>Feature sequence001 601 1785 gene locus_tag LOCUS_00010 601 1785 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789261.1 protein_id gnl|my_center|LOCUS_00010 1839 3233 gene locus_tag LOCUS_00020 1839 3233 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8G7R9 protein_id gnl|my_center|LOCUS_00020 3235 5145 gene locus_tag LOCUS_00030 3235 5145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118540.1 protein_id gnl|my_center|LOCUS_00030 5317 6774 gene locus_tag LOCUS_00040 5317 6774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 6801 7394 gene locus_tag LOCUS_00050 gene sigY 6801 7394 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122304.1 protein_id gnl|my_center|LOCUS_00050 7394 9364 gene locus_tag LOCUS_00060 7394 9364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 9461 11923 gene locus_tag LOCUS_00070 9461 11923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 11998 15060 gene locus_tag LOCUS_00080 11998 15060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 15412 16971 gene locus_tag LOCUS_00090 15412 16971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 17099 18532 gene locus_tag LOCUS_00100 17099 18532 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118263.1 protein_id gnl|my_center|LOCUS_00100 18534 20102 gene locus_tag LOCUS_00110 18534 20102 CDS product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_00110 20117 21733 gene locus_tag LOCUS_00120 20117 21733 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202403.1 protein_id gnl|my_center|LOCUS_00120 22052 23086 gene locus_tag LOCUS_00130 22052 23086 CDS product sugar:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767241.1 protein_id gnl|my_center|LOCUS_00130 23088 24245 gene locus_tag LOCUS_00140 gene gci 23088 24245 CDS product D-galactarolactone cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CEQ8 protein_id gnl|my_center|LOCUS_00140 24235 25635 gene locus_tag LOCUS_00150 24235 25635 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098976.1 protein_id gnl|my_center|LOCUS_00150 25692 25997 gene locus_tag LOCUS_00160 25692 25997 CDS product stress responsive protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940377.1 protein_id gnl|my_center|LOCUS_00160 26039 27769 gene locus_tag LOCUS_00170 26039 27769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 27781 30720 gene locus_tag LOCUS_00180 27781 30720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 30710 33397 gene locus_tag LOCUS_00190 30710 33397 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202510.1 protein_id gnl|my_center|LOCUS_00190 33609 35030 gene locus_tag LOCUS_00200 33609 35030 CDS product aryl-sulfate sulfohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120414.1 protein_id gnl|my_center|LOCUS_00200 35048 36898 gene locus_tag LOCUS_00210 35048 36898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 36895 37869 gene locus_tag LOCUS_00220 36895 37869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 37889 39334 gene locus_tag LOCUS_00230 gene aslA 37889 39334 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_00230 39437 41581 gene locus_tag LOCUS_00240 39437 41581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 41594 42229 gene locus_tag LOCUS_00250 41594 42229 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887630.1 protein_id gnl|my_center|LOCUS_00250 42420 45686 gene locus_tag LOCUS_00260 42420 45686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 45866 47221 gene locus_tag LOCUS_00270 45866 47221 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120368.1 protein_id gnl|my_center|LOCUS_00270 47319 49379 gene locus_tag LOCUS_00280 47319 49379 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029026.1 protein_id gnl|my_center|LOCUS_00280 49519 52728 gene locus_tag LOCUS_00290 49519 52728 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZY5 protein_id gnl|my_center|LOCUS_00290 52728 54290 gene locus_tag LOCUS_00300 gene arsA 52728 54290 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121409.1 protein_id gnl|my_center|LOCUS_00300 54649 56133 gene locus_tag LOCUS_00310 54649 56133 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121095.1 protein_id gnl|my_center|LOCUS_00310 56172 58028 gene locus_tag LOCUS_00320 56172 58028 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117792.1 protein_id gnl|my_center|LOCUS_00320 58021 60096 gene locus_tag LOCUS_00330 58021 60096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 >Feature sequence002 275 1627 gene locus_tag LOCUS_00340 gene mnmE 275 1627 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFI8 protein_id gnl|my_center|LOCUS_00340 1759 3066 gene locus_tag LOCUS_00350 1759 3066 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461463.1 protein_id gnl|my_center|LOCUS_00350 3075 4127 gene locus_tag LOCUS_00360 gene hisC 3075 4127 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNC3 protein_id gnl|my_center|LOCUS_00360 4127 5062 gene locus_tag LOCUS_00370 4127 5062 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_00370 5059 5817 gene locus_tag LOCUS_00380 5059 5817 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057314.1 protein_id gnl|my_center|LOCUS_00380 5814 7253 gene locus_tag LOCUS_00390 5814 7253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 7280 9022 gene locus_tag LOCUS_00400 7280 9022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 9029 11419 gene locus_tag LOCUS_00410 9029 11419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 11467 11904 gene locus_tag LOCUS_00420 gene ykcE 11467 11904 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130996.1 protein_id gnl|my_center|LOCUS_00420 12387 13607 gene locus_tag LOCUS_00430 12387 13607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 14104 15195 gene locus_tag LOCUS_00440 14104 15195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 16131 15169 gene locus_tag LOCUS_00450 16131 15169 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NFX8 protein_id gnl|my_center|LOCUS_00450 16789 16124 gene locus_tag LOCUS_00460 16789 16124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 17087 16872 gene locus_tag LOCUS_00470 17087 16872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 17908 17084 gene locus_tag LOCUS_00480 17908 17084 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963972.1 protein_id gnl|my_center|LOCUS_00480 19145 17895 gene locus_tag LOCUS_00490 gene murC 19145 17895 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SG3 protein_id gnl|my_center|LOCUS_00490 21420 19153 gene locus_tag LOCUS_00500 21420 19153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 21556 22701 gene locus_tag LOCUS_00510 gene tgt 21556 22701 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5Y5 protein_id gnl|my_center|LOCUS_00510 22710 23057 gene locus_tag LOCUS_00520 gene yajC 22710 23057 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037519.1 protein_id gnl|my_center|LOCUS_00520 23073 25544 gene locus_tag LOCUS_00530 23073 25544 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531306.1 protein_id gnl|my_center|LOCUS_00530 25606 27318 gene locus_tag LOCUS_00540 gene recJ 25606 27318 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_00540 27375 28199 gene locus_tag LOCUS_00550 27375 28199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 28208 29434 gene locus_tag LOCUS_00560 gene ftsA 28208 29434 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748E0 protein_id gnl|my_center|LOCUS_00560 29427 30548 gene locus_tag LOCUS_00570 gene ftsZ 29427 30548 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK72 protein_id gnl|my_center|LOCUS_00570 31175 30552 gene locus_tag LOCUS_00580 31175 30552 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_00580 31715 31176 gene locus_tag LOCUS_00590 31715 31176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 33109 31712 gene locus_tag LOCUS_00600 33109 31712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 34094 33075 gene locus_tag LOCUS_00610 34094 33075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 34852 34091 gene locus_tag LOCUS_00620 34852 34091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 35282 34857 gene locus_tag LOCUS_00630 35282 34857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 36427 35333 gene locus_tag LOCUS_00640 36427 35333 CDS product sodium/calcium exchanger membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061691.1 protein_id gnl|my_center|LOCUS_00640 36469 37536 gene locus_tag LOCUS_00650 36469 37536 CDS product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257568.1 protein_id gnl|my_center|LOCUS_00650 37559 38245 gene locus_tag LOCUS_00660 37559 38245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 38229 39179 gene locus_tag LOCUS_00670 38229 39179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 39190 40380 gene locus_tag LOCUS_00680 39190 40380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 41298 40339 gene locus_tag LOCUS_00690 41298 40339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 >Feature sequence003 860 222 gene locus_tag LOCUS_00700 gene nqrC 860 222 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43957 protein_id gnl|my_center|LOCUS_00700 2085 853 gene locus_tag LOCUS_00710 gene nqrB 2085 853 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FRK7 protein_id gnl|my_center|LOCUS_00710 3440 2085 gene locus_tag LOCUS_00720 gene nqrA 3440 2085 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JNZ8 protein_id gnl|my_center|LOCUS_00720 4435 3551 gene locus_tag LOCUS_00730 4435 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 4483 5583 gene locus_tag LOCUS_00740 4483 5583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 5580 7166 gene locus_tag LOCUS_00750 5580 7166 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948187.1 protein_id gnl|my_center|LOCUS_00750 7289 7828 gene locus_tag LOCUS_00760 7289 7828 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896432.1 protein_id gnl|my_center|LOCUS_00760 8196 9521 gene locus_tag LOCUS_00770 8196 9521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 9521 10642 gene locus_tag LOCUS_00780 9521 10642 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_00780 10753 10983 gene locus_tag LOCUS_00790 gene rpmB 10753 10983 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51325 protein_id gnl|my_center|LOCUS_00790 11358 11053 gene locus_tag LOCUS_00800 gene rpsN 11358 11053 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44381 protein_id gnl|my_center|LOCUS_00800 11546 11959 gene locus_tag LOCUS_00810 11546 11959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 12012 13151 gene locus_tag LOCUS_00820 12012 13151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 13144 14493 gene locus_tag LOCUS_00830 13144 14493 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808422.1 protein_id gnl|my_center|LOCUS_00830 14493 15182 gene locus_tag LOCUS_00840 14493 15182 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707237.1 protein_id gnl|my_center|LOCUS_00840 15179 16045 gene locus_tag LOCUS_00850 15179 16045 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393743.1 protein_id gnl|my_center|LOCUS_00850 16231 16767 gene locus_tag LOCUS_00860 16231 16767 CDS product excinuclease Uvr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966468.1 protein_id gnl|my_center|LOCUS_00860 16742 17818 gene locus_tag LOCUS_00870 gene mcsB 16742 17818 CDS product protein-arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37570 protein_id gnl|my_center|LOCUS_00870 17820 20339 gene locus_tag LOCUS_00880 gene clpC 17820 20339 CDS product ATP-dependent Clp protease ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121080.1 protein_id gnl|my_center|LOCUS_00880 20379 22097 gene locus_tag LOCUS_00890 gene argS 20379 22097 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RG14 protein_id gnl|my_center|LOCUS_00890 22626 22468 gene locus_tag LOCUS_00900 22626 22468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 22724 23491 gene locus_tag LOCUS_00910 22724 23491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 23595 24554 gene locus_tag LOCUS_00920 23595 24554 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056920.1 protein_id gnl|my_center|LOCUS_00920 24576 24968 gene locus_tag LOCUS_00930 gene yjgF 24576 24968 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962909.1 protein_id gnl|my_center|LOCUS_00930 24958 26013 gene locus_tag LOCUS_00940 24958 26013 CDS product thiamin biosynthesis lipoprotein ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_231920.2 protein_id gnl|my_center|LOCUS_00940 26047 26712 gene locus_tag LOCUS_00950 26047 26712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 26717 27172 gene locus_tag LOCUS_00960 26717 27172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 27266 29737 gene locus_tag LOCUS_00970 27266 29737 CDS product alpha-1,4 glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKZ5 protein_id gnl|my_center|LOCUS_00970 31897 29732 gene locus_tag LOCUS_00980 gene recD2 31897 29732 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCL3 protein_id gnl|my_center|LOCUS_00980 32863 31904 gene locus_tag LOCUS_00990 gene murB 32863 31904 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P18579 protein_id gnl|my_center|LOCUS_00990 33041 33673 gene locus_tag LOCUS_01000 gene spoU 33041 33673 CDS product 23S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789074.1 protein_id gnl|my_center|LOCUS_01000 33755 33679 gene locus_tag LOCUS_t00010 33755 33679 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 34915 33821 gene locus_tag LOCUS_01010 gene hisC 34915 33821 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RL44 protein_id gnl|my_center|LOCUS_01010 36081 34912 gene locus_tag LOCUS_01020 36081 34912 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_01020 37006 36104 gene locus_tag LOCUS_01030 gene nadA 37006 36104 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZV3 protein_id gnl|my_center|LOCUS_01030 38165 37074 gene locus_tag LOCUS_01040 gene pfkA3 38165 37074 CDS product ATP-dependent 6-phosphofructokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E9 protein_id gnl|my_center|LOCUS_01040 >Feature sequence004 <1 527 gene locus_tag LOCUS_01050 <1 527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012706088.1:epimerase 524 2428 gene locus_tag LOCUS_01060 524 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 2469 3905 gene locus_tag LOCUS_01070 2469 3905 CDS product undecaprenyl-phosphate galactose phosphotransferase WbaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937590.1 protein_id gnl|my_center|LOCUS_01070 3908 4300 gene locus_tag LOCUS_01080 3908 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 4384 4737 gene locus_tag LOCUS_01090 4384 4737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 5658 4795 gene locus_tag LOCUS_01100 5658 4795 CDS product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_01100 5828 8581 gene locus_tag LOCUS_01110 5828 8581 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082976.1 protein_id gnl|my_center|LOCUS_01110 9003 8641 gene locus_tag LOCUS_01120 9003 8641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 9175 10041 gene locus_tag LOCUS_01130 gene ddl 9175 10041 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFT1 protein_id gnl|my_center|LOCUS_01130 10217 10675 gene locus_tag LOCUS_01140 gene mraZ 10217 10675 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y5L6 protein_id gnl|my_center|LOCUS_01140 10691 10876 gene locus_tag LOCUS_01150 10691 10876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 10879 11805 gene locus_tag LOCUS_01160 gene rsmH 10879 11805 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG80 protein_id gnl|my_center|LOCUS_01160 11807 12172 gene locus_tag LOCUS_01170 11807 12172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 12205 14049 gene locus_tag LOCUS_01180 gene ftsI 12205 14049 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_01180 14046 15497 gene locus_tag LOCUS_01190 gene murE 14046 15497 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK84 protein_id gnl|my_center|LOCUS_01190 15494 16810 gene locus_tag LOCUS_01200 gene murF 15494 16810 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK83 protein_id gnl|my_center|LOCUS_01200 16814 17953 gene locus_tag LOCUS_01210 gene mraY 16814 17953 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748D3 protein_id gnl|my_center|LOCUS_01210 17953 19251 gene locus_tag LOCUS_01220 gene murD 17953 19251 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NEZ5 protein_id gnl|my_center|LOCUS_01220 19262 20230 gene locus_tag LOCUS_01230 19262 20230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 20249 21379 gene locus_tag LOCUS_01240 20249 21379 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460697.1 protein_id gnl|my_center|LOCUS_01240 21376 22227 gene locus_tag LOCUS_01250 21376 22227 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_01250 22235 22903 gene locus_tag LOCUS_01260 22235 22903 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_01260 24333 22900 gene locus_tag LOCUS_01270 24333 22900 CDS product putative RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KGF9 protein_id gnl|my_center|LOCUS_01270 24432 24746 gene locus_tag LOCUS_01280 gene trxA 24432 24746 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A4L3 protein_id gnl|my_center|LOCUS_01280 25380 24757 gene locus_tag LOCUS_01290 25380 24757 CDS product 3'-exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938381.1 protein_id gnl|my_center|LOCUS_01290 26135 25377 gene locus_tag LOCUS_01300 gene trmJ 26135 25377 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D44 protein_id gnl|my_center|LOCUS_01300 26973 26122 gene locus_tag LOCUS_01310 gene nfo 26973 26122 CDS product putative endonuclease 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83QW6 protein_id gnl|my_center|LOCUS_01310 27199 29820 gene locus_tag LOCUS_01320 27199 29820 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UU96 protein_id gnl|my_center|LOCUS_01320 29825 31111 gene locus_tag LOCUS_01330 29825 31111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 31119 31694 gene locus_tag LOCUS_01340 31119 31694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 32754 31687 gene locus_tag LOCUS_01350 32754 31687 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S78 protein_id gnl|my_center|LOCUS_01350 33446 32853 gene locus_tag LOCUS_01360 33446 32853 CDS product outer surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933798.1 protein_id gnl|my_center|LOCUS_01360 34052 33474 gene locus_tag LOCUS_01370 34052 33474 CDS product outer surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933798.1 protein_id gnl|my_center|LOCUS_01370 35899 34151 gene locus_tag LOCUS_01380 35899 34151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 37215 35896 gene locus_tag LOCUS_01390 37215 35896 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLG1 protein_id gnl|my_center|LOCUS_01390 >Feature sequence005 345 929 gene locus_tag LOCUS_01400 345 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 2407 926 gene locus_tag LOCUS_01410 2407 926 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454621.1 protein_id gnl|my_center|LOCUS_01410 4399 2408 gene locus_tag LOCUS_01420 4399 2408 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81A99 protein_id gnl|my_center|LOCUS_01420 5528 4419 gene locus_tag LOCUS_01430 gene mnmA 5528 4419 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74A22 protein_id gnl|my_center|LOCUS_01430 5727 5882 gene locus_tag LOCUS_01440 5727 5882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883146.1 protein_id gnl|my_center|LOCUS_01440 5977 6696 gene locus_tag LOCUS_01450 gene rluB 5977 6696 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3ECR0 protein_id gnl|my_center|LOCUS_01450 6741 8021 gene locus_tag LOCUS_01460 6741 8021 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259308.1 protein_id gnl|my_center|LOCUS_01460 8052 9194 gene locus_tag LOCUS_01470 gene metX 8052 9194 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9J1 protein_id gnl|my_center|LOCUS_01470 9191 9955 gene locus_tag LOCUS_01480 9191 9955 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJC9 protein_id gnl|my_center|LOCUS_01480 9952 10674 gene locus_tag LOCUS_01490 9952 10674 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259632.1 protein_id gnl|my_center|LOCUS_01490 10674 11036 gene locus_tag LOCUS_01500 10674 11036 CDS product redox protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464876.1 protein_id gnl|my_center|LOCUS_01500 11103 12443 gene locus_tag LOCUS_01510 11103 12443 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788731.1 protein_id gnl|my_center|LOCUS_01510 12826 12440 gene locus_tag LOCUS_01520 12826 12440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 13676 12870 gene locus_tag LOCUS_01530 gene purQ 13676 12870 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942280.1 protein_id gnl|my_center|LOCUS_01530 14377 13676 gene locus_tag LOCUS_01540 gene pyrF 14377 13676 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK39 protein_id gnl|my_center|LOCUS_01540 14683 14390 gene locus_tag LOCUS_01550 14683 14390 CDS product stress responsive protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932932.1 protein_id gnl|my_center|LOCUS_01550 14806 18495 gene locus_tag LOCUS_01560 gene hrpA 14806 18495 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214608.1 protein_id gnl|my_center|LOCUS_01560 18527 19192 gene locus_tag LOCUS_01570 18527 19192 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942483.1 protein_id gnl|my_center|LOCUS_01570 19737 19189 gene locus_tag LOCUS_01580 19737 19189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 19839 20021 gene locus_tag LOCUS_01590 19839 20021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 20043 20116 gene locus_tag LOCUS_t00020 20043 20116 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 21854 20130 gene locus_tag LOCUS_01600 21854 20130 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_01600 22060 22779 gene locus_tag LOCUS_01610 gene xynB 22060 22779 CDS product xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038153.1 protein_id gnl|my_center|LOCUS_01610 22786 23520 gene locus_tag LOCUS_01620 22786 23520 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111875.1 protein_id gnl|my_center|LOCUS_01620 23811 23521 gene locus_tag LOCUS_01630 23811 23521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 23996 25507 gene locus_tag LOCUS_01640 gene glyQS 23996 25507 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UEU9 protein_id gnl|my_center|LOCUS_01640 26415 25504 gene locus_tag LOCUS_01650 26415 25504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 27223 26405 gene locus_tag LOCUS_01660 27223 26405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 28581 27238 gene locus_tag LOCUS_01670 28581 27238 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJD1 protein_id gnl|my_center|LOCUS_01670 28944 28594 gene locus_tag LOCUS_01680 28944 28594 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946343.1 protein_id gnl|my_center|LOCUS_01680 29399 28953 gene locus_tag LOCUS_01690 29399 28953 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_01690 30634 29399 gene locus_tag LOCUS_01700 30634 29399 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKV3 protein_id gnl|my_center|LOCUS_01700 31821 30631 gene locus_tag LOCUS_01710 31821 30631 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946340.1 protein_id gnl|my_center|LOCUS_01710 32576 31821 gene locus_tag LOCUS_01720 