>Feature sequence001 <1 786 gene locus_tag LOCUS_00010 <1 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E8H2:arabinose 5-phosphate isomerase 956 1711 gene locus_tag LOCUS_00020 956 1711 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546302.1 protein_id gnl|my_center|LOCUS_00020 1715 2650 gene locus_tag LOCUS_00030 1715 2650 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545278.1 protein_id gnl|my_center|LOCUS_00030 2667 3974 gene locus_tag LOCUS_00040 2667 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4218 5411 gene locus_tag LOCUS_00050 4218 5411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5719 6891 gene locus_tag LOCUS_00060 5719 6891 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871132.1 protein_id gnl|my_center|LOCUS_00060 6962 7846 gene locus_tag LOCUS_00070 6962 7846 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227567.1 protein_id gnl|my_center|LOCUS_00070 7864 8694 gene locus_tag LOCUS_00080 7864 8694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 9826 10977 gene locus_tag LOCUS_00090 9826 10977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 11142 12299 gene locus_tag LOCUS_00100 11142 12299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 12286 12582 gene locus_tag LOCUS_00110 12286 12582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 13457 13729 gene locus_tag LOCUS_00120 13457 13729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 13737 14582 gene locus_tag LOCUS_00130 13737 14582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 14766 16229 gene locus_tag LOCUS_00140 14766 16229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 16222 18198 gene locus_tag LOCUS_00150 gene wcaG 16222 18198 CDS product nucleotide sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338776.1 protein_id gnl|my_center|LOCUS_00150 18226 19398 gene locus_tag LOCUS_00160 18226 19398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 19395 21509 gene locus_tag LOCUS_00170 19395 21509 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546064.1 protein_id gnl|my_center|LOCUS_00170 21499 22599 gene locus_tag LOCUS_00180 21499 22599 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202631.1 protein_id gnl|my_center|LOCUS_00180 22820 24229 gene locus_tag LOCUS_00190 22820 24229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 24233 25474 gene locus_tag LOCUS_00200 24233 25474 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048108.1 protein_id gnl|my_center|LOCUS_00200 >Feature sequence002 <1 733 gene locus_tag LOCUS_00210 <1 733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122220.1:aldehyde dehydrogenase 764 1969 gene locus_tag LOCUS_00220 764 1969 CDS product iron alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122942.1 protein_id gnl|my_center|LOCUS_00220 1984 3147 gene locus_tag LOCUS_00230 1984 3147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00230 3161 4498 gene locus_tag LOCUS_00240 gene hemN 3161 4498 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120944.1 protein_id gnl|my_center|LOCUS_00240 4518 5075 gene locus_tag LOCUS_00250 4518 5075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 5103 6368 gene locus_tag LOCUS_00260 5103 6368 CDS product alkylhalidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117886.1 protein_id gnl|my_center|LOCUS_00260 6365 7660 gene locus_tag LOCUS_00270 6365 7660 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118182.1 protein_id gnl|my_center|LOCUS_00270 7671 8129 gene locus_tag LOCUS_00280 7671 8129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 8186 8713 gene locus_tag LOCUS_00290 8186 8713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 8724 10004 gene locus_tag LOCUS_00300 gene ftsA 8724 10004 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122747.1 protein_id gnl|my_center|LOCUS_00300 10027 10716 gene locus_tag LOCUS_00310 gene lolD 10027 10716 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AT2 protein_id gnl|my_center|LOCUS_00310 10721 14134 gene locus_tag LOCUS_00320 10721 14134 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121231.1 protein_id gnl|my_center|LOCUS_00320 14140 14883 gene locus_tag LOCUS_00330 14140 14883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 14976 17285 gene locus_tag LOCUS_00340 14976 17285 CDS product filamin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121212.1 protein_id gnl|my_center|LOCUS_00340 17352 18692 gene locus_tag LOCUS_00350 17352 18692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121211.1 protein_id gnl|my_center|LOCUS_00350 19008 19919 gene locus_tag LOCUS_00360 19008 19919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 19916 21205 gene locus_tag LOCUS_00370 19916 21205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 22119 21214 gene locus_tag LOCUS_00380 22119 21214 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719409.1 protein_id gnl|my_center|LOCUS_00380 22304 22744 gene locus_tag LOCUS_00390 22304 22744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 22796 23638 gene locus_tag LOCUS_00400 22796 23638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 >Feature sequence003 2857 1826 gene locus_tag LOCUS_00410 2857 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51040 protein_id gnl|my_center|LOCUS_00410 2973 4064 gene locus_tag LOCUS_00420 gene prfA 2973 4064 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67032 protein_id gnl|my_center|LOCUS_00420 4057 4935 gene locus_tag LOCUS_00430 gene prmC 4057 4935 