene locus_tag LOCUS_21200 gene rmuC 197156 198412 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 protein_id gnl|my_center|LOCUS_21200 198537 199445 gene locus_tag LOCUS_21210 198537 199445 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592852.1 protein_id gnl|my_center|LOCUS_21210 200076 199450 gene locus_tag LOCUS_21220 200076 199450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 200211 201854 gene locus_tag LOCUS_21230 200211 201854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 202627 202172 gene locus_tag LOCUS_21240 202627 202172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 203765 202743 gene locus_tag LOCUS_21250 203765 202743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 204255 203854 gene locus_tag LOCUS_21260 204255 203854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 204471 205049 gene locus_tag LOCUS_21270 204471 205049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 206266 205229 gene locus_tag LOCUS_21280 206266 205229 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088575.1 protein_id gnl|my_center|LOCUS_21280 207104 206319 gene locus_tag LOCUS_21290 207104 206319 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083971.1 protein_id gnl|my_center|LOCUS_21290 207194 207868 gene locus_tag LOCUS_21300 207194 207868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 207849 209018 gene locus_tag LOCUS_21310 207849 209018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 209098 210015 gene locus_tag LOCUS_21320 209098 210015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 210567 210145 gene locus_tag LOCUS_21330 210567 210145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 210655 211425 gene locus_tag LOCUS_21340 210655 211425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 212095 211472 gene locus_tag LOCUS_21350 212095 211472 CDS product putative transcriptional regulator, TetR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702265.1 protein_id gnl|my_center|LOCUS_21350 213425 212175 gene locus_tag LOCUS_21360 gene paaJ 213425 212175 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390637.1 protein_id gnl|my_center|LOCUS_21360 213486 214193 gene locus_tag LOCUS_21370 213486 214193 CDS product endoflagellar filament sheath protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227585.1 protein_id gnl|my_center|LOCUS_21370 214221 215249 gene locus_tag LOCUS_21380 214221 215249 CDS product flagellar filament outer layer protein Flaa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001972005.1 protein_id gnl|my_center|LOCUS_21380 215552 216646 gene locus_tag LOCUS_21390 215552 216646 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978063.1 protein_id gnl|my_center|LOCUS_21390 216673 217719 gene locus_tag LOCUS_21400 216673 217719 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941284.1 protein_id gnl|my_center|LOCUS_21400 217722 218852 gene locus_tag LOCUS_21410 217722 218852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 219770 218988 gene locus_tag LOCUS_21420 219770 218988 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022303.1 protein_id gnl|my_center|LOCUS_21420 220206 219808 gene locus_tag LOCUS_21430 220206 219808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153016.1 protein_id gnl|my_center|LOCUS_21430 221289 220273 gene locus_tag LOCUS_21440 221289 220273 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000995968.1 protein_id gnl|my_center|LOCUS_21440 221358 222497 gene locus_tag LOCUS_21450 221358 222497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767375.1 protein_id gnl|my_center|LOCUS_21450 222544 224880 gene locus_tag LOCUS_21460 222544 224880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 225094 226179 gene locus_tag LOCUS_21470 225094 226179 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021039.1 protein_id gnl|my_center|LOCUS_21470 226614 227972 gene locus_tag LOCUS_21480 gene erg3 226614 227972 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 protein_id gnl|my_center|LOCUS_21480 229339 228020 gene locus_tag LOCUS_21490 229339 228020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229352.1 protein_id gnl|my_center|LOCUS_21490 230171 229419 gene locus_tag LOCUS_21500 230171 229419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 230656 230174 gene locus_tag LOCUS_21510 230656 230174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 231170 230646 gene locus_tag LOCUS_21520 gene yfiT 231170 230646 CDS product putative metal-dependent hydrolase YfiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31562 protein_id gnl|my_center|LOCUS_21520 232387 231170 gene locus_tag LOCUS_21530 gene caiA 232387 231170 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348045.1 protein_id gnl|my_center|LOCUS_21530 232564 233910 gene locus_tag LOCUS_21540 232564 233910 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083372.1 protein_id gnl|my_center|LOCUS_21540 235158 234076 gene locus_tag LOCUS_21550 235158 234076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112360.1 protein_id gnl|my_center|LOCUS_21550 236495 235434 gene locus_tag LOCUS_21560 236495 235434 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768437.1 protein_id gnl|my_center|LOCUS_21560 237878 236613 gene locus_tag LOCUS_21570 237878 236613 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056650.1 protein_id gnl|my_center|LOCUS_21570 238516 238049 gene locus_tag LOCUS_21580 238516 238049 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360600.1 protein_id gnl|my_center|LOCUS_21580 238633 239481 gene locus_tag LOCUS_21590 238633 239481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 239574 240365 gene locus_tag LOCUS_21600 239574 240365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963620.1 protein_id gnl|my_center|LOCUS_21600 240803 240489 gene locus_tag LOCUS_21610 240803 240489 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKP7 protein_id gnl|my_center|LOCUS_21610 240935 241648 gene locus_tag LOCUS_21620 240935 241648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21620 241682 242842 gene locus_tag LOCUS_21630 241682 242842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21630 243014 244951 gene locus_tag LOCUS_21640 gene faa1 243014 244951 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277633.1 protein_id gnl|my_center|LOCUS_21640 245060 246061 gene locus_tag LOCUS_21650 245060 246061 CDS product sodium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865853.1 protein_id gnl|my_center|LOCUS_21650 246189 246782 gene locus_tag LOCUS_21660 246189 246782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 247414 246791 gene locus_tag LOCUS_21670 247414 246791 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856975.1 protein_id gnl|my_center|LOCUS_21670 247514 248389 gene locus_tag LOCUS_21680 247514 248389 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559672.1 protein_id gnl|my_center|LOCUS_21680 248854 248504 gene locus_tag LOCUS_21690 248854 248504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 249291 251264 gene locus_tag LOCUS_21700 249291 251264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 251354 253222 gene locus_tag LOCUS_21710 251354 253222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 254503 253535 gene locus_tag LOCUS_21720 254503 253535 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701174.1 protein_id gnl|my_center|LOCUS_21720 255373 254618 gene locus_tag LOCUS_21730 255373 254618 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525829.1 protein_id gnl|my_center|LOCUS_21730 255903 257618 gene locus_tag LOCUS_21740 gene ssl2 255903 257618 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042798.1 protein_id gnl|my_center|LOCUS_21740 257675 259993 gene locus_tag LOCUS_21750 257675 259993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 260101 261276 gene locus_tag LOCUS_21760 gene erg3 260101 261276 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162077.1 protein_id gnl|my_center|LOCUS_21760 262043 261321 gene locus_tag LOCUS_21770 262043 261321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 262125 263939 gene locus_tag LOCUS_21780 gene sglT 262125 263939 CDS product sodium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036949.1 protein_id gnl|my_center|LOCUS_21780 264073 265224 gene locus_tag LOCUS_21790 264073 265224 CDS product alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314866.1 protein_id gnl|my_center|LOCUS_21790 265272 266291 gene locus_tag LOCUS_21800 265272 266291 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442797.1 protein_id gnl|my_center|LOCUS_21800 267068 266439 gene locus_tag LOCUS_21810 267068 266439 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405414.1 protein_id gnl|my_center|LOCUS_21810 269411 267153 gene locus_tag LOCUS_21820 269411 267153 CDS product thio:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918106.1 protein_id gnl|my_center|LOCUS_21820 269822 270913 gene locus_tag LOCUS_21830 269822 270913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 271387 271046 gene locus_tag LOCUS_21840 271387 271046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 272069 271509 gene locus_tag LOCUS_21850 gene def 272069 271509 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93LE9 protein_id gnl|my_center|LOCUS_21850 272219 272146 gene locus_tag LOCUS_t00260 272219 272146 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 272406 273767 gene locus_tag LOCUS_21860 272406 273767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 273764 276502 gene locus_tag LOCUS_21870 273764 276502 CDS product serine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612757.1 protein_id gnl|my_center|LOCUS_21870 276570 276905 gene locus_tag LOCUS_21880 gene spoIIAA 276570 276905 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7V3 protein_id gnl|my_center|LOCUS_21880 276909 279344 gene locus_tag LOCUS_21890 276909 279344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 279538 280521 gene locus_tag LOCUS_21900 279538 280521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 281192 280461 gene locus_tag LOCUS_21910 281192 280461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 283169 281268 gene locus_tag LOCUS_21920 gene fadD 283169 281268 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845063.1 protein_id gnl|my_center|LOCUS_21920 283219 284028 gene locus_tag LOCUS_21930 gene pyrF 283219 284028 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962701.1 protein_id gnl|my_center|LOCUS_21930 284365 285039 gene locus_tag LOCUS_21940 284365 285039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345920.1 protein_id gnl|my_center|LOCUS_21940 285076 286992 gene locus_tag LOCUS_21950 gene sdhA 285076 286992 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050920.1 protein_id gnl|my_center|LOCUS_21950 286989 287744 gene locus_tag LOCUS_21960 286989 287744 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364422.1 protein_id gnl|my_center|LOCUS_21960 287747 288091 gene locus_tag LOCUS_21970 287747 288091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 288093 288410 gene locus_tag LOCUS_21980 288093 288410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 288473 288901 gene locus_tag LOCUS_21990 288473 288901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 289582 289067 gene locus_tag LOCUS_22000 289582 289067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 289663 290034 gene locus_tag LOCUS_22010 289663 290034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 291207 290119 gene locus_tag LOCUS_22020 291207 290119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 292327 291272 gene locus_tag LOCUS_22030 292327 291272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 293662 292559 gene locus_tag LOCUS_22040 gene pyrC 293662 292559 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83B17 protein_id gnl|my_center|LOCUS_22040 294682 293990 gene locus_tag LOCUS_22050 294682 293990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 295590 294679 gene locus_tag LOCUS_22060 295590 294679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 296304 295624 gene locus_tag LOCUS_22070 296304 295624 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RI70 protein_id gnl|my_center|LOCUS_22070 296316 296528 gene locus_tag LOCUS_22080 296316 296528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 296548 296910 gene locus_tag LOCUS_22090 296548 296910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 296925 298472 gene locus_tag LOCUS_22100 296925 298472 CDS product UDP phosphate-alpha-4-amino-4-deoxy-L-arabinose arabinosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506556.1 protein_id gnl|my_center|LOCUS_22100 298509 299240 gene locus_tag LOCUS_22110 298509 299240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 299255 300157 gene locus_tag LOCUS_22120 299255 300157 CDS product 2-polyprenyl-3-methyl-5-hydroxy-6-metoxy-1,4-benzoquinol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283287.1 protein_id gnl|my_center|LOCUS_22120 302025 300163 gene locus_tag LOCUS_22130 302025 300163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 302296 304122 gene locus_tag LOCUS_22140 302296 304122 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FP69 protein_id gnl|my_center|LOCUS_22140 305232 304291 gene locus_tag LOCUS_22150 305232 304291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775834.1 protein_id gnl|my_center|LOCUS_22150 305898 305254 gene locus_tag LOCUS_22160 305898 305254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 306375 306100 gene locus_tag LOCUS_22170 306375 306100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 307302 309026 gene locus_tag LOCUS_22180 307302 309026 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365019.1 protein_id gnl|my_center|LOCUS_22180 310969 309110 gene locus_tag LOCUS_22190 310969 309110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 313170 310975 gene locus_tag LOCUS_22200 313170 310975 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388417.1 protein_id gnl|my_center|LOCUS_22200 314963 313659 gene locus_tag LOCUS_22210 gene hisD 314963 313659 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F393 protein_id gnl|my_center|LOCUS_22210 316037 315057 gene locus_tag LOCUS_22220 316037 315057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 316479 316940 gene locus_tag LOCUS_22230 gene nrfC 316479 316940 CDS product cytochrome c nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325128.1 protein_id gnl|my_center|LOCUS_22230 316937 318310 gene locus_tag LOCUS_22240 gene nrfA 316937 318310 CDS product cytochrome c-552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJN5 protein_id gnl|my_center|LOCUS_22240 318435 319685 gene locus_tag LOCUS_22250 318435 319685 CDS product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262931.1 protein_id gnl|my_center|LOCUS_22250 320282 319854 gene locus_tag LOCUS_22260 320282 319854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477375.1 protein_id gnl|my_center|LOCUS_22260 320619 320960 gene locus_tag LOCUS_22270 320619 320960 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808563.1 protein_id gnl|my_center|LOCUS_22270 320957 321424 gene locus_tag LOCUS_22280 320957 321424 CDS product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126727.1 protein_id gnl|my_center|LOCUS_22280 322800 321421 gene locus_tag LOCUS_22290 322800 321421 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085627.1 protein_id gnl|my_center|LOCUS_22290 322942 325404 gene locus_tag LOCUS_22300 322942 325404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 325478 326092 gene locus_tag LOCUS_22310 325478 326092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 326089 327885 gene locus_tag LOCUS_22320 gene caiA 326089 327885 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615702.1 protein_id gnl|my_center|LOCUS_22320 328113 328481 gene locus_tag LOCUS_22330 328113 328481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 328827 328754 gene locus_tag LOCUS_t00270 328827 328754 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 329113 328835 gene locus_tag LOCUS_22340 gene rpsT 329113 328835 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZQ3 protein_id gnl|my_center|LOCUS_22340 329259 330518 gene locus_tag LOCUS_22350 329259 330518 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455556.1 protein_id gnl|my_center|LOCUS_22350 330520 331602 gene locus_tag LOCUS_22360 330520 331602 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918546.1 protein_id gnl|my_center|LOCUS_22360 331599 332243 gene locus_tag LOCUS_22370 gene crp 331599 332243 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367409.1 protein_id gnl|my_center|LOCUS_22370 332212 333351 gene locus_tag LOCUS_22380 332212 333351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 333809 333474 gene locus_tag LOCUS_22390 333809 333474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 334454 333912 gene locus_tag LOCUS_22400 334454 333912 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5A2 protein_id gnl|my_center|LOCUS_22400 336633 334699 gene locus_tag LOCUS_22410 gene argS 336633 334699 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F5J3 protein_id gnl|my_center|LOCUS_22410 337452 336664 gene locus_tag LOCUS_22420 337452 336664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 339019 337670 gene locus_tag LOCUS_22430 339019 337670 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_22430 339803 339033 gene locus_tag LOCUS_22440 339803 339033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 341319 339805 gene locus_tag LOCUS_22450 341319 339805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 341462 341914 gene locus_tag LOCUS_22460 341462 341914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 342065 343132 gene locus_tag LOCUS_22470 342065 343132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468938.1 protein_id gnl|my_center|LOCUS_22470 344982 343255 gene locus_tag LOCUS_22480 gene thiC 344982 343255 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45740 protein_id gnl|my_center|LOCUS_22480 346746 345424 gene locus_tag LOCUS_22490 346746 345424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 348212 346896 gene locus_tag LOCUS_22500 gene add 348212 346896 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229174.1 protein_id gnl|my_center|LOCUS_22500 351528 348271 gene locus_tag LOCUS_22510 351528 348271 CDS product serine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521953.1 protein_id gnl|my_center|LOCUS_22510 352724 351780 gene locus_tag LOCUS_22520 gene lpxC 352724 351780 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3U4 protein_id gnl|my_center|LOCUS_22520 353267 353019 gene locus_tag LOCUS_22530 353267 353019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 354417 353533 gene locus_tag LOCUS_22540 gene rluA 354417 353533 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F9H2 protein_id gnl|my_center|LOCUS_22540 354547 355071 gene locus_tag LOCUS_22550 354547 355071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 355183 355656 gene locus_tag LOCUS_22560 355183 355656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 355930 356325 gene locus_tag LOCUS_22570 355930 356325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 356309 357079 gene locus_tag LOCUS_22580 356309 357079 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529920.1 protein_id gnl|my_center|LOCUS_22580 357207 358652 gene locus_tag LOCUS_22590 357207 358652 CDS product two-component system sensor histidine kinase CreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388499.1 protein_id gnl|my_center|LOCUS_22590 358822 360168 gene locus_tag LOCUS_22600 gene creD 358822 360168 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214632.1 protein_id gnl|my_center|LOCUS_22600 360319 361572 gene locus_tag LOCUS_22610 360319 361572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796266.1 protein_id gnl|my_center|LOCUS_22610 361662 362234 gene locus_tag LOCUS_22620 361662 362234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 362788 362252 gene locus_tag LOCUS_22630 362788 362252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112637.1 protein_id gnl|my_center|LOCUS_22630 364723 363056 gene locus_tag LOCUS_22640 364723 363056 CDS product cholesterol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222688.1 protein_id gnl|my_center|LOCUS_22640 364757 365776 gene locus_tag LOCUS_22650 364757 365776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 365786 366961 gene locus_tag LOCUS_22660 365786 366961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 369154 367031 gene locus_tag LOCUS_22670 369154 367031 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449670.1 protein_id gnl|my_center|LOCUS_22670 369993 369334 gene locus_tag LOCUS_22680 369993 369334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 372082 370202 gene locus_tag LOCUS_22690 372082 370202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 373098 372073 gene locus_tag LOCUS_22700 373098 372073 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531243.1 protein_id gnl|my_center|LOCUS_22700 373829 373095 gene locus_tag LOCUS_22710 373829 373095 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140583.1 protein_id gnl|my_center|LOCUS_22710 373765 373956 gene locus_tag LOCUS_22720 373765 373956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 374066 374668 gene locus_tag LOCUS_22730 374066 374668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 375284 374985 gene locus_tag LOCUS_22740 gene ydzA 375284 374985 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963096.1 protein_id gnl|my_center|LOCUS_22740 376016 375489 gene locus_tag LOCUS_22750 376016 375489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 376398 376003 gene locus_tag LOCUS_22760 376398 376003 CDS product biopolymer transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_602633.2 protein_id gnl|my_center|LOCUS_22760 377042 376395 gene locus_tag LOCUS_22770 377042 376395 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017058.1 protein_id gnl|my_center|LOCUS_22770 377078 377584 gene locus_tag LOCUS_22780 377078 377584 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256620.1 protein_id gnl|my_center|LOCUS_22780 377644 378201 gene locus_tag LOCUS_22790 377644 378201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 378285 378830 gene locus_tag LOCUS_22800 378285 378830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 380617 378851 gene locus_tag LOCUS_22810 gene cstA 380617 378851 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67304 protein_id gnl|my_center|LOCUS_22810 380768 381616 gene locus_tag LOCUS_22820 gene tatD 380768 381616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253693.1 protein_id gnl|my_center|LOCUS_22820 383358 381661 gene locus_tag LOCUS_22830 383358 381661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942511.1 protein_id gnl|my_center|LOCUS_22830 383482 384747 gene locus_tag LOCUS_22840 gene serS 383482 384747 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EY78 protein_id gnl|my_center|LOCUS_22840 384847 385848 gene locus_tag LOCUS_22850 384847 385848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 386193 387380 gene locus_tag LOCUS_22860 386193 387380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 387597 388010 gene locus_tag LOCUS_22870 387597 388010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 388468 389190 gene locus_tag LOCUS_22880 388468 389190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 389200 390570 gene locus_tag LOCUS_22890 gene norB 389200 390570 CDS product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707560.1 protein_id gnl|my_center|LOCUS_22890 390567 391358 gene locus_tag LOCUS_22900 gene nirQ 390567 391358 CDS product denitrification regulatory protein NirQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51481 protein_id gnl|my_center|LOCUS_22900 391855 393240 gene locus_tag LOCUS_22910 391855 393240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 393253 393900 gene locus_tag LOCUS_22920 393253 393900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 394131 394667 gene locus_tag LOCUS_22930 394131 394667 CDS product cytochrome C oxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118864.1 protein_id gnl|my_center|LOCUS_22930 394664 394900 gene locus_tag LOCUS_22940 394664 394900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 395687 395202 gene locus_tag LOCUS_22950 395687 395202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 396199 395756 gene locus_tag LOCUS_22960 gene nsrR 396199 395756 CDS product HTH-type transcriptional regulator NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07573 protein_id gnl|my_center|LOCUS_22960 396961 396449 gene locus_tag LOCUS_22970 396961 396449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 397191 397460 gene locus_tag LOCUS_22980 397191 397460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 397495 398565 gene locus_tag LOCUS_22990 397495 398565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 398562 399815 gene locus_tag LOCUS_23000 398562 399815 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707565.1 protein_id gnl|my_center|LOCUS_23000 399812 400237 gene locus_tag LOCUS_23010 399812 400237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 400977 402143 gene locus_tag LOCUS_23020 400977 402143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117866.1 protein_id gnl|my_center|LOCUS_23020 402429 402611 gene locus_tag LOCUS_23030 402429 402611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 403477 402815 gene locus_tag LOCUS_23040 403477 402815 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403974.1 protein_id gnl|my_center|LOCUS_23040 403704 403462 gene locus_tag LOCUS_23050 403704 403462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 403703 404158 gene locus_tag LOCUS_23060 403703 404158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 404628 404188 gene locus_tag LOCUS_23070 404628 404188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 405145 406719 gene locus_tag LOCUS_23080 405145 406719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686596.1 protein_id gnl|my_center|LOCUS_23080 406903 408282 gene locus_tag LOCUS_23090 406903 408282 CDS product nitrite reductase, copper-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200986.1 protein_id gnl|my_center|LOCUS_23090 408381 409148 gene locus_tag LOCUS_23100 408381 409148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689183.1 protein_id gnl|my_center|LOCUS_23100 409173 409892 gene locus_tag LOCUS_23110 409173 409892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 410732 410133 gene locus_tag LOCUS_23120 410732 410133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 410893 412179 gene locus_tag LOCUS_23130 410893 412179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 412320 413777 gene locus_tag LOCUS_23140 412320 413777 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257950.1 protein_id gnl|my_center|LOCUS_23140 414217 415551 gene locus_tag LOCUS_23150 414217 415551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 415711 416181 gene locus_tag LOCUS_23160 415711 416181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 416496 417275 gene locus_tag LOCUS_23170 416496 417275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 417409 418821 gene locus_tag LOCUS_23180 417409 418821 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477226.1 protein_id gnl|my_center|LOCUS_23180 418900 419649 gene locus_tag LOCUS_23190 418900 419649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063818.1 protein_id gnl|my_center|LOCUS_23190 419790 420521 gene locus_tag LOCUS_23200 419790 420521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 420527 421837 gene locus_tag LOCUS_23210 420527 421837 CDS product collagenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993821.1 protein_id gnl|my_center|LOCUS_23210 422700 422206 gene locus_tag LOCUS_23220 422700 422206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 424579 422987 gene locus_tag LOCUS_23230 gene yhcX 424579 422987 CDS product hydrolase YhcX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54608 protein_id gnl|my_center|LOCUS_23230 425329 424592 gene locus_tag LOCUS_23240 425329 424592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 425853 427727 gene locus_tag LOCUS_23250 425853 427727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 428553 427885 gene locus_tag LOCUS_23260 428553 427885 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081289.1 protein_id gnl|my_center|LOCUS_23260 428661 429176 gene locus_tag LOCUS_23270 428661 429176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 429305 429742 gene locus_tag LOCUS_23280 429305 429742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 429744 430295 gene locus_tag LOCUS_23290 429744 430295 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037753.1 protein_id gnl|my_center|LOCUS_23290 431047 