32576 31821 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141371.1 protein_id gnl|my_center|LOCUS_01720 34051 32597 gene locus_tag LOCUS_01730 gene ycf24 34051 32597 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141370.1 protein_id gnl|my_center|LOCUS_01730 34468 34070 gene locus_tag LOCUS_01740 34468 34070 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037893.1 protein_id gnl|my_center|LOCUS_01740 35367 34564 gene locus_tag LOCUS_01750 gene mazG 35367 34564 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941834.1 protein_id gnl|my_center|LOCUS_01750 >Feature sequence006 1151 144 gene locus_tag LOCUS_01760 1151 144 CDS product hydroxymethylglutaryl-CoA reductase (NADPH) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957686.1 protein_id gnl|my_center|LOCUS_01760 1317 2021 gene locus_tag LOCUS_01770 gene phoB 1317 2021 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938382.1 protein_id gnl|my_center|LOCUS_01770 2079 3890 gene locus_tag LOCUS_01780 gene phoR 2079 3890 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722633.1 protein_id gnl|my_center|LOCUS_01780 3943 5013 gene locus_tag LOCUS_01790 3943 5013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 5936 5010 gene locus_tag LOCUS_01800 5936 5010 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9W9T3 protein_id gnl|my_center|LOCUS_01800 6385 5948 gene locus_tag LOCUS_01810 6385 5948 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_01810 7522 6488 gene locus_tag LOCUS_01820 gene rlmN 7522 6488 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CSW0 protein_id gnl|my_center|LOCUS_01820 9138 7522 gene locus_tag LOCUS_01830 gene pgi 9138 7522 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJY9 protein_id gnl|my_center|LOCUS_01830 9275 11419 gene locus_tag LOCUS_01840 gene prc 9275 11419 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091593.1 protein_id gnl|my_center|LOCUS_01840 12459 11368 gene locus_tag LOCUS_01850 12459 11368 CDS product mechanosensitive ion channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496414.1 protein_id gnl|my_center|LOCUS_01850 13525 12470 gene locus_tag LOCUS_01860 13525 12470 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263412.1 protein_id gnl|my_center|LOCUS_01860 15099 13522 gene locus_tag LOCUS_01870 15099 13522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 17245 15137 gene locus_tag LOCUS_01880 gene greA 17245 15137 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51157 protein_id gnl|my_center|LOCUS_01880 17435 17349 gene locus_tag LOCUS_t00030 17435 17349 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 17553 17741 gene locus_tag LOCUS_01890 17553 17741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 17819 18490 gene locus_tag LOCUS_01900 17819 18490 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263331.1 protein_id gnl|my_center|LOCUS_01900 18530 21418 gene locus_tag LOCUS_01910 18530 21418 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938240.1 protein_id gnl|my_center|LOCUS_01910 22751 21429 gene locus_tag LOCUS_01920 22751 21429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 23201 22767 gene locus_tag LOCUS_01930 23201 22767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 23609 23205 gene locus_tag LOCUS_01940 23609 23205 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119077.1 protein_id gnl|my_center|LOCUS_01940 24395 23643 gene locus_tag LOCUS_01950 24395 23643 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404334.1 protein_id gnl|my_center|LOCUS_01950 25287 24424 gene locus_tag LOCUS_01960 25287 24424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 28097 25299 gene locus_tag LOCUS_01970 28097 25299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 29430 28228 gene locus_tag LOCUS_01980 29430 28228 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876398.1 protein_id gnl|my_center|LOCUS_01980 30704 29460 gene locus_tag LOCUS_01990 gene fabF 30704 29460 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67612 protein_id gnl|my_center|LOCUS_01990 31034 30798 gene locus_tag LOCUS_02000 gene acpP 31034 30798 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67611 protein_id gnl|my_center|LOCUS_02000 31830 31069 gene locus_tag LOCUS_02010 gene fabG 31830 31069 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933770.1 protein_id gnl|my_center|LOCUS_02010 32722 31823 gene locus_tag LOCUS_02020 gene fabD-2 32722 31823 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CS0 protein_id gnl|my_center|LOCUS_02020 33716 32724 gene locus_tag LOCUS_02030 gene fabH 33716 32724 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJX8 protein_id gnl|my_center|LOCUS_02030 34733 33720 gene locus_tag LOCUS_02040 34733 33720 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_02040 34924 34739 gene locus_tag LOCUS_02050 gene rpmF 34924 34739 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CS3 protein_id gnl|my_center|LOCUS_02050 35405 34944 gene locus_tag LOCUS_02060 35405 34944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 >Feature sequence007 661 314 gene locus_tag LOCUS_02070 gene mrpC 661 314 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942978.1 protein_id gnl|my_center|LOCUS_02070 1077 661 gene locus_tag LOCUS_02080 gene mrpB 1077 661 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942979.1 protein_id gnl|my_center|LOCUS_02080 3236 1074 gene locus_tag LOCUS_02090 gene mrpA 3236 1074 CDS product Na(+)/H(+) antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942980.1 protein_id gnl|my_center|LOCUS_02090 3557 3835 gene locus_tag LOCUS_02100 3557 3835 CDS product dipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552279.1 protein_id gnl|my_center|LOCUS_02100 4175 5371 gene locus_tag LOCUS_02110 gene murA 4175 5371 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89W71 protein_id gnl|my_center|LOCUS_02110 5390 6001 gene locus_tag LOCUS_02120 gene ppa 5390 6001 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z6Y8 protein_id gnl|my_center|LOCUS_02120 8508 6004 gene locus_tag LOCUS_02130 gene gyrA 8508 6004 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H88 protein_id gnl|my_center|LOCUS_02130 10950 8518 gene locus_tag LOCUS_02140 gene gyrB 10950 8518 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZK5 protein_id gnl|my_center|LOCUS_02140 11948 11052 gene locus_tag LOCUS_02150 gene hslO 11948 11052 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HPV0 protein_id gnl|my_center|LOCUS_02150 12568 11960 gene locus_tag LOCUS_02160 gene rluA 12568 11960 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114801.1 protein_id gnl|my_center|LOCUS_02160 13957 12629 gene locus_tag LOCUS_02170 gene xylA2 13957 12629 CDS product xylose isomerase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3H1 protein_id gnl|my_center|LOCUS_02170 15442 13970 gene locus_tag LOCUS_02180 15442 13970 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765651.1 protein_id gnl|my_center|LOCUS_02180 16604 15456 gene locus_tag LOCUS_02190 gene xynA 16604 15456 CDS product beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3F6 protein_id gnl|my_center|LOCUS_02190 17998 16631 gene locus_tag LOCUS_02200 17998 16631 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107431.1 protein_id gnl|my_center|LOCUS_02200 21927 18013 gene locus_tag LOCUS_02210 21927 18013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 25566 21943 gene locus_tag LOCUS_02220 25566 21943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 28431 25603 gene locus_tag LOCUS_02230 28431 25603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 28597 29742 gene locus_tag LOCUS_02240 gene xylR 28597 29742 CDS product XylR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338851.1 protein_id gnl|my_center|LOCUS_02240 31078 29744 gene locus_tag LOCUS_02250 31078 29744 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966721.1 protein_id gnl|my_center|LOCUS_02250 33114 31075 gene locus_tag LOCUS_02260 33114 31075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 34685 33300 gene locus_tag LOCUS_02270 34685 33300 CDS product N-sulfoglucosamine sulfohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767366.1 protein_id gnl|my_center|LOCUS_02270 >Feature sequence008 2220 382 gene locus_tag LOCUS_02280 2220 382 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119224.1 protein_id gnl|my_center|LOCUS_02280 2378 3931 gene locus_tag LOCUS_02290 gene arsA 2378 3931 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121409.1 protein_id gnl|my_center|LOCUS_02290 4049 4948 gene locus_tag LOCUS_02300 4049 4948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 4945 6141 gene locus_tag LOCUS_02310 4945 6141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 6326 6401 gene locus_tag LOCUS_t00040 6326 6401 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6457 7656 gene locus_tag LOCUS_02320 gene tuf 6457 7656 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8R603 protein_id gnl|my_center|LOCUS_02320 7898 7973 gene locus_tag LOCUS_t00050 7898 7973 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 7995 8198 gene locus_tag LOCUS_02330 gene secE 7995 8198 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y0 protein_id gnl|my_center|LOCUS_02330 8213 8767 gene locus_tag LOCUS_02340 gene nusG 8213 8767 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y1 protein_id gnl|my_center|LOCUS_02340 8787 9209 gene locus_tag LOCUS_02350 gene rplK 8787 9209 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9LAK6 protein_id gnl|my_center|LOCUS_02350 9212 9904 gene locus_tag LOCUS_02360 gene rplA 9212 9904 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFW1 protein_id gnl|my_center|LOCUS_02360 9924 10454 gene locus_tag LOCUS_02370 gene rplJ 9924 10454 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29394 protein_id gnl|my_center|LOCUS_02370 10492 10908 gene locus_tag LOCUS_02380 gene rplL 10492 10908 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8YAA3 protein_id gnl|my_center|LOCUS_02380 11020 14790 gene locus_tag LOCUS_02390 gene rpoB 11020 14790 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B0B7N1 protein_id gnl|my_center|LOCUS_02390 14809 19032 gene locus_tag LOCUS_02400 gene rpoC 14809 19032 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O84316 protein_id gnl|my_center|LOCUS_02400 19309 19680 gene locus_tag LOCUS_02410 gene rpsL 19309 19680 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VTD7 protein_id gnl|my_center|LOCUS_02410 19696 20169 gene locus_tag LOCUS_02420 gene rpsG 19696 20169 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG51 protein_id gnl|my_center|LOCUS_02420 20272 22404 gene locus_tag LOCUS_02430 gene fusA2 20272 22404 CDS product elongation factor G 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y8 protein_id gnl|my_center|LOCUS_02430 22420 22728 gene locus_tag LOCUS_02440 gene rpsJ 22420 22728 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UE17 protein_id gnl|my_center|LOCUS_02440 22738 23367 gene locus_tag LOCUS_02450 gene rplC 22738 23367 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A476 protein_id gnl|my_center|LOCUS_02450 23379 24020 gene locus_tag LOCUS_02460 gene rplD 23379 24020 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFP8 protein_id gnl|my_center|LOCUS_02460 24017 24301 gene locus_tag LOCUS_02470 gene rplW 24017 24301 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NPG8 protein_id gnl|my_center|LOCUS_02470 24315 25142 gene locus_tag LOCUS_02480 24315 25142 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459099.1 protein_id gnl|my_center|LOCUS_02480 25145 25414 gene locus_tag LOCUS_02490 gene rpsS 25145 25414 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z7R1 protein_id gnl|my_center|LOCUS_02490 25423 25758 gene locus_tag LOCUS_02500 gene rplV 25423 25758 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK63 protein_id gnl|my_center|LOCUS_02500 25774 26406 gene locus_tag LOCUS_02510 gene rpsC 25774 26406 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UE24 protein_id gnl|my_center|LOCUS_02510 26419 26838 gene locus_tag LOCUS_02520 gene rplP 26419 26838 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7J9 protein_id gnl|my_center|LOCUS_02520 26851 27045 gene locus_tag LOCUS_02530 26851 27045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 27047 27313 gene locus_tag LOCUS_02540 gene rpsQ 27047 27313 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88XX7 protein_id gnl|my_center|LOCUS_02540 27320 27685 gene locus_tag LOCUS_02550 gene rplN 27320 27685 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFQ7 protein_id gnl|my_center|LOCUS_02550 27699 27926 gene locus_tag LOCUS_02560 27699 27926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 27952 28497 gene locus_tag LOCUS_02570 gene rplE 27952 28497 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7J4 protein_id gnl|my_center|LOCUS_02570 28511 28909 gene locus_tag LOCUS_02580 gene rpsH 28511 28909 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66623 protein_id gnl|my_center|LOCUS_02580 28928 29464 gene locus_tag LOCUS_02590 gene rplF 28928 29464 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5W0 protein_id gnl|my_center|LOCUS_02590 29464 29799 gene locus_tag LOCUS_02600 gene rplR 29464 29799 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FM75 protein_id gnl|my_center|LOCUS_02600 29808 30359 gene locus_tag LOCUS_02610 gene rpsE 29808 30359 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CDY0 protein_id gnl|my_center|LOCUS_02610 30378 30818 gene locus_tag LOCUS_02620 gene rplO 30378 30818 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y447 protein_id gnl|my_center|LOCUS_02620 30839 32179 gene locus_tag LOCUS_02630 gene secY 30839 32179 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749A7 protein_id gnl|my_center|LOCUS_02630 32183 32836 gene locus_tag LOCUS_02640 32183 32836 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_02640 32833 33591 gene locus_tag LOCUS_02650 32833 33591 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_02650 33591 33812 gene locus_tag LOCUS_02660 33591 33812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 33936 34337 gene locus_tag LOCUS_02670 gene rpsM 33936 34337 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CE04 protein_id gnl|my_center|LOCUS_02670 >Feature sequence009 203 3 gene locus_tag LOCUS_02680 203 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 519 1217 gene locus_tag LOCUS_02690 519 1217 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932468.1 protein_id gnl|my_center|LOCUS_02690 1287 2648 gene locus_tag LOCUS_02700 1287 2648 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037525.1 protein_id gnl|my_center|LOCUS_02700 2789 4588 gene locus_tag LOCUS_02710 2789 4588 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089481.1 protein_id gnl|my_center|LOCUS_02710 4612 6459 gene locus_tag LOCUS_02720 4612 6459 CDS product ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089482.1 protein_id gnl|my_center|LOCUS_02720 6468 7520 gene locus_tag LOCUS_02730 6468 7520 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089483.1 protein_id gnl|my_center|LOCUS_02730 8692 7517 gene locus_tag LOCUS_02740 gene patB 8692 7517 CDS product cystathionine beta-lyase PatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q08432 protein_id gnl|my_center|LOCUS_02740 10794 8677 gene locus_tag LOCUS_02750 10794 8677 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074094.1 protein_id gnl|my_center|LOCUS_02750 11217 10894 gene locus_tag LOCUS_02760 11217 10894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 11320 12792 gene locus_tag LOCUS_02770 11320 12792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 12789 13661 gene locus_tag LOCUS_02780 12789 13661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 15946 13658 gene locus_tag LOCUS_02790 15946 13658 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114668.1 protein_id gnl|my_center|LOCUS_02790 16610 15948 gene locus_tag LOCUS_02800 16610 15948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 17390 16650 gene locus_tag LOCUS_02810 17390 16650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 17549 17406 gene locus_tag LOCUS_02820 17549 17406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 18149 17562 gene locus_tag LOCUS_02830 18149 17562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02830 19540 18164 gene locus_tag LOCUS_02840 19540 18164 CDS product cytochrome c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157695.1 protein_id gnl|my_center|LOCUS_02840 20268 19540 gene locus_tag LOCUS_02850 20268 19540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 21398 20268 gene locus_tag LOCUS_02860 21398 20268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 22742 21402 gene locus_tag LOCUS_02870 22742 21402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 23233 22763 gene locus_tag LOCUS_02880 23233 22763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 23404 23258 gene locus_tag LOCUS_02890 23404 23258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 25190 23406 gene locus_tag LOCUS_02900 25190 23406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 25505 25723 gene locus_tag LOCUS_02910 gene cspA 25505 25723 CDS product cold-shock protein CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072720.1 protein_id gnl|my_center|LOCUS_02910 26290 25799 gene locus_tag LOCUS_02920 26290 25799 CDS product 7,8-dihydro-8-oxoguanine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980098.1 protein_id gnl|my_center|LOCUS_02920 27212 26373 gene locus_tag LOCUS_02930 27212 26373 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 protein_id gnl|my_center|LOCUS_02930 28060 27290 gene locus_tag LOCUS_02940 28060 27290 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878084.1 protein_id gnl|my_center|LOCUS_02940 28205 29863 gene locus_tag LOCUS_02950 gene glnS 28205 29863 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747A1 protein_id gnl|my_center|LOCUS_02950 30522 30259 gene locus_tag LOCUS_02960 30522 30259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 30873 30625 gene locus_tag LOCUS_02970 30873 30625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 31297 30905 gene locus_tag LOCUS_02980 31297 30905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 32200 32006 gene locus_tag LOCUS_02990 32200 32006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 >Feature sequence010 55 930 gene locus_tag LOCUS_03000 55 930 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFK3 protein_id gnl|my_center|LOCUS_03000 947 2236 gene locus_tag LOCUS_03010 gene gltA 947 2236 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ68 protein_id gnl|my_center|LOCUS_03010 2738 2286 gene locus_tag LOCUS_03020 2738 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 3235 2738 gene locus_tag LOCUS_03030 gene tpx 3235 2738 CDS product putative thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KED5 protein_id gnl|my_center|LOCUS_03030 3390 3644 gene locus_tag LOCUS_03040 3390 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 3710 4315 gene locus_tag LOCUS_03050 gene hisB 3710 4315 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60885 protein_id gnl|my_center|LOCUS_03050 4331 5119 gene locus_tag LOCUS_03060 4331 5119 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMZ5 protein_id gnl|my_center|LOCUS_03060 5197 5817 gene locus_tag LOCUS_03070 gene hisH 5197 5817 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGL5 protein_id gnl|my_center|LOCUS_03070 6074 5814 gene locus_tag LOCUS_03080 6074 5814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 6357 6076 gene locus_tag LOCUS_03090 6357 6076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 7689 6433 gene locus_tag LOCUS_03100 gene bioA 7689 6433 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ98 protein_id gnl|my_center|LOCUS_03100 8399 7686 gene locus_tag LOCUS_03110 gene bioD 8399 7686 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHS9 protein_id gnl|my_center|LOCUS_03110 9172 8396 gene locus_tag LOCUS_03120 gene bioC 9172 8396 CDS product malonyl-[acyl-carrier protein] O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749W5 protein_id gnl|my_center|LOCUS_03120 9263 10159 gene locus_tag LOCUS_03130 9263 10159 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023359.1 protein_id gnl|my_center|LOCUS_03130 10781 10128 gene locus_tag LOCUS_03140 10781 10128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 11938 10778 gene locus_tag LOCUS_03150 gene bioF 11938 10778 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749W3 protein_id gnl|my_center|LOCUS_03150 12079 13827 gene locus_tag LOCUS_03160 gene ilvD 12079 13827 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKA4 protein_id gnl|my_center|LOCUS_03160 14603 13824 gene locus_tag LOCUS_03170 14603 13824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 14624 14887 gene locus_tag LOCUS_03180 14624 14887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 15057 15851 gene locus_tag LOCUS_03190 15057 15851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 15851 16498 gene locus_tag LOCUS_03200 15851 16498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 16550 17140 gene locus_tag LOCUS_03210 gene rpoE 16550 17140 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63S89 protein_id gnl|my_center|LOCUS_03210 17161 17574 gene locus_tag LOCUS_03220 17161 17574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 19323 17644 gene locus_tag LOCUS_03230 19323 17644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 19794 19339 gene locus_tag LOCUS_03240 gene ywlE 19794 19339 CDS product protein-arginine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39155 protein_id gnl|my_center|LOCUS_03240 20402 19791 gene locus_tag LOCUS_03250 20402 19791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 20490 22682 gene locus_tag LOCUS_03260 20490 22682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 23590 22679 gene locus_tag LOCUS_03270 23590 22679 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_03270 25029 23605 gene locus_tag LOCUS_03280 25029 23605 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267578.1 protein_id gnl|my_center|LOCUS_03280 25056 25433 gene locus_tag LOCUS_03290 25056 25433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 27113 25455 gene locus_tag LOCUS_03300 27113 25455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 27816 27214 gene locus_tag LOCUS_03310 27816 27214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 28832 27822 gene locus_tag LOCUS_03320 28832 27822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812222.1 protein_id gnl|my_center|LOCUS_03320 30005 28851 gene locus_tag LOCUS_03330 30005 28851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 30478 29996 gene locus_tag LOCUS_03340 30478 29996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 >Feature sequence011 1567 134 gene locus_tag LOCUS_03350 1567 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 2346 1564 gene locus_tag LOCUS_03360 gene mqnD 2346 1564 CDS product 1,4-dihydroxy-6-naphtoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FZ8 protein_id gnl|my_center|LOCUS_03360 2516 4309 gene locus_tag LOCUS_03370 gene cysJ 2516 4309 CDS product sulfite reductase [NADPH] flavoprotein alpha-component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUX4 protein_id gnl|my_center|LOCUS_03370 4322 6022 gene locus_tag LOCUS_03380 gene cysI 4322 6022 CDS product sulfite reductase [NADPH] hemoprotein beta-component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB00 