430418 gene locus_tag LOCUS_23300 gene tpm 431047 430418 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963562.1 protein_id gnl|my_center|LOCUS_23300 431276 432127 gene locus_tag LOCUS_23310 431276 432127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615243.1 protein_id gnl|my_center|LOCUS_23310 432135 432734 gene locus_tag LOCUS_23320 432135 432734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 433015 433698 gene locus_tag LOCUS_23330 433015 433698 CDS product photosynthetic protein synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049241.1 protein_id gnl|my_center|LOCUS_23330 433723 434889 gene locus_tag LOCUS_23340 433723 434889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 434947 436005 gene locus_tag LOCUS_23350 434947 436005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 436969 436106 gene locus_tag LOCUS_23360 436969 436106 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 protein_id gnl|my_center|LOCUS_23360 437644 437078 gene locus_tag LOCUS_23370 437644 437078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 438378 437689 gene locus_tag LOCUS_23380 438378 437689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846138.1 protein_id gnl|my_center|LOCUS_23380 440183 438375 gene locus_tag LOCUS_23390 440183 438375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 441753 440527 gene locus_tag LOCUS_23400 gene pgk 441753 440527 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WKE4 protein_id gnl|my_center|LOCUS_23400 442966 441971 gene locus_tag LOCUS_23410 442966 441971 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MS4 protein_id gnl|my_center|LOCUS_23410 443439 443008 gene locus_tag LOCUS_23420 gene uspA 443439 443008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188723.1 protein_id gnl|my_center|LOCUS_23420 443539 443988 gene locus_tag LOCUS_23430 443539 443988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 444082 444774 gene locus_tag LOCUS_23440 444082 444774 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105413.1 protein_id gnl|my_center|LOCUS_23440 445881 444901 gene locus_tag LOCUS_23450 445881 444901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 445975 447102 gene locus_tag LOCUS_23460 445975 447102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796266.1 protein_id gnl|my_center|LOCUS_23460 447121 447561 gene locus_tag LOCUS_23470 447121 447561 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258944.1 protein_id gnl|my_center|LOCUS_23470 450682 447578 gene locus_tag LOCUS_23480 450682 447578 CDS product serine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521953.1 protein_id gnl|my_center|LOCUS_23480 450873 451544 gene locus_tag LOCUS_23490 450873 451544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 451879 453381 gene locus_tag LOCUS_23500 451879 453381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 453383 455833 gene locus_tag LOCUS_23510 453383 455833 CDS product UPF0753 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCK3 protein_id gnl|my_center|LOCUS_23510 456839 455925 gene locus_tag LOCUS_23520 456839 455925 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 protein_id gnl|my_center|LOCUS_23520 456977 457087 gene locus_tag LOCUS_r00010 456977 457087 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence06 4397 279 gene locus_tag LOCUS_23530 4397 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 4461 5231 gene locus_tag LOCUS_23540 4461 5231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 6312 5398 gene locus_tag LOCUS_23550 6312 5398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 7506 6412 gene locus_tag LOCUS_23560 7506 6412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 8500 7862 gene locus_tag LOCUS_23570 8500 7862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 11344 8858 gene locus_tag LOCUS_23580 11344 8858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 11402 12034 gene locus_tag LOCUS_23590 11402 12034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 12172 13299 gene locus_tag LOCUS_23600 12172 13299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 15477 13540 gene locus_tag LOCUS_23610 15477 13540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 16338 15757 gene locus_tag LOCUS_23620 16338 15757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 17257 16445 gene locus_tag LOCUS_23630 17257 16445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 17340 18380 gene locus_tag LOCUS_23640 17340 18380 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701174.1 protein_id gnl|my_center|LOCUS_23640 18808 18374 gene locus_tag LOCUS_23650 18808 18374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 19554 18853 gene locus_tag LOCUS_23660 gene yniC 19554 18853 CDS product 2-deoxyglucose-6-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070789.1 protein_id gnl|my_center|LOCUS_23660 19610 20944 gene locus_tag LOCUS_23670 19610 20944 CDS product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931864.1 protein_id gnl|my_center|LOCUS_23670 21203 22543 gene locus_tag LOCUS_23680 21203 22543 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918539.1 protein_id gnl|my_center|LOCUS_23680 23230 22682 gene locus_tag LOCUS_23690 23230 22682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 24093 23293 gene locus_tag LOCUS_23700 24093 23293 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667234.1 protein_id gnl|my_center|LOCUS_23700 25152 24124 gene locus_tag LOCUS_23710 25152 24124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 25232 25831 gene locus_tag LOCUS_23720 25232 25831 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941355.1 protein_id gnl|my_center|LOCUS_23720 28586 25869 gene locus_tag LOCUS_23730 28586 25869 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948919.1 protein_id gnl|my_center|LOCUS_23730 29085 28570 gene locus_tag LOCUS_23740 29085 28570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 29761 29435 gene locus_tag LOCUS_23750 29761 29435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 30256 29762 gene locus_tag LOCUS_23760 30256 29762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 31623 30289 gene locus_tag LOCUS_23770 31623 30289 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073459.1 protein_id gnl|my_center|LOCUS_23770 32281 31733 gene locus_tag LOCUS_23780 32281 31733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 32481 32281 gene locus_tag LOCUS_23790 32481 32281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 33334 32471 gene locus_tag LOCUS_23800 33334 32471 CDS product cytochrome c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391078.1 protein_id gnl|my_center|LOCUS_23800 34803 33355 gene locus_tag LOCUS_23810 34803 33355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23810 35082 35858 gene locus_tag LOCUS_23820 35082 35858 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063877.1 protein_id gnl|my_center|LOCUS_23820 35855 38434 gene locus_tag LOCUS_23830 35855 38434 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403467.1 protein_id gnl|my_center|LOCUS_23830 38786 39646 gene locus_tag LOCUS_23840 38786 39646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 40391 39837 gene locus_tag LOCUS_23850 40391 39837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_599952.1 protein_id gnl|my_center|LOCUS_23850 41009 40614 gene locus_tag LOCUS_23860 41009 40614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 42228 41134 gene locus_tag LOCUS_23870 42228 41134 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201655.1 protein_id gnl|my_center|LOCUS_23870 42298 43449 gene locus_tag LOCUS_23880 42298 43449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 43454 44119 gene locus_tag LOCUS_23890 43454 44119 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105364.1 protein_id gnl|my_center|LOCUS_23890 44141 44824 gene locus_tag LOCUS_23900 44141 44824 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019283.1 protein_id gnl|my_center|LOCUS_23900 44852 45532 gene locus_tag LOCUS_23910 44852 45532 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873009.1 protein_id gnl|my_center|LOCUS_23910 46307 47677 gene locus_tag LOCUS_23920 46307 47677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 47689 49695 gene locus_tag LOCUS_23930 47689 49695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 49692 50045 gene locus_tag LOCUS_23940 49692 50045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 50347 52125 gene locus_tag LOCUS_23950 50347 52125 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071261.1 protein_id gnl|my_center|LOCUS_23950 52940 52122 gene locus_tag LOCUS_23960 52940 52122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 54256 53027 gene locus_tag LOCUS_23970 54256 53027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 54456 54653 gene locus_tag LOCUS_23980 54456 54653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 59388 56242 gene locus_tag LOCUS_23990 59388 56242 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844282.1 protein_id gnl|my_center|LOCUS_23990 60981 59401 gene locus_tag LOCUS_24000 60981 59401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 62552 60981 gene locus_tag LOCUS_24010 62552 60981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 63850 62567 gene locus_tag LOCUS_24020 63850 62567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 65442 63940 gene locus_tag LOCUS_24030 65442 63940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 65791 65426 gene locus_tag LOCUS_24040 65791 65426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 66300 67181 gene locus_tag LOCUS_24050 66300 67181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 67270 68127 gene locus_tag LOCUS_24060 67270 68127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 70077 68221 gene locus_tag LOCUS_24070 70077 68221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 71385 70621 gene locus_tag LOCUS_24080 gene caiD 71385 70621 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947682.1 protein_id gnl|my_center|LOCUS_24080 72140 71451 gene locus_tag LOCUS_24090 72140 71451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 72765 74972 gene locus_tag LOCUS_24100 72765 74972 CDS product catalase peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814129.1 protein_id gnl|my_center|LOCUS_24100 76252 75128 gene locus_tag LOCUS_24110 gene rhlE 76252 75128 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKS5 protein_id gnl|my_center|LOCUS_24110 76614 76360 gene locus_tag LOCUS_24120 76614 76360 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_24120 77131 77940 gene locus_tag LOCUS_24130 77131 77940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 78797 77961 gene locus_tag LOCUS_24140 78797 77961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 80637 79042 gene locus_tag LOCUS_24150 80637 79042 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895689.1 protein_id gnl|my_center|LOCUS_24150 81101 81970 gene locus_tag LOCUS_24160 81101 81970 CDS product type 11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258363.1 protein_id gnl|my_center|LOCUS_24160 81967 83121 gene locus_tag LOCUS_24170 81967 83121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704031.1 protein_id gnl|my_center|LOCUS_24170 83123 84616 gene locus_tag LOCUS_24180 83123 84616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 84719 86080 gene locus_tag LOCUS_24190 84719 86080 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258472.1 protein_id gnl|my_center|LOCUS_24190 87698 86499 gene locus_tag LOCUS_24200 87698 86499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 88729 87983 gene locus_tag LOCUS_24210 88729 87983 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403965.1 protein_id gnl|my_center|LOCUS_24210 89207 88842 gene locus_tag LOCUS_24220 89207 88842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975039.1 protein_id gnl|my_center|LOCUS_24220 90211 89330 gene locus_tag LOCUS_24230 90211 89330 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198301.1 protein_id gnl|my_center|LOCUS_24230 90543 90959 gene locus_tag LOCUS_24240 90543 90959 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975073.1 protein_id gnl|my_center|LOCUS_24240 90919 91521 gene locus_tag LOCUS_24250 90919 91521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 92807 91680 gene locus_tag LOCUS_24260 92807 91680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 94520 94161 gene locus_tag LOCUS_24270 94520 94161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 95110 94880 gene locus_tag LOCUS_24280 95110 94880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 95481 95107 gene locus_tag LOCUS_24290 95481 95107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 96169 95798 gene locus_tag LOCUS_24300 96169 95798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 97105 96401 gene locus_tag LOCUS_24310 97105 96401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 97564 99102 gene locus_tag LOCUS_24320 97564 99102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 99204 102350 gene locus_tag LOCUS_24330 gene hsdR 99204 102350 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968692.1 protein_id gnl|my_center|LOCUS_24330 102381 103988 gene locus_tag LOCUS_24340 gene hsdM 102381 103988 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968694.1 protein_id gnl|my_center|LOCUS_24340 103988 105232 gene locus_tag LOCUS_24350 gene hsdS 103988 105232 CDS product specificity protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968693.1 protein_id gnl|my_center|LOCUS_24350 105707 106846 gene locus_tag LOCUS_24360 105707 106846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 107470 107255 gene locus_tag LOCUS_24370 107470 107255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 108674 109090 gene locus_tag LOCUS_24380 108674 109090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 109083 109811 gene locus_tag LOCUS_24390 109083 109811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 110220 110726 gene locus_tag LOCUS_24400 110220 110726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 110904 112172 gene locus_tag LOCUS_24410 110904 112172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 112684 112223 gene locus_tag LOCUS_24420 112684 112223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 114123 112807 gene locus_tag LOCUS_24430 114123 112807 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174384.1 protein_id gnl|my_center|LOCUS_24430 114373 114125 gene locus_tag LOCUS_24440 114373 114125 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106029.1 protein_id gnl|my_center|LOCUS_24440 115017 116141 gene locus_tag LOCUS_24450 115017 116141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616634.1 protein_id gnl|my_center|LOCUS_24450 116164 116433 gene locus_tag LOCUS_24460 116164 116433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 118163 116478 gene locus_tag LOCUS_24470 118163 116478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 119030 118767 gene locus_tag LOCUS_24480 119030 118767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 119486 119046 gene locus_tag LOCUS_24490 119486 119046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 119922 120389 gene locus_tag LOCUS_24500 119922 120389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 120579 120998 gene locus_tag LOCUS_24510 120579 120998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 121174 121911 gene locus_tag LOCUS_24520 121174 121911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 122709 122023 gene locus_tag LOCUS_24530 122709 122023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 122985 124118 gene locus_tag LOCUS_24540 122985 124118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 124942 125709 gene locus_tag LOCUS_24550 124942 125709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 125724 127682 gene locus_tag LOCUS_24560 125724 127682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 127994 129187 gene locus_tag LOCUS_24570 127994 129187 CDS product calcineurin-like phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551577.1 protein_id gnl|my_center|LOCUS_24570 129902 130846 gene locus_tag LOCUS_24580 gene glnII 129902 130846 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNZ8 protein_id gnl|my_center|LOCUS_24580 130947 131462 gene locus_tag LOCUS_24590 130947 131462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 131455 132102 gene locus_tag LOCUS_24600 131455 132102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 132014 132793 gene locus_tag LOCUS_24610 132014 132793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 134067 134393 gene locus_tag LOCUS_24620 134067 134393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 135216 135719 gene locus_tag LOCUS_24630 135216 135719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 136087 135911 gene locus_tag LOCUS_24640 136087 135911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 136378 136533 gene locus_tag LOCUS_24650 136378 136533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 137495 137827 gene locus_tag LOCUS_24660 137495 137827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 137939 138412 gene locus_tag LOCUS_24670 137939 138412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 139029 138775 gene locus_tag LOCUS_24680 139029 138775 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224398.1 protein_id gnl|my_center|LOCUS_24680 139621 140619 gene locus_tag LOCUS_24690 gene pknB 139621 140619 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328819.1 protein_id gnl|my_center|LOCUS_24690 141048 140671 gene locus_tag LOCUS_24700 141048 140671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 141195 142460 gene locus_tag LOCUS_24710 141195 142460 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263870.1 protein_id gnl|my_center|LOCUS_24710 143039 142623 gene locus_tag LOCUS_24720 143039 142623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 143412 143137 gene locus_tag LOCUS_24730 143412 143137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 143825 144787 gene locus_tag LOCUS_24740 143825 144787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229074.1 protein_id gnl|my_center|LOCUS_24740 145837 144890 gene locus_tag LOCUS_24750 145837 144890 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889174.1 protein_id gnl|my_center|LOCUS_24750 145939 146883 gene locus_tag LOCUS_24760 145939 146883 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200923.1 protein_id gnl|my_center|LOCUS_24760 147687 147902 gene locus_tag LOCUS_24770 147687 147902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 147984 148316 gene locus_tag LOCUS_24780 147984 148316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 148507 148283 gene locus_tag LOCUS_24790 148507 148283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 148646 149635 gene locus_tag LOCUS_24800 148646 149635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 149632 149865 gene locus_tag LOCUS_24810 149632 149865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 150022 150567 gene locus_tag LOCUS_24820 150022 150567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 151208 150840 gene locus_tag LOCUS_24830 151208 150840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 151624 154260 gene locus_tag LOCUS_24840 gene hsdM-1 151624 154260 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681381.1 protein_id gnl|my_center|LOCUS_24840 154251 155486 gene locus_tag LOCUS_24850 154251 155486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871055.1 protein_id gnl|my_center|LOCUS_24850 155495 158557 gene locus_tag LOCUS_24860 155495 158557 CDS product restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875622.1 protein_id gnl|my_center|LOCUS_24860 158799 158554 gene locus_tag LOCUS_24870 158799 158554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 159309 159019 gene locus_tag LOCUS_24880 159309 159019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 159506 160036 gene locus_tag LOCUS_24890 159506 160036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 160009 161406 gene locus_tag LOCUS_24900 160009 161406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 161473 161778 gene locus_tag LOCUS_24910 161473 161778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 162215 163873 gene locus_tag LOCUS_24920 162215 163873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 163934 163861 gene locus_tag LOCUS_t00280 163934 163861 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 164829 164095 gene locus_tag LOCUS_24930 164829 164095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766240.1 protein_id gnl|my_center|LOCUS_24930 166782 164914 gene locus_tag LOCUS_24940 166782 164914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 168141 167101 gene locus_tag LOCUS_24950 168141 167101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919309.1 protein_id gnl|my_center|LOCUS_24950 168976 168329 gene locus_tag LOCUS_24960 168976 168329 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384710.1 protein_id gnl|my_center|LOCUS_24960 169196 169675 gene locus_tag LOCUS_24970 169196 169675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 169688 170854 gene locus_tag LOCUS_24980 169688 170854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 171249 170851 gene locus_tag LOCUS_24990 171249 170851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 171614 171228 gene locus_tag LOCUS_25000 171614 171228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 172292 171822 gene locus_tag LOCUS_25010 172292 171822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403166.1 protein_id gnl|my_center|LOCUS_25010 173035 172415 gene locus_tag LOCUS_25020 gene leuD 173035 172415 CDS product isopropylmalate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143407.1 protein_id gnl|my_center|LOCUS_25020 174444 173056 gene locus_tag LOCUS_25030 gene leuC 174444 173056 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKF0 protein_id gnl|my_center|LOCUS_25030 175594 174707 gene locus_tag LOCUS_25040 175594 174707 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_25040 176395 175727 gene locus_tag LOCUS_25050 176395 175727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 177510 176512 gene locus_tag LOCUS_25060 177510 176512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 178611 177640 gene locus_tag LOCUS_25070 178611 177640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 178777 179637 gene locus_tag LOCUS_25080 178777 179637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 179916 180380 gene locus_tag LOCUS_25090 179916 180380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 180747 181310 gene locus_tag LOCUS_25100 180747 181310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 181501 183285 gene locus_tag LOCUS_25110 181501 183285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 183282 186383 gene locus_tag LOCUS_25120 gene sbcC 183282 186383 CDS product nuclease SbcCD subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73RB9 protein_id gnl|my_center|LOCUS_25120 187627 186380 gene locus_tag LOCUS_25130 187627 186380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 189544 187640 gene locus_tag LOCUS_25140 189544 187640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 190807 189962 gene locus_tag LOCUS_25150 190807 189962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 191988 190921 gene locus_tag LOCUS_25160 191988 190921 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069734.1 protein_id gnl|my_center|LOCUS_25160 192642 192190 gene locus_tag LOCUS_25170 192642 192190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404496.1 protein_id gnl|my_center|LOCUS_25170 192732 193127 gene locus_tag LOCUS_25180 192732 193127 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705325.1 protein_id gnl|my_center|LOCUS_25180 194131 193382 gene locus_tag LOCUS_25190 194131 193382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255354.1 protein_id gnl|my_center|LOCUS_25190 194493 195425 gene locus_tag LOCUS_25200 194493 195425 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460847.1 protein_id gnl|my_center|LOCUS_25200 196586 195510 gene locus_tag LOCUS_25210 196586 195510 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_25210 197638 196835 gene locus_tag LOCUS_25220 197638 196835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143164.1 protein_id gnl|my_center|LOCUS_25220 198333 197779 gene locus_tag LOCUS_25230 198333 197779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 199554 198556 gene locus_tag LOCUS_25240 199554 198556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 199689 200840 gene locus_tag LOCUS_25250 199689 200840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 201054 202904 gene locus_tag LOCUS_25260 201054 202904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731071.1 protein_id gnl|my_center|LOCUS_25260 203561 202962 gene locus_tag LOCUS_25270 203561 202962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 203825 204580 gene locus_tag LOCUS_25280 203825 204580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 204647 205258 gene locus_tag LOCUS_25290 204647 205258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 205710 206231 gene locus_tag LOCUS_25300 205710 206231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 207045 206248 gene locus_tag LOCUS_25310 207045 206248 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104155.1 protein_id gnl|my_center|LOCUS_25310 208043 207174 gene locus_tag LOCUS_25320 gene dhaA 208043 207174 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T767 protein_id gnl|my_center|LOCUS_25320 209404 208139 gene locus_tag LOCUS_25330 209404 208139 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707233.1 protein_id gnl|my_center|LOCUS_25330 209475 210902 gene locus_tag LOCUS_25340 209475 210902 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382014.1 protein_id gnl|my_center|LOCUS_25340 211669 210983 gene locus_tag LOCUS_25350 211669 210983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963792.1 protein_id gnl|my_center|LOCUS_25350 212646 211957 gene locus_tag LOCUS_25360 212646 211957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963792.1 protein_id gnl|my_center|LOCUS_25360 213312 212725 gene locus_tag LOCUS_25370 213312 212725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 215580 213448 gene locus_tag LOCUS_25380 215580 213448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 216977 215643 gene locus_tag LOCUS_25390 216977 215643 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110258.1 protein_id gnl|my_center|LOCUS_25390 217276 217761 gene locus_tag LOCUS_25400 217276 217761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 218216 218725 gene locus_tag LOCUS_25410 218216 218725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 219757 218837 gene locus_tag LOCUS_25420 219757 218837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970816.1 protein_id gnl|my_center|LOCUS_25420 220326 219967 gene locus_tag LOCUS_25430 220326 219967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 220550 220780 gene locus_tag LOCUS_25440 220550 220780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 220789 221739 gene locus_tag LOCUS_25450 220789 221739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 222370 222984 gene locus_tag LOCUS_25460 222370 222984 CDS product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964140.1 protein_id gnl|my_center|LOCUS_25460 223200 224186 gene locus_tag LOCUS_25470 gene ywcH 223200 224186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39606 protein_id gnl|my_center|LOCUS_25470 224811 224194 gene locus_tag LOCUS_25480 224811 224194 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015509.1 protein_id gnl|my_center|LOCUS_25480 225023 225490 gene locus_tag LOCUS_25490 225023 225490 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088078.1 protein_id gnl|my_center|LOCUS_25490 225634 226764 gene locus_tag LOCUS_25500 225634 226764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 226865 228802 gene locus_tag LOCUS_25510 226865 228802 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247314.1 protein_id gnl|my_center|LOCUS_25510 228818 229912 gene locus_tag LOCUS_25520 228818 229912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455718.1 protein_id gnl|my_center|LOCUS_25520 230018 231304 gene locus_tag LOCUS_25530 gene hisS 230018 231304 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F9Y3 protein_id gnl|my_center|LOCUS_25530 232261 231488 gene locus_tag LOCUS_25540 232261 231488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 232997 232248 gene locus_tag LOCUS_25550 232997 232248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 233932 233420 gene locus_tag LOCUS_25560 233932 233420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 234403 233951 gene locus_tag LOCUS_25570 234403 233951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 234690 237380 gene