protein_id gnl|my_center|LOCUS_03380 6019 6723 gene locus_tag LOCUS_03390 gene cysH 6019 6723 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L92 protein_id gnl|my_center|LOCUS_03390 6732 8498 gene locus_tag LOCUS_03400 gene uup 6732 8498 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120247.1 protein_id gnl|my_center|LOCUS_03400 8552 9727 gene locus_tag LOCUS_03410 8552 9727 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085484.1 protein_id gnl|my_center|LOCUS_03410 9734 10558 gene locus_tag LOCUS_03420 9734 10558 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WJ69 protein_id gnl|my_center|LOCUS_03420 10555 11049 gene locus_tag LOCUS_03430 10555 11049 CDS product phosphohistidine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390011.1 protein_id gnl|my_center|LOCUS_03430 11150 11770 gene locus_tag LOCUS_03440 11150 11770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 11934 12116 gene locus_tag LOCUS_03450 11934 12116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 12186 12695 gene locus_tag LOCUS_03460 gene aroK 12186 12695 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHI3 protein_id gnl|my_center|LOCUS_03460 13511 12825 gene locus_tag LOCUS_03470 13511 12825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 14496 13501 gene locus_tag LOCUS_03480 gene srkA 14496 13501 CDS product stress response kinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I632 protein_id gnl|my_center|LOCUS_03480 15158 14493 gene locus_tag LOCUS_03490 15158 14493 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404382.1 protein_id gnl|my_center|LOCUS_03490 15727 15164 gene locus_tag LOCUS_03500 15727 15164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 17118 15880 gene locus_tag LOCUS_03510 gene glgC 17118 15880 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674820.1 protein_id gnl|my_center|LOCUS_03510 17288 17363 gene locus_tag LOCUS_t00060 17288 17363 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 18115 17372 gene locus_tag LOCUS_03520 gene truA 18115 17372 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y457 protein_id gnl|my_center|LOCUS_03520 18551 18216 gene locus_tag LOCUS_03530 18551 18216 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545706.1 protein_id gnl|my_center|LOCUS_03530 20044 18536 gene locus_tag LOCUS_03540 gene zwf 20044 18536 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WE89 protein_id gnl|my_center|LOCUS_03540 20147 21229 gene locus_tag LOCUS_03550 20147 21229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919039.1 protein_id gnl|my_center|LOCUS_03550 22131 21226 gene locus_tag LOCUS_03560 22131 21226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 23222 22239 gene locus_tag LOCUS_03570 23222 22239 CDS product hemolysin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324277.1 protein_id gnl|my_center|LOCUS_03570 24478 23219 gene locus_tag LOCUS_03580 24478 23219 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_03580 24705 25820 gene locus_tag LOCUS_03590 24705 25820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 26653 25817 gene locus_tag LOCUS_03600 26653 25817 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336944.1 protein_id gnl|my_center|LOCUS_03600 27294 26668 gene locus_tag LOCUS_03610 gene ribE 27294 26668 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942332.1 protein_id gnl|my_center|LOCUS_03610 27641 27297 gene locus_tag LOCUS_03620 27641 27297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 >Feature sequence012 40 906 gene locus_tag LOCUS_03630 40 906 CDS product sucrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120367.1 protein_id gnl|my_center|LOCUS_03630 1234 2199 gene locus_tag LOCUS_03640 gene pmi 1234 2199 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966201.1 protein_id gnl|my_center|LOCUS_03640 2592 2221 gene locus_tag LOCUS_03650 2592 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 2716 2632 gene locus_tag LOCUS_t00070 2716 2632 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 3700 2807 gene locus_tag LOCUS_03660 3700 2807 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_03660 3748 4683 gene locus_tag LOCUS_03670 gene lacC 3748 4683 CDS product tagatose-6-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97F04 protein_id gnl|my_center|LOCUS_03670 5153 4680 gene locus_tag LOCUS_03680 5153 4680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 5719 5153 gene locus_tag LOCUS_03690 gene efp1 5719 5153 CDS product elongation factor P 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FY7 protein_id gnl|my_center|LOCUS_03690 6528 5782 gene locus_tag LOCUS_03700 6528 5782 CDS product 1-(5-phosphoribosyl)-5-amino-4-imidazole-carboxylate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812203.1 protein_id gnl|my_center|LOCUS_03700 6695 7879 gene locus_tag LOCUS_03710 gene metK 6695 7879 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CXS7 protein_id gnl|my_center|LOCUS_03710 7927 9111 gene locus_tag LOCUS_03720 gene lpxK 7927 9111 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AU2 protein_id gnl|my_center|LOCUS_03720 12323 9108 gene locus_tag LOCUS_03730 gene carB 12323 9108 CDS product carbamoyl phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878769.1 protein_id gnl|my_center|LOCUS_03730 13881 12334 gene locus_tag LOCUS_03740 gene guaA 13881 12334 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHY9 protein_id gnl|my_center|LOCUS_03740 14978 13878 gene locus_tag LOCUS_03750 gene carA 14978 13878 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DP3 protein_id gnl|my_center|LOCUS_03750 15196 15900 gene locus_tag LOCUS_03760 15196 15900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 16888 15914 gene locus_tag LOCUS_03770 16888 15914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 18309 16885 gene locus_tag LOCUS_03780 gene phrA 18309 16885 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJC9 protein_id gnl|my_center|LOCUS_03780 18416 19057 gene locus_tag LOCUS_03790 18416 19057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 19173 19454 gene locus_tag LOCUS_03800 19173 19454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 19458 20708 gene locus_tag LOCUS_03810 gene hisS 19458 20708 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHW0 protein_id gnl|my_center|LOCUS_03810 20711 22510 gene locus_tag LOCUS_03820 gene aspS 20711 22510 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZE17 protein_id gnl|my_center|LOCUS_03820 22507 23310 gene locus_tag LOCUS_03830 gene trpA 22507 23310 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIU0 protein_id gnl|my_center|LOCUS_03830 23312 24394 gene locus_tag LOCUS_03840 gene manC 23312 24394 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403343.1 protein_id gnl|my_center|LOCUS_03840 25028 24690 gene locus_tag LOCUS_03850 25028 24690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 26274 25114 gene locus_tag LOCUS_03860 gene purR 26274 25114 CDS product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E4H9 protein_id gnl|my_center|LOCUS_03860 >Feature sequence013 528 1532 gene locus_tag LOCUS_03870 gene rpoA 528 1532 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749B3 protein_id gnl|my_center|LOCUS_03870 1622 1954 gene locus_tag LOCUS_03880 1622 1954 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459109.1 protein_id gnl|my_center|LOCUS_03880 2027 2626 gene locus_tag LOCUS_03890 gene orn 2027 2626 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NI61 protein_id gnl|my_center|LOCUS_03890 2694 5078 gene locus_tag LOCUS_03900 2694 5078 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392586.1 protein_id gnl|my_center|LOCUS_03900 5059 5664 gene locus_tag LOCUS_03910 5059 5664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 5664 6236 gene locus_tag LOCUS_03920 gene pgsA 5664 6236 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939132.1 protein_id gnl|my_center|LOCUS_03920 6233 6796 gene locus_tag LOCUS_03930 6233 6796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 7549 6758 gene locus_tag LOCUS_03940 7549 6758 CDS product adenine nucleotide alpha hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461498.1 protein_id gnl|my_center|LOCUS_03940 8807 7764 gene locus_tag LOCUS_03950 8807 7764 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AE7 protein_id gnl|my_center|LOCUS_03950 8897 9271 gene locus_tag LOCUS_03960 8897 9271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 9315 9755 gene locus_tag LOCUS_03970 9315 9755 CDS product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462206.1 protein_id gnl|my_center|LOCUS_03970 9756 10529 gene locus_tag LOCUS_03980 gene lpxA 9756 10529 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHC0 protein_id gnl|my_center|LOCUS_03980 10625 12031 gene locus_tag LOCUS_03990 gene htrA 10625 12031 CDS product putative periplasmic serine endoprotease DegP-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P18584 protein_id gnl|my_center|LOCUS_03990 13199 12111 gene locus_tag LOCUS_04000 13199 12111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 13498 14973 gene locus_tag LOCUS_04010 13498 14973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 14976 16778 gene locus_tag LOCUS_04020 14976 16778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 16782 18332 gene locus_tag LOCUS_04030 gene ydeN 16782 18332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263807.1 protein_id gnl|my_center|LOCUS_04030 18505 20262 gene locus_tag LOCUS_04040 gene atsA 18505 20262 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122139.1 protein_id gnl|my_center|LOCUS_04040 20262 21773 gene locus_tag LOCUS_04050 20262 21773 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117744.1 protein_id gnl|my_center|LOCUS_04050 21770 23350 gene locus_tag LOCUS_04060 gene ids 21770 23350 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123097.1 protein_id gnl|my_center|LOCUS_04060 23358 25166 gene locus_tag LOCUS_04070 23358 25166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 >Feature sequence014 201 1049 gene locus_tag LOCUS_04080 gene panC 201 1049 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X0G6 protein_id gnl|my_center|LOCUS_04080 1117 1190 gene locus_tag LOCUS_t00080 1117 1190 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1219 1602 gene locus_tag LOCUS_04090 gene gcvH 1219 1602 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIQ7 protein_id gnl|my_center|LOCUS_04090 1655 2365 gene locus_tag LOCUS_04100 gene lipB 1655 2365 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WKF8 protein_id gnl|my_center|LOCUS_04100 3126 2362 gene locus_tag LOCUS_04110 gene surE 3126 2362 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1H7 protein_id gnl|my_center|LOCUS_04110 3215 3973 gene locus_tag LOCUS_04120 3215 3973 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB2 protein_id gnl|my_center|LOCUS_04120 3970 4416 gene locus_tag LOCUS_04130 3970 4416 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25437 protein_id gnl|my_center|LOCUS_04130 5486 4413 gene locus_tag LOCUS_04140 5486 4413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 5641 6723 gene locus_tag LOCUS_04150 gene aroC 5641 6723 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLM1 protein_id gnl|my_center|LOCUS_04150 6723 7148 gene locus_tag LOCUS_04160 6723 7148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 7093 8064 gene locus_tag LOCUS_04170 gene tatC 7093 8064 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K0J7 protein_id gnl|my_center|LOCUS_04170 8064 8315 gene locus_tag LOCUS_04180 8064 8315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 8312 9100 gene locus_tag LOCUS_04190 8312 9100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 9173 9264 gene locus_tag LOCUS_t00090 9173 9264 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9523 12345 gene locus_tag LOCUS_04200 9523 12345 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A925 protein_id gnl|my_center|LOCUS_04200 12445 13758 gene locus_tag LOCUS_04210 12445 13758 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIE4 protein_id gnl|my_center|LOCUS_04210 13745 15091 gene locus_tag LOCUS_04220 13745 15091 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y4R0 protein_id gnl|my_center|LOCUS_04220 15493 15095 gene locus_tag LOCUS_04230 15493 15095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 16440 15490 gene locus_tag LOCUS_04240 16440 15490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 16327 16566 gene locus_tag LOCUS_04250 16327 16566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 16576 16713 gene locus_tag LOCUS_04260 16576 16713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 16807 17868 gene locus_tag LOCUS_04270 16807 17868 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943403.1 protein_id gnl|my_center|LOCUS_04270 17931 19373 gene locus_tag LOCUS_04280 gene lysS 17931 19373 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CII7 protein_id gnl|my_center|LOCUS_04280 19598 19377 gene locus_tag LOCUS_04290 19598 19377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 19650 19859 gene locus_tag LOCUS_04300 19650 19859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 19993 21270 gene locus_tag LOCUS_04310 19993 21270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 21280 21873 gene locus_tag LOCUS_04320 gene plsY 21280 21873 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U809 protein_id gnl|my_center|LOCUS_04320 21873 22862 gene locus_tag LOCUS_04330 gene gpsA 21873 22862 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIV6 protein_id gnl|my_center|LOCUS_04330 22946 24166 gene locus_tag LOCUS_04340 22946 24166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_04340 24195 24980 gene locus_tag LOCUS_04350 24195 24980 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_04350 25864 24977 gene locus_tag LOCUS_04360 25864 24977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 >Feature sequence015 925 2250 gene locus_tag LOCUS_04370 gene ibeB 925 2250 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123112.1 protein_id gnl|my_center|LOCUS_04370 2247 3410 gene locus_tag LOCUS_04380 2247 3410 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262874.1 protein_id gnl|my_center|LOCUS_04380 3400 6525 gene locus_tag LOCUS_04390 gene czcA 3400 6525 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 protein_id gnl|my_center|LOCUS_04390 7153 6506 gene locus_tag LOCUS_04400 gene gmk 7153 6506 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y558 protein_id gnl|my_center|LOCUS_04400 8039 7158 gene locus_tag LOCUS_04410 8039 7158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392409.1 protein_id gnl|my_center|LOCUS_04410 9240 8029 gene locus_tag LOCUS_04420 gene trpB1 9240 8029 CDS product tryptophan synthase beta chain 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66923 protein_id gnl|my_center|LOCUS_04420 10149 9304 gene locus_tag LOCUS_04430 gene gluQ 10149 9304 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VY0 protein_id gnl|my_center|LOCUS_04430 10766 10149 gene locus_tag LOCUS_04440 gene trpF 10766 10149 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59649 protein_id gnl|my_center|LOCUS_04440 11432 10788 gene locus_tag LOCUS_04450 gene azoR 11432 10788 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U839 protein_id gnl|my_center|LOCUS_04450 11609 12439 gene locus_tag LOCUS_04460 gene thyX 11609 12439 CDS product flavin-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73QY2 protein_id gnl|my_center|LOCUS_04460 13545 12424 gene locus_tag LOCUS_04470 gene lpxB 13545 12424 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AT9 protein_id gnl|my_center|LOCUS_04470 14363 13542 gene locus_tag LOCUS_04480 14363 13542 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870029.1 protein_id gnl|my_center|LOCUS_04480 15174 14416 gene locus_tag LOCUS_04490 15174 14416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 15446 15267 gene locus_tag LOCUS_04500 15446 15267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 16252 15593 gene locus_tag LOCUS_04510 16252 15593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 17989 16262 gene locus_tag LOCUS_04520 17989 16262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 19203 17986 gene locus_tag LOCUS_04530 19203 17986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 22409 19203 gene locus_tag LOCUS_04540 22409 19203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 22816 22376 gene locus_tag LOCUS_04550 22816 22376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 23913 22831 gene locus_tag LOCUS_04560 23913 22831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 24915 23965 gene locus_tag LOCUS_04570 24915 23965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 >Feature sequence016 1416 238 gene locus_tag LOCUS_04580 gene sucC 1416 238 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFE7 protein_id gnl|my_center|LOCUS_04580 2177 1413 gene locus_tag LOCUS_04590 gene frdB 2177 1413 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941838.1 protein_id gnl|my_center|LOCUS_04590 4093 2177 gene locus_tag LOCUS_04600 gene sdhA 4093 2177 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_04600 4769 4107 gene locus_tag LOCUS_04610 4769 4107 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933917.1 protein_id gnl|my_center|LOCUS_04610 4968 5909 gene locus_tag LOCUS_04620 gene mdh 4968 5909 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7K1 protein_id gnl|my_center|LOCUS_04620 7767 5959 gene locus_tag LOCUS_04630 7767 5959 CDS product 3-octaprenyl-4-hydroxybenzoate carboxy-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942647.1 protein_id gnl|my_center|LOCUS_04630 8546 7824 gene locus_tag LOCUS_04640 8546 7824 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331314.1 protein_id gnl|my_center|LOCUS_04640 8869 9891 gene locus_tag LOCUS_04650 gene mreB-1 8869 9891 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_04650 9926 10765 gene locus_tag LOCUS_04660 gene mreC 9926 10765 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HD74 protein_id gnl|my_center|LOCUS_04660 10762 11256 gene locus_tag LOCUS_04670 10762 11256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 11253 13418 gene locus_tag LOCUS_04680 11253 13418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 13415 14593 gene locus_tag LOCUS_04690 13415 14593 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460900.1 protein_id gnl|my_center|LOCUS_04690 14605 16194 gene locus_tag LOCUS_04700 gene cafA 14605 16194 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_04700 16198 17223 gene locus_tag LOCUS_04710 gene galM 16198 17223 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q882J1 protein_id gnl|my_center|LOCUS_04710 17480 18676 gene locus_tag LOCUS_04720 17480 18676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 18691 19158 gene locus_tag LOCUS_04730 gene prx-4 18691 19158 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944057.1 protein_id gnl|my_center|LOCUS_04730 19945 19142 gene locus_tag LOCUS_04740 19945 19142 CDS product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393993.1 protein_id gnl|my_center|LOCUS_04740 20645 19929 gene locus_tag LOCUS_04750 20645 19929 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRE6 protein_id gnl|my_center|LOCUS_04750 21811 20642 gene locus_tag LOCUS_04760 gene dnaJ 21811 20642 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV44 protein_id gnl|my_center|LOCUS_04760 22359 21814 gene locus_tag LOCUS_04770 gene grpE 22359 21814 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKX5 protein_id gnl|my_center|LOCUS_04770 22792 22478 gene locus_tag LOCUS_04780 22792 22478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 22709 23257 gene locus_tag LOCUS_04790 22709 23257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 24476 23247 gene locus_tag LOCUS_04800 24476 23247 CDS product sodium:glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056889.1 protein_id gnl|my_center|LOCUS_04800 >Feature sequence017 1948 3105 gene locus_tag LOCUS_04810 1948 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67300 protein_id gnl|my_center|LOCUS_04810 4123 3164 gene locus_tag LOCUS_04820 4123 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 4692 4147 gene locus_tag LOCUS_04830 4692 4147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 5609 4689 gene locus_tag LOCUS_04840 gene pyrD 5609 4689 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGM0 protein_id gnl|my_center|LOCUS_04840 6381 5602 gene locus_tag LOCUS_04850 gene pyrK 6381 5602 CDS product dihydroorotate dehydrogenase B (NAD(+)), electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CB8 protein_id gnl|my_center|LOCUS_04850 6657 8384 gene locus_tag LOCUS_04860 gene lepA 6657 8384 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B0B9H2 protein_id gnl|my_center|LOCUS_04860 8381 9454 gene locus_tag LOCUS_04870 8381 9454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 9544 9807 gene locus_tag LOCUS_04880 gene rpsT 9544 9807 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A7U7 protein_id gnl|my_center|LOCUS_04880 10381 9860 gene locus_tag LOCUS_04890 10381 9860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 10491 12068 gene locus_tag LOCUS_04900 10491 12068 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061266.1 protein_id gnl|my_center|LOCUS_04900 12550 12065 gene locus_tag LOCUS_04910 12550 12065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 13047 12547 gene locus_tag LOCUS_04920 13047 12547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 13347 13769 gene locus_tag LOCUS_04930 gene rplM 13347 13769 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3Y121 protein_id gnl|my_center|LOCUS_04930 13784 14179 gene locus_tag LOCUS_04940 gene rplI1 13784 14179 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGH8 protein_id gnl|my_center|LOCUS_04940 14286 15473 gene locus_tag LOCUS_04950 gene argJ 14286 15473 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P62061 protein_id gnl|my_center|LOCUS_04950 15482 16354 gene locus_tag LOCUS_04960 gene argB 15482 16354 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQZ8 protein_id gnl|my_center|LOCUS_04960 16364 17605 gene locus_tag LOCUS_04970 gene argD 16364 17605 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG65 protein_id gnl|my_center|LOCUS_04970 17621 17971 gene locus_tag LOCUS_04980 17621 17971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964440.1 protein_id gnl|my_center|LOCUS_04980 17993 19195 gene locus_tag LOCUS_04990 gene argG 17993 19195 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59846 protein_id gnl|my_center|LOCUS_04990 19223 20140 gene locus_tag LOCUS_05000 19223 20140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 20177 21442 gene locus_tag LOCUS_05010 gene lysA 20177 21442 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020771.1 protein_id gnl|my_center|LOCUS_05010 21454 22326 gene locus_tag LOCUS_05020 gene dapA 21454 22326 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GT6 protein_id gnl|my_center|LOCUS_05020 22323 23135 gene locus_tag LOCUS_05030 gene dapB 22323 23135 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFP1 protein_id gnl|my_center|LOCUS_05030 23159 23899 gene locus_tag LOCUS_05040 23159 23899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 >Feature sequence018 1561 281 gene locus_tag LOCUS_05050 gene murC 1561 281 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F6L9 protein_id gnl|my_center|LOCUS_05050 2666 1551 gene locus_tag LOCUS_05060 gene murG 2666 1551 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU4 protein_id gnl|my_center|LOCUS_05060 3523 2666 gene locus_tag LOCUS_05070 gene genX 3523 2666 CDS product EF-P lysine aminoacylase GenX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942397.1 protein_id gnl|my_center|LOCUS_05070 4095 3529 gene locus_tag LOCUS_05080 gene efp2 4095 3529 CDS product elongation factor P 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CC2 protein_id gnl|my_center|LOCUS_05080 4549 4169 gene locus_tag LOCUS_05090 4549 4169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 4656 5309 gene locus_tag LOCUS_05100 4656 5309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 6046 5306 gene locus_tag LOCUS_05110 6046 5306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121844.1 protein_id gnl|my_center|LOCUS_05110 6132 7631 gene locus_tag LOCUS_05120 gene cls-2 6132 7631 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943983.1 protein_id gnl|my_center|LOCUS_05120 7638 8774 gene locus_tag LOCUS_05130 7638 8774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 9536 8760 gene locus_tag LOCUS_05140 9536 8760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 10431 9541 gene locus_tag LOCUS_05150 gene folD 10431 9541 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIB4 protein_id gnl|my_center|LOCUS_05150 10755 10558 gene locus_tag LOCUS_05160 10755 10558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 12290 10842 gene locus_tag LOCUS_05170 gene gcvPB 12290 10842 CDS product glycine dehydrogenase (aminomethyl-transferring) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72C60 protein_id gnl|my_center|LOCUS_05170 13651 12287 gene locus_tag LOCUS_05180 gene gcvPA 13651 12287 CDS product putative glycine dehydrogenase (decarboxylating) subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72C59 protein_id gnl|my_center|LOCUS_05180 14721 13687 gene locus_tag LOCUS_05190 gene gcvT 14721 13687 CDS product glycine cleavage system T protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_010902.2 protein_id gnl|my_center|LOCUS_05190 14887 16590 gene locus_tag LOCUS_05200 gene cstA 14887 16590 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332193.1 protein_id gnl|my_center|LOCUS_05200 16647 17189 gene locus_tag LOCUS_05210 gene folE1 16647 17189 CDS product GTP cyclohydrolase 1 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYG8 protein_id gnl|my_center|LOCUS_05210 17194 17901 gene locus_tag LOCUS_05220 17194 17901 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888239.1 protein_id gnl|my_center|LOCUS_05220 18101 19462 gene locus_tag LOCUS_05230 18101 19462 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877378.1 protein_id gnl|my_center|LOCUS_05230 19878 19411 gene locus_tag LOCUS_05240 19878 19411 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036473.1 protein_id gnl|my_center|LOCUS_05240 20854 19868 gene locus_tag LOCUS_05250 20854 19868 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940306.1 protein_id gnl|my_center|LOCUS_05250 20963 21919 gene locus_tag LOCUS_05260 20963 21919 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545566.1 protein_id gnl|my_center|LOCUS_05260 22657 21923 gene locus_tag LOCUS_05270 22657 21923 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058012.1 protein_id gnl|my_center|LOCUS_05270 <23346 22654 gene locus_tag LOCUS_05280 <23346 22654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931864.1:FAD-linked oxidase >Feature sequence019 652 1413 gene locus_tag LOCUS_05290 652 1413 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97FH7 protein_id gnl|my_center|LOCUS_05290 1461 2102 gene locus_tag LOCUS_05300 1461 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 2178 3614 gene locus_tag LOCUS_05310 2178 3614 CDS product TIGR03663 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023977.1 protein_id gnl|my_center|LOCUS_05310 3671 4408 gene locus_tag LOCUS_05320 3671 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331802.1 protein_id gnl|my_center|LOCUS_05320 5697 4405 gene locus_tag LOCUS_05330 5697 4405 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_05330 5865 9065 gene locus_tag LOCUS_05340 gene lacZ 5865 9065 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56307 protein_id gnl|my_center|LOCUS_05340 10620 9172 gene locus_tag LOCUS_05350 10620 9172 CDS product L-fuculose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582815.1 protein_id gnl|my_center|LOCUS_05350 11897 10632 gene locus_tag LOCUS_05360 gene sorE 11897 10632 CDS product L-sorbose 1-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815633.1 protein_id gnl|my_center|LOCUS_05360 12982 11909 gene locus_tag LOCUS_05370 12982 11909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 14175 12979 gene locus_tag LOCUS_05380 14175 12979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 16648 14195 gene locus_tag LOCUS_05390 16648 14195 CDS product pyruvate dehydrogenase E1 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582808.1 protein_id gnl|my_center|LOCUS_05390 17916 16672 gene locus_tag LOCUS_05400 gene acoC 17916 16672 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HHW3 protein_id gnl|my_center|LOCUS_05400 18689 17931 gene locus_tag LOCUS_05410 18689 17931 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964739.1 protein_id gnl|my_center|LOCUS_05410 20622 18838 gene locus_tag LOCUS_05420 gene fucI 20622 18838 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZS4 protein_id gnl|my_center|LOCUS_05420 22773 20770 gene locus_tag LOCUS_05430 22773 20770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 >Feature sequence020 <1 1443 gene locus_tag LOCUS_05440 <1 1443 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202181.1:alpha-L-fucosidase 1534 1459 gene locus_tag LOCUS_t00100 1534 1459 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1714 2028 gene locus_tag LOCUS_05450 gene rplU 1714 2028 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9FD29 protein_id gnl|my_center|LOCUS_05450 2046 2300 gene locus_tag LOCUS_05460 gene rpmA 2046 2300 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPR5 protein_id gnl|my_center|LOCUS_05460 2388 3392 gene locus_tag LOCUS_05470 2388 3392 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460894.1 protein_id gnl|my_center|LOCUS_05470 4422 3412 gene locus_tag LOCUS_05480 gene trpD 4422 3412 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIT6 protein_id gnl|my_center|LOCUS_05480 4864 4508 gene locus_tag LOCUS_05490 gene rplT 4864 4508 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D01 protein_id gnl|my_center|LOCUS_05490 5068 4880 gene locus_tag LOCUS_05500 gene rpmI 5068 4880 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D02 protein_id gnl|my_center|LOCUS_05500 6121 5186 gene locus_tag LOCUS_05510 6121 5186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 6268 7617 gene locus_tag LOCUS_05520 gene thrC 6268 7617 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942338.1 protein_id gnl|my_center|LOCUS_05520 7645 8874 gene locus_tag LOCUS_05530 7645 8874 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087643.1 protein_id gnl|my_center|LOCUS_05530 8904 10052 gene locus_tag LOCUS_05540 8904 10052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 10064 10852 gene locus_tag LOCUS_05550 gene ttg2B 10064 10852 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147518.1 protein_id gnl|my_center|LOCUS_05550 10849 11583 gene locus_tag LOCUS_05560 gene ttg2A 10849 11583 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433117.1 protein_id gnl|my_center|LOCUS_05560 11604 12533 gene locus_tag LOCUS_05570 11604 12533 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942544.1 protein_id gnl|my_center|LOCUS_05570 13899 12535 gene locus_tag LOCUS_05580 13899 12535 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682344.1 protein_id gnl|my_center|LOCUS_05580 13962 15515 gene locus_tag LOCUS_05590 13962 15515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 16798 15530 gene locus_tag LOCUS_05600 gene clpX 16798 15530 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NDN9 protein_id gnl|my_center|LOCUS_05600 17408 16806 gene locus_tag LOCUS_05610 gene clpP 17408 16806 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1BA83 protein_id gnl|my_center|LOCUS_05610 18794 17496 gene locus_tag LOCUS_05620 gene tig 18794 17496 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CNY4 protein_id gnl|my_center|LOCUS_05620 19840 18869 gene locus_tag LOCUS_05630 19840 18869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 19979 20995 gene locus_tag LOCUS_05640 19979 20995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 20979 21794 gene locus_tag LOCUS_05650 20979 21794 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816814.1 protein_id gnl|my_center|LOCUS_05650 22033 21782 gene locus_tag LOCUS_05660 22033 21782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 22082 22645 gene locus_tag LOCUS_05670 gene ahpC 22082 22645 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071237.1 protein_id gnl|my_center|LOCUS_05670 >Feature sequence021 <1 899 gene locus_tag LOCUS_05680 <1 899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946695.1:peptide ABC transporter permease 896 1786 gene locus_tag LOCUS_05690 896 1786 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868768.1 protein_id gnl|my_center|LOCUS_05690 1786 2592 gene locus_tag LOCUS_05700 1786 2592 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289492.1 protein_id gnl|my_center|LOCUS_05700 2579 3343 gene locus_tag LOCUS_05710 2579 3343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05710 4038 3340 gene locus_tag LOCUS_05720 gene rnc 4038 3340 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EXX3 protein_id gnl|my_center|LOCUS_05720 4922 4038 gene locus_tag LOCUS_05730 4922 4038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 5189 5764 gene locus_tag LOCUS_05740 5189 5764 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460653.1 protein_id gnl|my_center|LOCUS_05740 5850 6566 gene locus_tag LOCUS_05750 5850 6566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883163.1 protein_id gnl|my_center|LOCUS_05750 7903 6914 gene locus_tag LOCUS_05760 7903 6914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932494.1 protein_id gnl|my_center|LOCUS_05760 7992 9467 gene locus_tag LOCUS_05770 7992 9467 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5F2 protein_id gnl|my_center|LOCUS_05770 9469 10665 gene locus_tag LOCUS_05780 9469 10665 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056455.1 protein_id gnl|my_center|LOCUS_05780 10711 11040 gene locus_tag LOCUS_05790 10711 11040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 11058 12278 gene locus_tag LOCUS_05800 gene aspC 11058 12278 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121115.1 protein_id gnl|my_center|LOCUS_05800 12306 13598 gene locus_tag LOCUS_05810 gene kdtA 12306 13598 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_05810 13940 14860 gene locus_tag LOCUS_05820 13940 14860 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937909.1 protein_id gnl|my_center|LOCUS_05820 14874 16301 gene locus_tag LOCUS_05830 gene ahcY 14874 16301 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNQ7 protein_id gnl|my_center|LOCUS_05830 17763 16276 gene locus_tag LOCUS_05840 gene pepA 17763 16276 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJQ9 protein_id gnl|my_center|LOCUS_05840 18107 17763 gene locus_tag LOCUS_05850 18107 17763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 20274 18097 gene locus_tag LOCUS_05860 20274 18097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 20510 22339 gene locus_tag LOCUS_05870 gene sigA 20510 22339 CDS product RNA polymerase sigma factor SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P18333 protein_id gnl|my_center|LOCUS_05870 >Feature sequence022 437 240 gene locus_tag LOCUS_05880 437 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 802 533 gene locus_tag LOCUS_05890 802 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 4016 1485 gene locus_tag LOCUS_05900 4016 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 5910 4141 gene locus_tag LOCUS_05910 5910 4141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 7024 6512 gene locus_tag LOCUS_05920 7024 6512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 8088 7126 gene locus_tag LOCUS_05930 8088 7126 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123934.1 protein_id gnl|my_center|LOCUS_05930 8371 9024 gene locus_tag LOCUS_05940 8371 9024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 9054 10112 gene locus_tag LOCUS_05950 9054 10112 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_05950 10430 11857 gene locus_tag LOCUS_05960 10430 11857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 12511 13701 gene locus_tag LOCUS_05970 12511 13701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 13779 15173 gene locus_tag LOCUS_05980 13779 15173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142012.1 protein_id gnl|my_center|LOCUS_05980 15214 15885 gene locus_tag LOCUS_05990 15214 15885 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057606.1 protein_id gnl|my_center|LOCUS_05990 15882 17102 gene locus_tag LOCUS_06000 15882 17102 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173094.1 protein_id gnl|my_center|LOCUS_06000 17355 17092 gene locus_tag LOCUS_06010 17355 17092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 17508 18275 gene locus_tag LOCUS_06020 17508 18275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 >Feature sequence023 414 872 gene locus_tag LOCUS_06030 gene vanY 414 872 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023254.1 protein_id gnl|my_center|LOCUS_06030 904 1785 gene locus_tag LOCUS_06040 904 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 1775 2770 gene locus_tag LOCUS_06050 1775 2770 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028250.1 protein_id gnl|my_center|LOCUS_06050 2861 4396 gene locus_tag LOCUS_06060 2861 4396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 4804 5229 gene locus_tag LOCUS_06070 4804 5229 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070455.1 protein_id gnl|my_center|LOCUS_06070 6422 5226 gene locus_tag LOCUS_06080 gene gltX 6422 5226 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7C5 protein_id gnl|my_center|LOCUS_06080 6708 9077 gene locus_tag LOCUS_06090 6708 9077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121107.1 protein_id gnl|my_center|LOCUS_06090 9089 10345 gene locus_tag LOCUS_06100 9089 10345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327912.1 protein_id gnl|my_center|LOCUS_06100 10342 11457 gene locus_tag LOCUS_06110 10342 11457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782250.1 protein_id gnl|my_center|LOCUS_06110 11464 14532 gene locus_tag LOCUS_06120 11464 14532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 14586 15329 gene locus_tag LOCUS_06130 14586 15329 CDS product dolichyl-phosphate beta-D-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_06130 16147 15305 gene locus_tag LOCUS_06140 gene rsmA 16147 15305 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73NS2 protein_id gnl|my_center|LOCUS_06140 17088 16144 gene locus_tag LOCUS_06150 gene pdxA 17088 16144 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3V8D3 protein_id gnl|my_center|LOCUS_06150 18195 17170 gene locus_tag LOCUS_06160 gene glnII 18195 17170 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KM78 protein_id gnl|my_center|LOCUS_06160 >Feature sequence024 1520 33 gene locus_tag LOCUS_06170 gene gltD 1520 33 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330518.1 protein_id gnl|my_center|LOCUS_06170 6149 1536 gene locus_tag LOCUS_06180 gene gltB 6149 1536 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262574.1 protein_id gnl|my_center|LOCUS_06180 6705 6307 gene locus_tag LOCUS_06190 6705 6307 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933794.1 protein_id gnl|my_center|LOCUS_06190 7793 6702 gene locus_tag LOCUS_06200 gene rsgA 7793 6702 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q729X9 protein_id gnl|my_center|LOCUS_06200 8422 7778 gene locus_tag LOCUS_06210 8422 7778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 8505 9026 gene locus_tag LOCUS_06220 gene apt 8505 9026 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCV7 protein_id gnl|my_center|LOCUS_06220 9667 9083 gene locus_tag LOCUS_06230 9667 9083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 10673 10095 gene locus_tag LOCUS_06240 10673 10095 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404799.1 protein_id gnl|my_center|LOCUS_06240 13279 10685 gene locus_tag LOCUS_06250 gene alaS 13279 10685 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG04 protein_id gnl|my_center|LOCUS_06250 15190 13364 gene locus_tag LOCUS_06260 15190 13364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 15789 15232 gene locus_tag LOCUS_06270 15789 15232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 15925 17337 gene locus_tag LOCUS_06280 15925 17337 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MR8 protein_id gnl|my_center|LOCUS_06280 17685 17368 gene locus_tag LOCUS_06290 17685 17368 CDS product UPF0345 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7H3 protein_id gnl|my_center|LOCUS_06290 <18336 17688 gene locus_tag LOCUS_06300 <18336 17688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WHM1:aconitate hydratase >Feature sequence025 321 2207 gene locus_tag LOCUS_06310 gene mnmG 321 2207 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Q4 protein_id gnl|my_center|LOCUS_06310 3305 2199 gene locus_tag LOCUS_06320 3305 2199 CDS product carotenoid 1,2-hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404080.1 protein_id gnl|my_center|LOCUS_06320 5914 3308 gene locus_tag LOCUS_06330 5914 3308 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255972.1 protein_id gnl|my_center|LOCUS_06330 6605 5928 gene locus_tag LOCUS_06340 6605 5928 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404083.1 protein_id gnl|my_center|LOCUS_06340 6749 6824 gene locus_tag LOCUS_t00110 6749 6824 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 7344 7171 gene locus_tag LOCUS_06350 7344 7171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 8009 7494 gene locus_tag LOCUS_06360 8009 7494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022236.1 protein_id gnl|my_center|LOCUS_06360 8244 7960 gene locus_tag LOCUS_06370 8244 7960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 8606 8908 gene locus_tag LOCUS_06380 8606 8908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124810.1 protein_id gnl|my_center|LOCUS_06380 9304 10770 gene locus_tag LOCUS_06390 9304 10770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 11895 10801 gene locus_tag LOCUS_06400 11895 10801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 11992 12531 gene locus_tag LOCUS_06410 11992 12531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 13148 12525 gene locus_tag LOCUS_06420 13148 12525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 14104 13154 gene locus_tag LOCUS_06430 14104 13154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 14948 14097 gene locus_tag LOCUS_06440 14948 14097 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_06440 15813 14935 gene locus_tag LOCUS_06450 15813 14935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 16601 15810 gene locus_tag LOCUS_06460 16601 15810 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257270.1 protein_id gnl|my_center|LOCUS_06460 17875 16598 gene locus_tag LOCUS_06470 17875 16598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 >Feature sequence026 45 1517 gene locus_tag LOCUS_06480 gene ilvC 45 1517 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TN4 protein_id gnl|my_center|LOCUS_06480 1732 1568 gene locus_tag LOCUS_06490 1732 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 1944 1868 gene locus_tag LOCUS_t00120 1944 1868 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 3273 2017 gene locus_tag LOCUS_06500 gene proA 3273 2017 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKZ6 protein_id gnl|my_center|LOCUS_06500 4382 3288 gene locus_tag LOCUS_06510 gene proB 4382 3288 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKZ7 protein_id gnl|my_center|LOCUS_06510 4497 5048 gene locus_tag LOCUS_06520 4497 5048 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223682.1 protein_id gnl|my_center|LOCUS_06520 5045 5527 gene locus_tag LOCUS_06530 gene coaD 5045 5527 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8I0 protein_id gnl|my_center|LOCUS_06530 6274 5528 gene locus_tag LOCUS_06540 gene znuB 6274 5528 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070906.1 protein_id gnl|my_center|LOCUS_06540 7169 6264 gene locus_tag LOCUS_06550 gene znuA 7169 6264 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070905.1 protein_id gnl|my_center|LOCUS_06550 8524 7184 gene locus_tag LOCUS_06560 8524 7184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478317.1 protein_id gnl|my_center|LOCUS_06560 8644 8946 gene locus_tag LOCUS_06570 8644 8946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 9054 9320 gene locus_tag LOCUS_06580 9054 9320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 9516 9607 gene locus_tag LOCUS_t00130 9516 9607 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9651 9965 gene locus_tag LOCUS_06590 9651 9965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 9988 10833 gene locus_tag LOCUS_06600 9988 10833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 11179 10838 gene locus_tag LOCUS_06610 11179 10838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 13163 11217 gene locus_tag LOCUS_06620 gene ftsH-2 13163 11217 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C66 protein_id gnl|my_center|LOCUS_06620 14749 13454 gene locus_tag LOCUS_06630 gene tilS 14749 13454 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C65 protein_id gnl|my_center|LOCUS_06630 17791 14762 gene locus_tag LOCUS_06640 gene secA 17791 14762 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z765 protein_id gnl|my_center|LOCUS_06640 >Feature sequence027 778 332 gene locus_tag LOCUS_06650 778 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 2492 840 gene locus_tag LOCUS_06660 gene gpmI 2492 840 CDS product putative 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59173 protein_id gnl|my_center|LOCUS_06660 3241 2564 gene locus_tag LOCUS_06670 3241 2564 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403642.1 protein_id gnl|my_center|LOCUS_06670 4971 3244 gene locus_tag LOCUS_06680 4971 3244 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108753.1 protein_id gnl|my_center|LOCUS_06680 5480 5914 gene locus_tag LOCUS_06690 5480 5914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403898.1 protein_id gnl|my_center|LOCUS_06690 7527 5911 gene locus_tag LOCUS_06700 7527 5911 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/inosine monophosphate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023907.1 protein_id gnl|my_center|LOCUS_06700 8199 7597 gene locus_tag LOCUS_06710 8199 7597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 9123 8263 gene locus_tag LOCUS_06720 gene nadK 9123 8263 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ34 protein_id gnl|my_center|LOCUS_06720 9365 9949 gene locus_tag LOCUS_06730 9365 9949 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194486.1 protein_id gnl|my_center|LOCUS_06730 9943 10197 gene locus_tag LOCUS_06740 9943 10197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 