locus_tag LOCUS_25580 234690 237380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 239252 237642 gene locus_tag LOCUS_25590 239252 237642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 239710 239249 gene locus_tag LOCUS_25600 gene folK 239710 239249 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806222.1 protein_id gnl|my_center|LOCUS_25600 240636 239707 gene locus_tag LOCUS_25610 gene dnaC 240636 239707 CDS product DNA replication protein DnaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601184.1 protein_id gnl|my_center|LOCUS_25610 240728 241711 gene locus_tag LOCUS_25620 240728 241711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867010.1 protein_id gnl|my_center|LOCUS_25620 241853 243097 gene locus_tag LOCUS_25630 241853 243097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 243955 243296 gene locus_tag LOCUS_25640 gene arsC 243955 243296 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123107.1 protein_id gnl|my_center|LOCUS_25640 245016 243952 gene locus_tag LOCUS_25650 gene acr3 245016 243952 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826560.1 protein_id gnl|my_center|LOCUS_25650 245624 245025 gene locus_tag LOCUS_25660 245624 245025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 245961 245635 gene locus_tag LOCUS_25670 245961 245635 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405177.1 protein_id gnl|my_center|LOCUS_25670 246667 246053 gene locus_tag LOCUS_25680 246667 246053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886252.1 protein_id gnl|my_center|LOCUS_25680 246735 247760 gene locus_tag LOCUS_25690 gene gpsA 246735 247760 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZB6 protein_id gnl|my_center|LOCUS_25690 249534 247954 gene locus_tag LOCUS_25700 249534 247954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005189.1 protein_id gnl|my_center|LOCUS_25700 249616 250509 gene locus_tag LOCUS_25710 gene acuC 249616 250509 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410917.1 protein_id gnl|my_center|LOCUS_25710 250509 251396 gene locus_tag LOCUS_25720 250509 251396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510896.1 protein_id gnl|my_center|LOCUS_25720 253130 251496 gene locus_tag LOCUS_25730 253130 251496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 253204 254106 gene locus_tag LOCUS_25740 gene mtnP 253204 254106 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CXR2 protein_id gnl|my_center|LOCUS_25740 254107 254913 gene locus_tag LOCUS_25750 254107 254913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 254913 255728 gene locus_tag LOCUS_25760 gene echA5 254913 255728 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403433.1 protein_id gnl|my_center|LOCUS_25760 256906 255878 gene locus_tag LOCUS_25770 256906 255878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 257524 257141 gene locus_tag LOCUS_25780 257524 257141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 257710 258573 gene locus_tag LOCUS_25790 257710 258573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 258736 259515 gene locus_tag LOCUS_25800 gene fliP 258736 259515 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F300 protein_id gnl|my_center|LOCUS_25800 259540 259803 gene locus_tag LOCUS_25810 gene fliQ 259540 259803 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137385.1 protein_id gnl|my_center|LOCUS_25810 259805 260638 gene locus_tag LOCUS_25820 gene fliR 259805 260638 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F302 protein_id gnl|my_center|LOCUS_25820 260628 262016 gene locus_tag LOCUS_25830 260628 262016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 262013 264154 gene locus_tag LOCUS_25840 gene flhA 262013 264154 CDS product endoflagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412863.1 protein_id gnl|my_center|LOCUS_25840 264298 265446 gene locus_tag LOCUS_25850 264298 265446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 265484 265909 gene locus_tag LOCUS_25860 gene rsfS 265484 265909 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F6E4 protein_id gnl|my_center|LOCUS_25860 266508 266071 gene locus_tag LOCUS_25870 266508 266071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 267328 266546 gene locus_tag LOCUS_25880 gene ste14 267328 266546 CDS product lipid A Kdo2 1-phosphate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173879.1 protein_id gnl|my_center|LOCUS_25880 268085 267369 gene locus_tag LOCUS_25890 gene cmoA 268085 267369 CDS product carboxy-S-adenosyl-L-methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PAS7 protein_id gnl|my_center|LOCUS_25890 268284 269333 gene locus_tag LOCUS_25900 gene mrp 268284 269333 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3R3 protein_id gnl|my_center|LOCUS_25900 269495 269953 gene locus_tag LOCUS_25910 269495 269953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 270318 270025 gene locus_tag LOCUS_25920 270318 270025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150993.1 protein_id gnl|my_center|LOCUS_25920 271451 270678 gene locus_tag LOCUS_25930 gene rsmI 271451 270678 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F1Y4 protein_id gnl|my_center|LOCUS_25930 272021 271455 gene locus_tag LOCUS_25940 272021 271455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273875.1 protein_id gnl|my_center|LOCUS_25940 272022 272822 gene locus_tag LOCUS_25950 272022 272822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623631.1 protein_id gnl|my_center|LOCUS_25950 272878 274974 gene locus_tag LOCUS_25960 272878 274974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253390.1 protein_id gnl|my_center|LOCUS_25960 274971 276578 gene locus_tag LOCUS_25970 274971 276578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793299.1 protein_id gnl|my_center|LOCUS_25970 276603 277733 gene locus_tag LOCUS_25980 276603 277733 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249135.1 protein_id gnl|my_center|LOCUS_25980 277920 279695 gene locus_tag LOCUS_25990 gene caiA 277920 279695 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587238.1 protein_id gnl|my_center|LOCUS_25990 279770 281212 gene locus_tag LOCUS_26000 279770 281212 CDS product UPF0061 protein R00982 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92RB2 protein_id gnl|my_center|LOCUS_26000 281328 281501 gene locus_tag LOCUS_26010 281328 281501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 282677 281511 gene locus_tag LOCUS_26020 282677 281511 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941857.1 protein_id gnl|my_center|LOCUS_26020 282734 283636 gene locus_tag LOCUS_26030 282734 283636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 284668 283838 gene locus_tag LOCUS_26040 284668 283838 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277165.1 protein_id gnl|my_center|LOCUS_26040 285641 284661 gene locus_tag LOCUS_26050 285641 284661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 285779 286762 gene locus_tag LOCUS_26060 285779 286762 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336191.1 protein_id gnl|my_center|LOCUS_26060 286704 287537 gene locus_tag LOCUS_26070 286704 287537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 287540 288313 gene locus_tag LOCUS_26080 287540 288313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 288310 289731 gene locus_tag LOCUS_26090 288310 289731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 289735 290697 gene locus_tag LOCUS_26100 gene moxR 289735 290697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119708.1 protein_id gnl|my_center|LOCUS_26100 290699 292042 gene locus_tag LOCUS_26110 290699 292042 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121952.1 protein_id gnl|my_center|LOCUS_26110 292866 292138 gene locus_tag LOCUS_26120 gene tesA 292866 292138 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576212.1 protein_id gnl|my_center|LOCUS_26120 293828 292920 gene locus_tag LOCUS_26130 293828 292920 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250348.1 protein_id gnl|my_center|LOCUS_26130 293925 294677 gene locus_tag LOCUS_26140 293925 294677 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425174.1 protein_id gnl|my_center|LOCUS_26140 296221 294860 gene locus_tag LOCUS_26150 296221 294860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 297450 296218 gene locus_tag LOCUS_26160 297450 296218 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986927.1 protein_id gnl|my_center|LOCUS_26160 298580 297585 gene locus_tag LOCUS_26170 298580 297585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529382.1 protein_id gnl|my_center|LOCUS_26170 298652 299140 gene locus_tag LOCUS_26180 298652 299140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 299170 299859 gene locus_tag LOCUS_26190 299170 299859 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068458.1 protein_id gnl|my_center|LOCUS_26190 301118 299814 gene locus_tag LOCUS_26200 gene cyaA 301118 299814 CDS product guanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067952.1 protein_id gnl|my_center|LOCUS_26200 302431 301181 gene locus_tag LOCUS_26210 302431 301181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439951.1 protein_id gnl|my_center|LOCUS_26210 302588 304198 gene locus_tag LOCUS_26220 gene gabD2 302588 304198 CDS product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029859.1 protein_id gnl|my_center|LOCUS_26220 304443 305213 gene locus_tag LOCUS_26230 gene fabG 304443 305213 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351753.1 protein_id gnl|my_center|LOCUS_26230 305213 307342 gene locus_tag LOCUS_26240 305213 307342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 307342 308232 gene locus_tag LOCUS_26250 gene gluQ 307342 308232 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BE3 protein_id gnl|my_center|LOCUS_26250 308285 310015 gene locus_tag LOCUS_26260 308285 310015 CDS product aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_26260 310810 310088 gene locus_tag LOCUS_26270 310810 310088 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403515.1 protein_id gnl|my_center|LOCUS_26270 312565 310943 gene locus_tag LOCUS_26280 312565 310943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67300 protein_id gnl|my_center|LOCUS_26280 312898 313230 gene locus_tag LOCUS_26290 312898 313230 CDS product ArsC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396628.1 protein_id gnl|my_center|LOCUS_26290 313353 313943 gene locus_tag LOCUS_26300 313353 313943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186895.1 protein_id gnl|my_center|LOCUS_26300 314186 314007 gene locus_tag LOCUS_26310 314186 314007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 314323 314952 gene locus_tag LOCUS_26320 314323 314952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 314959 315780 gene locus_tag LOCUS_26330 314959 315780 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259169.1 protein_id gnl|my_center|LOCUS_26330 315819 319010 gene locus_tag LOCUS_26340 315819 319010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 319007 322762 gene locus_tag LOCUS_26350 319007 322762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 322755 324632 gene locus_tag LOCUS_26360 gene recD 322755 324632 CDS product RecBCD enzyme subunit RecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3JNM3 protein_id gnl|my_center|LOCUS_26360 327631 324848 gene locus_tag LOCUS_26370 327631 324848 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389558.1 protein_id gnl|my_center|LOCUS_26370 329881 327683 gene locus_tag LOCUS_26380 329881 327683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 330024 330806 gene locus_tag LOCUS_26390 330024 330806 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975613.1 protein_id gnl|my_center|LOCUS_26390 330812 331033 gene locus_tag LOCUS_26400 330812 331033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 331946 330933 gene locus_tag LOCUS_26410 331946 330933 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727141.1 protein_id gnl|my_center|LOCUS_26410 333439 331958 gene locus_tag LOCUS_26420 gene uhpC 333439 331958 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625279.1 protein_id gnl|my_center|LOCUS_26420 333467 333751 gene locus_tag LOCUS_26430 333467 333751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 333748 335028 gene locus_tag LOCUS_26440 gene thrA 333748 335028 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F059 protein_id gnl|my_center|LOCUS_26440 335040 335426 gene locus_tag LOCUS_26450 335040 335426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 335534 335917 gene locus_tag LOCUS_26460 335534 335917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 335930 337042 gene locus_tag LOCUS_26470 gene wecE 335930 337042 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538757.1 protein_id gnl|my_center|LOCUS_26470 338231 337284 gene locus_tag LOCUS_26480 gene ynbB 338231 337284 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CJY4 protein_id gnl|my_center|LOCUS_26480 338860 338228 gene locus_tag LOCUS_26490 338860 338228 CDS product CDP-alcohol phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104477.1 protein_id gnl|my_center|LOCUS_26490 338902 339618 gene locus_tag LOCUS_26500 338902 339618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 339840 340082 gene locus_tag LOCUS_26510 339840 340082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 340992 340150 gene locus_tag LOCUS_26520 340992 340150 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391756.1 protein_id gnl|my_center|LOCUS_26520 341663 341091 gene locus_tag LOCUS_26530 341663 341091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 342814 341669 gene locus_tag LOCUS_26540 gene wecE 342814 341669 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367657.1 protein_id gnl|my_center|LOCUS_26540 344145 342937 gene locus_tag LOCUS_26550 344145 342937 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MG13 protein_id gnl|my_center|LOCUS_26550 344393 344142 gene locus_tag LOCUS_26560 344393 344142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 344448 345959 gene locus_tag LOCUS_26570 344448 345959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 345996 346781 gene locus_tag LOCUS_26580 345996 346781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 346864 347349 gene locus_tag LOCUS_26590 346864 347349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 347321 347680 gene locus_tag LOCUS_26600 347321 347680 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545366.1 protein_id gnl|my_center|LOCUS_26600 348813 347857 gene locus_tag LOCUS_26610 348813 347857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 348946 349701 gene locus_tag LOCUS_26620 348946 349701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 349730 350836 gene locus_tag LOCUS_26630 349730 350836 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016360.1 protein_id gnl|my_center|LOCUS_26630 350992 352452 gene locus_tag LOCUS_26640 350992 352452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 352455 353873 gene locus_tag LOCUS_26650 gene ndh 352455 353873 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932061.1 protein_id gnl|my_center|LOCUS_26650 355000 353909 gene locus_tag LOCUS_26660 355000 353909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 355218 356522 gene locus_tag LOCUS_26670 355218 356522 CDS product dicarboxylate:amino acid:cation symporter DAACS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 protein_id gnl|my_center|LOCUS_26670 358884 356686 gene locus_tag LOCUS_26680 gene feoB 358884 356686 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVT6 protein_id gnl|my_center|LOCUS_26680 359128 358904 gene locus_tag LOCUS_26690 359128 358904 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887863.1 protein_id gnl|my_center|LOCUS_26690 359832 359485 gene locus_tag LOCUS_26700 gene rpsI 359832 359485 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FM58 protein_id gnl|my_center|LOCUS_26700 360362 359901 gene locus_tag LOCUS_26710 gene rplM 360362 359901 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1G5 protein_id gnl|my_center|LOCUS_26710 360994 360380 gene locus_tag LOCUS_26720 360994 360380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 362106 361105 gene locus_tag LOCUS_26730 362106 361105 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022116.1 protein_id gnl|my_center|LOCUS_26730 362955 362110 gene locus_tag LOCUS_26740 362955 362110 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129903.1 protein_id gnl|my_center|LOCUS_26740 363852 363064 gene locus_tag LOCUS_26750 gene caiD 363852 363064 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505733.1 protein_id gnl|my_center|LOCUS_26750 364014 363856 gene locus_tag LOCUS_26760 364014 363856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 365579 364011 gene locus_tag LOCUS_26770 365579 364011 CDS product symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198012.1 protein_id gnl|my_center|LOCUS_26770 367803 366208 gene locus_tag LOCUS_26780 367803 366208 CDS product acetyl-CoA carboxylase biotin carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623974.1 protein_id gnl|my_center|LOCUS_26780 368248 368571 gene locus_tag LOCUS_26790 368248 368571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 368738 369154 gene locus_tag LOCUS_26800 368738 369154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 369151 370029 gene locus_tag LOCUS_26810 gene nadC 369151 370029 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266735.1 protein_id gnl|my_center|LOCUS_26810 370054 370965 gene locus_tag LOCUS_26820 370054 370965 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145208.1 protein_id gnl|my_center|LOCUS_26820 371918 371064 gene locus_tag LOCUS_26830 371918 371064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 373006 371936 gene locus_tag LOCUS_26840 373006 371936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 374024 373161 gene locus_tag LOCUS_26850 374024 373161 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085314.1 protein_id gnl|my_center|LOCUS_26850 375083 374034 gene locus_tag LOCUS_26860 gene tas 375083 374034 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263655.1 protein_id gnl|my_center|LOCUS_26860 375613 375155 gene locus_tag LOCUS_26870 375613 375155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 376051 375740 gene locus_tag LOCUS_26880 376051 375740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 378330 376117 gene locus_tag LOCUS_26890 378330 376117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 378851 378369 gene locus_tag LOCUS_26900 gene ispF 378851 378369 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F0A5 protein_id gnl|my_center|LOCUS_26900 381751 379004 gene locus_tag LOCUS_26910 381751 379004 CDS product UPF0182 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJD6 protein_id gnl|my_center|LOCUS_26910 382949 382026 gene locus_tag LOCUS_26920 gene nadA 382949 382026 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F8D9 protein_id gnl|my_center|LOCUS_26920 383099 383341 gene locus_tag LOCUS_26930 383099 383341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837773.1 protein_id gnl|my_center|LOCUS_26930 383351 383950 gene locus_tag LOCUS_26940 383351 383950 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391397.1 protein_id gnl|my_center|LOCUS_26940 384787 384029 gene locus_tag LOCUS_26950 384787 384029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880576.1 protein_id gnl|my_center|LOCUS_26950 387438 384901 gene locus_tag LOCUS_26960 387438 384901 CDS product penicillin G acylase precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821884.1 protein_id gnl|my_center|LOCUS_26960 388050 387442 gene locus_tag LOCUS_26970 gene ribD 388050 387442 CDS product pyrimidine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087013.1 protein_id gnl|my_center|LOCUS_26970 388157 388693 gene locus_tag LOCUS_26980 388157 388693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 389669 388827 gene locus_tag LOCUS_26990 gene suhB 389669 388827 CDS product inositol phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050899.1 protein_id gnl|my_center|LOCUS_26990 389752 390816 gene locus_tag LOCUS_27000 389752 390816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 391120 391749 gene locus_tag LOCUS_27010 391120 391749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 392329 391895 gene locus_tag LOCUS_27020 392329 391895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 392550 393254 gene locus_tag LOCUS_27030 392550 393254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 394632 393382 gene locus_tag LOCUS_27040 394632 393382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 397298 394698 gene locus_tag LOCUS_27050 gene mutS 397298 394698 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F496 protein_id gnl|my_center|LOCUS_27050 399307 397298 gene locus_tag LOCUS_27060 gene gyrB 399307 397298 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8FA30 protein_id gnl|my_center|LOCUS_27060 399893 399516 gene locus_tag LOCUS_27070 399893 399516 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125527.1 protein_id gnl|my_center|LOCUS_27070 400304 400744 gene locus_tag LOCUS_27080 400304 400744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 401605 401069 gene locus_tag LOCUS_27090 401605 401069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 401711 401977 gene locus_tag LOCUS_27100 401711 401977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 402500 402093 gene locus_tag LOCUS_27110 402500 402093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 403011 402535 gene locus_tag LOCUS_27120 403011 402535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 403633 403214 gene locus_tag LOCUS_27130 403633 403214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 404257 403736 gene locus_tag LOCUS_27140 404257 403736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989716.1 protein_id gnl|my_center|LOCUS_27140 404426 404755 gene locus_tag LOCUS_27150 404426 404755 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086780.1 protein_id gnl|my_center|LOCUS_27150 404742 405230 gene locus_tag LOCUS_27160 404742 405230 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620896.1 protein_id gnl|my_center|LOCUS_27160 406280 405231 gene locus_tag LOCUS_27170 406280 405231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 407070 406318 gene locus_tag LOCUS_27180 407070 406318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 407648 407082 gene locus_tag LOCUS_27190 407648 407082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 407849 408232 gene locus_tag LOCUS_27200 407849 408232 CDS product DUF962 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206200.1 protein_id gnl|my_center|LOCUS_27200 409306 408380 gene locus_tag LOCUS_27210 409306 408380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 410351 409473 gene locus_tag LOCUS_27220 410351 409473 CDS product S-adenosyl-L-methionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2XCM7 protein_id gnl|my_center|LOCUS_27220 411043 410390 gene locus_tag LOCUS_27230 411043 410390 CDS product deaminase reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967700.1 protein_id gnl|my_center|LOCUS_27230 411747 411163 gene locus_tag LOCUS_27240 411747 411163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 412364 411747 gene locus_tag LOCUS_27250 412364 411747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 413117 412536 gene locus_tag LOCUS_27260 413117 412536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247875.1 protein_id gnl|my_center|LOCUS_27260 413846 413370 gene locus_tag LOCUS_27270 413846 413370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 414404 414003 gene locus_tag LOCUS_27280 414404 414003 CDS product nucleic acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679941.1 protein_id gnl|my_center|LOCUS_27280 414675 414397 gene locus_tag LOCUS_27290 414675 414397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 >Feature sequence07 4009 4845 gene locus_tag LOCUS_27300 4009 4845 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_27300 5002 6234 gene locus_tag LOCUS_27310 5002 6234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186167.1 protein_id gnl|my_center|LOCUS_27310 6458 7432 gene locus_tag LOCUS_27320 6458 7432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 7548 8078 gene locus_tag LOCUS_27330 7548 8078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 10084 8075 gene locus_tag LOCUS_27340 10084 8075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 11073 10042 gene locus_tag LOCUS_27350 11073 10042 CDS product CDP-paratose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969522.1 protein_id gnl|my_center|LOCUS_27350 12663 11212 gene locus_tag LOCUS_27360 12663 11212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 13218 12820 gene locus_tag LOCUS_27370 13218 12820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 14464 13310 gene locus_tag LOCUS_27380 14464 13310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 14991 14473 gene locus_tag LOCUS_27390 14991 14473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 17356 15728 gene locus_tag LOCUS_27400 gene groL 17356 15728 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61439 protein_id gnl|my_center|LOCUS_27400 17655 17371 gene locus_tag LOCUS_27410 gene groS 17655 17371 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61437 protein_id gnl|my_center|LOCUS_27410 18116 19372 gene locus_tag LOCUS_27420 18116 19372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002109366.1 protein_id gnl|my_center|LOCUS_27420 19756 19403 gene locus_tag LOCUS_27430 19756 19403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 19829 20425 gene locus_tag LOCUS_27440 19829 20425 CDS product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268572.1 protein_id gnl|my_center|LOCUS_27440 21102 20440 gene locus_tag LOCUS_27450 21102 20440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 21361 21645 gene locus_tag LOCUS_27460 21361 21645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 22124 21720 gene locus_tag LOCUS_27470 22124 21720 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946351.1 protein_id gnl|my_center|LOCUS_27470 22342 22881 gene locus_tag LOCUS_27480 22342 22881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 24070 23033 gene locus_tag LOCUS_27490 24070 23033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 27586 24290 gene locus_tag LOCUS_27500 27586 24290 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933702.1 protein_id gnl|my_center|LOCUS_27500 27727 28956 gene locus_tag LOCUS_27510 27727 28956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 30134 29196 gene locus_tag LOCUS_27520 30134 29196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 30920 30228 gene locus_tag LOCUS_27530 gene crp 30920 30228 CDS product transcriptional regulator Crp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070320.1 protein_id gnl|my_center|LOCUS_27530 32338 31016 gene locus_tag LOCUS_27540 32338 31016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 34776 32338 gene locus_tag LOCUS_27550 34776 32338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 36044 34779 gene locus_tag LOCUS_27560 36044 34779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 37075 36086 gene locus_tag LOCUS_27570 37075 36086 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887266.1 protein_id gnl|my_center|LOCUS_27570 38146 37361 gene locus_tag LOCUS_27580 38146 37361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 38503 38150 gene locus_tag LOCUS_27590 38503 38150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 38727 38527 gene locus_tag LOCUS_27600 gene rpmE 38727 38527 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73MK4 protein_id gnl|my_center|LOCUS_27600 38788 38961 gene locus_tag LOCUS_27610 38788 38961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 38978 41380 gene locus_tag LOCUS_27620 38978 41380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 41807 41406 gene locus_tag LOCUS_27630 41807 41406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 42898 41888 gene locus_tag LOCUS_27640 42898 41888 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XA53 protein_id gnl|my_center|LOCUS_27640 43854 42895 gene locus_tag LOCUS_27650 43854 42895 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029252.1 protein_id gnl|my_center|LOCUS_27650 44575 43964 gene locus_tag LOCUS_27660 44575 43964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 45481 44708 gene locus_tag LOCUS_27670 45481 44708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 45845 45396 gene locus_tag LOCUS_27680 45845 45396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 46312 46644 gene locus_tag LOCUS_27690 46312 46644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 48590 46665 gene locus_tag LOCUS_27700 48590 46665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 48735 49637 