10194 11048 gene locus_tag LOCUS_06750 gene desC 10194 11048 CDS product stearoyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207178.1 protein_id gnl|my_center|LOCUS_06750 11045 11848 gene locus_tag LOCUS_06760 11045 11848 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036519.1 protein_id gnl|my_center|LOCUS_06760 11901 12923 gene locus_tag LOCUS_06770 11901 12923 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942955.1 protein_id gnl|my_center|LOCUS_06770 12935 13501 gene locus_tag LOCUS_06780 12935 13501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 13566 14075 gene locus_tag LOCUS_06790 gene basA 13566 14075 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DR82 protein_id gnl|my_center|LOCUS_06790 14150 15415 gene locus_tag LOCUS_06800 14150 15415 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768840.1 protein_id gnl|my_center|LOCUS_06800 15412 16161 gene locus_tag LOCUS_06810 15412 16161 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406949.1 protein_id gnl|my_center|LOCUS_06810 >Feature sequence028 3 386 gene locus_tag LOCUS_06820 3 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 418 1269 gene locus_tag LOCUS_06830 gene accD 418 1269 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VC83 protein_id gnl|my_center|LOCUS_06830 1266 2549 gene locus_tag LOCUS_06840 gene folC 1266 2549 CDS product folylpolyglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q05865 protein_id gnl|my_center|LOCUS_06840 3042 2566 gene locus_tag LOCUS_06850 3042 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 3306 3103 gene locus_tag LOCUS_06860 3306 3103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 3527 4555 gene locus_tag LOCUS_06870 gene aroB 3527 4555 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RI75 protein_id gnl|my_center|LOCUS_06870 4555 5682 gene locus_tag LOCUS_06880 4555 5682 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392539.1 protein_id gnl|my_center|LOCUS_06880 5687 8239 gene locus_tag LOCUS_06890 5687 8239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 8240 9205 gene locus_tag LOCUS_06900 gene xerC 8240 9205 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQY6 protein_id gnl|my_center|LOCUS_06900 10078 12585 gene locus_tag LOCUS_06910 10078 12585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 12842 14185 gene locus_tag LOCUS_06920 12842 14185 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966721.1 protein_id gnl|my_center|LOCUS_06920 14252 15742 gene locus_tag LOCUS_06930 14252 15742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 >Feature sequence029 492 31 gene locus_tag LOCUS_06940 492 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 2713 449 gene locus_tag LOCUS_06950 2713 449 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721972.1 protein_id gnl|my_center|LOCUS_06950 3681 2725 gene locus_tag LOCUS_06960 3681 2725 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_06960 4956 3811 gene locus_tag LOCUS_06970 gene rlmL 4956 3811 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943707.1 protein_id gnl|my_center|LOCUS_06970 5309 4953 gene locus_tag LOCUS_06980 5309 4953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 5649 8840 gene locus_tag LOCUS_06990 5649 8840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 9661 8846 gene locus_tag LOCUS_07000 gene kdsA 9661 8846 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61655 protein_id gnl|my_center|LOCUS_07000 10410 9658 gene locus_tag LOCUS_07010 gene kdsB 10410 9658 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BY2 protein_id gnl|my_center|LOCUS_07010 10877 10407 gene locus_tag LOCUS_07020 10877 10407 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942329.1 protein_id gnl|my_center|LOCUS_07020 10974 12005 gene locus_tag LOCUS_07030 10974 12005 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932014.1 protein_id gnl|my_center|LOCUS_07030 11999 12580 gene locus_tag LOCUS_07040 11999 12580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 12715 14421 gene locus_tag LOCUS_07050 gene ptfA 12715 14421 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336551.1 protein_id gnl|my_center|LOCUS_07050 15929 14535 gene locus_tag LOCUS_07060 15929 14535 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947330.1 protein_id gnl|my_center|LOCUS_07060 >Feature sequence030 361 274 gene locus_tag LOCUS_t00140 361 274 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 518 1015 gene locus_tag LOCUS_07070 518 1015 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313806.1 protein_id gnl|my_center|LOCUS_07070 1012 1557 gene locus_tag LOCUS_07080 gene rfaH 1012 1557 CDS product transcription antitermination protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZI5 protein_id gnl|my_center|LOCUS_07080 1675 3513 gene locus_tag LOCUS_07090 gene glmS 1675 3513 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG38 protein_id gnl|my_center|LOCUS_07090 3516 4379 gene locus_tag LOCUS_07100 gene cysQ 3516 4379 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880167.1 protein_id gnl|my_center|LOCUS_07100 4445 5347 gene locus_tag LOCUS_07110 gene cysD 4445 5347 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGW0 protein_id gnl|my_center|LOCUS_07110 5347 7311 gene locus_tag LOCUS_07120 gene cysNC 5347 7311 CDS product bifunctional enzyme CysN/CysC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMW2 protein_id gnl|my_center|LOCUS_07120 7544 8431 gene locus_tag LOCUS_07130 7544 8431 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EP17 protein_id gnl|my_center|LOCUS_07130 8533 9273 gene locus_tag LOCUS_07140 8533 9273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 9321 10310 gene locus_tag LOCUS_07150 9321 10310 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706682.1 protein_id gnl|my_center|LOCUS_07150 10320 11372 gene locus_tag LOCUS_07160 gene gmd 10320 11372 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZ92 protein_id gnl|my_center|LOCUS_07160 11819 12781 gene locus_tag LOCUS_07170 gene wcaG 11819 12781 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F5U0 protein_id gnl|my_center|LOCUS_07170 12837 14195 gene locus_tag LOCUS_07180 12837 14195 CDS product coenzyme F420 hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975144.1 protein_id gnl|my_center|LOCUS_07180 15100 15537 gene locus_tag LOCUS_07190 15100 15537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 >Feature sequence031 182 2386 gene locus_tag LOCUS_07200 182 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 2598 4004 gene locus_tag LOCUS_07210 2598 4004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 4202 5839 gene locus_tag LOCUS_07220 4202 5839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 6155 7273 gene locus_tag LOCUS_07230 6155 7273 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144234.1 protein_id gnl|my_center|LOCUS_07230 7273 8982 gene locus_tag LOCUS_07240 7273 8982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 8984 10474 gene locus_tag LOCUS_07250 8984 10474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 10509 11462 gene locus_tag LOCUS_07260 10509 11462 CDS product glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080062.1 protein_id gnl|my_center|LOCUS_07260 11933 11857 gene locus_tag LOCUS_t00150 11933 11857 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 12027 12971 gene locus_tag LOCUS_07270 12027 12971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 13014 14120 gene locus_tag LOCUS_07280 13014 14120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063795.1 protein_id gnl|my_center|LOCUS_07280 14175 14251 gene locus_tag LOCUS_t00160 14175 14251 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 14596 14372 gene locus_tag LOCUS_07290 14596 14372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 >Feature sequence032 <1 2009 gene locus_tag LOCUS_07300 <1 2009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WCA1:DNA ligase 2019 2468 gene locus_tag LOCUS_07310 2019 2468 CDS product beta-D-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964154.1 protein_id gnl|my_center|LOCUS_07310 4780 2465 gene locus_tag LOCUS_07320 gene yaeT 4780 2465 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AT3 protein_id gnl|my_center|LOCUS_07320 6164 4788 gene locus_tag LOCUS_07330 gene dnaB 6164 4788 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DH0 protein_id gnl|my_center|LOCUS_07330 6616 6164 gene locus_tag LOCUS_07340 gene rplI 6616 6164 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FE1 protein_id gnl|my_center|LOCUS_07340 6838 6626 gene locus_tag LOCUS_07350 6838 6626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 7296 6868 gene locus_tag LOCUS_07360 7296 6868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 7644 7300 gene locus_tag LOCUS_07370 7644 7300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 8240 7656 gene locus_tag LOCUS_07380 gene pth 8240 7656 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97E97 protein_id gnl|my_center|LOCUS_07380 8886 8254 gene locus_tag LOCUS_07390 gene rplY 8886 8254 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMC2 protein_id gnl|my_center|LOCUS_07390 9834 8896 gene locus_tag LOCUS_07400 gene prs 9834 8896 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG56 protein_id gnl|my_center|LOCUS_07400 9925 9852 gene locus_tag LOCUS_t00170 9925 9852 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 10189 10034 gene locus_tag LOCUS_07410 10189 10034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 11601 10222 gene locus_tag LOCUS_07420 gene argH 11601 10222 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z15 protein_id gnl|my_center|LOCUS_07420 12106 11654 gene locus_tag LOCUS_07430 gene dtd 12106 11654 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZI9 protein_id gnl|my_center|LOCUS_07430 13833 12109 gene locus_tag LOCUS_07440 13833 12109 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082593.1 protein_id gnl|my_center|LOCUS_07440 >Feature sequence033 337 1509 gene locus_tag LOCUS_07450 337 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 1862 2842 gene locus_tag LOCUS_07460 1862 2842 CDS product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582687.1 protein_id gnl|my_center|LOCUS_07460 2839 4365 gene locus_tag LOCUS_07470 gene ids 2839 4365 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123097.1 protein_id gnl|my_center|LOCUS_07470 5165 4332 gene locus_tag LOCUS_07480 5165 4332 CDS product kappa-carrageenase [precursor] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118992.1 protein_id gnl|my_center|LOCUS_07480 5346 6782 gene locus_tag LOCUS_07490 gene fucA 5346 6782 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120626.1 protein_id gnl|my_center|LOCUS_07490 8314 6779 gene locus_tag LOCUS_07500 8314 6779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 10045 8351 gene locus_tag LOCUS_07510 10045 8351 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120369.1 protein_id gnl|my_center|LOCUS_07510 10961 10125 gene locus_tag LOCUS_07520 10961 10125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 11737 10979 gene locus_tag LOCUS_07530 11737 10979 CDS product sucrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120367.1 protein_id gnl|my_center|LOCUS_07530 11934 11734 gene locus_tag LOCUS_07540 11934 11734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 12282 12893 gene locus_tag LOCUS_07550 12282 12893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 12913 14697 gene locus_tag LOCUS_07560 12913 14697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 >Feature sequence034 983 489 gene locus_tag LOCUS_07570 983 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 1424 1041 gene locus_tag LOCUS_07580 1424 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 1529 2473 gene locus_tag LOCUS_07590 gene rnhC 1529 2473 CDS product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z6J1 protein_id gnl|my_center|LOCUS_07590 2906 2463 gene locus_tag LOCUS_07600 2906 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 3337 2906 gene locus_tag LOCUS_07610 3337 2906 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119077.1 protein_id gnl|my_center|LOCUS_07610 4066 3338 gene locus_tag LOCUS_07620 4066 3338 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404334.1 protein_id gnl|my_center|LOCUS_07620 4891 4106 gene locus_tag LOCUS_07630 4891 4106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 7704 4888 gene locus_tag LOCUS_07640 7704 4888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404331.1 protein_id gnl|my_center|LOCUS_07640 7863 8069 gene locus_tag LOCUS_07650 gene rpmE 7863 8069 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73MK4 protein_id gnl|my_center|LOCUS_07650 8145 9248 gene locus_tag LOCUS_07660 gene prfA 8145 9248 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73JU6 protein_id gnl|my_center|LOCUS_07660 9279 10892 gene locus_tag LOCUS_07670 gene nadB 9279 10892 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C48 protein_id gnl|my_center|LOCUS_07670 11522 10893 gene locus_tag LOCUS_07680 11522 10893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 11903 11658 gene locus_tag LOCUS_07690 11903 11658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 12584 11907 gene locus_tag LOCUS_07700 12584 11907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 13039 12584 gene locus_tag LOCUS_07710 13039 12584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 13664 13032 gene locus_tag LOCUS_07720 13664 13032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 >Feature sequence035 2519 1593 gene locus_tag LOCUS_07730 2519 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 3382 2597 gene locus_tag LOCUS_07740 3382 2597 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129903.1 protein_id gnl|my_center|LOCUS_07740 4307 3375 gene locus_tag LOCUS_07750 4307 3375 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170714.1 protein_id gnl|my_center|LOCUS_07750 4887 4300 gene locus_tag LOCUS_07760 4887 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 6881 5796 gene locus_tag LOCUS_07770 6881 5796 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391123.1 protein_id gnl|my_center|LOCUS_07770 6982 8787 gene locus_tag LOCUS_07780 gene msbA 6982 8787 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_07780 9713 8784 gene locus_tag LOCUS_07790 9713 8784 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207641.1 protein_id gnl|my_center|LOCUS_07790 10615 9710 gene locus_tag LOCUS_07800 gene msbB 10615 9710 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316336.1 protein_id gnl|my_center|LOCUS_07800 10726 10802 gene locus_tag LOCUS_t00180 10726 10802 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 11489 10803 gene locus_tag LOCUS_07810 11489 10803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 <14682 11531 gene locus_tag LOCUS_07820 <14682 11531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to G5EBD4:chromosome partition protein Smc >Feature sequence036 77 571 gene locus_tag LOCUS_07830 77 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 580 810 gene locus_tag LOCUS_07840 580 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 803 1228 gene locus_tag LOCUS_07850 803 1228 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979519.1 protein_id gnl|my_center|LOCUS_07850 1221 1598 gene locus_tag LOCUS_07860 1221 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 1717 4239 gene locus_tag LOCUS_07870 gene leuS 1717 4239 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WY15 protein_id gnl|my_center|LOCUS_07870 4249 4878 gene locus_tag LOCUS_07880 4249 4878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 5083 4904 gene locus_tag LOCUS_07890 5083 4904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 5620 5123 gene locus_tag LOCUS_07900 5620 5123 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249819.1 protein_id gnl|my_center|LOCUS_07900 5695 6792 gene locus_tag LOCUS_07910 5695 6792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 6805 7479 gene locus_tag LOCUS_07920 gene yggS 6805 7479 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_07920 7476 8267 gene locus_tag LOCUS_07930 gene proC 7476 8267 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22008 protein_id gnl|my_center|LOCUS_07930 8423 8499 gene locus_tag LOCUS_t00190 8423 8499 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 8688 8503 gene locus_tag LOCUS_07940 8688 8503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 8732 9109 gene locus_tag LOCUS_07950 8732 9109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 10398 9106 gene locus_tag LOCUS_07960 gene rsmB 10398 9106 CDS product tRNA/rRNA cytosine-C5-methylase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071740.1 protein_id gnl|my_center|LOCUS_07960 10529 11725 gene locus_tag LOCUS_07970 gene aspC 10529 11725 CDS product aromatic amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706588.1 protein_id gnl|my_center|LOCUS_07970 11735 11911 gene locus_tag LOCUS_07980 11735 11911 CDS product Rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKT9 protein_id gnl|my_center|LOCUS_07980 12336 11941 gene locus_tag LOCUS_07990 12336 11941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 >Feature sequence037 1948 5 gene locus_tag LOCUS_08000 1948 5 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZU4 protein_id gnl|my_center|LOCUS_08000 3256 1985 gene locus_tag LOCUS_08010 gene rsmB 3256 1985 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Z4 protein_id gnl|my_center|LOCUS_08010 4350 3253 gene locus_tag LOCUS_08020 4350 3253 CDS product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583661.1 protein_id gnl|my_center|LOCUS_08020 4581 4351 gene locus_tag LOCUS_08030 gene xseB 4581 4351 CDS product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYU6 protein_id gnl|my_center|LOCUS_08030 5951 4602 gene locus_tag LOCUS_08040 gene xseA 5951 4602 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z4Q1 protein_id gnl|my_center|LOCUS_08040 6742 5954 gene locus_tag LOCUS_08050 6742 5954 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_08050 7145 6879 gene locus_tag LOCUS_08060 7145 6879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 8293 7163 gene locus_tag LOCUS_08070 gene nrdB 8293 7163 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43755 protein_id gnl|my_center|LOCUS_08070 10597 8333 gene locus_tag LOCUS_08080 gene nrdA 10597 8333 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JL92 protein_id gnl|my_center|LOCUS_08080 10983 11059 gene locus_tag LOCUS_t00200 10983 11059 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 12192 11278 gene locus_tag LOCUS_08090 12192 11278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 13756 12497 gene locus_tag LOCUS_08100 13756 12497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119734.1 protein_id gnl|my_center|LOCUS_08100 >Feature sequence038 226 1095 gene locus_tag LOCUS_08110 gene lipA 226 1095 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q816A0 protein_id gnl|my_center|LOCUS_08110 1114 1800 gene locus_tag LOCUS_08120 1114 1800 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940919.1 protein_id gnl|my_center|LOCUS_08120 2720 1797 gene locus_tag LOCUS_08130 2720 1797 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071604.1 protein_id gnl|my_center|LOCUS_08130 2805 3053 gene locus_tag LOCUS_08140 2805 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 3098 4531 gene locus_tag LOCUS_08150 3098 4531 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941700.1 protein_id gnl|my_center|LOCUS_08150 4602 6554 gene locus_tag LOCUS_08160 gene acsA2 4602 6554 CDS product acetyl-coenzyme A synthetase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV66 protein_id gnl|my_center|LOCUS_08160 6627 6848 gene locus_tag LOCUS_08170 gene infA 6627 6848 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20458 protein_id gnl|my_center|LOCUS_08170 7002 6850 gene locus_tag LOCUS_08180 7002 6850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 8684 6999 gene locus_tag LOCUS_08190 8684 6999 CDS product symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198012.1 protein_id gnl|my_center|LOCUS_08190 9344 8769 gene locus_tag LOCUS_08200 gene purN 9344 8769 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CB5 protein_id gnl|my_center|LOCUS_08200 9415 9852 gene locus_tag LOCUS_08210 9415 9852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 9859 10608 gene locus_tag LOCUS_08220 9859 10608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816793.1 protein_id gnl|my_center|LOCUS_08220 10610 11902 gene locus_tag LOCUS_08230 10610 11902 CDS product UPF0272 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFJ5 protein_id gnl|my_center|LOCUS_08230 11899 13443 gene locus_tag LOCUS_08240 11899 13443 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122594.1 protein_id gnl|my_center|LOCUS_08240 >Feature sequence039 1121 618 gene locus_tag LOCUS_08250 gene folK 1121 618 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C0G3 protein_id gnl|my_center|LOCUS_08250 1908 1105 gene locus_tag LOCUS_08260 1908 1105 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878250.1 protein_id gnl|my_center|LOCUS_08260 3444 1993 gene locus_tag LOCUS_08270 3444 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 5267 3471 gene locus_tag LOCUS_08280 gene pycB 5267 3471 CDS product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858311.1 protein_id gnl|my_center|LOCUS_08280 5518 5291 gene locus_tag LOCUS_08290 5518 5291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 5631 6365 gene locus_tag LOCUS_08300 5631 6365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 6362 6808 gene locus_tag LOCUS_08310 6362 6808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 6887 7258 gene locus_tag LOCUS_08320 gene rbfA 6887 7258 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4J2 protein_id gnl|my_center|LOCUS_08320 7255 7980 gene locus_tag LOCUS_08330 7255 7980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 7977 8921 gene locus_tag LOCUS_08340 gene ribF 7977 8921 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM3 protein_id gnl|my_center|LOCUS_08340 9166 8918 gene locus_tag LOCUS_08350 9166 8918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 9362 10639 gene locus_tag LOCUS_08360 9362 10639 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462314.1 protein_id gnl|my_center|LOCUS_08360 10636 11379 gene locus_tag LOCUS_08370 10636 11379 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460415.1 protein_id gnl|my_center|LOCUS_08370 11379 12248 gene locus_tag LOCUS_08380 11379 12248 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAG4 protein_id gnl|my_center|LOCUS_08380 12267 13640 gene locus_tag LOCUS_08390 12267 13640 CDS product putative zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67776 protein_id gnl|my_center|LOCUS_08390 >Feature sequence040 699 1724 gene locus_tag LOCUS_08400 gene queA 699 1724 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I6F0 protein_id gnl|my_center|LOCUS_08400 2260 1736 gene locus_tag LOCUS_08410 2260 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08410 2581 2276 gene locus_tag LOCUS_08420 2581 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08420 2830 4686 gene locus_tag LOCUS_08430 gene htpG 2830 4686 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61185 protein_id gnl|my_center|LOCUS_08430 5312 4683 gene locus_tag LOCUS_08440 5312 4683 CDS product hydrolase phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123566.1 protein_id gnl|my_center|LOCUS_08440 6090 5359 gene locus_tag LOCUS_08450 6090 5359 CDS product RNA pseudouridylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930119.1 protein_id gnl|my_center|LOCUS_08450 7546 6095 gene locus_tag LOCUS_08460 7546 6095 CDS product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870209.1 protein_id gnl|my_center|LOCUS_08460 8893 7550 gene locus_tag LOCUS_08470 8893 7550 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459869.1 protein_id gnl|my_center|LOCUS_08470 10415 9069 gene locus_tag LOCUS_08480 10415 9069 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_08480 10912 10427 gene locus_tag LOCUS_08490 10912 10427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08490 11802 10909 gene locus_tag LOCUS_08500 11802 10909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08500 >Feature sequence041 551 2017 gene locus_tag LOCUS_08510 551 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122583.1 protein_id gnl|my_center|LOCUS_08510 2008 2964 gene locus_tag LOCUS_08520 2008 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057009.1 protein_id gnl|my_center|LOCUS_08520 2969 6310 gene locus_tag LOCUS_08530 2969 6310 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266501.1 protein_id gnl|my_center|LOCUS_08530 6323 8845 gene locus_tag LOCUS_08540 6323 8845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266502.1 protein_id gnl|my_center|LOCUS_08540 8842 9744 gene locus_tag LOCUS_08550 8842 9744 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390313.1 protein_id gnl|my_center|LOCUS_08550 9895 10959 gene locus_tag LOCUS_08560 9895 10959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 11052 11915 gene locus_tag LOCUS_08570 11052 11915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461868.1 protein_id gnl|my_center|LOCUS_08570 12019 12831 gene locus_tag LOCUS_08580 12019 12831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 13453 12884 gene locus_tag LOCUS_08590 13453 12884 CDS product putative quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4C8 protein_id gnl|my_center|LOCUS_08590 13703 13627 gene locus_tag LOCUS_t00210 13703 13627 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence042 1608 214 gene locus_tag LOCUS_08600 1608 214 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K440 protein_id gnl|my_center|LOCUS_08600 2905 1634 gene locus_tag LOCUS_08610 2905 1634 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202170.1 protein_id gnl|my_center|LOCUS_08610 4583 2997 gene locus_tag LOCUS_08620 4583 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 5537 4698 gene locus_tag LOCUS_08630 5537 4698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 7121 5550 gene locus_tag LOCUS_08640 7121 5550 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803772.1 protein_id gnl|my_center|LOCUS_08640 9380 7131 gene locus_tag LOCUS_08650 9380 7131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 11851 9380 gene locus_tag LOCUS_08660 11851 9380 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082399.1 protein_id gnl|my_center|LOCUS_08660 13290 11863 gene locus_tag LOCUS_08670 13290 11863 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257654.1 protein_id gnl|my_center|LOCUS_08670 13598 13413 gene locus_tag LOCUS_08680 13598 13413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 >Feature sequence043 389 2212 gene locus_tag LOCUS_08690 389 2212 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73KH3 protein_id gnl|my_center|LOCUS_08690 2223 4274 gene locus_tag LOCUS_08700 2223 4274 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679930.1 protein_id gnl|my_center|LOCUS_08700 5336 4320 gene locus_tag LOCUS_08710 5336 4320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 6185 5382 gene locus_tag LOCUS_08720 6185 5382 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362994.1 protein_id gnl|my_center|LOCUS_08720 7215 6199 gene locus_tag LOCUS_08730 7215 6199 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383135.1 protein_id gnl|my_center|LOCUS_08730 8320 7235 gene locus_tag LOCUS_08740 8320 7235 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525264.1 protein_id gnl|my_center|LOCUS_08740 9771 8329 gene locus_tag LOCUS_08750 9771 8329 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066669.1 protein_id gnl|my_center|LOCUS_08750 11218 9794 gene locus_tag LOCUS_08760 11218 9794 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769537.1 protein_id gnl|my_center|LOCUS_08760 12866 11346 gene locus_tag LOCUS_08770 12866 11346 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582721.1 protein_id gnl|my_center|LOCUS_08770 13177 12878 gene locus_tag LOCUS_08780 13177 12878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 >Feature sequence044 2210 1728 gene locus_tag LOCUS_08790 gene tadA 2210 1728 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFZ1 protein_id gnl|my_center|LOCUS_08790 3101 2211 gene locus_tag LOCUS_08800 3101 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107505.1 protein_id gnl|my_center|LOCUS_08800 3216 4121 gene locus_tag LOCUS_08810 gene thiL 3216 4121 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747S1 protein_id gnl|my_center|LOCUS_08810 4198 5976 gene locus_tag LOCUS_08820 4198 5976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 5989 6909 gene locus_tag LOCUS_08830 gene fmt 5989 6909 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GW4 protein_id gnl|my_center|LOCUS_08830 8167 7295 gene locus_tag LOCUS_08840 gene hisG 8167 7295 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KB10 protein_id gnl|my_center|LOCUS_08840 8675 8250 gene locus_tag LOCUS_08850 8675 8250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 9816 8668 gene locus_tag LOCUS_08860 9816 8668 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DR9 protein_id gnl|my_center|LOCUS_08860 9868 10398 gene locus_tag LOCUS_08870 9868 10398 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869771.1 protein_id gnl|my_center|LOCUS_08870 11705 10395 gene locus_tag LOCUS_08880 gene dinB1 11705 10395 CDS product DNA polymerase IV 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54545 protein_id gnl|my_center|LOCUS_08880 12133 12819 gene locus_tag LOCUS_08890 12133 12819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 >Feature sequence045 1873 1613 gene locus_tag LOCUS_08900 1873 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 1945 2439 gene locus_tag LOCUS_08910 1945 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 3354 2446 gene locus_tag LOCUS_08920 gene spoOJ 3354 2446 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966989.1 protein_id gnl|my_center|LOCUS_08920 4198 3416 gene locus_tag LOCUS_08930 4198 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 4751 4203 gene locus_tag LOCUS_08940 4751 4203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 5176 4748 gene locus_tag LOCUS_08950 5176 4748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 6561 5197 gene locus_tag LOCUS_08960 gene accC1 6561 5197 CDS product biotin carboxylase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P49787 protein_id gnl|my_center|LOCUS_08960 7025 6570 gene locus_tag LOCUS_08970 gene accB 7025 6570 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931852.1 protein_id gnl|my_center|LOCUS_08970 7453 8022 gene locus_tag LOCUS_08980 7453 8022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 8228 8073 gene locus_tag LOCUS_08990 8228 8073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 8304 9626 gene locus_tag LOCUS_09000 8304 9626 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122010.1 protein_id gnl|my_center|LOCUS_09000 9642 10406 gene locus_tag LOCUS_09010 9642 10406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 10419 11438 gene locus_tag LOCUS_09020 10419 11438 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141892.1 protein_id gnl|my_center|LOCUS_09020 >Feature sequence046 1087 281 gene locus_tag LOCUS_09030 1087 281 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482313.1 protein_id gnl|my_center|LOCUS_09030 1193 3583 gene locus_tag LOCUS_09040 1193 3583 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937404.1 protein_id gnl|my_center|LOCUS_09040 3564 4211 gene locus_tag LOCUS_09050 3564 4211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 5219 4194 gene locus_tag LOCUS_09060 5219 4194 CDS product TIGR00374 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081596.1 protein_id gnl|my_center|LOCUS_09060 6399 5212 gene locus_tag LOCUS_09070 6399 5212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101181.1 protein_id gnl|my_center|LOCUS_09070 6544 7572 gene locus_tag LOCUS_09080 gene fni 6544 7572 CDS product isopentenyl-diphosphate delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ26 protein_id gnl|my_center|LOCUS_09080 7556 8752 gene locus_tag LOCUS_09090 7556 8752 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732325.1 protein_id gnl|my_center|LOCUS_09090 8730 9731 gene locus_tag LOCUS_09100 8730 9731 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771666.1 protein_id gnl|my_center|LOCUS_09100 9770 10681 gene locus_tag LOCUS_09110 9770 10681 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772552.1 protein_id gnl|my_center|LOCUS_09110 11525 10632 gene locus_tag LOCUS_09120 11525 10632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 12051 11536 gene locus_tag LOCUS_09130 12051 11536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 >Feature sequence047 2816 324 gene locus_tag LOCUS_09140 2816 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 4147 2813 gene locus_tag LOCUS_09150 4147 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 6996 4204 gene locus_tag LOCUS_09160 6996 4204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 8308 7016 gene locus_tag LOCUS_09170 8308 7016 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120406.1 protein_id gnl|my_center|LOCUS_09170 9313 8321 gene locus_tag LOCUS_09180 9313 8321 CDS product AP endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_09180 10509 9340 gene locus_tag LOCUS_09190 10509 9340 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122159.1 protein_id gnl|my_center|LOCUS_09190 11771 10512 gene locus_tag LOCUS_09200 11771 10512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 <12571 11908 gene locus_tag LOCUS_09210 <12571 11908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122841.1:sulfatase >Feature sequence048 1412 1338 gene locus_tag LOCUS_t00220 1412 1338 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 2076 1477 gene locus_tag LOCUS_09220 gene recR 2076 1477 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAI4 protein_id gnl|my_center|LOCUS_09220 2403 2089 gene locus_tag LOCUS_09230 2403 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 4080 2419 gene locus_tag LOCUS_09240 gene dnaX 4080 2419 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940771.1 protein_id gnl|my_center|LOCUS_09240 4242 5411 gene locus_tag LOCUS_09250 gene galK 4242 5411 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A6T4 protein_id gnl|my_center|LOCUS_09250 5424 6398 gene locus_tag LOCUS_09260 gene galE 5424 6398 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987061.1 protein_id gnl|my_center|LOCUS_09260 6395 7201 gene locus_tag LOCUS_09270 6395 7201 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767365.1 protein_id gnl|my_center|LOCUS_09270 7264 8109 gene locus_tag LOCUS_09280 7264 8109 CDS product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367477.1 protein_id gnl|my_center|LOCUS_09280 8106 9869 gene locus_tag LOCUS_09290 gene fhs 8106 9869 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJE1 protein_id gnl|my_center|LOCUS_09290 10231 9866 gene locus_tag LOCUS_09300 10231 9866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724527.1 protein_id gnl|my_center|LOCUS_09300 12417 10234 gene locus_tag LOCUS_09310 12417 10234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 >Feature sequence049 189 115 gene locus_tag LOCUS_t00230 189 115 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 310 1284 gene locus_tag LOCUS_09320 310 1284 CDS product exosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176633.1 protein_id gnl|my_center|LOCUS_09320 1254 2051 gene locus_tag LOCUS_09330 1254 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 2122 2418 gene locus_tag LOCUS_09340 gene gatC 2122 2418 CDS product glutamyl-tRNA(Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O06492 protein_id gnl|my_center|LOCUS_09340 2427 3896 gene locus_tag LOCUS_09350 gene gatA 2427 3896 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YL59 protein_id gnl|my_center|LOCUS_09350 3893 5320 gene locus_tag LOCUS_09360 3893 5320 CDS product aspartyl/glutamyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812379.1 protein_id gnl|my_center|LOCUS_09360 5951 5298 gene locus_tag LOCUS_09370 gene nth 5951 5298 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Z0 protein_id gnl|my_center|LOCUS_09370 8722 5957 gene locus_tag LOCUS_09380 gene polA 8722 5957 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 protein_id gnl|my_center|LOCUS_09380 8894 9655 gene locus_tag LOCUS_09390 gene tpiA 8894 9655 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLU0 protein_id gnl|my_center|LOCUS_09390 9674 10024 gene locus_tag LOCUS_09400 9674 10024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 10042 11913 gene locus_tag LOCUS_09410 10042 11913 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810151.1 protein_id gnl|my_center|LOCUS_09410 >Feature sequence050 1474 857 gene locus_tag LOCUS_09420 1474 857 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122839.1 protein_id gnl|my_center|LOCUS_09420 1995 1507 gene locus_tag LOCUS_09430 gene smpB 1995 1507 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WSY8 protein_id gnl|my_center|LOCUS_09430 2359 2105 gene locus_tag LOCUS_09440 2359 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 4152 2521 gene locus_tag LOCUS_09450 gene groL 4152 2521 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AL6 protein_id gnl|my_center|LOCUS_09450 4458 4171 gene locus_tag LOCUS_09460 gene groS 4458 4171 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1B0 protein_id gnl|my_center|LOCUS_09460 6427 4496 gene locus_tag LOCUS_09470 gene dnaK 6427 4496 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H59 protein_id gnl|my_center|LOCUS_09470 6752 7000 gene locus_tag LOCUS_09480 6752 7000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454560.1 protein_id gnl|my_center|LOCUS_09480 6997 7293 gene locus_tag LOCUS_09490 6997 7293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 7755 7312 gene locus_tag LOCUS_09500 7755 7312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 8938 7865 gene locus_tag LOCUS_09510 8938 7865 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034368.1 protein_id gnl|my_center|LOCUS_09510 9320 9036 gene locus_tag LOCUS_09520 gene ptsH 9320 9036 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946224.1 protein_id gnl|my_center|LOCUS_09520 9780 9328 gene locus_tag LOCUS_09530 9780 9328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 10655 9858 gene locus_tag LOCUS_09540 10655 9858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 10760 11836 gene locus_tag LOCUS_09550 gene serC 10760 11836 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHV7 protein_id gnl|my_center|LOCUS_09550 11861 11935 gene locus_tag LOCUS_t00240 11861 11935 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence051 995 180 gene locus_tag LOCUS_09560 995 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 3967 992 gene locus_tag LOCUS_09570 3967 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 5279 3981 gene locus_tag LOCUS_09580 5279 3981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 5454 5792 gene locus_tag LOCUS_09590 5454 5792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 7473 5800 gene locus_tag LOCUS_09600 7473 5800 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072775.1 protein_id gnl|my_center|LOCUS_09600 7704 7474 gene locus_tag LOCUS_09610 7704 7474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 8568 7792 gene locus_tag LOCUS_09620 8568 7792 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943898.1 protein_id gnl|my_center|LOCUS_09620 8615 9979 gene locus_tag LOCUS_09630 8615 9979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 10088 11365 gene locus_tag LOCUS_09640 gene eno 10088 11365 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KNX9 protein_id gnl|my_center|LOCUS_09640 11470 11784 gene locus_tag LOCUS_09650 11470 11784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 >Feature sequence052 711 301 gene locus_tag LOCUS_09660 gene tolR 711 301 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089889.1 protein_id gnl|my_center|LOCUS_09660 1463 714 gene locus_tag LOCUS_09670 gene tolQ-2 1463 714 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940358.1 protein_id gnl|my_center|LOCUS_09670 1653 1578 gene locus_tag LOCUS_t00250 1653 1578 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1945 2145 gene locus_tag LOCUS_09680 1945 2145 CDS product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807812.1 protein_id gnl|my_center|LOCUS_09680 2145 2927 gene locus_tag LOCUS_09690 gene thiG 2145 2927 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEJ1 protein_id gnl|my_center|LOCUS_09690 2920 4068 gene locus_tag LOCUS_09700 gene thiH 2920 4068 CDS product thiamine biosynthesis protein ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932379.1 protein_id gnl|my_center|LOCUS_09700 4292 4038 gene locus_tag LOCUS_09710 4292 4038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 6546 4261 gene locus_tag LOCUS_09720 6546 4261 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRH5 protein_id gnl|my_center|LOCUS_09720 6770 6543 gene locus_tag LOCUS_09730 6770 6543 CDS product iron transporter FeoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390222.1 protein_id gnl|my_center|LOCUS_09730 7792 6779 gene locus_tag LOCUS_09740 7792 6779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 7968 7777 gene locus_tag LOCUS_09750 7968 7777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 9895 8090 gene locus_tag LOCUS_09760 gene yidK 9895 8090 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422351.1 protein_id gnl|my_center|LOCUS_09760 10269 10193 gene locus_tag LOCUS_t00260 10269 10193 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 11365 10448 gene locus_tag LOCUS_09770 11365 10448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 >Feature sequence053 250 789 gene locus_tag LOCUS_09780 250 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 843 1778 gene locus_tag LOCUS_09790 843 1778 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390930.1 protein_id gnl|my_center|LOCUS_09790 1831 2613 gene locus_tag LOCUS_09800 1831 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 2703 3788 gene locus_tag LOCUS_09810 gene leuB 2703 3788 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0M8 protein_id gnl|my_center|LOCUS_09810 4360 3785 gene locus_tag LOCUS_09820 4360 3785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258774.1 protein_id gnl|my_center|LOCUS_09820 4830 4360 gene locus_tag LOCUS_09830 4830 4360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 5423 4827 gene locus_tag LOCUS_09840 gene ppiB 5423 4827 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG23 protein_id gnl|my_center|LOCUS_09840 5476 6390 gene locus_tag LOCUS_09850 gene waaM 5476 6390 CDS product lipid A lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948625.1 protein_id gnl|my_center|LOCUS_09850 6472 7848 gene locus_tag LOCUS_09860 6472 7848 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0H9 protein_id gnl|my_center|LOCUS_09860 7850 8584 gene locus_tag LOCUS_09870 7850 8584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 8581 9789 gene locus_tag LOCUS_09880 8581 9789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 9786 10970 gene locus_tag LOCUS_09890 9786 10970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403389.1 protein_id gnl|my_center|LOCUS_09890 >Feature sequence054 2184 1669 gene locus_tag LOCUS_09900 2184 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 2414 3919 gene locus_tag LOCUS_09910 2414 3919 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767035.1 protein_id gnl|my_center|LOCUS_09910 3955 5406 gene locus_tag LOCUS_09920 3955 5406 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121095.1 protein_id gnl|my_center|LOCUS_09920 6081 5407 gene locus_tag LOCUS_09930 6081 5407 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q038H8 protein_id gnl|my_center|LOCUS_09930 6324 7817 gene locus_tag LOCUS_09940 6324 7817 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256609.1 protein_id gnl|my_center|LOCUS_09940 11302 7913 gene locus_tag LOCUS_09950 11302 7913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 >Feature sequence055 291 707 gene locus_tag LOCUS_09960 291 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 740 2182 gene locus_tag LOCUS_09970 gene manB 740 2182 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022277.1 protein_id gnl|my_center|LOCUS_09970 2238 3758 gene locus_tag LOCUS_09980 gene trpE 2238 3758 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_09980 3760 4323 gene locus_tag LOCUS_09990 gene pabA 3760 4323 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602287.1 protein_id gnl|my_center|LOCUS_09990 5909 4320 gene locus_tag LOCUS_10000 gene nadE 5909 4320 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211555.1 protein_id gnl|my_center|LOCUS_10000 7403 5919 gene locus_tag LOCUS_10010 gene guaB 7403 5919 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X168 protein_id gnl|my_center|LOCUS_10010 7546 11055 gene locus_tag LOCUS_10020 7546 11055 CDS product pyruvate-flavodoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMD6 protein_id gnl|my_center|LOCUS_10020 >Feature sequence056 168 1685 gene locus_tag LOCUS_10030 168 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10030 3359 1686 gene locus_tag LOCUS_10040 gene recN 3359 1686 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BH7 protein_id gnl|my_center|LOCUS_10040 3751 3401 gene locus_tag LOCUS_10050 3751 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 4510 5388 gene locus_tag LOCUS_10060 4510 5388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 5402 6370 gene locus_tag LOCUS_10070 gene accA 5402 6370 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG09 protein_id gnl|my_center|LOCUS_10070 6736 6386 gene locus_tag LOCUS_10080 gene folB 6736 6386 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPT5 protein_id gnl|my_center|LOCUS_10080 7434 6739 gene locus_tag LOCUS_10090 7434 6739 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974981.1 protein_id gnl|my_center|LOCUS_10090 7493 8926 gene locus_tag LOCUS_10100 gene yqeZ 7493 8926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54465 protein_id gnl|my_center|LOCUS_10100 10440 8923 gene locus_tag LOCUS_10110 gene rho 10440 8923 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z7U4 protein_id gnl|my_center|LOCUS_10110 11048 10440 gene locus_tag LOCUS_10120 gene coaE 11048 10440 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DQ32 protein_id gnl|my_center|LOCUS_10120 >Feature sequence057 1264 665 gene locus_tag LOCUS_10130 1264 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 2443 1343 gene locus_tag LOCUS_10140 gene ychF 2443 1343 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72C55 protein_id gnl|my_center|LOCUS_10140 3277 2447 gene locus_tag LOCUS_10150 3277 