gene locus_tag LOCUS_27710 48735 49637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 51187 49769 gene locus_tag LOCUS_27720 gene hemN 51187 49769 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67886 protein_id gnl|my_center|LOCUS_27720 52923 51466 gene locus_tag LOCUS_27730 gene rho 52923 51466 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7C5 protein_id gnl|my_center|LOCUS_27730 54277 53192 gene locus_tag LOCUS_27740 gene nlpD 54277 53192 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576385.1 protein_id gnl|my_center|LOCUS_27740 54714 54316 gene locus_tag LOCUS_27750 54714 54316 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974282.1 protein_id gnl|my_center|LOCUS_27750 55422 54853 gene locus_tag LOCUS_27760 55422 54853 CDS product abortive infection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331723.1 protein_id gnl|my_center|LOCUS_27760 55913 55632 gene locus_tag LOCUS_27770 55913 55632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 57924 56026 gene locus_tag LOCUS_27780 57924 56026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 58364 60004 gene locus_tag LOCUS_27790 58364 60004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 60132 61097 gene locus_tag LOCUS_27800 60132 61097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 62264 61179 gene locus_tag LOCUS_27810 62264 61179 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932156.1 protein_id gnl|my_center|LOCUS_27810 63623 62475 gene locus_tag LOCUS_27820 63623 62475 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404059.1 protein_id gnl|my_center|LOCUS_27820 63804 64835 gene locus_tag LOCUS_27830 63804 64835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 65097 64819 gene locus_tag LOCUS_27840 65097 64819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 65257 65835 gene locus_tag LOCUS_27850 65257 65835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 65892 66368 gene locus_tag LOCUS_27860 65892 66368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 66537 67010 gene locus_tag LOCUS_27870 66537 67010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 67074 68312 gene locus_tag LOCUS_27880 67074 68312 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971146.1 protein_id gnl|my_center|LOCUS_27880 68329 69471 gene locus_tag LOCUS_27890 68329 69471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 69671 70669 gene locus_tag LOCUS_27900 gene hemF 69671 70669 CDS product coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN4 protein_id gnl|my_center|LOCUS_27900 70666 71361 gene locus_tag LOCUS_27910 70666 71361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 72700 71534 gene locus_tag LOCUS_27920 72700 71534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 73817 72687 gene locus_tag LOCUS_27930 73817 72687 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767913.1 protein_id gnl|my_center|LOCUS_27930 73955 75178 gene locus_tag LOCUS_27940 73955 75178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 75337 76737 gene locus_tag LOCUS_27950 gene glcD 75337 76737 CDS product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002070251.1 protein_id gnl|my_center|LOCUS_27950 76871 78736 gene locus_tag LOCUS_27960 76871 78736 CDS product glucoamylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027999.1 protein_id gnl|my_center|LOCUS_27960 78905 79387 gene locus_tag LOCUS_27970 78905 79387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 80130 79507 gene locus_tag LOCUS_27980 80130 79507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 80179 81066 gene locus_tag LOCUS_27990 80179 81066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 82277 81099 gene locus_tag LOCUS_28000 82277 81099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 84035 82293 gene locus_tag LOCUS_28010 84035 82293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 85004 84108 gene locus_tag LOCUS_28020 gene trpS 85004 84108 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221812.1 protein_id gnl|my_center|LOCUS_28020 85156 85488 gene locus_tag LOCUS_28030 85156 85488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 85525 85905 gene locus_tag LOCUS_28040 85525 85905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 86044 87123 gene locus_tag LOCUS_28050 86044 87123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 87127 88185 gene locus_tag LOCUS_28060 87127 88185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 88702 89700 gene locus_tag LOCUS_28070 88702 89700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 90373 89810 gene locus_tag LOCUS_28080 90373 89810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190402.1 protein_id gnl|my_center|LOCUS_28080 91597 90554 gene locus_tag LOCUS_28090 91597 90554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907503.1 protein_id gnl|my_center|LOCUS_28090 92228 91572 gene locus_tag LOCUS_28100 gene hisG 92228 91572 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F6P1 protein_id gnl|my_center|LOCUS_28100 92965 92225 gene locus_tag LOCUS_28110 92965 92225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 94664 92967 gene locus_tag LOCUS_28120 gene rpsA 94664 92967 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182263.1 protein_id gnl|my_center|LOCUS_28120 95408 94722 gene locus_tag LOCUS_28130 gene cmk1 95408 94722 CDS product cytidylate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43892 protein_id gnl|my_center|LOCUS_28130 96495 95596 gene locus_tag LOCUS_28140 gene tyrA 96495 95596 CDS product bifunctional chorismate mutase/prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763025.1 protein_id gnl|my_center|LOCUS_28140 97684 96530 gene locus_tag LOCUS_28150 gene pheA 97684 96530 CDS product bifunctional chorismate mutase/prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281293.1 protein_id gnl|my_center|LOCUS_28150 98375 97668 gene locus_tag LOCUS_28160 98375 97668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 99513 98452 gene locus_tag LOCUS_28170 99513 98452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 99898 99539 gene locus_tag LOCUS_28180 99898 99539 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101124.1 protein_id gnl|my_center|LOCUS_28180 101024 99969 gene locus_tag LOCUS_28190 gene cheB1 101024 99969 CDS product chemotaxis response regulator protein-glutamate methylesterase of group 1 operon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F6P9 protein_id gnl|my_center|LOCUS_28190 104285 101031 gene locus_tag LOCUS_28200 gene cheA 104285 101031 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907369.1 protein_id gnl|my_center|LOCUS_28200 104806 104288 gene locus_tag LOCUS_28210 gene cheW 104806 104288 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200285.1 protein_id gnl|my_center|LOCUS_28210 105378 104803 gene locus_tag LOCUS_28220 105378 104803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 106140 105814 gene locus_tag LOCUS_28230 gene zapA 106140 105814 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F6Q5 protein_id gnl|my_center|LOCUS_28230 107054 106140 gene locus_tag LOCUS_28240 107054 106140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 107796 107446 gene locus_tag LOCUS_28250 gene rplT 107796 107446 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F6Q7 protein_id gnl|my_center|LOCUS_28250 108011 107811 gene locus_tag LOCUS_28260 gene rpmI 108011 107811 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97GK6 protein_id gnl|my_center|LOCUS_28260 108654 108019 gene locus_tag LOCUS_28270 gene infC 108654 108019 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNL3 protein_id gnl|my_center|LOCUS_28270 110185 108929 gene locus_tag LOCUS_28280 gene glyA 110185 108929 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F6A0 protein_id gnl|my_center|LOCUS_28280 111157 110297 gene locus_tag LOCUS_28290 gene lplA 111157 110297 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258776.1 protein_id gnl|my_center|LOCUS_28290 111597 111157 gene locus_tag LOCUS_28300 gene rsbW 111597 111157 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377010.1 protein_id gnl|my_center|LOCUS_28300 113588 111762 gene locus_tag LOCUS_28310 gene bipA 113588 111762 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405892.1 protein_id gnl|my_center|LOCUS_28310 114657 113803 gene locus_tag LOCUS_28320 114657 113803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 114952 115137 gene locus_tag LOCUS_28330 114952 115137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 116049 115234 gene locus_tag LOCUS_28340 116049 115234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 116176 116547 gene locus_tag LOCUS_28350 116176 116547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 116659 117405 gene locus_tag LOCUS_28360 116659 117405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 117604 118320 gene locus_tag LOCUS_28370 117604 118320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 118459 119232 gene locus_tag LOCUS_28380 118459 119232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 119258 119941 gene locus_tag LOCUS_28390 119258 119941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 120572 120087 gene locus_tag LOCUS_28400 gene coaD 120572 120087 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYP6 protein_id gnl|my_center|LOCUS_28400 122095 120569 gene locus_tag LOCUS_28410 122095 120569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 122176 123087 gene locus_tag LOCUS_28420 gene lipA 122176 123087 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3V7 protein_id gnl|my_center|LOCUS_28420 123198 123806 gene locus_tag LOCUS_28430 123198 123806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760764.1 protein_id gnl|my_center|LOCUS_28430 123803 124081 gene locus_tag LOCUS_28440 123803 124081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 124106 124969 gene locus_tag LOCUS_28450 124106 124969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 124984 125841 gene locus_tag LOCUS_28460 124984 125841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 130589 126078 gene locus_tag LOCUS_28470 130589 126078 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030438.1 protein_id gnl|my_center|LOCUS_28470 130845 131990 gene locus_tag LOCUS_28480 130845 131990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 133493 132165 gene locus_tag LOCUS_28490 133493 132165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 136449 133993 gene locus_tag LOCUS_28500 136449 133993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 136827 138884 gene locus_tag LOCUS_28510 136827 138884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 138941 139510 gene locus_tag LOCUS_28520 138941 139510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 139685 140488 gene locus_tag LOCUS_28530 139685 140488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 142135 140579 gene locus_tag LOCUS_28540 142135 140579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 142322 142480 gene locus_tag LOCUS_28550 gene rpmG 142322 142480 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WH4 protein_id gnl|my_center|LOCUS_28550 142526 143587 gene locus_tag LOCUS_28560 142526 143587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 143595 143667 gene locus_tag LOCUS_t00290 143595 143667 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 143693 144478 gene locus_tag LOCUS_28570 gene glmU 143693 144478 CDS product UDP-N-acetylglucosamine diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805357.1 protein_id gnl|my_center|LOCUS_28570 144482 145453 gene locus_tag LOCUS_28580 gene prs 144482 145453 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZN0 protein_id gnl|my_center|LOCUS_28580 145511 146116 gene locus_tag LOCUS_28590 gene rplY 145511 146116 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMC2 protein_id gnl|my_center|LOCUS_28590 146131 146694 gene locus_tag LOCUS_28600 gene pth 146131 146694 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767698.1 protein_id gnl|my_center|LOCUS_28600 146750 148774 gene locus_tag LOCUS_28610 gene hflB 146750 148774 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZN3 protein_id gnl|my_center|LOCUS_28610 149074 150663 gene locus_tag LOCUS_28620 149074 150663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 150778 151932 gene locus_tag LOCUS_28630 gene caiA 150778 151932 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000374065.1 protein_id gnl|my_center|LOCUS_28630 152034 152492 gene locus_tag LOCUS_28640 gene tadA 152034 152492 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BV6 protein_id gnl|my_center|LOCUS_28640 152676 152762 gene locus_tag LOCUS_t00300 152676 152762 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 154177 153548 gene locus_tag LOCUS_28650 154177 153548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879725.1 protein_id gnl|my_center|LOCUS_28650 154649 154398 gene locus_tag LOCUS_28660 154649 154398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 155416 154745 gene locus_tag LOCUS_28670 155416 154745 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022123.1 protein_id gnl|my_center|LOCUS_28670 155562 156095 gene locus_tag LOCUS_28680 155562 156095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 156682 156152 gene locus_tag LOCUS_28690 156682 156152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 156855 157055 gene locus_tag LOCUS_28700 156855 157055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545426.1 protein_id gnl|my_center|LOCUS_28700 157131 159350 gene locus_tag LOCUS_28710 157131 159350 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005309.1 protein_id gnl|my_center|LOCUS_28710 159851 160453 gene locus_tag LOCUS_28720 159851 160453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 160885 161196 gene locus_tag LOCUS_28730 160885 161196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 161570 163951 gene locus_tag LOCUS_28740 161570 163951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 168736 163994 gene locus_tag LOCUS_28750 168736 163994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 170343 168820 gene locus_tag LOCUS_28760 170343 168820 CDS product 6-aminohexanoate-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976239.1 protein_id gnl|my_center|LOCUS_28760 170456 171307 gene locus_tag LOCUS_28770 170456 171307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 171342 172592 gene locus_tag LOCUS_28780 171342 172592 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087499.1 protein_id gnl|my_center|LOCUS_28780 174403 172754 gene locus_tag LOCUS_28790 174403 172754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 174484 175257 gene locus_tag LOCUS_28800 174484 175257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510896.1 protein_id gnl|my_center|LOCUS_28800 175244 175720 gene locus_tag LOCUS_28810 175244 175720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 175775 176170 gene locus_tag LOCUS_28820 175775 176170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088521.1 protein_id gnl|my_center|LOCUS_28820 176217 178211 gene locus_tag LOCUS_28830 176217 178211 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487747.1 protein_id gnl|my_center|LOCUS_28830 178564 178316 gene locus_tag LOCUS_28840 178564 178316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 180160 178844 gene locus_tag LOCUS_28850 gene erg3 180160 178844 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162077.1 protein_id gnl|my_center|LOCUS_28850 181397 180381 gene locus_tag LOCUS_28860 181397 180381 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886873.1 protein_id gnl|my_center|LOCUS_28860 182571 181468 gene locus_tag LOCUS_28870 182571 181468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 183062 182649 gene locus_tag LOCUS_28880 gene maoC 183062 182649 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034360.1 protein_id gnl|my_center|LOCUS_28880 183684 183238 gene locus_tag LOCUS_28890 183684 183238 CDS product dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274661.1 protein_id gnl|my_center|LOCUS_28890 183731 184237 gene locus_tag LOCUS_28900 183731 184237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 184890 186746 gene locus_tag LOCUS_28910 184890 186746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121107.1 protein_id gnl|my_center|LOCUS_28910 186775 188199 gene locus_tag LOCUS_28920 186775 188199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340206.1 protein_id gnl|my_center|LOCUS_28920 188504 188977 gene locus_tag LOCUS_28930 188504 188977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 189024 190019 gene locus_tag LOCUS_28940 189024 190019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 191858 190095 gene locus_tag LOCUS_28950 191858 190095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 192794 192198 gene locus_tag LOCUS_28960 192794 192198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 194338 192872 gene locus_tag LOCUS_28970 194338 192872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 194630 195322 gene locus_tag LOCUS_28980 194630 195322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 195322 196971 gene locus_tag LOCUS_28990 195322 196971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 196987 197604 gene locus_tag LOCUS_29000 gene rnd 196987 197604 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128627.1 protein_id gnl|my_center|LOCUS_29000 198300 197830 gene locus_tag LOCUS_29010 198300 197830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 199058 198363 gene locus_tag LOCUS_29020 199058 198363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 199124 200632 gene locus_tag LOCUS_29030 199124 200632 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_29030 200666 200896 gene locus_tag LOCUS_29040 200666 200896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 200909 201976 gene locus_tag LOCUS_29050 gene purM 200909 201976 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F242 protein_id gnl|my_center|LOCUS_29050 201969 203123 gene locus_tag LOCUS_29060 gene rlmN 201969 203123 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7V1 protein_id gnl|my_center|LOCUS_29060 203120 205132 gene locus_tag LOCUS_29070 203120 205132 CDS product para-aminobenzoate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933375.1 protein_id gnl|my_center|LOCUS_29070 205129 206022 gene locus_tag LOCUS_29080 205129 206022 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963796.1 protein_id gnl|my_center|LOCUS_29080 206087 207436 gene locus_tag LOCUS_29090 206087 207436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 207520 208311 gene locus_tag LOCUS_29100 207520 208311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 208478 209257 gene locus_tag LOCUS_29110 208478 209257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 209299 210189 gene locus_tag LOCUS_29120 209299 210189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 211104 210466 gene locus_tag LOCUS_29130 211104 210466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 211727 211284 gene locus_tag LOCUS_29140 211727 211284 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675599.1 protein_id gnl|my_center|LOCUS_29140 213931 211955 gene locus_tag LOCUS_29150 213931 211955 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64SQ0 protein_id gnl|my_center|LOCUS_29150 214563 213928 gene locus_tag LOCUS_29160 214563 213928 CDS product ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788431.1 protein_id gnl|my_center|LOCUS_29160 215882 214560 gene locus_tag LOCUS_29170 215882 214560 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788433.1 protein_id gnl|my_center|LOCUS_29170 217718 215952 gene locus_tag LOCUS_29180 gene atpA 217718 215952 CDS product V-type ATP synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64SP7 protein_id gnl|my_center|LOCUS_29180 218632 217778 gene locus_tag LOCUS_29190 218632 217778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 219246 218629 gene locus_tag LOCUS_29200 219246 218629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 219983 219366 gene locus_tag LOCUS_29210 219983 219366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 220087 220269 gene locus_tag LOCUS_29220 220087 220269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 221127 220342 gene locus_tag LOCUS_29230 221127 220342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 222688 221207 gene locus_tag LOCUS_29240 gene nhaC 222688 221207 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711547.1 protein_id gnl|my_center|LOCUS_29240 224081 222693 gene locus_tag LOCUS_29250 gene sthA 224081 222693 CDS product soluble pyridine nucleotide transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57112 protein_id gnl|my_center|LOCUS_29250 225201 224089 gene locus_tag LOCUS_29260 225201 224089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 225382 225687 gene locus_tag LOCUS_29270 225382 225687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 225687 226010 gene locus_tag LOCUS_29280 225687 226010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 226007 226546 gene locus_tag LOCUS_29290 226007 226546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 227558 226614 gene locus_tag LOCUS_29300 gene dapF 227558 226614 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F9V5 protein_id gnl|my_center|LOCUS_29300 227778 228731 gene locus_tag LOCUS_29310 227778 228731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 228728 229069 gene locus_tag LOCUS_29320 228728 229069 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F1Q9 protein_id gnl|my_center|LOCUS_29320 230137 229208 gene locus_tag LOCUS_29330 230137 229208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 230284 232446 gene locus_tag LOCUS_29340 230284 232446 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640121.1 protein_id gnl|my_center|LOCUS_29340 234068 233337 gene locus_tag LOCUS_29350 234068 233337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 234119 235141 gene locus_tag LOCUS_29360 gene thiL 234119 235141 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F0S9 protein_id gnl|my_center|LOCUS_29360 235610 235281 gene locus_tag LOCUS_29370 235610 235281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 235689 236183 gene locus_tag LOCUS_29380 gene fur 235689 236183 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078417.1 protein_id gnl|my_center|LOCUS_29380 236422 238389 gene locus_tag LOCUS_29390 gene ligA 236422 238389 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYU4 protein_id gnl|my_center|LOCUS_29390 239910 238540 gene locus_tag LOCUS_29400 239910 238540 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933713.1 protein_id gnl|my_center|LOCUS_29400 239965 241344 gene locus_tag LOCUS_29410 239965 241344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 241334 242926 gene locus_tag LOCUS_29420 241334 242926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 242934 244106 gene locus_tag LOCUS_29430 gene wecE 242934 244106 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281953.1 protein_id gnl|my_center|LOCUS_29430 247249 244094 gene locus_tag LOCUS_29440 247249 244094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 249404 247254 gene locus_tag LOCUS_29450 gene metG 249404 247254 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KT69 protein_id gnl|my_center|LOCUS_29450 250198 249404 gene locus_tag LOCUS_29460 gene sseA 250198 249404 CDS product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227049.1 protein_id gnl|my_center|LOCUS_29460 251381 250290 gene locus_tag LOCUS_29470 251381 250290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 251461 252459 gene locus_tag LOCUS_29480 251461 252459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 253824 252565 gene locus_tag LOCUS_29490 gene pgi 253824 252565 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80860 protein_id gnl|my_center|LOCUS_29490 253910 254626 gene locus_tag LOCUS_29500 253910 254626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472806.1 protein_id gnl|my_center|LOCUS_29500 255443 254631 gene locus_tag LOCUS_29510 255443 254631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 255791 255864 gene locus_tag LOCUS_t00310 255791 255864 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 255989 256690 gene locus_tag LOCUS_29520 gene vicR 255989 256690 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795919.1 protein_id gnl|my_center|LOCUS_29520 256718 258112 gene locus_tag LOCUS_29530 gene vicK 256718 258112 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254665.1 protein_id gnl|my_center|LOCUS_29530 258574 259020 gene locus_tag LOCUS_29540 258574 259020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 260064 259255 gene locus_tag LOCUS_29550 260064 259255 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870525.1 protein_id gnl|my_center|LOCUS_29550 261040 260078 gene locus_tag LOCUS_29560 gene pstA 261040 260078 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S082 protein_id gnl|my_center|LOCUS_29560 262002 261037 gene locus_tag LOCUS_29570 262002 261037 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCU9 protein_id gnl|my_center|LOCUS_29570 263009 262023 gene locus_tag LOCUS_29580 gene pstS 263009 262023 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941760.1 protein_id gnl|my_center|LOCUS_29580 263172 263771 gene locus_tag LOCUS_29590 gene phoU 263172 263771 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E69 protein_id gnl|my_center|LOCUS_29590 263797 265140 gene locus_tag LOCUS_29600 gene kdtA 263797 265140 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576871.1 protein_id gnl|my_center|LOCUS_29600 265757 265224 gene locus_tag LOCUS_29610 gene fliL 265757 265224 CDS product endoflagellar basal body-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501992.1 protein_id gnl|my_center|LOCUS_29610 266688 265903 gene locus_tag LOCUS_29620 gene motB 266688 265903 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129914.1 protein_id gnl|my_center|LOCUS_29620 267668 266880 gene locus_tag LOCUS_29630 gene motA 267668 266880 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345490.1 protein_id gnl|my_center|LOCUS_29630 267878 267681 gene locus_tag LOCUS_29640 267878 267681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 267993 269156 gene locus_tag LOCUS_29650 267993 269156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 269153 270679 gene locus_tag LOCUS_29660 gene dltB 269153 270679 CDS product membrane-bound O-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898728.1 protein_id gnl|my_center|LOCUS_29660 271437 272012 gene locus_tag LOCUS_29670 271437 272012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 272121 273011 gene locus_tag LOCUS_29680 272121 273011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932722.1 protein_id gnl|my_center|LOCUS_29680 273101 273547 gene locus_tag LOCUS_29690 273101 273547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 273583 274137 gene locus_tag LOCUS_29700 273583 274137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621286.1 protein_id gnl|my_center|LOCUS_29700 274237 275334 gene locus_tag LOCUS_29710 gene cobT 274237 275334 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYK9 protein_id gnl|my_center|LOCUS_29710 275503 276291 gene locus_tag LOCUS_29720 gene cobS 275503 276291 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZK9 protein_id gnl|my_center|LOCUS_29720 276276 276875 gene locus_tag LOCUS_29730 gene gpmA 276276 276875 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963576.1 protein_id gnl|my_center|LOCUS_29730 276960 277568 gene locus_tag LOCUS_29740 276960 277568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 278416 277643 gene locus_tag LOCUS_29750 278416 277643 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836548.1 protein_id gnl|my_center|LOCUS_29750 278600 279682 gene locus_tag LOCUS_29760 gene acoA 278600 279682 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4N0 protein_id gnl|my_center|LOCUS_29760 279790 280770 gene locus_tag LOCUS_29770 gene acoB 279790 280770 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279894.1 protein_id gnl|my_center|LOCUS_29770 280802 282301 gene locus_tag LOCUS_29780 gene aceF 280802 282301 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4N2 protein_id gnl|my_center|LOCUS_29780 282298 282684 gene locus_tag LOCUS_29790 282298 282684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 282681 284474 gene locus_tag LOCUS_29800 282681 284474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 285392 284394 gene locus_tag LOCUS_29810 285392 284394 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868565.1 protein_id gnl|my_center|LOCUS_29810 285460 287397 gene locus_tag LOCUS_29820 285460 287397 CDS product sodium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490750.1 protein_id gnl|my_center|LOCUS_29820 290587 287522 gene locus_tag LOCUS_29830 290587 287522 CDS product serine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521953.1 