2447 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S275 protein_id gnl|my_center|LOCUS_10150 5267 3354 gene locus_tag LOCUS_10160 gene thiC 5267 3354 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VF5 protein_id gnl|my_center|LOCUS_10160 5528 6541 gene locus_tag LOCUS_10170 gene bioB 5528 6541 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4I8 protein_id gnl|my_center|LOCUS_10170 6548 7546 gene locus_tag LOCUS_10180 6548 7546 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81IM0 protein_id gnl|my_center|LOCUS_10180 8285 7524 gene locus_tag LOCUS_10190 8285 7524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 9042 8278 gene locus_tag LOCUS_10200 9042 8278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 9167 9781 gene locus_tag LOCUS_10210 9167 9781 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879566.1 protein_id gnl|my_center|LOCUS_10210 9828 9912 gene locus_tag LOCUS_t00270 9828 9912 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 <11383 10045 gene locus_tag LOCUS_10220 <11383 10045 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937393.1:NAD(P)-dependent oxidoreductase >Feature sequence058 2012 1512 gene locus_tag LOCUS_10230 2012 1512 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879824.1 protein_id gnl|my_center|LOCUS_10230 3402 2005 gene locus_tag LOCUS_10240 3402 2005 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_10240 4579 3395 gene locus_tag LOCUS_10250 gene gnfL 4579 3395 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941669.1 protein_id gnl|my_center|LOCUS_10250 6416 4656 gene locus_tag LOCUS_10260 6416 4656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 7834 6413 gene locus_tag LOCUS_10270 7834 6413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 8378 7845 gene locus_tag LOCUS_10280 8378 7845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 8538 10025 gene locus_tag LOCUS_10290 8538 10025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 >Feature sequence059 176 883 gene locus_tag LOCUS_10300 gene rsmI 176 883 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0T7 protein_id gnl|my_center|LOCUS_10300 936 1463 gene locus_tag LOCUS_10310 936 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 1464 2918 gene locus_tag LOCUS_10320 1464 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 3130 5022 gene locus_tag LOCUS_10330 gene btuB 3130 5022 CDS product vitamin B12 transporter BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z314 protein_id gnl|my_center|LOCUS_10330 6453 5017 gene locus_tag LOCUS_10340 6453 5017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 9596 6627 gene locus_tag LOCUS_10350 9596 6627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 10378 9593 gene locus_tag LOCUS_10360 10378 9593 CDS product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097743.1 protein_id gnl|my_center|LOCUS_10360 10845 10375 gene locus_tag LOCUS_10370 10845 10375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 >Feature sequence060 923 171 gene locus_tag LOCUS_10380 923 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 1734 925 gene locus_tag LOCUS_10390 1734 925 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480274.1 protein_id gnl|my_center|LOCUS_10390 1869 3953 gene locus_tag LOCUS_10400 gene fusA 1869 3953 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFP4 protein_id gnl|my_center|LOCUS_10400 4092 4454 gene locus_tag LOCUS_10410 gene cbiX 4092 4454 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943630.1 protein_id gnl|my_center|LOCUS_10410 4540 4722 gene locus_tag LOCUS_10420 4540 4722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 5682 4765 gene locus_tag LOCUS_10430 5682 4765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 6528 5734 gene locus_tag LOCUS_10440 gene pilD 6528 5734 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BJ8 protein_id gnl|my_center|LOCUS_10440 7394 6525 gene locus_tag LOCUS_10450 gene aroE 7394 6525 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RI72 protein_id gnl|my_center|LOCUS_10450 9010 7394 gene locus_tag LOCUS_10460 gene leuA 9010 7394 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT17 protein_id gnl|my_center|LOCUS_10460 9910 9140 gene locus_tag LOCUS_10470 9910 9140 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764311.1 protein_id gnl|my_center|LOCUS_10470 10875 9949 gene locus_tag LOCUS_10480 10875 9949 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027929.1 protein_id gnl|my_center|LOCUS_10480 >Feature sequence061 694 350 gene locus_tag LOCUS_10490 694 350 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083241.1 protein_id gnl|my_center|LOCUS_10490 2154 862 gene locus_tag LOCUS_10500 2154 862 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD2 protein_id gnl|my_center|LOCUS_10500 2270 2437 gene locus_tag LOCUS_10510 2270 2437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 4649 2403 gene locus_tag LOCUS_10520 gene ptsP 4649 2403 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941826.1 protein_id gnl|my_center|LOCUS_10520 4780 8115 gene locus_tag LOCUS_10530 4780 8115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 8648 8190 gene locus_tag LOCUS_10540 gene msrB 8648 8190 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJK9 protein_id gnl|my_center|LOCUS_10540 8790 9110 gene locus_tag LOCUS_10550 8790 9110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 9700 9092 gene locus_tag LOCUS_10560 9700 9092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 <10848 9784 gene locus_tag LOCUS_10570 <10848 9784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262833.1:type II secretion system protein GspD >Feature sequence062 1504 1001 gene locus_tag LOCUS_10580 1504 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 2384 1497 gene locus_tag LOCUS_10590 2384 1497 CDS product methyltransferase FkbM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545859.1 protein_id gnl|my_center|LOCUS_10590 2491 5622 gene locus_tag LOCUS_10600 2491 5622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 7780 5690 gene locus_tag LOCUS_10610 gene pnp 7780 5690 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CS9 protein_id gnl|my_center|LOCUS_10610 8173 7910 gene locus_tag LOCUS_10620 gene rpsO 8173 7910 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MD64 protein_id gnl|my_center|LOCUS_10620 8601 8359 gene locus_tag LOCUS_10630 8601 8359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 8509 9171 gene locus_tag LOCUS_10640 8509 9171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 10312 9176 gene locus_tag LOCUS_10650 gene hflX 10312 9176 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDT2 protein_id gnl|my_center|LOCUS_10650 >Feature sequence063 252 1049 gene locus_tag LOCUS_10660 252 1049 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258574.1 protein_id gnl|my_center|LOCUS_10660 1042 1863 gene locus_tag LOCUS_10670 1042 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 1877 2530 gene locus_tag LOCUS_10680 gene nth 1877 2530 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGP4 protein_id gnl|my_center|LOCUS_10680 2573 3466 gene locus_tag LOCUS_10690 gene zupT 2573 3466 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GP0 protein_id gnl|my_center|LOCUS_10690 3537 4517 gene locus_tag LOCUS_10700 gene hemB 3537 4517 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJW7 protein_id gnl|my_center|LOCUS_10700 4521 5789 gene locus_tag LOCUS_10710 gene hemL 4521 5789 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P812 protein_id gnl|my_center|LOCUS_10710 7059 5806 gene locus_tag LOCUS_10720 7059 5806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920272.1 protein_id gnl|my_center|LOCUS_10720 7210 7046 gene locus_tag LOCUS_10730 7210 7046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 10296 7267 gene locus_tag LOCUS_10740 10296 7267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 >Feature sequence064 99 2075 gene locus_tag LOCUS_10750 gene uvrB 99 2075 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180R0 protein_id gnl|my_center|LOCUS_10750 2592 2086 gene locus_tag LOCUS_10760 2592 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 2921 2589 gene locus_tag LOCUS_10770 2921 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 3789 2986 gene locus_tag LOCUS_10780 3789 2986 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933874.1 protein_id gnl|my_center|LOCUS_10780 3865 4281 gene locus_tag LOCUS_10790 gene queF 3865 4281 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3H7H6 protein_id gnl|my_center|LOCUS_10790 4643 4278 gene locus_tag LOCUS_10800 4643 4278 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q728E6 protein_id gnl|my_center|LOCUS_10800 5349 4645 gene locus_tag LOCUS_10810 gene queC 5349 4645 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FW9 protein_id gnl|my_center|LOCUS_10810 6098 5349 gene locus_tag LOCUS_10820 gene queE 6098 5349 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKG4 protein_id gnl|my_center|LOCUS_10820 6733 6095 gene locus_tag LOCUS_10830 6733 6095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 7649 6711 gene locus_tag LOCUS_10840 7649 6711 CDS product putative lipopolysaccharide heptosyltransferase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094901.1 protein_id gnl|my_center|LOCUS_10840 8586 7654 gene locus_tag LOCUS_10850 gene argF 8586 7654 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P18186 protein_id gnl|my_center|LOCUS_10850 9650 8583 gene locus_tag LOCUS_10860 gene pyrB 9650 8583 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LF8 protein_id gnl|my_center|LOCUS_10860 10022 9723 gene locus_tag LOCUS_10870 10022 9723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 >Feature sequence065 692 1063 gene locus_tag LOCUS_10880 692 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 2130 1060 gene locus_tag LOCUS_10890 2130 1060 CDS product RmuC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958086.1 protein_id gnl|my_center|LOCUS_10890 2326 2568 gene locus_tag LOCUS_10900 2326 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 3935 2565 gene locus_tag LOCUS_10910 gene miaB 3935 2565 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SME9 protein_id gnl|my_center|LOCUS_10910 4598 3939 gene locus_tag LOCUS_10920 gene poxF 4598 3939 CDS product phenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639315.2 protein_id gnl|my_center|LOCUS_10920 4962 4810 gene locus_tag LOCUS_10930 4962 4810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 4903 6531 gene locus_tag LOCUS_10940 4903 6531 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228613.1 protein_id gnl|my_center|LOCUS_10940 6528 8291 gene locus_tag LOCUS_10950 6528 8291 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228612.1 protein_id gnl|my_center|LOCUS_10950 8708 8292 gene locus_tag LOCUS_10960 8708 8292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943269.1 protein_id gnl|my_center|LOCUS_10960 9742 8705 gene locus_tag LOCUS_10970 gene murG 9742 8705 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJG7 protein_id gnl|my_center|LOCUS_10970 >Feature sequence066 <1 1161 gene locus_tag LOCUS_10980 <1 1161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932712.1:DEAD/DEAH box family ATP-dependent RNA helicase 1219 1806 gene locus_tag LOCUS_10990 1219 1806 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMQ6 protein_id gnl|my_center|LOCUS_10990 1888 3150 gene locus_tag LOCUS_11000 gene icd 1888 3150 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KI74 protein_id gnl|my_center|LOCUS_11000 3944 3147 gene locus_tag LOCUS_11010 gene rph 3944 3147 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JYN5 protein_id gnl|my_center|LOCUS_11010 4088 4225 gene locus_tag LOCUS_11020 gene rpmH 4088 4225 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3H6S0 protein_id gnl|my_center|LOCUS_11020 4232 4684 gene locus_tag LOCUS_11030 gene rnpA 4232 4684 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBG7 protein_id gnl|my_center|LOCUS_11030 4677 4931 gene locus_tag LOCUS_11040 4677 4931 CDS product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RHA5 protein_id gnl|my_center|LOCUS_11040 4928 6682 gene locus_tag LOCUS_11050 gene yidC 4928 6682 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Q2 protein_id gnl|my_center|LOCUS_11050 8077 6689 gene locus_tag LOCUS_11060 gene rpoN 8077 6689 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BZ1 protein_id gnl|my_center|LOCUS_11060 8198 8983 gene locus_tag LOCUS_11070 8198 8983 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942276.1 protein_id gnl|my_center|LOCUS_11070 >Feature sequence067 <1 614 gene locus_tag LOCUS_11080 <1 614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024170.1:cell surface protein 727 1476 gene locus_tag LOCUS_11090 727 1476 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903708.1 protein_id gnl|my_center|LOCUS_11090 2189 1473 gene locus_tag LOCUS_11100 2189 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 2343 3980 gene locus_tag LOCUS_11110 gene fumA 2343 3980 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CKB5 protein_id gnl|my_center|LOCUS_11110 4063 4509 gene locus_tag LOCUS_11120 4063 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 4506 5423 gene locus_tag LOCUS_11130 4506 5423 CDS product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192895.1 protein_id gnl|my_center|LOCUS_11130 >Feature sequence068 975 76 gene locus_tag LOCUS_11140 gene miaA 975 76 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MBD2 protein_id gnl|my_center|LOCUS_11140 1429 968 gene locus_tag LOCUS_11150 gene lspA 1429 968 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AR4 protein_id gnl|my_center|LOCUS_11150 2134 1448 gene locus_tag LOCUS_11160 2134 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 5357 2232 gene locus_tag LOCUS_11170 gene ileS 5357 2232 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B0B9C6 protein_id gnl|my_center|LOCUS_11170 >Feature sequence069 674 2110 gene locus_tag LOCUS_11180 674 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 2219 3685 gene locus_tag LOCUS_11190 2219 3685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 3925 5124 gene locus_tag LOCUS_11200 3925 5124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 5252 7264 gene locus_tag LOCUS_11210 5252 7264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 7276 8919 gene locus_tag LOCUS_11220 gene araB 7276 8919 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E3E6 protein_id gnl|my_center|LOCUS_11220 >Feature sequence070 241 1605 gene locus_tag LOCUS_11230 gene ugdH 241 1605 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118525.1 protein_id gnl|my_center|LOCUS_11230 1814 1602 gene locus_tag LOCUS_11240 1814 1602 CDS product ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190278.1 protein_id gnl|my_center|LOCUS_11240 2071 1814 gene locus_tag LOCUS_11250 2071 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 2275 2090 gene locus_tag LOCUS_11260 2275 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 3068 2355 gene locus_tag LOCUS_11270 3068 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 4807 3065 gene locus_tag LOCUS_11280 4807 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 5292 4807 gene locus_tag LOCUS_11290 5292 4807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 6179 5289 gene locus_tag LOCUS_11300 6179 5289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 7180 6176 gene locus_tag LOCUS_11310 7180 6176 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761569.1 protein_id gnl|my_center|LOCUS_11310 8136 7177 gene locus_tag LOCUS_11320 gene batA 8136 7177 CDS product aerotolerance regulator BatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121996.1 protein_id gnl|my_center|LOCUS_11320 >Feature sequence071 <1 1192 gene locus_tag LOCUS_11330 <1 1192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122518.1:sulfatase 1208 2323 gene locus_tag LOCUS_11340 gene pam 1208 2323 CDS product peptidylglycine monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122516.1 protein_id gnl|my_center|LOCUS_11340 2409 3686 gene locus_tag LOCUS_11350 gene serS 2409 3686 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMH8 protein_id gnl|my_center|LOCUS_11350 4575 3679 gene locus_tag LOCUS_11360 4575 3679 CDS product lipid A biosynthesis acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869059.1 protein_id gnl|my_center|LOCUS_11360 8108 4572 gene locus_tag LOCUS_11370 8108 4572 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHB7 protein_id gnl|my_center|LOCUS_11370 8140 8364 gene locus_tag LOCUS_11380 8140 8364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 >Feature sequence072 <1 1042 gene locus_tag LOCUS_11390 <1 1042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KIQ1:putative lipid II flippase MurJ 1177 2226 gene locus_tag LOCUS_11400 gene argC 1177 2226 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HE28 protein_id gnl|my_center|LOCUS_11400 2245 2394 gene locus_tag LOCUS_11410 2245 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 2411 3517 gene locus_tag LOCUS_11420 2411 3517 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGI3 protein_id gnl|my_center|LOCUS_11420 4016 3519 gene locus_tag LOCUS_11430 4016 3519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 4176 5576 gene locus_tag LOCUS_11440 gene leuC 4176 5576 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZI8 protein_id gnl|my_center|LOCUS_11440 5576 6196 gene locus_tag LOCUS_11450 gene leuD 5576 6196 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZA4 protein_id gnl|my_center|LOCUS_11450 6214 7473 gene locus_tag LOCUS_11460 gene icd 6214 7473 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L5 protein_id gnl|my_center|LOCUS_11460 >Feature sequence073 875 168 gene locus_tag LOCUS_11470 875 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 1463 2422 gene locus_tag LOCUS_11480 gene hemE 1463 2422 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGD0 protein_id gnl|my_center|LOCUS_11480 2415 3020 gene locus_tag LOCUS_11490 2415 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 3034 4392 gene locus_tag LOCUS_11500 gene hemG 3034 4392 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403969.1 protein_id gnl|my_center|LOCUS_11500 4412 5443 gene locus_tag LOCUS_11510 gene hemH 4412 5443 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP3 protein_id gnl|my_center|LOCUS_11510 6540 5440 gene locus_tag LOCUS_11520 6540 5440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 6620 7330 gene locus_tag LOCUS_11530 gene cmoA 6620 7330 CDS product carboxy-S-adenosyl-L-methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FUL8 protein_id gnl|my_center|LOCUS_11530 >Feature sequence074 1 651 gene locus_tag LOCUS_11540 1 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 753 1364 gene locus_tag LOCUS_11550 753 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 1377 1922 gene locus_tag LOCUS_11560 1377 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 1961 3703 gene locus_tag LOCUS_11570 gene atpA 1961 3703 CDS product V-type ATP synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73M28 protein_id gnl|my_center|LOCUS_11570 3693 4994 gene locus_tag LOCUS_11580 gene atpB 3693 4994 CDS product V-type ATP synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73M29 protein_id gnl|my_center|LOCUS_11580 5000 5587 gene locus_tag LOCUS_11590 gene atpD 5000 5587 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51119 protein_id gnl|my_center|LOCUS_11590 5584 7359 gene locus_tag LOCUS_11600 gene atpI 5584 7359 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51118 protein_id gnl|my_center|LOCUS_11600 >Feature sequence075 382 26 gene locus_tag LOCUS_11610 382 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 402 584 gene locus_tag LOCUS_11620 402 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 709 1209 gene locus_tag LOCUS_11630 709 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 1689 2072 gene locus_tag LOCUS_11640 1689 2072 CDS product DUF4186 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705325.1 protein_id gnl|my_center|LOCUS_11640 2103 3386 gene locus_tag LOCUS_11650 gene pcnB 2103 3386 CDS product poly(A) polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CGX0 protein_id gnl|my_center|LOCUS_11650 3464 4996 gene locus_tag LOCUS_11660 3464 4996 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389142.1 protein_id gnl|my_center|LOCUS_11660 4999 5823 gene locus_tag LOCUS_11670 gene prmC 4999 5823 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULT2 protein_id gnl|my_center|LOCUS_11670 <7428 5830 gene locus_tag LOCUS_11680 <7428 5830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066544.1:potassium transporter >Feature sequence076 2811 2647 gene locus_tag LOCUS_11690 2811 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 2783 5053 gene locus_tag LOCUS_11700 2783 5053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 5063 6595 gene locus_tag LOCUS_11710 5063 6595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920272.1 protein_id gnl|my_center|LOCUS_11710 >Feature sequence077 1706 393 gene locus_tag LOCUS_11720 1706 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 1864 5577 gene locus_tag LOCUS_11730 gene metH 1864 5577 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267702.1 protein_id gnl|my_center|LOCUS_11730 >Feature sequence078 1295 2521 gene locus_tag LOCUS_11740 gene pfk 1295 2521 CDS product pyrophosphate--fructose 6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UES2 protein_id gnl|my_center|LOCUS_11740 3035 2523 gene locus_tag LOCUS_11750 gene ruvC 3035 2523 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHT5 protein_id gnl|my_center|LOCUS_11750 3793 3038 gene locus_tag LOCUS_11760 3793 3038 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P62035 protein_id gnl|my_center|LOCUS_11760 5012 3807 gene locus_tag LOCUS_11770 gene tyrS 5012 3807 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHS8 protein_id gnl|my_center|LOCUS_11770 6826 5129 gene locus_tag LOCUS_11780 gene rpsA 6826 5129 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z8M3 protein_id gnl|my_center|LOCUS_11780 >Feature sequence079 699 196 gene locus_tag LOCUS_11790 699 196 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023691.1 protein_id gnl|my_center|LOCUS_11790 2432 711 gene locus_tag LOCUS_11800 gene ilvB 2432 711 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37251 protein_id gnl|my_center|LOCUS_11800 3706 2627 gene locus_tag LOCUS_11810 3706 2627 CDS product putative RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPG1 protein_id gnl|my_center|LOCUS_11810 4515 3667 gene locus_tag LOCUS_11820 4515 3667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 5320 4583 gene locus_tag LOCUS_11830 gene coaX 5320 4583 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5R1 protein_id gnl|my_center|LOCUS_11830 6319 5483 gene locus_tag LOCUS_11840 6319 5483 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920753.1 protein_id gnl|my_center|LOCUS_11840 >Feature sequence080 <1 721 gene locus_tag LOCUS_11850 <1 721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783762.1:dioxygenase 724 1788 gene locus_tag LOCUS_11860 gene kdgK 724 1788 CDS product 2-keto-3-deoxygluconate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338792.1 protein_id gnl|my_center|LOCUS_11860 1801 3249 gene locus_tag LOCUS_11870 gene gnd 1801 3249 CDS product 6-phosphogluconate dehydrogenase, decarboxylating inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K1Q5 protein_id gnl|my_center|LOCUS_11870 4475 6124 gene locus_tag LOCUS_11880 4475 6124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 >Feature sequence081 3205 236 gene locus_tag LOCUS_11890 gene purSL 3205 236 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CN9 protein_id gnl|my_center|LOCUS_11890 3363 4241 gene locus_tag LOCUS_11900 3363 4241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 5374 4247 gene locus_tag LOCUS_11910 gene lptF 5374 4247 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942567.1 protein_id gnl|my_center|LOCUS_11910 6114 5386 gene locus_tag LOCUS_11920 6114 5386 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022565.1 protein_id gnl|my_center|LOCUS_11920 >Feature sequence082 485 1093 gene locus_tag LOCUS_11930 485 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 1341 1949 gene locus_tag LOCUS_11940 gene sodA 1341 1949 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RUV2 protein_id gnl|my_center|LOCUS_11940 2416 2063 gene locus_tag LOCUS_11950 2416 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 4614 2758 gene locus_tag LOCUS_11960 4614 2758 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117792.1 protein_id gnl|my_center|LOCUS_11960 6330 4624 gene locus_tag LOCUS_11970 6330 4624 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117793.1 protein_id gnl|my_center|LOCUS_11970 >Feature sequence083 3831 739 gene locus_tag LOCUS_11980 3831 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 5006 3831 gene locus_tag LOCUS_11990 5006 3831 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJ87 protein_id gnl|my_center|LOCUS_11990 5460 4981 gene locus_tag LOCUS_12000 gene yugG 5460 4981 CDS product putative HTH-type transcriptional regulator YugG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05236 protein_id gnl|my_center|LOCUS_12000 6336 5572 gene locus_tag LOCUS_12010 6336 5572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 >Feature sequence084 437 892 gene locus_tag LOCUS_12020 gene nrdR 437 892 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q837G1 protein_id gnl|my_center|LOCUS_12020 913 1563 gene locus_tag LOCUS_12030 913 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 1560 3131 gene locus_tag LOCUS_12040 gene lnt 1560 3131 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_12040 3197 4291 gene locus_tag LOCUS_12050 gene prfB 3197 4291 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y4D8 protein_id gnl|my_center|LOCUS_12050 4288 5061 gene locus_tag LOCUS_12060 gene trpC 4288 5061 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZFA7 protein_id gnl|my_center|LOCUS_12060 >Feature sequence085 2560 467 gene locus_tag LOCUS_12070 gene infB 2560 467 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97I51 protein_id gnl|my_center|LOCUS_12070 3747 2560 gene locus_tag LOCUS_12080 gene nusA 3747 2560 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS2 protein_id gnl|my_center|LOCUS_12080 3947 5314 gene locus_tag LOCUS_12090 3947 5314 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460200.1 protein_id gnl|my_center|LOCUS_12090 5311 5943 gene locus_tag LOCUS_12100 5311 5943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 >Feature sequence086 87 1703 gene locus_tag LOCUS_12110 87 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 1720 3387 gene locus_tag LOCUS_12120 1720 3387 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329503.1 protein_id gnl|my_center|LOCUS_12120 3389 3910 gene locus_tag LOCUS_12130 3389 3910 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814644.1 protein_id gnl|my_center|LOCUS_12130 3982 4968 gene locus_tag LOCUS_12140 3982 4968 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_12140 4972 5859 gene locus_tag LOCUS_12150 4972 5859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_12150 >Feature sequence087 1135 1587 gene locus_tag LOCUS_12160 1135 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 protein_id gnl|my_center|LOCUS_12160 2585 1647 gene locus_tag LOCUS_12170 2585 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 3278 2634 gene locus_tag LOCUS_12180 3278 2634 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813213.1 protein_id gnl|my_center|LOCUS_12180 3641 3291 gene locus_tag LOCUS_12190 gene rplS 3641 3291 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YK97 protein_id gnl|my_center|LOCUS_12190 4412 3708 gene locus_tag LOCUS_12200 gene trmD 4412 3708 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJV4 protein_id gnl|my_center|LOCUS_12200 4733 4503 gene locus_tag LOCUS_12210 4733 4503 CDS product UPF0109 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJV6 protein_id gnl|my_center|LOCUS_12210 5146 4730 gene locus_tag LOCUS_12220 5146 4730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 5347 5895 gene locus_tag LOCUS_12230 5347 5895 CDS product ATP--cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_12230 >Feature sequence088 354 2165 gene locus_tag LOCUS_12240 354 2165 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791956.1 protein_id gnl|my_center|LOCUS_12240 2342 3574 gene locus_tag LOCUS_12250 2342 3574 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584016.1 protein_id gnl|my_center|LOCUS_12250 3851 4354 gene locus_tag LOCUS_12260 gene arsC 3851 4354 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938935.1 protein_id gnl|my_center|LOCUS_12260 4414 4548 gene locus_tag LOCUS_12270 4414 4548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 5285 4602 gene locus_tag LOCUS_12280 5285 4602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 >Feature sequence089 2527 884 gene locus_tag LOCUS_12290 2527 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 4245 2524 gene locus_tag LOCUS_12300 4245 2524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 4661 5281 gene locus_tag LOCUS_12310 4661 5281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 >Feature sequence090 1459 395 gene locus_tag LOCUS_12320 gene pheA 1459 395 CDS product P-protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67085 protein_id gnl|my_center|LOCUS_12320 2130 1456 gene locus_tag LOCUS_12330 2130 1456 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SK60 protein_id gnl|my_center|LOCUS_12330 2923 2123 gene locus_tag LOCUS_12340 gene scpA 2923 2123 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C43 protein_id gnl|my_center|LOCUS_12340 3885 2920 gene locus_tag LOCUS_12350 gene trpS 3885 2920 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQA4 protein_id gnl|my_center|LOCUS_12350 >Feature sequence091 349 612 gene locus_tag LOCUS_12360 349 612 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5DZS6 protein_id gnl|my_center|LOCUS_12360 600 902 gene locus_tag LOCUS_12370 600 902 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263487.1 protein_id gnl|my_center|LOCUS_12370 998 2632 gene locus_tag LOCUS_12380 998 2632 CDS product phosphoglucomutase, alpha-D-glucose phosphate-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971701.1 protein_id gnl|my_center|LOCUS_12380 4461 2626 gene locus_tag LOCUS_12390 4461 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 4898 4464 gene locus_tag LOCUS_12400 4898 4464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 5304 4900 gene locus_tag LOCUS_12410 5304 4900 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123550.1 protein_id gnl|my_center|LOCUS_12410 >Feature sequence092 46 861 gene locus_tag LOCUS_12420 46 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 2629 851 gene locus_tag LOCUS_12430 gene ptsI 2629 851 CDS product phosphoenolpyruvate-protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BZ6 protein_id gnl|my_center|LOCUS_12430 2907 2629 gene locus_tag LOCUS_12440 2907 2629 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404610.1 protein_id gnl|my_center|LOCUS_12440 3835 2894 gene locus_tag LOCUS_12450 gene hprK 3835 2894 CDS product HPr kinase/phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3J9 protein_id gnl|my_center|LOCUS_12450 4146 3847 gene locus_tag LOCUS_12460 4146 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 4906 4169 gene locus_tag LOCUS_12470 gene yhbG 4906 4169 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369327.1 protein_id gnl|my_center|LOCUS_12470 5309 4899 gene locus_tag LOCUS_12480 5309 4899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 >Feature sequence093 732 289 gene locus_tag LOCUS_12490 gene fucU 732 289 CDS product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z427 protein_id gnl|my_center|LOCUS_12490 1846 734 gene locus_tag LOCUS_12500 gene yphC 1846 734 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001361601.1 protein_id gnl|my_center|LOCUS_12500 2906 1869 gene locus_tag LOCUS_12510 2906 1869 CDS product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404019.1 protein_id gnl|my_center|LOCUS_12510 3086 4465 gene locus_tag LOCUS_12520 3086 4465 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201906.1 protein_id gnl|my_center|LOCUS_12520 >Feature sequence094 283 207 gene locus_tag LOCUS_t00280 283 207 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 531 454 gene locus_tag LOCUS_t00290 531 454 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 657 2384 gene locus_tag LOCUS_12530 657 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 2381 3313 gene locus_tag LOCUS_12540 2381 3313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 3881 3369 gene locus_tag LOCUS_12550 gene purE 3881 3369 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3P5X1 protein_id gnl|my_center|LOCUS_12550 <4609 3871 gene locus_tag LOCUS_12560 <4609 3871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74FJ8:phosphoribosylamine--glycine ligase >Feature sequence095 1447 278 gene locus_tag LOCUS_12570 1447 278 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941549.1 protein_id gnl|my_center|LOCUS_12570 3171 1444 gene locus_tag LOCUS_12580 3171 1444 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089481.1 protein_id gnl|my_center|LOCUS_12580 3769 3209 gene locus_tag LOCUS_12590 3769 3209 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74A46 protein_id gnl|my_center|LOCUS_12590 3864 3938 gene locus_tag LOCUS_t00300 3864 3938 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4298 4086 gene locus_tag LOCUS_12600 4298 4086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 >Feature sequence096 211 1818 gene locus_tag LOCUS_12610 211 1818 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482406.1 protein_id gnl|my_center|LOCUS_12610 3218 1986 gene locus_tag LOCUS_12620 gene nqrF 3218 1986 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS0 protein_id gnl|my_center|LOCUS_12620 3889 3278 gene locus_tag LOCUS_12630 gene nqrE 3889 3278 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X4Q7 protein_id gnl|my_center|LOCUS_12630 <4411 3895 gene locus_tag LOCUS_12640 <4411 3895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87MA9:Na(+)-translocating NADH-quinone reductase subunit D >Feature sequence097 1334 114 gene locus_tag LOCUS_12650 1334 114 CDS product hexokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680422.1 protein_id gnl|my_center|LOCUS_12650 1827 1345 gene locus_tag LOCUS_12660 gene rlmH 1827 1345 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKY9 protein_id gnl|my_center|LOCUS_12660 2136 1828 gene locus_tag LOCUS_12670 2136 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942208.1 protein_id gnl|my_center|LOCUS_12670 2782 2147 gene locus_tag LOCUS_12680 2782 2147 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956875.1 protein_id gnl|my_center|LOCUS_12680 <4354 2841 gene locus_tag LOCUS_12690 <4354 2841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941191.1:aminodeoxychorismate synthase, component I >Feature sequence098 1331 972 gene locus_tag LOCUS_12700 1331 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 1831 1755 gene locus_tag LOCUS_t00310 1831 1755 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2842 1895 gene locus_tag LOCUS_12710 2842 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 3561 2830 gene locus_tag LOCUS_12720 3561 2830 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573004.1 protein_id gnl|my_center|LOCUS_12720 3647 4288 gene locus_tag LOCUS_12730 gene rex 3647 4288 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73LF2 protein_id gnl|my_center|LOCUS_12730 >Feature sequence099 2064 1345 gene locus_tag LOCUS_12740 gene pdxJ 2064 1345 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPB5 protein_id gnl|my_center|LOCUS_12740 3279 2074 gene locus_tag LOCUS_12750 3279 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 3819 3310 gene locus_tag LOCUS_12760 3819 3310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 >Feature sequence100 1042 407 gene locus_tag LOCUS_12770 1042 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 2451 1075 gene locus_tag LOCUS_12780 2451 1075 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767658.1 protein_id gnl|my_center|LOCUS_12780 2591 3277 gene locus_tag LOCUS_12790 gene arsC 2591 3277 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123107.1 protein_id gnl|my_center|LOCUS_12790 4059 3271 gene locus_tag LOCUS_12800 4059 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 >Feature sequence101 423 1145 gene locus_tag LOCUS_12810 gene menG 423 1145 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WB34 protein_id gnl|my_center|LOCUS_12810 1145 1903 gene locus_tag LOCUS_12820 gene mqnA 1145 1903 CDS product chorismate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UT25 protein_id gnl|my_center|LOCUS_12820 2760 1900 gene locus_tag LOCUS_12830 2760 1900 CDS product PEP-CTERM domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123432.1 protein_id gnl|my_center|LOCUS_12830 3680 2835 gene locus_tag LOCUS_12840 gene lgt 3680 2835 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG31 protein_id gnl|my_center|LOCUS_12840 >Feature sequence102 3234 1534 gene locus_tag LOCUS_12850 3234 1534 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117793.1 protein_id gnl|my_center|LOCUS_12850 3919 3248 gene locus_tag LOCUS_12860 3919 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 >Feature sequence103 1802 330 gene locus_tag LOCUS_12870 gene metC/metB 1802 330 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124559.1 protein_id gnl|my_center|LOCUS_12870 1960 3156 gene locus_tag LOCUS_12880 gene apgM 1960 3156 CDS product putative 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C57 protein_id gnl|my_center|LOCUS_12880 >Feature sequence104 1094 105 gene locus_tag LOCUS_12890 1094 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 1191 2114 gene locus_tag LOCUS_12900 gene era 1191 2114 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND14 protein_id gnl|my_center|LOCUS_12900 2145 2291 gene locus_tag LOCUS_12910 2145 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 >Feature sequence105 209 1027 gene locus_tag LOCUS_12920 209 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 1052 3667 gene locus_tag LOCUS_12930 1052 3667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 >Feature sequence106 102 2495 gene locus_tag LOCUS_12940 gene pheT 102 2495 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CZ9 protein_id gnl|my_center|LOCUS_12940 >Feature sequence107 2355 1159 gene locus_tag LOCUS_12950 2355 1159 CDS product glycosyhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029020.1 protein_id gnl|my_center|LOCUS_12950 <3531 2339 gene locus_tag LOCUS_12960 <3531 2339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029020.1:glycosyhydrolase >Feature sequence108 2707 2255 gene locus_tag LOCUS_12970 2707 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 3270 2707 gene locus_tag LOCUS_12980 gene def 3270 2707 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIB4 protein_id gnl|my_center|LOCUS_12980 >Feature sequence109 757 260 gene locus_tag LOCUS_12990 757 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 1745 759 gene locus_tag LOCUS_13000 gene sppA 1745 759 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941487.1 protein_id gnl|my_center|LOCUS_13000 1840 2811 gene locus_tag LOCUS_13010 1840 2811 CDS product arabinose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195206.1 protein_id gnl|my_center|LOCUS_13010 2968 3204 gene locus_tag LOCUS_13020 2968 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 >Feature sequence110 836 381 gene locus_tag LOCUS_13030 gene nusB 836 381 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIA9 protein_id gnl|my_center|LOCUS_13030 1351 839 gene locus_tag LOCUS_13040 gene ribH 1351 839 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHQ1 protein_id gnl|my_center|LOCUS_13040 2564 1359 gene locus_tag LOCUS_13050 gene ribBA 2564 1359 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q818X6 protein_id gnl|my_center|LOCUS_13050 <3420 2828 gene locus_tag LOCUS_13060 <3420 2828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q650L9:undecaprenyl-diphosphatase >Feature sequence111 1027 239 gene locus_tag LOCUS_13070 1027 239 CDS product thiamine biosynthesis protein ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966206.1 protein_id gnl|my_center|LOCUS_13070 1096 1734 gene locus_tag LOCUS_13080 1096 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124163.1 protein_id gnl|my_center|LOCUS_13080 2258 1755 gene locus_tag LOCUS_13090 2258 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 2930 3064 gene locus_tag LOCUS_13100 2930 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 3045 3176 gene locus_tag LOCUS_13110 3045 3176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 >Feature sequence112 1127 1435 gene locus_tag LOCUS_13120 1127 1435 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038930.1 protein_id gnl|my_center|LOCUS_13120 1432 2148 gene locus_tag LOCUS_13130 1432 2148 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939330.1 protein_id gnl|my_center|LOCUS_13130 >Feature sequence113 619 218 gene locus_tag LOCUS_13140 619 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 713 2506 gene locus_tag LOCUS_13150 gene mutL 713 2506 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y788 protein_id gnl|my_center|LOCUS_13150 3082 2507 gene locus_tag LOCUS_13160 3082 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 >Feature sequence114 294 1124 gene locus_tag LOCUS_13170 294 1124 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SL85 protein_id gnl|my_center|LOCUS_13170 3023 1125 gene locus_tag LOCUS_13180 gene purF 3023 1125 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_13180 >Feature sequence115 303 1859 gene locus_tag LOCUS_13190 303 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 >Feature sequence116 1830 631 gene locus_tag LOCUS_13200 gene pgk 1830 631 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HYC0 protein_id gnl|my_center|LOCUS_13200 2912 1917 gene locus_tag LOCUS_13210 gene gap 2912 1917 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59199 protein_id gnl|my_center|LOCUS_13210 >Feature sequence117 399 2090 gene locus_tag LOCUS_13220 399 2090 CDS product general secretion pathway protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330716.1 protein_id gnl|my_center|LOCUS_13220 >Feature sequence118 355 2 gene locus_tag LOCUS_13230 gene shaG 355 2 CDS product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958313.1 protein_id gnl|my_center|LOCUS_13230 621 355 gene locus_tag LOCUS_13240 gene mrpF 621 355 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942975.1 protein_id gnl|my_center|LOCUS_13240 977 618 gene locus_tag LOCUS_13250 977 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 1912 974 gene locus_tag LOCUS_13260 1912 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13260 >Feature sequence119 >Feature sequence120 1360 197 gene locus_tag LOCUS_13270 1360 197 CDS product sodium:hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947236.1 protein_id gnl|my_center|LOCUS_13270 1938 1441 gene locus_tag LOCUS_13280 1938 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 >Feature sequence121 847 212 gene locus_tag LOCUS_13290 847 212 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113851.1 protein_id gnl|my_center|LOCUS_13290 1281 835 gene locus_tag LOCUS_13300 1281 835 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583329.1 protein_id gnl|my_center|LOCUS_13300 >Feature sequence122 1795 290 gene locus_tag LOCUS_13310 1795 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 >Feature sequence123 <2018 1377 gene locus_tag LOCUS_13320 <2018 1377 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202535.1:alpha-L-fucosidase >Feature sequence124 604 2 gene locus_tag LOCUS_13330 gene rpsD 604 2 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KXP5 protein_id gnl|my_center|LOCUS_13330 <1984 808 gene locus_tag LOCUS_13340 <1984 808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008661626.1:magnesium chelatase >Feature sequence125 314 1303 gene locus_tag LOCUS_13350 gene ruvB 314 1303 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3F9 protein_id gnl|my_center|LOCUS_13350 1581 1300 gene locus_tag LOCUS_13360 gene ppiC 1581 1300 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071952.1 protein_id gnl|my_center|LOCUS_13360 >Feature sequence126 267 192 gene locus_tag LOCUS_t00320 267 192 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 405 701 gene locus_tag LOCUS_13370 405 701 CDS product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933319.1 protein_id gnl|my_center|LOCUS_13370 1117 698 gene locus_tag LOCUS_13380 gene fosA 1117 698 CDS product glutathione transferase FosA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4K6 protein_id gnl|my_center|LOCUS_13380 1228 1579 gene locus_tag LOCUS_tm00010 1228 1579 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence127 506 658 gene locus_tag LOCUS_13390 506 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 1263 655 gene locus_tag LOCUS_13400 1263 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 >Feature sequence128 1629 607 gene locus_tag LOCUS_13410 gene recA 1629 607 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O50487 protein_id gnl|my_center|LOCUS_13410 >Feature sequence129 192 1637 gene locus_tag LOCUS_13420 192 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 >Feature sequence130 <1588 277 gene locus_tag LOCUS_13430 <1588 277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B8E083:UvrABC system protein A >Feature sequence131 315 638 gene locus_tag LOCUS_13440 315 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 >Feature sequence132 >Feature sequence133 303 998 gene locus_tag LOCUS_13450 gene mtnN 303 998 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2A4 protein_id gnl|my_center|LOCUS_13450 1256 >1473 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttggttctgatcttaatga >Feature sequence134 <1 567 gene locus_tag LOCUS_13460 <1 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121692.1:helicase >Feature sequence135 <1 1226 gene locus_tag LOCUS_13470 <1 1226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HXE5:ATP-dependent RNA helicase RhlB 1316 1404 gene locus_tag LOCUS_t00330 1316 1404 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence136 1154 156 gene locus_tag LOCUS_13480 1154 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 >Feature sequence137 <1333 534 gene locus_tag LOCUS_13490 <1333 534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938513.1:MATE family efflux transporter >Feature sequence138 175 1182 gene locus_tag LOCUS_13500 gene pheS 175 1182 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189P4 protein_id gnl|my_center|LOCUS_13500