protein_id gnl|my_center|LOCUS_29830 290901 292274 gene locus_tag LOCUS_29840 290901 292274 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404096.1 protein_id gnl|my_center|LOCUS_29840 293656 292526 gene locus_tag LOCUS_29850 293656 292526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 294192 295367 gene locus_tag LOCUS_29860 294192 295367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069698.1 protein_id gnl|my_center|LOCUS_29860 296068 296535 gene locus_tag LOCUS_29870 296068 296535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 297103 296507 gene locus_tag LOCUS_29880 gene pyrE 297103 296507 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F1Z0 protein_id gnl|my_center|LOCUS_29880 297106 299058 gene locus_tag LOCUS_29890 gene lnt2 297106 299058 CDS product apolipoprotein N-acyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYY4 protein_id gnl|my_center|LOCUS_29890 299638 299018 gene locus_tag LOCUS_29900 299638 299018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 300720 299647 gene locus_tag LOCUS_29910 300720 299647 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F2Z8 protein_id gnl|my_center|LOCUS_29910 303182 301206 gene locus_tag LOCUS_29920 303182 301206 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201677.1 protein_id gnl|my_center|LOCUS_29920 303255 303935 gene locus_tag LOCUS_29930 303255 303935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 305221 304136 gene locus_tag LOCUS_29940 305221 304136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 305784 305332 gene locus_tag LOCUS_29950 305784 305332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 306048 306860 gene locus_tag LOCUS_29960 306048 306860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 307496 307032 gene locus_tag LOCUS_29970 307496 307032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 307646 308101 gene locus_tag LOCUS_29980 307646 308101 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461316.1 protein_id gnl|my_center|LOCUS_29980 309272 308166 gene locus_tag LOCUS_29990 309272 308166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 309472 309281 gene locus_tag LOCUS_30000 309472 309281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 310757 309867 gene locus_tag LOCUS_30010 gene xerD 310757 309867 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ZAM7 protein_id gnl|my_center|LOCUS_30010 310894 312273 gene locus_tag LOCUS_30020 gene glyQS 310894 312273 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F6C0 protein_id gnl|my_center|LOCUS_30020 312287 312703 gene locus_tag LOCUS_30030 312287 312703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403489.1 protein_id gnl|my_center|LOCUS_30030 312741 314096 gene locus_tag LOCUS_30040 312741 314096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 316213 314129 gene locus_tag LOCUS_30050 316213 314129 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836895.1 protein_id gnl|my_center|LOCUS_30050 316484 316849 gene locus_tag LOCUS_30060 gene panD 316484 316849 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CVE9 protein_id gnl|my_center|LOCUS_30060 317095 317901 gene locus_tag LOCUS_30070 317095 317901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 318648 318133 gene locus_tag LOCUS_30080 318648 318133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206947.1 protein_id gnl|my_center|LOCUS_30080 318781 319881 gene locus_tag LOCUS_30090 318781 319881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200269.1 protein_id gnl|my_center|LOCUS_30090 321000 319897 gene locus_tag LOCUS_30100 321000 319897 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865348.1 protein_id gnl|my_center|LOCUS_30100 321153 321761 gene locus_tag LOCUS_30110 321153 321761 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219098.1 protein_id gnl|my_center|LOCUS_30110 323600 322269 gene locus_tag LOCUS_30120 323600 322269 CDS product adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057770.1 protein_id gnl|my_center|LOCUS_30120 323653 324084 gene locus_tag LOCUS_30130 323653 324084 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081702.1 protein_id gnl|my_center|LOCUS_30130 324216 324875 gene locus_tag LOCUS_30140 324216 324875 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4G4 protein_id gnl|my_center|LOCUS_30140 325190 325567 gene locus_tag LOCUS_30150 325190 325567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 327084 325564 gene locus_tag LOCUS_30160 gene phr 327084 325564 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121881.1 protein_id gnl|my_center|LOCUS_30160 328678 327467 gene locus_tag LOCUS_30170 gene pfk-1 328678 327467 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933267.1 protein_id gnl|my_center|LOCUS_30170 330500 328716 gene locus_tag LOCUS_30180 330500 328716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016926.1 protein_id gnl|my_center|LOCUS_30180 331633 330695 gene locus_tag LOCUS_30190 gene etfA 331633 330695 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072965.1 protein_id gnl|my_center|LOCUS_30190 332418 331657 gene locus_tag LOCUS_30200 gene etfB 332418 331657 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692397.1 protein_id gnl|my_center|LOCUS_30200 333001 332627 gene locus_tag LOCUS_30210 333001 332627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 333043 334239 gene locus_tag LOCUS_30220 gene ivd 333043 334239 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202093.1 protein_id gnl|my_center|LOCUS_30220 334702 337149 gene locus_tag LOCUS_30230 gene amtB 334702 337149 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F074 protein_id gnl|my_center|LOCUS_30230 337940 337344 gene locus_tag LOCUS_30240 337940 337344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 338069 338488 gene locus_tag LOCUS_30250 338069 338488 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532664.1 protein_id gnl|my_center|LOCUS_30250 339926 338640 gene locus_tag LOCUS_30260 339926 338640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 341320 340784 gene locus_tag LOCUS_30270 gene pth 341320 340784 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3Q2 protein_id gnl|my_center|LOCUS_30270 341396 342853 gene locus_tag LOCUS_30280 gene dnaX 341396 342853 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929205.1 protein_id gnl|my_center|LOCUS_30280 342875 343201 gene locus_tag LOCUS_30290 342875 343201 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EY85 protein_id gnl|my_center|LOCUS_30290 343201 343797 gene locus_tag LOCUS_30300 gene recR 343201 343797 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAI4 protein_id gnl|my_center|LOCUS_30300 344813 343860 gene locus_tag LOCUS_30310 344813 343860 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948814.1 protein_id gnl|my_center|LOCUS_30310 345105 346418 gene locus_tag LOCUS_30320 345105 346418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 347925 346465 gene locus_tag LOCUS_30330 347925 346465 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085828.1 protein_id gnl|my_center|LOCUS_30330 349385 348045 gene locus_tag LOCUS_30340 gene cyaA 349385 348045 CDS product guanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247973.1 protein_id gnl|my_center|LOCUS_30340 349520 350668 gene locus_tag LOCUS_30350 349520 350668 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957890.1 protein_id gnl|my_center|LOCUS_30350 350924 352039 gene locus_tag LOCUS_30360 350924 352039 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7DDD1 protein_id gnl|my_center|LOCUS_30360 352075 352707 gene locus_tag LOCUS_30370 352075 352707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 354113 352875 gene locus_tag LOCUS_30380 gene cysN 354113 352875 CDS product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYJ5 protein_id gnl|my_center|LOCUS_30380 355198 354263 gene locus_tag LOCUS_30390 gene cysD 355198 354263 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYJ4 protein_id gnl|my_center|LOCUS_30390 356891 355218 gene locus_tag LOCUS_30400 gene cysI 356891 355218 CDS product sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287342.1 protein_id gnl|my_center|LOCUS_30400 358206 357106 gene locus_tag LOCUS_30410 358206 357106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 358813 358226 gene locus_tag LOCUS_30420 358813 358226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 359552 358851 gene locus_tag LOCUS_30430 359552 358851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 360305 359682 gene locus_tag LOCUS_30440 360305 359682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 360904 360302 gene locus_tag LOCUS_30450 360904 360302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 361528 361247 gene locus_tag LOCUS_30460 361528 361247 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257426.1 protein_id gnl|my_center|LOCUS_30460 363200 361662 gene locus_tag LOCUS_30470 363200 361662 CDS product Baeyer-Villiger monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RKB5 protein_id gnl|my_center|LOCUS_30470 363470 364591 gene locus_tag LOCUS_30480 363470 364591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 365694 364807 gene locus_tag LOCUS_30490 365694 364807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 protein_id gnl|my_center|LOCUS_30490 366496 365924 gene locus_tag LOCUS_30500 366496 365924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494335.1 protein_id gnl|my_center|LOCUS_30500 369328 366617 gene locus_tag LOCUS_30510 369328 366617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 370072 369407 gene locus_tag LOCUS_30520 370072 369407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 370336 371085 gene locus_tag LOCUS_30530 gene apr 370336 371085 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942361.1 protein_id gnl|my_center|LOCUS_30530 371085 371969 gene locus_tag LOCUS_30540 371085 371969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 372173 373189 gene locus_tag LOCUS_30550 372173 373189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 373364 373705 gene locus_tag LOCUS_30560 373364 373705 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I3A6 protein_id gnl|my_center|LOCUS_30560 373765 374817 gene locus_tag LOCUS_30570 373765 374817 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272562.1 protein_id gnl|my_center|LOCUS_30570 376582 375089 gene locus_tag LOCUS_30580 376582 375089 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104117.1 protein_id gnl|my_center|LOCUS_30580 378119 376776 gene locus_tag LOCUS_30590 gene aofH 378119 376776 CDS product putative flavin-containing monoamine oxidase AofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63534 protein_id gnl|my_center|LOCUS_30590 378309 378986 gene locus_tag LOCUS_30600 378309 378986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 380027 379269 gene locus_tag LOCUS_30610 380027 379269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 380296 380057 gene locus_tag LOCUS_30620 380296 380057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 380833 381384 gene locus_tag LOCUS_30630 380833 381384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 381422 382030 gene locus_tag LOCUS_30640 381422 382030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 382104 382508 gene locus_tag LOCUS_30650 382104 382508 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183065.1 protein_id gnl|my_center|LOCUS_30650 383490 382654 gene locus_tag LOCUS_30660 383490 382654 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 protein_id gnl|my_center|LOCUS_30660 384472 383570 gene locus_tag LOCUS_30670 384472 383570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 384609 385886 gene locus_tag LOCUS_30680 gene hemL 384609 385886 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHH6 protein_id gnl|my_center|LOCUS_30680 385902 386948 gene locus_tag LOCUS_30690 385902 386948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 386964 387659 gene locus_tag LOCUS_30700 386964 387659 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_30700 387920 388966 gene locus_tag LOCUS_30710 gene hemE 387920 388966 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKW0 protein_id gnl|my_center|LOCUS_30710 389632 389111 gene locus_tag LOCUS_30720 389632 389111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 391311 389851 gene locus_tag LOCUS_30730 391311 389851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 391621 391439 gene locus_tag LOCUS_30740 391621 391439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 393351 391618 gene locus_tag LOCUS_30750 393351 391618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837584.1 protein_id gnl|my_center|LOCUS_30750 393849 393478 gene locus_tag LOCUS_30760 393849 393478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 394292 393846 gene locus_tag LOCUS_30770 gene fliS 394292 393846 CDS product flagellar protein FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3W9 protein_id gnl|my_center|LOCUS_30770 395284 394424 gene locus_tag LOCUS_30780 gene uppP 395284 394424 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NG92 protein_id gnl|my_center|LOCUS_30780 395818 395414 gene locus_tag LOCUS_30790 395818 395414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 396284 396820 gene locus_tag LOCUS_30800 396284 396820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 397432 396893 gene locus_tag LOCUS_30810 397432 396893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 397596 398192 gene locus_tag LOCUS_30820 397596 398192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 398156 398830 gene locus_tag LOCUS_30830 398156 398830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 400150 398894 gene locus_tag LOCUS_30840 400150 398894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 >Feature sequence08 1366 521 gene locus_tag LOCUS_30850 1366 521 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4M3 protein_id gnl|my_center|LOCUS_30850 3185 2547 gene locus_tag LOCUS_30860 3185 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 3383 4318 gene locus_tag LOCUS_30870 3383 4318 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257729.1 protein_id gnl|my_center|LOCUS_30870 5109 4576 gene locus_tag LOCUS_30880 5109 4576 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095503.1 protein_id gnl|my_center|LOCUS_30880 6677 5310 gene locus_tag LOCUS_30890 6677 5310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 7935 7111 gene locus_tag LOCUS_30900 7935 7111 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971279.1 protein_id gnl|my_center|LOCUS_30900 8206 9150 gene locus_tag LOCUS_30910 8206 9150 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529501.1 protein_id gnl|my_center|LOCUS_30910 10660 9122 gene locus_tag LOCUS_30920 10660 9122 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015951.1 protein_id gnl|my_center|LOCUS_30920 11738 10947 gene locus_tag LOCUS_30930 11738 10947 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258110.1 protein_id gnl|my_center|LOCUS_30930 12085 12798 gene locus_tag LOCUS_30940 12085 12798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 12887 14452 gene locus_tag LOCUS_30950 12887 14452 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964301.1 protein_id gnl|my_center|LOCUS_30950 14709 15062 gene locus_tag LOCUS_30960 14709 15062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 15217 16455 gene locus_tag LOCUS_30970 15217 16455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 16562 16771 gene locus_tag LOCUS_30980 16562 16771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 18351 16930 gene locus_tag LOCUS_30990 gene pyk 18351 16930 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747D6 protein_id gnl|my_center|LOCUS_30990 18410 19657 gene locus_tag LOCUS_31000 18410 19657 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987056.1 protein_id gnl|my_center|LOCUS_31000 19647 20171 gene locus_tag LOCUS_31010 19647 20171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 23212 20270 gene locus_tag LOCUS_31020 23212 20270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 23401 23877 gene locus_tag LOCUS_31030 23401 23877 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095212.1 protein_id gnl|my_center|LOCUS_31030 25554 23968 gene locus_tag LOCUS_31040 25554 23968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 25600 25995 gene locus_tag LOCUS_31050 25600 25995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 27332 25992 gene locus_tag LOCUS_31060 gene serB 27332 25992 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931867.1 protein_id gnl|my_center|LOCUS_31060 27788 28405 gene locus_tag LOCUS_31070 gene rpsD 27788 28405 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q817A4 protein_id gnl|my_center|LOCUS_31070 28839 28510 gene locus_tag LOCUS_31080 28839 28510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 29006 30358 gene locus_tag LOCUS_31090 29006 30358 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0Q1 protein_id gnl|my_center|LOCUS_31090 31541 30576 gene locus_tag LOCUS_31100 31541 30576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 31982 31614 gene locus_tag LOCUS_31110 31982 31614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 32164 35112 gene locus_tag LOCUS_31120 32164 35112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 35938 35141 gene locus_tag LOCUS_31130 35938 35141 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F308 protein_id gnl|my_center|LOCUS_31130 36381 35947 gene locus_tag LOCUS_31140 36381 35947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053201.1 protein_id gnl|my_center|LOCUS_31140 37349 36396 gene locus_tag LOCUS_31150 37349 36396 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F306 protein_id gnl|my_center|LOCUS_31150 39214 37394 gene locus_tag LOCUS_31160 39214 37394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 39529 40146 gene locus_tag LOCUS_31170 39529 40146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 40238 41290 gene locus_tag LOCUS_31180 gene fbaB 40238 41290 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120064.1 protein_id gnl|my_center|LOCUS_31180 41759 43630 gene locus_tag LOCUS_31190 41759 43630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 46285 43757 gene locus_tag LOCUS_31200 46285 43757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 46901 49168 gene locus_tag LOCUS_31210 46901 49168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 49469 51907 gene locus_tag LOCUS_31220 49469 51907 CDS product signal transduction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002071771.1 protein_id gnl|my_center|LOCUS_31220 52546 52007 gene locus_tag LOCUS_31230 52546 52007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 56104 52673 gene locus_tag LOCUS_31240 56104 52673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 56473 56637 gene locus_tag LOCUS_31250 56473 56637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 56893 57162 gene locus_tag LOCUS_31260 56893 57162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 57645 57280 gene locus_tag LOCUS_31270 57645 57280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 58093 57701 gene locus_tag LOCUS_31280 58093 57701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 59036 58107 gene locus_tag LOCUS_31290 59036 58107 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939052.1 protein_id gnl|my_center|LOCUS_31290 59118 59465 gene locus_tag LOCUS_31300 59118 59465 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940209.1 protein_id gnl|my_center|LOCUS_31300 59494 60186 gene locus_tag LOCUS_31310 59494 60186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392265.1 protein_id gnl|my_center|LOCUS_31310 60183 61421 gene locus_tag LOCUS_31320 gene nupG 60183 61421 CDS product nucleoside permease NupG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CQC8 protein_id gnl|my_center|LOCUS_31320 61418 64507 gene locus_tag LOCUS_31330 61418 64507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 64512 65138 gene locus_tag LOCUS_31340 64512 65138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795862.1 protein_id gnl|my_center|LOCUS_31340 65135 73384 gene locus_tag LOCUS_31350 65135 73384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 75587 73476 gene locus_tag LOCUS_31360 gene fhlA 75587 73476 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017465.1 protein_id gnl|my_center|LOCUS_31360 75914 76696 gene locus_tag LOCUS_31370 75914 76696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054413.1 protein_id gnl|my_center|LOCUS_31370 76805 77974 gene locus_tag LOCUS_31380 76805 77974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 78055 79395 gene locus_tag LOCUS_31390 78055 79395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 79792 79427 gene locus_tag LOCUS_31400 gene rsbV 79792 79427 CDS product anti-sigma-B factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WVX8 protein_id gnl|my_center|LOCUS_31400 81359 80067 gene locus_tag LOCUS_31410 81359 80067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 82409 81492 gene locus_tag LOCUS_31420 82409 81492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 82754 82443 gene locus_tag LOCUS_31430 82754 82443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 83664 82948 gene locus_tag LOCUS_31440 83664 82948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963154.1 protein_id gnl|my_center|LOCUS_31440 86532 83839 gene locus_tag LOCUS_31450 86532 83839 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060943.1 protein_id gnl|my_center|LOCUS_31450 88088 86622 gene locus_tag LOCUS_31460 88088 86622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 88451 89845 gene locus_tag LOCUS_31470 gene eutB 88451 89845 CDS product ethanolamine ammonia-lyase heavy chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004541772.1 protein_id gnl|my_center|LOCUS_31470 89842 90780 gene locus_tag LOCUS_31480 gene eutC 89842 90780 CDS product ethanolamine ammonia-lyase light chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8I0 protein_id gnl|my_center|LOCUS_31480 91701 90892 gene locus_tag LOCUS_31490 91701 90892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 92397 91900 gene locus_tag LOCUS_31500 92397 91900 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963692.1 protein_id gnl|my_center|LOCUS_31500 92532 93137 gene locus_tag LOCUS_31510 92532 93137 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856975.1 protein_id gnl|my_center|LOCUS_31510 94232 93336 gene locus_tag LOCUS_31520 94232 93336 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103810.1 protein_id gnl|my_center|LOCUS_31520 96143 94572 gene locus_tag LOCUS_31530 96143 94572 CDS product all-trans-retinol 13,14-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964345.1 protein_id gnl|my_center|LOCUS_31530 96552 97061 gene locus_tag LOCUS_31540 96552 97061 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384710.1 protein_id gnl|my_center|LOCUS_31540 97513 97130 gene locus_tag LOCUS_31550 97513 97130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 98751 98479 gene locus_tag LOCUS_31560 98751 98479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503525.1 protein_id gnl|my_center|LOCUS_31560 99749 98910 gene locus_tag LOCUS_31570 99749 98910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 99842 100648 gene locus_tag LOCUS_31580 99842 100648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071068.1 protein_id gnl|my_center|LOCUS_31580 101889 100804 gene locus_tag LOCUS_31590 101889 100804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010145.1 protein_id gnl|my_center|LOCUS_31590 103420 102026 gene locus_tag LOCUS_31600 103420 102026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 103994 103797 gene locus_tag LOCUS_31610 103994 103797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 104358 104013 gene locus_tag LOCUS_tm00010 104358 104013 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 104507 106264 gene locus_tag LOCUS_31620 104507 106264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875631.1 protein_id gnl|my_center|LOCUS_31620 106483 108516 gene locus_tag LOCUS_31630 106483 108516 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_31630 108513 109562 gene locus_tag LOCUS_31640 108513 109562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 109716 110264 gene locus_tag LOCUS_31650 109716 110264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 111108 110320 gene locus_tag LOCUS_31660 111108 110320 CDS product endoflagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394583.1 protein_id gnl|my_center|LOCUS_31660 111287 111361 gene locus_tag LOCUS_t00320 111287 111361 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 111556 111897 gene locus_tag LOCUS_31670 111556 111897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 111955 112575 gene locus_tag LOCUS_31680 111955 112575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 112594 112842 gene locus_tag LOCUS_31690 112594 112842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 113261 112935 gene locus_tag LOCUS_31700 113261 112935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057944.1 protein_id gnl|my_center|LOCUS_31700 113500 114555 gene locus_tag LOCUS_31710 113500 114555 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530044.1 protein_id gnl|my_center|LOCUS_31710 115010 115729 gene locus_tag LOCUS_31720 115010 115729 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932468.1 protein_id gnl|my_center|LOCUS_31720 116631 115819 gene locus_tag LOCUS_31730 116631 115819 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120630.1 protein_id gnl|my_center|LOCUS_31730 116879 117502 gene locus_tag LOCUS_31740 116879 117502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 117519 118670 gene locus_tag LOCUS_31750 117519 118670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 118829 120034 gene locus_tag LOCUS_31760 gene yngJ 118829 120034 CDS product putative acyl-CoA dehydrogenase YngJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34421 protein_id gnl|my_center|LOCUS_31760 120893 120102 gene locus_tag LOCUS_31770 120893 120102 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVS4 protein_id gnl|my_center|LOCUS_31770 123117 121174 gene locus_tag LOCUS_31780 gene faa1 123117 121174 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416237.1 protein_id gnl|my_center|LOCUS_31780 123716 123264 gene locus_tag LOCUS_31790 123716 123264 CDS product bacitracin resistance protein BacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007616.1 protein_id gnl|my_center|LOCUS_31790 123837 124256 gene locus_tag LOCUS_31800 123837 124256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 124263 125345 gene locus_tag LOCUS_31810 124263 125345 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658622.1 protein_id gnl|my_center|LOCUS_31810 125528 125875 gene locus_tag LOCUS_31820 gene glnK 125528 125875 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767694.1 protein_id gnl|my_center|LOCUS_31820 126721 125987 gene locus_tag LOCUS_31830 gene fabG 126721 125987 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043153.1 protein_id gnl|my_center|LOCUS_31830 127003 128364 gene locus_tag LOCUS_31840 127003 128364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 128398 129702 gene locus_tag LOCUS_31850 gene argJ 128398 129702 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYV8 protein_id gnl|my_center|LOCUS_31850 129704 130996 gene locus_tag LOCUS_31860 129704 130996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 130993 133602 gene locus_tag LOCUS_31870 130993 133602 CDS product serine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244388.1 protein_id gnl|my_center|LOCUS_31870 133592 134473 gene locus_tag LOCUS_31880 133592 134473 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082135.1 protein_id gnl|my_center|LOCUS_31880 134524 135204 gene locus_tag LOCUS_31890 134524 135204 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122587.1 protein_id gnl|my_center|LOCUS_31890 135201 136673 gene locus_tag LOCUS_31900 135201 136673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 137019 136678 gene locus_tag LOCUS_31910 137019 136678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192756.1 protein_id gnl|my_center|LOCUS_31910 138217 137081 gene locus_tag LOCUS_31920 gene pyrD 138217 137081 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYC6 protein_id gnl|my_center|LOCUS_31920 138850 138230 gene locus_tag LOCUS_31930 gene lexA 138850 138230 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F663 protein_id gnl|my_center|LOCUS_31930 138920 139117 gene locus_tag LOCUS_31940 138920 139117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 140237 139206 gene locus_tag LOCUS_31950 140237 139206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 141363 140503 gene locus_tag LOCUS_31960 gene murI 141363 140503 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748S8 protein_id gnl|my_center|LOCUS_31960 142706 141477 gene locus_tag LOCUS_31970 gene lysC 142706 141477 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F865 protein_id gnl|my_center|LOCUS_31970 144163 143048 gene locus_tag LOCUS_31980 144163 143048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982215.1 protein_id gnl|my_center|LOCUS_31980 145372 144434 gene locus_tag LOCUS_31990 145372 144434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 146430 146239 gene locus_tag LOCUS_32000 146430 146239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 147000 146785 gene locus_tag LOCUS_32010 147000 146785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 148038 148280 gene locus_tag LOCUS_32020 148038 148280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 153434 151608 gene locus_tag LOCUS_32030 153434 151608 CDS product nucleoside-diphosphate sugar oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185930.1 protein_id gnl|my_center|LOCUS_32030 155313 154555 gene locus_tag LOCUS_32040 155313 154555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 156645 155488 gene locus_tag LOCUS_32050 156645 155488 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808460.1 protein_id gnl|my_center|LOCUS_32050 157342 156638 gene locus_tag LOCUS_32060 157342 156638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 159267 157513 gene locus_tag LOCUS_32070 159267 157513 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056091.1 protein_id gnl|my_center|LOCUS_32070 159313 159495 gene locus_tag LOCUS_32080 159313 159495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 161443 160619 gene locus_tag LOCUS_32090 161443 160619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 163557 161626 gene locus_tag LOCUS_32100 163557 161626 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387983.1 protein_id gnl|my_center|LOCUS_32100 164343 163564 gene locus_tag LOCUS_32110 164343 163564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 166839 166069 gene locus_tag LOCUS_32120 166839 166069 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922020.1 protein_id gnl|my_center|LOCUS_32120 168076 166823 gene locus_tag LOCUS_32130 168076 166823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 169212 168073 gene locus_tag LOCUS_32140 169212 168073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 170481 169786 gene locus_tag LOCUS_32150 gene neuA 170481 169786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132016.1 protein_id gnl|my_center|LOCUS_32150 171649 170498 gene locus_tag LOCUS_32160 171649 170498 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545909.1 protein_id gnl|my_center|LOCUS_32160 172641 171646 gene locus_tag LOCUS_32170 172641 171646 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392277.1 protein_id gnl|my_center|LOCUS_32170 173500 172634 gene locus_tag LOCUS_32180 173500 172634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 174915 173497 gene locus_tag LOCUS_32190 174915 173497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 175466 174954 gene locus_tag LOCUS_32200 175466 174954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 176928 175723 gene locus_tag LOCUS_32210 176928 175723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 178041 176986 gene locus_tag LOCUS_32220 178041 176986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 178912 178049 gene locus_tag LOCUS_32230 178912 178049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 180834 179539 gene locus_tag LOCUS_32240 gene capL 180834 179539 CDS product UDP-N-acetyl-D-galactosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942587.1 protein_id gnl|my_center|LOCUS_32240 181853 180831 gene locus_tag LOCUS_32250 181853 180831 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057042.1 protein_id gnl|my_center|LOCUS_32250 182959 182015 gene locus_tag LOCUS_32260 gene wcaG 182959 182015 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F5U0 protein_id gnl|my_center|LOCUS_32260 183466 183122 gene locus_tag LOCUS_32270 183466 183122 CDS product MarR family EPS-associated transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001968012.1 protein_id gnl|my_center|LOCUS_32270 184766 183864 gene locus_tag LOCUS_32280 184766 183864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 186375 185350 gene locus_tag LOCUS_32290 gene gmd 186375 185350 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZ92 protein_id gnl|my_center|LOCUS_32290 187450 186668 gene locus_tag LOCUS_32300 187450 186668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 188880 187468 gene locus_tag LOCUS_32310 188880 187468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 190362 188980 gene locus_tag LOCUS_32320 gene ugd 190362 188980 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963427.1 protein_id gnl|my_center|LOCUS_32320 190527 192194 gene locus_tag LOCUS_32330 190527 192194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 192236 193216 gene locus_tag LOCUS_32340 192236 193216 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142814.1 protein_id gnl|my_center|LOCUS_32340 193209 193709 gene locus_tag LOCUS_32350 193209 193709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 193706 195145 gene locus_tag LOCUS_32360 193706 195145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 196191 195268 gene locus_tag LOCUS_32370 196191 195268 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584122.1 protein_id gnl|my_center|LOCUS_32370 197867 196362 gene locus_tag LOCUS_32380 197867 196362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 199166 198348 gene locus_tag LOCUS_32390 199166 198348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 200634 199195 gene locus_tag LOCUS_32400 200634 199195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 201949 200909 gene locus_tag LOCUS_32410 gene fbaA 201949 200909 CDS product fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056231.1 protein_id gnl|my_center|LOCUS_32410 202796 202287 gene locus_tag LOCUS_32420 202796 202287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614581.1 protein_id gnl|my_center|LOCUS_32420 203452 202892 gene locus_tag LOCUS_32430 203452 202892 CDS product D,D-heptose 1,7-bisphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B7C9 protein_id gnl|my_center|LOCUS_32430 203598 205859 gene locus_tag LOCUS_32440 203598 205859 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466031.1 protein_id gnl|my_center|LOCUS_32440 206977 206039 gene locus_tag LOCUS_32450 206977 206039 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731476.1 protein_id gnl|my_center|LOCUS_32450 207107 208525 gene locus_tag LOCUS_32460 207107 208525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 209177 208836 gene locus_tag LOCUS_32470 209177 208836 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932665.1 protein_id gnl|my_center|LOCUS_32470 211073 209202 gene locus_tag LOCUS_32480 211073 209202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 212061 211573 gene locus_tag LOCUS_32490 212061 211573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 212530 212087 gene locus_tag LOCUS_32500 212530 212087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 213783 212698 gene locus_tag LOCUS_32510 213783 212698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 215087 213789 gene locus_tag LOCUS_32520 gene purB 215087 213789 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F1P9 protein_id gnl|my_center|LOCUS_32520 215871 215254 gene locus_tag LOCUS_32530 215871 215254 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200035.1 protein_id gnl|my_center|LOCUS_32530 217489 215873 gene locus_tag LOCUS_32540 217489 215873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 218115 217492 gene locus_tag LOCUS_32550 218115 217492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 218573 218112 gene locus_tag LOCUS_32560 218573 218112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 219120 218575 gene locus_tag LOCUS_32570 219120 218575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 219212 219406 gene locus_tag LOCUS_32580 219212 219406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 220795 219320 gene locus_tag LOCUS_32590 gene murC 220795 219320 CDS product UDP-N-acetylmuramate--alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708409.1 protein_id gnl|my_center|LOCUS_32590 221416 220805 gene locus_tag LOCUS_32600 221416 220805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 222095 221583 gene locus_tag LOCUS_32610 gene tpx 222095 221583 CDS product putative thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7T2 protein_id gnl|my_center|LOCUS_32610 222162 222581 gene locus_tag LOCUS_32620 222162 222581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 222604 223956 gene locus_tag LOCUS_32630 222604 223956 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222086.1 protein_id gnl|my_center|LOCUS_32630 224141 225166 gene locus_tag LOCUS_32640 224141 225166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 225285 226754 gene locus_tag LOCUS_32650 225285 226754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 226861 227310 gene locus_tag LOCUS_32660 226861 227310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 228248 227451 gene locus_tag LOCUS_32670 228248 227451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 229177 228434 gene locus_tag LOCUS_32680 gene fabG 229177 228434 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998676.1 protein_id gnl|my_center|LOCUS_32680 229362 230573 gene locus_tag LOCUS_32690 229362 230573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 231505 230705 gene locus_tag LOCUS_32700 231505 230705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 232203 231544 gene locus_tag LOCUS_32710 232203 231544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 232379 233359 gene locus_tag LOCUS_32720 232379 233359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 234452 233328 gene locus_tag LOCUS_32730 234452 233328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 234469 234795 gene locus_tag LOCUS_32740 234469 234795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 234838 235635 gene locus_tag LOCUS_32750 234838 235635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 235598 236068 gene locus_tag LOCUS_32760 235598 236068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 236152 236394 gene locus_tag LOCUS_32770 236152 236394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 236652 238610 gene locus_tag LOCUS_32780 gene acsA 236652 238610 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYG2 protein_id gnl|my_center|LOCUS_32780 238885 239625 gene locus_tag LOCUS_32790 gene fepB 238885 239625 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580059.1 protein_id gnl|my_center|LOCUS_32790 240501 239779 gene locus_tag LOCUS_32800 240501 239779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 240636 241172 gene locus_tag LOCUS_32810 240636 241172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 241175 243673 gene locus_tag LOCUS_32820 gene ccmF 241175 243673 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997623.1 protein_id gnl|my_center|LOCUS_32820 243666 244370 gene locus_tag LOCUS_32830 243666 244370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 244367 244762 gene locus_tag LOCUS_32840 244367 244762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 244762 245796 gene locus_tag LOCUS_32850 244762 245796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 245800 246504 gene locus_tag LOCUS_32860 245800 246504 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_32860 246909 246529 gene locus_tag LOCUS_32870 246909 246529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 246908 248035 gene locus_tag LOCUS_32880 gene yugF 246908 248035 CDS product putative hydrolase YugF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05235 protein_id gnl|my_center|LOCUS_32880 249379 248036 gene locus_tag LOCUS_32890 249379 248036 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256131.1 protein_id gnl|my_center|LOCUS_32890 249833 250708 gene locus_tag LOCUS_32900 249833 250708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 250741 251160 gene locus_tag LOCUS_32910 250741 251160 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619314.1 protein_id gnl|my_center|LOCUS_32910 251194 251598 gene locus_tag LOCUS_32920 gene exbD 251194 251598 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053705.1 protein_id gnl|my_center|LOCUS_32920 251694 252302 gene locus_tag LOCUS_32930 251694 252302 CDS product cell envelope biogenesis protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437523.1 protein_id gnl|my_center|LOCUS_32930 252401 252198 gene locus_tag LOCUS_32940 252401 252198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 252769 256545 gene locus_tag LOCUS_32950 252769 256545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 256860 258113 gene locus_tag LOCUS_32960 gene lipL48 256860 258113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002074543.1 protein_id gnl|my_center|LOCUS_32960 258179 258778 gene locus_tag LOCUS_32970 258179 258778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 258828 261845 gene locus_tag LOCUS_32980 258828 261845 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680902.1 protein_id gnl|my_center|LOCUS_32980 262919 261927 gene locus_tag LOCUS_32990 262919 261927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 263941 263153 gene locus_tag LOCUS_33000 263941 263153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 265217 264009 gene locus_tag LOCUS_33010 265217 264009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 266191 265364 gene locus_tag LOCUS_33020 266191 265364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 268310 266208 gene locus_tag LOCUS_33030 268310 266208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 268446 269348 gene locus_tag LOCUS_33040 268446 269348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 270362 269412 gene locus_tag LOCUS_33050 gene pstS 270362 269412 CDS product phosphate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768212.1 protein_id gnl|my_center|LOCUS_33050 271388 270420 gene locus_tag LOCUS_33060 gene nadR 271388 270420 CDS product transcriptional regulator NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401213.1 protein_id gnl|my_center|LOCUS_33060 272455 271385 gene locus_tag LOCUS_33070 272455 271385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 272649 272452 gene locus_tag LOCUS_33080 272649 272452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 273325 272744 gene locus_tag LOCUS_33090 273325 272744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 273640 274272 gene locus_tag LOCUS_33100 273640 274272 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144264.1 protein_id gnl|my_center|LOCUS_33100 274982 274263 gene locus_tag LOCUS_33110 274982 274263 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943590.1 protein_id gnl|my_center|LOCUS_33110 276831 275068 gene locus_tag LOCUS_33120 276831 275068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 277862 276828 gene locus_tag LOCUS_33130 277862 276828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 279473 277875 gene locus_tag LOCUS_33140 279473 277875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 280822 279554 gene locus_tag LOCUS_33150 gene ybbC 280822 279554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40407 protein_id gnl|my_center|LOCUS_33150 281040 281444 gene locus_tag LOCUS_33160 281040 281444 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648186.1 protein_id gnl|my_center|LOCUS_33160 282766 281447 gene locus_tag LOCUS_33170 282766 281447 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805980.1 protein_id gnl|my_center|LOCUS_33170 283129 282776 gene locus_tag LOCUS_33180 283129 282776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 283311 283126 gene locus_tag LOCUS_33190 283311 283126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 284765 283323 gene locus_tag LOCUS_33200 284765 283323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 285868 284765 gene locus_tag LOCUS_33210 285868 284765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 287220 285871 gene locus_tag LOCUS_33220 287220 285871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 289528 287399 gene locus_tag LOCUS_33230 289528 287399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356645.1 protein_id gnl|my_center|LOCUS_33230 289940 289455 gene locus_tag LOCUS_33240 gene nusB 289940 289455 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F8T8 protein_id gnl|my_center|LOCUS_33240 290404 289940 gene locus_tag LOCUS_33250 gene ribH 290404 289940 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HE53 protein_id gnl|my_center|LOCUS_33250 291669 290404 gene locus_tag LOCUS_33260 291669 290404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 292014 291940 gene locus_tag LOCUS_t00330 292014 291940 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 292805 292074 gene locus_tag LOCUS_33270 gene cobB 292805 292074 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3Z6 protein_id gnl|my_center|LOCUS_33270 293573 292911 gene locus_tag LOCUS_33280 293573 292911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142687.1 protein_id gnl|my_center|LOCUS_33280 294846 293566 gene locus_tag LOCUS_33290 294846 293566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 295736 294846 gene locus_tag LOCUS_33300 295736 294846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 295828 296247 gene locus_tag LOCUS_33310 295828 296247 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965534.1 protein_id gnl|my_center|LOCUS_33310 296428 297102 gene locus_tag LOCUS_33320 296428 297102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 297781 297221 gene locus_tag LOCUS_33330 297781 297221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 298817 297825 gene locus_tag LOCUS_33340 gene rpoA 298817 297825 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XD09 protein_id gnl|my_center|LOCUS_33340 299229 298849 gene locus_tag LOCUS_33350 gene rpsK 299229 298849 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XD11 protein_id gnl|my_center|LOCUS_33350 299638 299261 gene locus_tag LOCUS_33360 gene rpsM 299638 299261 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XD12 protein_id gnl|my_center|LOCUS_33360 299996 299778 gene locus_tag LOCUS_33370 gene infA 299996 299778 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XD14 protein_id gnl|my_center|LOCUS_33370 300660 300097 gene locus_tag LOCUS_33380 gene adk 300660 300097 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XD15 protein_id gnl|my_center|LOCUS_33380 302018 300660 gene locus_tag LOCUS_33390 gene secY 302018 300660 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G1UB19 protein_id gnl|my_center|LOCUS_33390 302596 302042 gene locus_tag LOCUS_33400 302596 302042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 302780 302589 gene locus_tag LOCUS_33410 gene rpmD 302780 302589 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYM5 protein_id gnl|my_center|LOCUS_33410 303327 302803 gene locus_tag LOCUS_33420 gene rpsE 303327 302803 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XD19 protein_id gnl|my_center|LOCUS_33420 303689 303330 gene locus_tag LOCUS_33430 gene rplR 303689 303330 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8G402 protein_id gnl|my_center|LOCUS_33430 304290 303742 gene locus_tag LOCUS_33440 gene rplF 304290 303742 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XD21 protein_id gnl|my_center|LOCUS_33440 304708 304313 gene locus_tag LOCUS_33450 gene rpsH 304708 304313 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XD22 protein_id gnl|my_center|LOCUS_33450 >Feature sequence09 2134 1094 gene locus_tag LOCUS_33460 2134 1094 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964234.1 protein_id gnl|my_center|LOCUS_33460 6058 2864 gene locus_tag LOCUS_33470 6058 2864 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839353.1 protein_id gnl|my_center|LOCUS_33470 7349 6627 gene locus_tag LOCUS_33480 7349 6627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 7860 8579 gene locus_tag LOCUS_33490 7860 8579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 9788 8622 gene locus_tag LOCUS_33500 9788 8622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 10108 10680 gene locus_tag LOCUS_33510 10108 10680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420565.1 protein_id gnl|my_center|LOCUS_33510 11834 10989 gene locus_tag LOCUS_33520 gene lpqC 11834 10989 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417210.1 protein_id gnl|my_center|LOCUS_33520 12182 13573 gene locus_tag LOCUS_33530 12182 13573 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957028.1 protein_id gnl|my_center|LOCUS_33530 13563 14588 gene locus_tag LOCUS_33540 13563 14588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678891.1 protein_id gnl|my_center|LOCUS_33540 14582 15745 gene locus_tag LOCUS_33550 14582 15745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33550 15679 16452 gene locus_tag LOCUS_33560 15679 16452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33560 16738 16654 gene locus_tag LOCUS_t00340 16738 16654 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 16838 17887 gene locus_tag LOCUS_33570 16838 17887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 18078 20030 gene locus_tag LOCUS_33580 gene fadD 18078 20030 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845063.1 protein_id gnl|my_center|LOCUS_33580 20212 21489 gene locus_tag LOCUS_33590 20212 21489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 21603 22199 gene locus_tag LOCUS_33600 gene hisB 21603 22199 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F9R6 protein_id gnl|my_center|LOCUS_33600 22882 23730 gene locus_tag LOCUS_33610 22882 23730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 23749 24381 gene locus_tag LOCUS_33620 gene hisH 23749 24381 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59118 protein_id gnl|my_center|LOCUS_33620 24406 25149 gene locus_tag LOCUS_33630 gene hisA 24406 25149 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F9R5 protein_id gnl|my_center|LOCUS_33630 26200 25328 gene locus_tag LOCUS_33640 26200 25328 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271588.1 protein_id gnl|my_center|LOCUS_33640 27840 26302 gene locus_tag LOCUS_33650 27840 26302 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532354.1 protein_id gnl|my_center|LOCUS_33650 29627 28011 gene locus_tag LOCUS_33660 gene pqqL 29627 28011 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333576.1 protein_id gnl|my_center|LOCUS_33660 30464 29694 gene locus_tag LOCUS_33670 30464 29694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 30650 31081 gene locus_tag LOCUS_33680 30650 31081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 31078 31680 gene locus_tag LOCUS_33690 31078 31680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056044.1 protein_id gnl|my_center|LOCUS_33690 31682 33178 gene locus_tag LOCUS_33700 31682 33178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749356.1 protein_id gnl|my_center|LOCUS_33700 33178 34797 gene locus_tag LOCUS_33710 33178 34797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 35387 34887 gene locus_tag LOCUS_33720 35387 34887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 35463 35936 gene locus_tag LOCUS_33730 35463 35936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 35948 36796 gene locus_tag LOCUS_33740 35948 36796 CDS product adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228615.1 protein_id gnl|my_center|LOCUS_33740 36836 37057 gene locus_tag LOCUS_33750 36836 37057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 37063 37284 gene locus_tag LOCUS_33760 37063 37284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 37281 37883 gene locus_tag LOCUS_33770 37281 37883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 38036 39607 gene locus_tag LOCUS_33780 38036 39607 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262844.1 protein_id gnl|my_center|LOCUS_33780 39923 40300 gene locus_tag LOCUS_33790 39923 40300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 40364 40660 gene locus_tag LOCUS_33800 40364 40660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291938.1 protein_id gnl|my_center|LOCUS_33800 40708 41184 gene locus_tag LOCUS_33810 40708 41184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 42020 41394 gene locus_tag LOCUS_33820 gene clpP 42020 41394 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4T6 protein_id gnl|my_center|LOCUS_33820 42513 42028 gene locus_tag LOCUS_33830 42513 42028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 43923 42625 gene locus_tag LOCUS_33840 gene eno 43923 42625 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HBF3 protein_id gnl|my_center|LOCUS_33840 44055 44555 gene locus_tag LOCUS_33850 44055 44555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 46222 44609 gene locus_tag LOCUS_33860 46222 44609 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64SU9 protein_id gnl|my_center|LOCUS_33860 47388 46546 gene locus_tag LOCUS_33870 47388 46546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 48263 47454 gene locus_tag LOCUS_33880 48263 47454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 49595 48306 gene locus_tag LOCUS_33890 49595 48306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 50584 49574 gene locus_tag LOCUS_33900 50584 49574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 50927 50658 gene locus_tag LOCUS_33910 50927 50658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 51036 51791 gene locus_tag LOCUS_33920 gene pdxJ 51036 51791 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3V8C9 protein_id gnl|my_center|LOCUS_33920 51857 53683 gene locus_tag LOCUS_33930 51857 53683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 53807 54523 gene locus_tag LOCUS_33940 53807 54523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050596.1 protein_id gnl|my_center|LOCUS_33940 54612 55229 gene locus_tag LOCUS_33950 gene sua5 54612 55229 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603802.1 protein_id gnl|my_center|LOCUS_33950 55423 56199 gene locus_tag LOCUS_33960 55423 56199 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F839 protein_id gnl|my_center|LOCUS_33960 56196 57083 gene locus_tag LOCUS_33970 56196 57083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 57080 57769 gene locus_tag LOCUS_33980 gene ruvA 57080 57769 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZW00 protein_id gnl|my_center|LOCUS_33980 58272 57799 gene locus_tag LOCUS_33990 58272 57799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 60670 58517 gene locus_tag LOCUS_34000 60670 58517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 60804 63560 gene locus_tag LOCUS_34010 gene smc 60804 63560 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ZAM9 protein_id gnl|my_center|LOCUS_34010 63869 65494 gene locus_tag LOCUS_34020 63869 65494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 65763 67841 gene locus_tag LOCUS_34030 65763 67841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 68762 67920 gene locus_tag LOCUS_34040 gene plsC 68762 67920 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431423.1 protein_id gnl|my_center|LOCUS_34040 68802 69374 gene locus_tag LOCUS_34050 68802 69374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 69374 70330 gene locus_tag LOCUS_34060 69374 70330 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SIC8 protein_id gnl|my_center|LOCUS_34060 70306 71643 gene locus_tag LOCUS_34070 70306 71643 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282546.1 protein_id gnl|my_center|LOCUS_34070 71673 74354 gene locus_tag LOCUS_34080 gene mrcA 71673 74354 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808183.1 protein_id gnl|my_center|LOCUS_34080 74640 76688 gene locus_tag LOCUS_34090 gene cfpA 74640 76688 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672116.1 protein_id gnl|my_center|LOCUS_34090 76843 77793 gene locus_tag LOCUS_34100 76843 77793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682102.1 protein_id gnl|my_center|LOCUS_34100 77814 78539 gene locus_tag LOCUS_34110 77814 78539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 78539 79723 gene locus_tag LOCUS_34120 78539 79723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 79704 82292 gene locus_tag LOCUS_34130 79704 82292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 82597 82403 gene locus_tag LOCUS_34140 82597 82403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 82663 83724 gene locus_tag LOCUS_34150 82663 83724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 83756 86353 gene locus_tag LOCUS_34160 83756 86353 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682103.1 protein_id gnl|my_center|LOCUS_34160 86704 86492 gene locus_tag LOCUS_34170 86704 86492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 86895 86701 gene locus_tag LOCUS_34180 86895 86701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 88147 87251 gene locus_tag LOCUS_34190 88147 87251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001975788.1 protein_id gnl|my_center|LOCUS_34190 89530 88451 gene locus_tag LOCUS_34200 gene aroG-2 89530 88451 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943764.1 protein_id gnl|my_center|LOCUS_34200 91003 89696 gene locus_tag LOCUS_34210 91003 89696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 91503 91033 gene locus_tag LOCUS_34220 91503 91033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 92780 91818 gene locus_tag LOCUS_34230 gene trxB 92780 91818 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3B3 protein_id gnl|my_center|LOCUS_34230 92866 93222 gene locus_tag LOCUS_34240 92866 93222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440098.1 protein_id gnl|my_center|LOCUS_34240 93378 93851 gene locus_tag LOCUS_34250 gene bcp 93378 93851 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292536.1 protein_id gnl|my_center|LOCUS_34250 93848 95542 gene locus_tag LOCUS_34260 93848 95542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 95737 96177 gene locus_tag LOCUS_34270 95737 96177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 96204 97565 gene locus_tag LOCUS_34280 96204 97565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 97672 98337 gene locus_tag LOCUS_34290 97672 98337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 98351 100324 gene locus_tag LOCUS_34300 98351 100324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34300 100346 101479 gene locus_tag LOCUS_34310 100346 101479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34310 101566 102723 gene locus_tag LOCUS_34320 101566 102723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 103063 102839 gene locus_tag LOCUS_34330 103063 102839 CDS product disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141324.1 protein_id gnl|my_center|LOCUS_34330 103290 103751 gene locus_tag LOCUS_34340 103290 103751 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F2M2 protein_id gnl|my_center|LOCUS_34340 103900 106911 gene locus_tag LOCUS_34350 103900 106911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 109883 106983 gene locus_tag LOCUS_34360 109883 106983 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510661.1 protein_id gnl|my_center|LOCUS_34360 110029 110808 gene locus_tag LOCUS_34370 110029 110808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 110903 111202 gene locus_tag LOCUS_34380 110903 111202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 112083 111415 gene locus_tag LOCUS_34390 112083 111415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 113421 112132 gene locus_tag LOCUS_34400 gene gltA 113421 112132 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F887 protein_id gnl|my_center|LOCUS_34400 113731 113949 gene locus_tag LOCUS_34410 113731 113949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 114207 115013 gene locus_tag LOCUS_34420 114207 115013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 117015 115042 gene locus_tag LOCUS_34430 117015 115042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 118823 117015 gene locus_tag LOCUS_34440 118823 117015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 120265 119126 gene locus_tag LOCUS_34450 gene rsgA 120265 119126 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F9Q7 protein_id gnl|my_center|LOCUS_34450 120319 122301 gene locus_tag LOCUS_34460 120319 122301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 123875 122379 gene locus_tag LOCUS_34470 gene glpK 123875 122379 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286755.1 protein_id gnl|my_center|LOCUS_34470 124375 124016 gene locus_tag LOCUS_34480 124375 124016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 125126 124545 gene locus_tag LOCUS_34490 125126 124545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 126478 125336 gene locus_tag LOCUS_34500 126478 125336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 127033 126692 gene locus_tag LOCUS_34510 127033 126692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 129492 127129 gene locus_tag LOCUS_34520 129492 127129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 129603 130607 gene locus_tag LOCUS_34530 gene htrB 129603 130607 CDS product lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069787.1 protein_id gnl|my_center|LOCUS_34530 131692 130790 gene locus_tag LOCUS_34540 131692 130790 CDS product phenazine biosynthesis protein PhzF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986681.1 protein_id gnl|my_center|LOCUS_34540 131829 133865 gene locus_tag LOCUS_34550 131829 133865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 135181 134087 gene locus_tag LOCUS_34560 135181 134087 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225411.1 protein_id gnl|my_center|LOCUS_34560 136470 135280 gene locus_tag LOCUS_34570 gene purT 136470 135280 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXP3 protein_id gnl|my_center|LOCUS_34570 136649 137092 gene locus_tag LOCUS_34580 136649 137092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 138574 137597 gene locus_tag LOCUS_34590 138574 137597 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220497.1 protein_id gnl|my_center|LOCUS_34590 139511 138702 gene locus_tag LOCUS_34600 139511 138702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 139560 139925 gene locus_tag LOCUS_34610 139560 139925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 140492 140109 gene locus_tag LOCUS_34620 140492 140109 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008656289.1 protein_id gnl|my_center|LOCUS_34620 140899 141993 gene locus_tag LOCUS_34630 gene ychF 140899 141993 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37518 protein_id gnl|my_center|LOCUS_34630 142116 142649 gene locus_tag LOCUS_34640 142116 142649 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881079.1 protein_id gnl|my_center|LOCUS_34640 144452 143091 gene locus_tag LOCUS_34650 144452 143091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869088.1 protein_id gnl|my_center|LOCUS_34650 144693 145109 gene locus_tag LOCUS_34660 gene ndk 144693 145109 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYP5 protein_id gnl|my_center|LOCUS_34660 145102 146061 gene locus_tag LOCUS_34670 145102 146061 CDS product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938644.1 protein_id gnl|my_center|LOCUS_34670 146061 146858 gene locus_tag LOCUS_34680 146061 146858 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081998.1 protein_id gnl|my_center|LOCUS_34680 151231 146816 gene locus_tag LOCUS_34690 151231 146816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 151428 151781 gene locus_tag LOCUS_34700 151428 151781 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287684.1 protein_id gnl|my_center|LOCUS_34700 151858 152937 gene locus_tag LOCUS_34710 151858 152937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 152937 153917 gene locus_tag LOCUS_34720 152937 153917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 154736 154068 gene locus_tag LOCUS_34730 154736 154068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 155730 154717 gene locus_tag LOCUS_34740 gene lgt 155730 154717 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F1X4 protein_id gnl|my_center|LOCUS_34740 157040 155724 gene locus_tag LOCUS_34750 gene pepP 157040 155724 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205134.1 protein_id gnl|my_center|LOCUS_34750 158538 157033 gene locus_tag LOCUS_34760 158538 157033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 159566 158535 gene locus_tag LOCUS_34770 gene aroE 159566 158535 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F8C0 protein_id gnl|my_center|LOCUS_34770 159649 159987 gene locus_tag LOCUS_34780 159649 159987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 160610 160245 gene locus_tag LOCUS_34790 160610 160245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 160832 162889 gene locus_tag LOCUS_34800 gene fliD 160832 162889 CDS product flagellar hook-associated protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73MN6 protein_id gnl|my_center|LOCUS_34800 163063 164064 gene locus_tag LOCUS_34810 163063 164064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 164086 165384 gene locus_tag LOCUS_34820 164086 165384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 165494 166711 gene locus_tag LOCUS_34830 165494 166711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 >Feature sequence10 97 678 gene locus_tag LOCUS_34840 97 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 809 2260 gene locus_tag LOCUS_34850 gene sufB 809 2260 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438391.1 protein_id gnl|my_center|LOCUS_34850 2351 3109 gene locus_tag LOCUS_34860 gene sufC 2351 3109 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136057.1 protein_id gnl|my_center|LOCUS_34860 3106 4308 gene locus_tag LOCUS_34870 3106 4308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 4388 4696 gene locus_tag LOCUS_34880 gene nirD 4388 4696 CDS product benzene 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010050.1 protein_id gnl|my_center|LOCUS_34880 4887 6155 gene locus_tag LOCUS_34890 gene csdB 4887 6155 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F0D5 protein_id gnl|my_center|LOCUS_34890 6161 6598 gene locus_tag LOCUS_34900 gene iscU 6161 6598 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058819.1 protein_id gnl|my_center|LOCUS_34900 6741 7814 gene locus_tag LOCUS_34910 6741 7814 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095359.1 protein_id gnl|my_center|LOCUS_34910 8047 9009 gene locus_tag LOCUS_34920 8047 9009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 8978 9775 gene locus_tag LOCUS_34930 8978 9775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 9772 10587 gene locus_tag LOCUS_34940 9772 10587 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080883.1 protein_id gnl|my_center|LOCUS_34940 11519 10680 gene locus_tag LOCUS_34950 11519 10680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 12793 11543 gene locus_tag LOCUS_34960 gene proA 12793 11543 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94872 protein_id gnl|my_center|LOCUS_34960 12915 13364 gene locus_tag LOCUS_34970 12915 13364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 13908 13288 gene locus_tag LOCUS_34980 13908 13288 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG81 protein_id gnl|my_center|LOCUS_34980 15365 14040 gene locus_tag LOCUS_34990 15365 14040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 15364 19923 gene locus_tag LOCUS_35000 15364 19923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594761.1 protein_id gnl|my_center|LOCUS_35000 20037 19840 gene locus_tag LOCUS_35010 20037 19840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 20746 20111 gene locus_tag LOCUS_35020 20746 20111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 22360 21029 gene locus_tag LOCUS_35030 22360 21029 CDS product UPF0272 protein Cgl2470/cg2715 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NMU4 protein_id gnl|my_center|LOCUS_35030 23536 22409 gene locus_tag LOCUS_35040 gene proB 23536 22409 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E032 protein_id gnl|my_center|LOCUS_35040 24566 23505 gene locus_tag LOCUS_35050 gene obg 24566 23505 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67849 protein_id gnl|my_center|LOCUS_35050 24854 24597 gene locus_tag LOCUS_35060 gene rpmA 24854 24597 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P56050 protein_id gnl|my_center|LOCUS_35060 25170 24844 gene locus_tag LOCUS_35070 25170 24844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392095.1 protein_id gnl|my_center|LOCUS_35070 25478 25167 gene locus_tag LOCUS_35080 gene rplU 25478 25167 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7U3 protein_id gnl|my_center|LOCUS_35080 26460 25849 gene locus_tag LOCUS_35090 26460 25849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 26998 26768 gene locus_tag LOCUS_35100 26998 26768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 27386 28402 gene locus_tag LOCUS_35110 27386 28402 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862891.1 protein_id gnl|my_center|LOCUS_35110 28514 28918 gene locus_tag LOCUS_35120 28514 28918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087924.1 protein_id gnl|my_center|LOCUS_35120 31664 29034 gene locus_tag LOCUS_35130 31664 29034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 32456 31980 gene locus_tag LOCUS_35140 32456 31980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 32967 32530 gene locus_tag LOCUS_35150 32967 32530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 33596 32964 gene locus_tag LOCUS_35160 33596 32964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 34639 33596 gene locus_tag LOCUS_35170 34639 33596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 35657 34884 gene locus_tag LOCUS_35180 35657 34884 CDS product ubiquinone/menaquinone biosynthesis methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813012.1 protein_id gnl|my_center|LOCUS_35180 37034 35670 gene locus_tag LOCUS_35190 37034 35670 CDS product sodium:glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015371.1 protein_id gnl|my_center|LOCUS_35190 39172 37031 gene locus_tag LOCUS_35200 39172 37031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901137.1 protein_id gnl|my_center|LOCUS_35200 39221 40603 gene locus_tag LOCUS_35210 39221 40603 CDS product putative RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F201 protein_id gnl|my_center|LOCUS_35210 40617 43550 gene locus_tag LOCUS_35220 40617 43550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 44343 43534 gene locus_tag LOCUS_35230 44343 43534 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172542.1 protein_id gnl|my_center|LOCUS_35230 44396 44791 gene locus_tag LOCUS_35240 gene msrB 44396 44791 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VTH6 protein_id gnl|my_center|LOCUS_35240 44853 46478 gene locus_tag LOCUS_35250 gene amyA 44853 46478 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202103.1 protein_id gnl|my_center|LOCUS_35250 46659 47615 gene locus_tag LOCUS_35260 46659 47615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 48553 47777 gene locus_tag LOCUS_35270 48553 47777 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227948.1 protein_id gnl|my_center|LOCUS_35270 49350 48601 gene locus_tag LOCUS_35280 49350 48601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35280 49591 50001 gene locus_tag LOCUS_35290 49591 50001 CDS product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258972.1 protein_id gnl|my_center|LOCUS_35290 49913 50149 gene locus_tag LOCUS_35300 49913 50149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 50121 50516 gene locus_tag LOCUS_35310 50121 50516 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943046.1 protein_id gnl|my_center|LOCUS_35310 50574 51044 gene locus_tag LOCUS_35320 50574 51044 CDS product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004152117.1 protein_id gnl|my_center|LOCUS_35320 53126 52479 gene locus_tag LOCUS_35330 53126 52479 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257775.1 protein_id gnl|my_center|LOCUS_35330 54198 53206 gene locus_tag LOCUS_35340 54198 53206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 54589 57405 gene locus_tag LOCUS_35350 54589 57405 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393269.1 protein_id gnl|my_center|LOCUS_35350 57424 57957 gene locus_tag LOCUS_35360 gene hpt 57424 57957 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359412.1 protein_id gnl|my_center|LOCUS_35360 58489 57977 gene locus_tag LOCUS_35370 58489 57977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 59487 58489 gene locus_tag LOCUS_35380 gene exo 59487 58489 CDS product exodeoxyribonuclease IX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036075.1 protein_id gnl|my_center|LOCUS_35380 60822 59593 gene locus_tag LOCUS_35390 60822 59593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439951.1 protein_id gnl|my_center|LOCUS_35390 60911 61843 gene locus_tag LOCUS_35400 60911 61843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 62251 61925 gene locus_tag LOCUS_35410 62251 61925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727998.1 protein_id gnl|my_center|LOCUS_35410 62369 62821 gene locus_tag LOCUS_35420 62369 62821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 62948 64441 gene locus_tag LOCUS_35430 62948 64441 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085627.1 protein_id gnl|my_center|LOCUS_35430 65779 64454 gene locus_tag LOCUS_35440 65779 64454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 66170 68383 gene locus_tag LOCUS_35450 gene hppA1 66170 68383 CDS product putative K(+)-stimulated pyrophosphate-energized sodium pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIS7 protein_id gnl|my_center|LOCUS_35450 68631 69293 gene locus_tag LOCUS_35460 68631 69293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 69531 69950 gene locus_tag LOCUS_35470 69531 69950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 70051 71064 gene locus_tag LOCUS_35480 70051 71064 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068140.1 protein_id gnl|my_center|LOCUS_35480 71240 72151 gene locus_tag LOCUS_35490 gene htrB 71240 72151 CDS product lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069787.1 protein_id gnl|my_center|LOCUS_35490 72811 72242 gene locus_tag LOCUS_35500 72811 72242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 74250 72976 gene locus_tag LOCUS_35510 74250 72976 CDS product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F5J2 protein_id gnl|my_center|LOCUS_35510 75318 74254 gene locus_tag LOCUS_35520 gene holA 75318 74254 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362655.1 protein_id gnl|my_center|LOCUS_35520 75433 77130 gene locus_tag LOCUS_35530 gene ilvB 75433 77130 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F341 protein_id gnl|my_center|LOCUS_35530 77296 77643 gene locus_tag LOCUS_35540 77296 77643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 78052 77822 gene locus_tag LOCUS_35550 78052 77822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 78381 78091 gene locus_tag LOCUS_35560 78381 78091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 78968 78387 gene locus_tag LOCUS_35570 gene rpoE 78968 78387 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435437.1 protein_id gnl|my_center|LOCUS_35570 79413 78961 gene locus_tag LOCUS_35580 79413 78961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 80116 79643 gene locus_tag LOCUS_35590 80116 79643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 80286 80834 gene locus_tag LOCUS_35600 80286 80834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118787.1 protein_id gnl|my_center|LOCUS_35600 81314 80925 gene locus_tag LOCUS_35610 81314 80925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 82875 81298 gene locus_tag LOCUS_35620 82875 81298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 85429 83369 gene locus_tag LOCUS_35630 gene gpsA 85429 83369 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229482.1 protein_id gnl|my_center|LOCUS_35630 85789 86949 gene locus_tag LOCUS_35640 85789 86949 CDS product metalloendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351651.1 protein_id gnl|my_center|LOCUS_35640 86925 87275 gene locus_tag LOCUS_35650 86925 87275 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246073.1 protein_id gnl|my_center|LOCUS_35650 87645 88241 gene locus_tag LOCUS_35660 87645 88241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 88307 89080 gene locus_tag LOCUS_35670 88307 89080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 89050 89874 gene locus_tag LOCUS_35680 89050 89874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 89947 90441 gene locus_tag LOCUS_35690 89947 90441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 90621 91013 gene locus_tag LOCUS_35700 90621 91013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 91299 93557 gene locus_tag LOCUS_35710 91299 93557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 95531 93741 gene locus_tag LOCUS_35720 95531 93741 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932972.1 protein_id gnl|my_center|LOCUS_35720 95797 96693 gene locus_tag LOCUS_35730 gene dhmA1 95797 96693 CDS product haloalkane dehalogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMS3 protein_id gnl|my_center|LOCUS_35730 96941 98029 gene locus_tag LOCUS_35740 96941 98029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 98040 99476 gene locus_tag LOCUS_35750 98040 99476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 99624 100298 gene locus_tag LOCUS_35760 99624 100298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 <101291 100584 gene locus_tag LOCUS_35770 <101291 100584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O51941:flagellar filament 35 kDa core protein >Feature sequence11 2120 399 gene locus_tag LOCUS_35780 2120 399 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895957.1 protein_id gnl|my_center|LOCUS_35780 2764 3513 gene locus_tag LOCUS_35790 gene ate 2764 3513 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M0 protein_id gnl|my_center|LOCUS_35790 3656 3480 gene locus_tag LOCUS_35800 3656 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 3852 4607 gene locus_tag LOCUS_35810 3852 4607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 4609 5910 gene locus_tag LOCUS_35820 4609 5910 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871000.1 protein_id gnl|my_center|LOCUS_35820 6679 6071 gene locus_tag LOCUS_35830 6679 6071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 6795 8522 gene locus_tag LOCUS_35840 6795 8522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 8778 9209 gene locus_tag LOCUS_35850 8778 9209 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897783.1 protein_id gnl|my_center|LOCUS_35850 9787 9308 gene locus_tag LOCUS_35860 gene bfr 9787 9308 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPS5 protein_id gnl|my_center|LOCUS_35860 10185 9991 gene locus_tag LOCUS_35870 10185 9991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 10393 10944 gene locus_tag LOCUS_35880 10393 10944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 12131 10908 gene locus_tag LOCUS_35890 12131 10908 CDS product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203405.1 protein_id gnl|my_center|LOCUS_35890 13095 12094 gene locus_tag LOCUS_35900 13095 12094 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7DDD1 protein_id gnl|my_center|LOCUS_35900 13293 15203 gene locus_tag LOCUS_35910 13293 15203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 16035 15271 gene locus_tag LOCUS_35920 16035 15271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532389.1 protein_id gnl|my_center|LOCUS_35920 16162 17958 gene locus_tag LOCUS_35930 16162 17958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 20112 17950 gene locus_tag LOCUS_35940 20112 17950 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256930.1 protein_id gnl|my_center|LOCUS_35940 21848 20265 gene locus_tag LOCUS_35950 21848 20265 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895957.1 protein_id gnl|my_center|LOCUS_35950 22919 22476 gene locus_tag LOCUS_35960 22919 22476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 23377 22973 gene locus_tag LOCUS_35970 23377 22973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 24468 23377 gene locus_tag LOCUS_35980 24468 23377 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224399.1 protein_id gnl|my_center|LOCUS_35980 24628 25104 gene locus_tag LOCUS_35990 24628 25104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 25916 25155 gene locus_tag LOCUS_36000 25916 25155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 26211 26744 gene locus_tag LOCUS_36010 26211 26744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 26741 27568 gene locus_tag LOCUS_36020 26741 27568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 29647 27593 gene locus_tag LOCUS_36030 29647 27593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 31041 29665 gene locus_tag LOCUS_36040 31041 29665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 31541 31071 gene locus_tag LOCUS_36050 31541 31071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 32417 31794 gene locus_tag LOCUS_36060 32417 31794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 33736 32621 gene locus_tag LOCUS_36070 33736 32621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 34813 33740 gene locus_tag LOCUS_36080 34813 33740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483742.1 protein_id gnl|my_center|LOCUS_36080 35026 36843 gene locus_tag LOCUS_36090 gene prc 35026 36843 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927328.1 protein_id gnl|my_center|LOCUS_36090 36937 37887 gene locus_tag LOCUS_36100 36937 37887 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943790.1 protein_id gnl|my_center|LOCUS_36100 38850 38065 gene locus_tag LOCUS_36110 38850 38065 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072068.1 protein_id gnl|my_center|LOCUS_36110 39788 38847 gene locus_tag LOCUS_36120 39788 38847 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256256.1 protein_id gnl|my_center|LOCUS_36120 40186 39824 gene locus_tag LOCUS_36130 40186 39824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 41387 40245 gene locus_tag LOCUS_36140 gene truD 41387 40245 CDS product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SI49 protein_id gnl|my_center|LOCUS_36140 42412 41471 gene locus_tag LOCUS_36150 42412 41471 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076445.1 protein_id gnl|my_center|LOCUS_36150 44593 42596 gene locus_tag LOCUS_36160 44593 42596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 45342 44590 gene locus_tag LOCUS_36170 45342 44590 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYR8 protein_id gnl|my_center|LOCUS_36170 45585 46709 gene locus_tag LOCUS_36180 gene mtfA 45585 46709 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122447.1 protein_id gnl|my_center|LOCUS_36180 47143 46763 gene locus_tag LOCUS_36190 47143 46763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 47265 48752 gene locus_tag LOCUS_36200 47265 48752 CDS product membrane-bound O-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898540.1 protein_id gnl|my_center|LOCUS_36200 48988 49506 gene locus_tag LOCUS_36210 48988 49506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875950.1 protein_id gnl|my_center|LOCUS_36210 49493 50395 gene locus_tag LOCUS_36220 gene argB 49493 50395 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59299 protein_id gnl|my_center|LOCUS_36220 50438 50983 gene locus_tag LOCUS_36230 gene apt 50438 50983 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63XK0 protein_id gnl|my_center|LOCUS_36230 51121 51498 gene locus_tag LOCUS_36240 51121 51498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 51601 52992 gene locus_tag LOCUS_36250 gene galF 51601 52992 CDS product nucleotide glucose-1-phosphate uridylyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200026.1 protein_id gnl|my_center|LOCUS_36250 53305 53844 gene locus_tag LOCUS_36260 53305 53844 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945785.1 protein_id gnl|my_center|LOCUS_36260 54713 53895 gene locus_tag LOCUS_36270 54713 53895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 54922 56520 gene locus_tag LOCUS_36280 54922 56520 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128566.1 protein_id gnl|my_center|LOCUS_36280 57207 56539 gene locus_tag LOCUS_36290 57207 56539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 58922 57519 gene locus_tag LOCUS_36300 gene traB 58922 57519 CDS product pheromone shutdown protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151296.1 protein_id gnl|my_center|LOCUS_36300 59033 59509 gene locus_tag LOCUS_36310 gene cheD2 59033 59509 CDS product putative chemoreceptor glutamine deamidase CheD 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EXT3 protein_id gnl|my_center|LOCUS_36310 59512 60381 gene locus_tag LOCUS_36320 59512 60381 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659901.1 protein_id gnl|my_center|LOCUS_36320 60439 61008 gene locus_tag LOCUS_36330 gene aroK 60439 61008 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EXT5 protein_id gnl|my_center|LOCUS_36330 62152 61031 gene locus_tag LOCUS_36340 62152 61031 CDS product putative hydrolase, alpha/beta fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703343.1 protein_id gnl|my_center|LOCUS_36340 63016 62252 gene locus_tag LOCUS_36350 63016 62252 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705171.1 protein_id gnl|my_center|LOCUS_36350 64973 63123 gene locus_tag LOCUS_36360 gene htpG2 64973 63123 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287997.1 protein_id gnl|my_center|LOCUS_36360 65349 65083 gene locus_tag LOCUS_36370 65349 65083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 66475 65384 gene locus_tag LOCUS_36380 66475 65384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489551.1 protein_id gnl|my_center|LOCUS_36380 66566 67723 gene locus_tag LOCUS_36390 66566 67723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666150.1 protein_id gnl|my_center|LOCUS_36390 67725 69188 gene locus_tag LOCUS_36400 67725 69188 CDS product membrane-bound O-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578213.1 protein_id gnl|my_center|LOCUS_36400 69204 70418 gene locus_tag LOCUS_36410 69204 70418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981104.1 protein_id gnl|my_center|LOCUS_36410 71925 70504 gene locus_tag LOCUS_36420 gene pykF 71925 70504 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EX62 protein_id gnl|my_center|LOCUS_36420 73857 71929 gene locus_tag LOCUS_36430 73857 71929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 73925 74686 gene locus_tag LOCUS_36440 gene menG 73925 74686 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EXJ3 protein_id gnl|my_center|LOCUS_36440 74715 75644 gene locus_tag LOCUS_36450 74715 75644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172862.1 protein_id gnl|my_center|LOCUS_36450 75834 76901 gene locus_tag LOCUS_36460 75834 76901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 77065 76868 gene locus_tag LOCUS_36470 77065 76868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 77833 77165 gene locus_tag LOCUS_36480 77833 77165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 78339 77833 gene locus_tag LOCUS_36490 78339 77833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240474.1 protein_id gnl|my_center|LOCUS_36490 82009 78434 gene locus_tag LOCUS_36500 82009 78434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 83714 82059 gene locus_tag LOCUS_36510 83714 82059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 84289 83852 gene locus_tag LOCUS_36520 84289 83852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 84402 84475 gene locus_tag LOCUS_t00350 84402 84475 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence12 1177 119 gene locus_tag LOCUS_36530 gene fliG 1177 119 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8FA11 protein_id gnl|my_center|LOCUS_36530 3136 1442 gene locus_tag LOCUS_36540 gene fliF 3136 1442 CDS product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F320 protein_id gnl|my_center|LOCUS_36540 3717 3349 gene locus_tag LOCUS_36550 gene fliE 3717 3349 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F952 protein_id gnl|my_center|LOCUS_36550 4550 4089 gene locus_tag LOCUS_36560 gene flgC 4550 4089 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F951 protein_id gnl|my_center|LOCUS_36560 5088 4672 gene locus_tag LOCUS_36570 5088 4672 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F950 protein_id gnl|my_center|LOCUS_36570 5435 5851 gene locus_tag LOCUS_36580 5435 5851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 6083 6811 gene locus_tag LOCUS_36590 6083 6811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 6928 7851 gene locus_tag LOCUS_36600 6928 7851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084059.1 protein_id gnl|my_center|LOCUS_36600 9773 8040 gene locus_tag LOCUS_36610 gene kefB 9773 8040 CDS product potassium transporter Kef inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399950.1 protein_id gnl|my_center|LOCUS_36610 11215 9776 gene locus_tag LOCUS_36620 gene dltB 11215 9776 CDS product membrane-bound O-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898580.1 protein_id gnl|my_center|LOCUS_36620 12552 11215 gene locus_tag LOCUS_36630 12552 11215 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675686.1 protein_id gnl|my_center|LOCUS_36630 13375 12593 gene locus_tag LOCUS_36640 gene ispA 13375 12593 CDS product geranylgeranyl pyrophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868877.1 protein_id gnl|my_center|LOCUS_36640 13343 13546 gene locus_tag LOCUS_36650 13343 13546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 14444 13572 gene locus_tag LOCUS_36660 14444 13572 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069743.1 protein_id gnl|my_center|LOCUS_36660 15245 15532 gene locus_tag LOCUS_36670 15245 15532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 15566 15730 gene locus_tag LOCUS_36680 15566 15730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 17107 16274 gene locus_tag LOCUS_36690 17107 16274 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002663.1 protein_id gnl|my_center|LOCUS_36690 17705 17316 gene locus_tag LOCUS_36700 17705 17316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 17704 18810 gene locus_tag LOCUS_36710 17704 18810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 18860 19369 gene locus_tag LOCUS_36720 18860 19369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 20534 19509 gene locus_tag LOCUS_36730 gene fliM 20534 19509 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4G0 protein_id gnl|my_center|LOCUS_36730 21481 20531 gene locus_tag LOCUS_36740 21481 20531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621805.1 protein_id gnl|my_center|LOCUS_36740 23125 21713 gene locus_tag LOCUS_36750 gene miaB 23125 21713 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F743 protein_id gnl|my_center|LOCUS_36750 23426 24142 gene locus_tag LOCUS_36760 23426 24142 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119768.1 protein_id gnl|my_center|LOCUS_36760 24217 24888 gene locus_tag LOCUS_36770 24217 24888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849665.1 protein_id gnl|my_center|LOCUS_36770 26126 25146 gene locus_tag LOCUS_36780 gene mviM 26126 25146 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140212.1 protein_id gnl|my_center|LOCUS_36780 27299 26157 gene locus_tag LOCUS_36790 gene dnaJ 27299 26157 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61441 protein_id gnl|my_center|LOCUS_36790 29570 27645 gene locus_tag LOCUS_36800 gene dnaK 29570 27645 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61443 protein_id gnl|my_center|LOCUS_36800 30334 29612 gene locus_tag LOCUS_36810 gene grpE 30334 29612 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RX5 protein_id gnl|my_center|LOCUS_36810 31551 30448 gene locus_tag LOCUS_36820 gene hrcA 31551 30448 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61447 protein_id gnl|my_center|LOCUS_36820 32844 31735 gene locus_tag LOCUS_36830 32844 31735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 33392 32916 gene locus_tag LOCUS_36840 33392 32916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 34614 33637 gene locus_tag LOCUS_36850 34614 33637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 34993 35937 gene locus_tag LOCUS_36860 34993 35937 CDS product metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578515.1 protein_id gnl|my_center|LOCUS_36860 36107 37123 gene locus_tag LOCUS_36870 36107 37123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 37120 37605 gene locus_tag LOCUS_36880 37120 37605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 37656 38699 gene locus_tag LOCUS_36890 gene srkA 37656 38699 CDS product stress response kinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F359 protein_id gnl|my_center|LOCUS_36890 39400 38696 gene locus_tag LOCUS_36900 39400 38696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 40144 39428 gene locus_tag LOCUS_36910 40144 39428 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946141.1 protein_id gnl|my_center|LOCUS_36910 40321 42177 gene locus_tag LOCUS_36920 40321 42177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 43336 42242 gene locus_tag LOCUS_36930 43336 42242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 43519 43980 gene locus_tag LOCUS_36940 43519 43980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 44205 44894 gene locus_tag LOCUS_36950 44205 44894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619825.1 protein_id gnl|my_center|LOCUS_36950 45035 45586 gene locus_tag LOCUS_36960 45035 45586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680200.1 protein_id gnl|my_center|LOCUS_36960 45890 46549 gene locus_tag LOCUS_36970 45890 46549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 47477 46617 gene locus_tag LOCUS_36980 gene flgG 47477 46617 CDS product flagellar basal body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F532 protein_id gnl|my_center|LOCUS_36980 47545 48954 gene locus_tag LOCUS_36990 47545 48954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 48936 49691 gene locus_tag LOCUS_37000 48936 49691 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069832.1 protein_id gnl|my_center|LOCUS_37000 49701 50639 gene locus_tag LOCUS_37010 49701 50639 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347675.1 protein_id gnl|my_center|LOCUS_37010 51528 50656 gene locus_tag LOCUS_37020 51528 50656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 52955 51711 gene locus_tag LOCUS_37030 gene manC 52955 51711 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070779.1 protein_id gnl|my_center|LOCUS_37030 54153 53089 gene locus_tag LOCUS_37040 54153 53089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 54338 54150 gene locus_tag LOCUS_37050 54338 54150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 55328 54450 gene locus_tag LOCUS_37060 gene miaA 55328 54450 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CXT5 protein_id gnl|my_center|LOCUS_37060 55963 55391 gene locus_tag LOCUS_37070 gene gmk 55963 55391 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B9R5 protein_id gnl|my_center|LOCUS_37070 56896 56057 gene locus_tag LOCUS_37080 gene cheR34H 56896 56057 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E21 protein_id gnl|my_center|LOCUS_37080 58320 56893 gene locus_tag LOCUS_37090 58320 56893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 58840 58496 gene locus_tag LOCUS_37100 58840 58496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 60825 58855 gene locus_tag LOCUS_37110 60825 58855 CDS product polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535110.1 protein_id gnl|my_center|LOCUS_37110 61658 60885 gene locus_tag LOCUS_37120 61658 60885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389276.1 protein_id gnl|my_center|LOCUS_37120 63156 61801 gene locus_tag LOCUS_37130 gene thrC 63156 61801 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626010.1 protein_id gnl|my_center|LOCUS_37130 63820 63170 gene locus_tag LOCUS_37140 63820 63170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 64448 63822 gene locus_tag LOCUS_37150 64448 63822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 66493 64445 gene locus_tag LOCUS_37160 66493 64445 CDS product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523709.1 protein_id gnl|my_center|LOCUS_37160 66618 66860 gene locus_tag LOCUS_37170 66618 66860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 >Feature sequence13 67 933 gene locus_tag LOCUS_37180 67 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 986 1606 gene locus_tag LOCUS_37190 gene radC 986 1606 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682286.1 protein_id gnl|my_center|LOCUS_37190 1795 2142 gene locus_tag LOCUS_37200 1795 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689175.1 protein_id gnl|my_center|LOCUS_37200 2142 2657 gene locus_tag LOCUS_37210 2142 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 2647 2943 gene locus_tag LOCUS_37220 2647 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 2945 5569 gene locus_tag LOCUS_37230 2945 5569 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584701.1 protein_id gnl|my_center|LOCUS_37230 5569 6192 gene locus_tag LOCUS_37240 5569 6192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 6297 6752 gene locus_tag LOCUS_37250 6297 6752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 6809 7336 gene locus_tag LOCUS_37260 6809 7336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 8755 7595 gene locus_tag LOCUS_37270 8755 7595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837638.1 protein_id gnl|my_center|LOCUS_37270 10214 8748 gene locus_tag LOCUS_37280 10214 8748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 10325 11449 gene locus_tag LOCUS_37290 gene queA 10325 11449 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EXK6 protein_id gnl|my_center|LOCUS_37290 11485 12390 gene locus_tag LOCUS_37300 11485 12390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 12825 13820 gene locus_tag LOCUS_37310 12825 13820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 13824 14114 gene locus_tag LOCUS_37320 13824 14114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 14279 14941 gene locus_tag LOCUS_37330 14279 14941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 15028 15255 gene locus_tag LOCUS_37340 15028 15255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 15817 16020 gene locus_tag LOCUS_37350 15817 16020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 16080 16244 gene locus_tag LOCUS_37360 16080 16244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 16551 16772 gene locus_tag LOCUS_37370 16551 16772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 18863 16800 gene locus_tag LOCUS_37380 gene dcp1 18863 16800 CDS product peptidase M3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963494.1 protein_id gnl|my_center|LOCUS_37380 19394 20818 gene locus_tag LOCUS_37390 19394 20818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122583.1 protein_id gnl|my_center|LOCUS_37390 20820 21755 gene locus_tag LOCUS_37400 20820 21755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057009.1 protein_id gnl|my_center|LOCUS_37400 21758 25042 gene locus_tag LOCUS_37410 21758 25042 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390311.1 protein_id gnl|my_center|LOCUS_37410 25043 27520 gene locus_tag LOCUS_37420 25043 27520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266502.1 protein_id gnl|my_center|LOCUS_37420 27513 28406 gene locus_tag LOCUS_37430 27513 28406 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390313.1 protein_id gnl|my_center|LOCUS_37430 29002 28559 gene locus_tag LOCUS_37440 gene dtd 29002 28559 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J474 protein_id gnl|my_center|LOCUS_37440 30257 29076 gene locus_tag LOCUS_37450 30257 29076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 30317 30907 gene locus_tag LOCUS_37460 30317 30907 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117778.1 protein_id gnl|my_center|LOCUS_37460 34829 31125 gene locus_tag LOCUS_37470 gene metH 34829 31125 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933516.1 protein_id gnl|my_center|LOCUS_37470 36308 35007 gene locus_tag LOCUS_37480 gene ahcY 36308 35007 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EXV1 protein_id gnl|my_center|LOCUS_37480 37391 36360 gene locus_tag LOCUS_37490 37391 36360 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230181.1 protein_id gnl|my_center|LOCUS_37490 >Feature sequence14 1073 219 gene locus_tag LOCUS_37500 gene parB4 1073 219 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095800.1 protein_id gnl|my_center|LOCUS_37500 1812 1057 gene locus_tag LOCUS_37510 gene parA4 1812 1057 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637633.1 protein_id gnl|my_center|LOCUS_37510 2230 3498 gene locus_tag LOCUS_37520 2230 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 3495 4469 gene locus_tag LOCUS_37530 3495 4469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 5116 5493 gene locus_tag LOCUS_37540 5116 5493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 7880 8095 gene locus_tag LOCUS_37550 7880 8095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 8164 9963 gene locus_tag LOCUS_37560 gene thrS 8164 9963 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y6X2 protein_id gnl|my_center|LOCUS_37560 10230 10649 gene locus_tag LOCUS_37570 10230 10649 CDS product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_37570 10732 12108 gene locus_tag LOCUS_37580 10732 12108 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190664.1 protein_id gnl|my_center|LOCUS_37580 12140 12727 gene locus_tag LOCUS_37590 12140 12727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 13060 12803 gene locus_tag LOCUS_37600 13060 12803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 13047 14453 gene locus_tag LOCUS_37610 13047 14453 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125226.1 protein_id gnl|my_center|LOCUS_37610 14450 16012 gene locus_tag LOCUS_37620 14450 16012 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944579.1 protein_id gnl|my_center|LOCUS_37620 16758 16024 gene locus_tag LOCUS_37630 16758 16024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 17037 18038 gene locus_tag LOCUS_37640 17037 18038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879978.1 protein_id gnl|my_center|LOCUS_37640 18938 18114 gene locus_tag LOCUS_37650 gene mqnD 18938 18114 CDS product 1,4-dihydroxy-6-naphtoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SI12 protein_id gnl|my_center|LOCUS_37650 19423 18935 gene locus_tag LOCUS_37660 19423 18935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 20406 19420 gene locus_tag LOCUS_37670 20406 19420 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636970.1 protein_id gnl|my_center|LOCUS_37670 20603 20530 gene locus_tag LOCUS_t00360 20603 20530 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence15 630 932 gene locus_tag LOCUS_37680 630 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 1894 1637 gene locus_tag LOCUS_37690 1894 1637 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020159.1 protein_id gnl|my_center|LOCUS_37690 2318 2752 gene locus_tag LOCUS_37700 2318 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 3273 2890 gene locus_tag LOCUS_37710 3273 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 4078 3566 gene locus_tag LOCUS_37720 4078 3566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 5036 4056 gene locus_tag LOCUS_37730 5036 4056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 5898 5053 gene locus_tag LOCUS_37740 5898 5053 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477748.1 protein_id gnl|my_center|LOCUS_37740 6197 5913 gene locus_tag LOCUS_37750 6197 5913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 7846 6776 gene locus_tag LOCUS_37760 7846 6776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 >Feature sequence16 1097 1945 gene locus_tag LOCUS_37770 1097 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 2383 3234 gene locus_tag LOCUS_37780 2383 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 3493 4422 gene locus_tag LOCUS_37790 3493 4422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 4422 4862 gene locus_tag LOCUS_37800 4422 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 4902 7661 gene locus_tag LOCUS_37810 gene sucA 4902 7661 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F6S7 protein_id gnl|my_center|LOCUS_37810 7882 8169 gene locus_tag LOCUS_37820 7882 8169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 8746 10188 gene locus_tag LOCUS_37830 8746 10188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 12174 10294 gene locus_tag LOCUS_37840 12174 10294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 13405 12353 gene locus_tag LOCUS_37850 gene perM 13405 12353 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206646.1 protein_id gnl|my_center|LOCUS_37850 13929 13405 gene locus_tag LOCUS_37860 gene crp 13929 13405 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645314.1 protein_id gnl|my_center|LOCUS_37860 14025 14096 gene locus_tag LOCUS_t00370 14025 14096 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 14099 14175 gene locus_tag LOCUS_t00380 14099 14175 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 14188 15123 gene locus_tag LOCUS_37870 14188 15123 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87FT1 protein_id gnl|my_center|LOCUS_37870 15165 15761 gene locus_tag LOCUS_37880 15165 15761 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262281.1 protein_id gnl|my_center|LOCUS_37880 17165 15762 gene locus_tag LOCUS_37890 17165 15762 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0W2 protein_id gnl|my_center|LOCUS_37890 >Feature sequence17 622 80 gene locus_tag LOCUS_37900 gene rplE 622 80 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XD24 protein_id gnl|my_center|LOCUS_37900 999 640 gene locus_tag LOCUS_37910 gene rplX 999 640 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XD25 protein_id gnl|my_center|LOCUS_37910 1392 1000 gene locus_tag LOCUS_37920 gene rplN 1392 1000 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XD26 protein_id gnl|my_center|LOCUS_37920 1652 1389 gene locus_tag LOCUS_37930 gene rpsQ 1652 1389 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XD27 protein_id gnl|my_center|LOCUS_37930 1912 1667 gene locus_tag LOCUS_37940 1912 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 2336 1923 gene locus_tag LOCUS_37950 gene rplP 2336 1923 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XD29 protein_id gnl|my_center|LOCUS_37950 3042 2362 gene locus_tag LOCUS_37960 gene rpsC 3042 2362 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XD30 protein_id gnl|my_center|LOCUS_37960 3393 3055 gene locus_tag LOCUS_37970 gene rplV 3393 3055 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XD31 protein_id gnl|my_center|LOCUS_37970 3671 3393 gene locus_tag LOCUS_37980 gene rpsS 3671 3393 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XD32 protein_id gnl|my_center|LOCUS_37980 4516 3674 gene locus_tag LOCUS_37990 gene rplB 4516 3674 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XD33 protein_id gnl|my_center|LOCUS_37990 4822 4523 gene locus_tag LOCUS_38000 gene rplW 4822 4523 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5X3 protein_id gnl|my_center|LOCUS_38000 5463 4819 gene locus_tag LOCUS_38010 gene rplD 5463 4819 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XD35 protein_id gnl|my_center|LOCUS_38010 6047 5460 gene locus_tag LOCUS_38020 gene rplC 6047 5460 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG47 protein_id gnl|my_center|LOCUS_38020 6396 6091 gene locus_tag LOCUS_38030 gene rpsJ 6396 6091 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XD37 protein_id gnl|my_center|LOCUS_38030 7615 6416 gene locus_tag LOCUS_38040 gene tuf 7615 6416 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XD38 protein_id gnl|my_center|LOCUS_38040 9804 7702 gene locus_tag LOCUS_38050 gene fusA2 9804 7702 CDS product elongation factor G 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y8 protein_id gnl|my_center|LOCUS_38050 10290 9817 gene locus_tag LOCUS_38060 gene rpsG 10290 9817 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5E1 protein_id gnl|my_center|LOCUS_38060 10674 10300 gene locus_tag LOCUS_38070 gene rpsL 10674 10300 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59164 protein_id gnl|my_center|LOCUS_38070 >Feature sequence18 4651 443 gene locus_tag LOCUS_38080 gene rpoC 4651 443 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F0S3 protein_id gnl|my_center|LOCUS_38080 >Feature sequence19 123 1163 gene locus_tag LOCUS_38090 123 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 3712 1181 gene locus_tag LOCUS_38100 3712 1181 CDS product carbohydrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083704.1 protein_id gnl|my_center|LOCUS_38100 >Feature sequence20 53 928 gene locus_tag LOCUS_38110 gene metF 53 928 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EY55 protein_id gnl|my_center|LOCUS_38110 947 2704 gene locus_tag LOCUS_38120 947 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004124.1 protein_id gnl|my_center|LOCUS_38120 2971 3597 gene locus_tag LOCUS_38130 2971 3597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 >Feature sequence21 748 1134 gene locus_tag LOCUS_38140 748 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 1453 2022 gene locus_tag LOCUS_38150 1453 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 2850 3131 gene locus_tag LOCUS_38160 2850 3131 CDS product plasmid maintenance system killer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530250.1 protein_id gnl|my_center|LOCUS_38160 3141 3440 gene locus_tag LOCUS_38170 3141 3440 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679295.1 protein_id gnl|my_center|LOCUS_38170 >Feature sequence22 2477 1437 gene locus_tag LOCUS_38180 2477 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 >Feature sequence23 270 563 gene locus_tag LOCUS_38190 270 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 2117 1161 gene locus_tag LOCUS_38200 2117 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 >Feature sequence24 117 1403 gene locus_tag LOCUS_38210 117 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 >Feature sequence25 358 143 gene locus_tag LOCUS_38220 358 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 675 364 gene locus_tag LOCUS_38230 675 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_38230 1922 960 gene locus_tag LOCUS_38240 1922 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 >Feature sequence26 785 123 gene locus_tag LOCUS_38250 785 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 1857 1048 gene locus_tag LOCUS_38260 gene blaA 1857 1048 CDS product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIK2 protein_id gnl|my_center|LOCUS_38260 >Feature sequence27 151 1803 gene locus_tag LOCUS_38270 151 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 >Feature sequence28 579 151 gene locus_tag LOCUS_38280 579 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 1827 847 gene locus_tag LOCUS_38290 1827 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 >Feature sequence29 1043 1705 gene locus_tag LOCUS_38300 1043 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 >Feature sequence30 208 1620 gene locus_tag LOCUS_38310 208 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 >Feature sequence31 109 603 gene locus_tag LOCUS_38320 109 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 1068 1322 gene locus_tag LOCUS_38330 1068 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 >Feature sequence32 >Feature sequence33 1322 153 gene locus_tag LOCUS_38340 1322 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 >Feature sequence34 >Feature sequence35 841 191 gene locus_tag LOCUS_38350 841 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 >Feature sequence36 1141 134 gene locus_tag LOCUS_38360 1141 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 >Feature sequence37 1067 144 gene locus_tag LOCUS_38370 1067 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 >Feature sequence38 >Feature sequence39 >Feature sequence40 >Feature sequence41 997 116 gene locus_tag LOCUS_38380 997 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 >Feature sequence42 949 110 gene locus_tag LOCUS_38390 949 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 >Feature sequence43 1009 134 gene locus_tag LOCUS_38400 1009 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 >Feature sequence44 302 129 gene locus_tag LOCUS_38410 302 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 1022 816 gene locus_tag LOCUS_38420 1022 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 >Feature sequence45 634 1026 gene locus_tag LOCUS_38430 634 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 >Feature sequence46 702 538 gene locus_tag LOCUS_38440 702 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 >Feature sequence47 >Feature sequence48 837 136 gene locus_tag LOCUS_38450 837 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 >Feature sequence49 703 122 gene locus_tag LOCUS_38460 703 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 >Feature sequence50 849 157 gene locus_tag LOCUS_38470 849 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 >Feature sequence51 >Feature sequence52 207 542 gene locus_tag LOCUS_38480 207 542 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097692.1 protein_id gnl|my_center|LOCUS_38480 547 870 gene locus_tag LOCUS_38490 547 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 >Feature sequence53 925 65 gene locus_tag LOCUS_38500 925 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 >Feature sequence54 549 139 gene locus_tag LOCUS_38510 549 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 662 814 gene locus_tag LOCUS_38520 662 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 >Feature sequence55 477 139 gene locus_tag LOCUS_38530 477 139 CDS product DNA repair protein HhH-GPD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667012.1 protein_id gnl|my_center|LOCUS_38530 731 474 gene locus_tag LOCUS_38540 731 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 >Feature sequence56 870 133 gene locus_tag LOCUS_38550 870 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550