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CG70 protein_id gnl|my_center|LOCUS_00430 7240 4943 gene locus_tag LOCUS_00440 gene prc 7240 4943 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329904.1 protein_id gnl|my_center|LOCUS_00440 8219 7263 gene locus_tag LOCUS_00450 8219 7263 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403454.1 protein_id gnl|my_center|LOCUS_00450 9669 8308 gene locus_tag LOCUS_00460 9669 8308 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403748.1 protein_id gnl|my_center|LOCUS_00460 9842 11428 gene locus_tag LOCUS_00470 9842 11428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 11449 11733 gene locus_tag LOCUS_00480 11449 11733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 12902 11910 gene locus_tag LOCUS_00490 12902 11910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 14449 12899 gene locus_tag LOCUS_00500 gene zwf 14449 12899 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WE89 protein_id gnl|my_center|LOCUS_00500 14912 14463 gene locus_tag LOCUS_00510 14912 14463 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MB82 protein_id gnl|my_center|LOCUS_00510 17440 14909 gene locus_tag LOCUS_00520 gene hrpB 17440 14909 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942482.1 protein_id gnl|my_center|LOCUS_00520 17709 17942 gene locus_tag LOCUS_00530 17709 17942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 >Feature sequence004 1690 584 gene locus_tag LOCUS_00540 1690 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 5427 1801 gene locus_tag LOCUS_00550 5427 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 6682 5588 gene locus_tag LOCUS_00560 6682 5588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 7370 6840 gene locus_tag LOCUS_00570 7370 6840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 8224 7367 gene locus_tag LOCUS_00580 gene srtN 8224 7367 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943708.1 protein_id gnl|my_center|LOCUS_00580 8450 9301 gene locus_tag LOCUS_00590 8450 9301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 10193 9336 gene locus_tag LOCUS_00600 10193 9336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 11209 10232 gene locus_tag LOCUS_00610 11209 10232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121108.1 protein_id gnl|my_center|LOCUS_00610 11874 12407 gene locus_tag LOCUS_00620 11874 12407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 12456 14135 gene locus_tag LOCUS_00630 12456 14135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 15495 14143 gene locus_tag LOCUS_00640 gene arsA 15495 14143 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122622.1 protein_id gnl|my_center|LOCUS_00640 >Feature sequence005 2 535 gene locus_tag LOCUS_00650 2 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 755 1783 gene locus_tag LOCUS_00660 755 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 1820 3097 gene locus_tag LOCUS_00670 1820 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 4472 3180 gene locus_tag LOCUS_00680 4472 3180 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887812.1 protein_id gnl|my_center|LOCUS_00680 5559 4498 gene locus_tag LOCUS_00690 5559 4498 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887814.1 protein_id gnl|my_center|LOCUS_00690 6404 7126 gene locus_tag LOCUS_00700 6404 7126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 7123 8202 gene locus_tag LOCUS_00710 gene dcm 7123 8202 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6MU27 protein_id gnl|my_center|LOCUS_00710 8195 9637 gene locus_tag LOCUS_00720 8195 9637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 9988 11733 gene locus_tag LOCUS_00730 9988 11733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681239.1 protein_id gnl|my_center|LOCUS_00730 11916 12872 gene locus_tag LOCUS_00740 11916 12872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109315.1 protein_id gnl|my_center|LOCUS_00740 13626 13000 gene locus_tag LOCUS_00750 13626 13000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 >Feature sequence006 2007 805 gene locus_tag LOCUS_00760 2007 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120898.1 protein_id gnl|my_center|LOCUS_00760 3237 2026 gene locus_tag LOCUS_00770 3237 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 3335 4612 gene locus_tag LOCUS_00780 3335 4612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117743.1 protein_id gnl|my_center|LOCUS_00780 4618 5514 gene locus_tag LOCUS_00790 gene xynB 4618 5514 CDS product xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038153.1 protein_id gnl|my_center|LOCUS_00790 6985 5519 gene locus_tag LOCUS_00800 6985 5519 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121087.1 protein_id gnl|my_center|LOCUS_00800 8158 7292 gene locus_tag LOCUS_00810 8158 7292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 9564 8155 gene locus_tag LOCUS_00820 9564 8155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 10227 9613 gene locus_tag LOCUS_00830 10227 9613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 10255 10662 gene locus_tag LOCUS_00840 10255 10662 CDS product acyl-CoA thioester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811622.1 protein_id gnl|my_center|LOCUS_00840 11213 10668 gene locus_tag LOCUS_00850 gene aroK 11213 10668 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SII4 protein_id gnl|my_center|LOCUS_00850 11306 11752 gene locus_tag LOCUS_00860 11306 11752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 11764 12855 gene locus_tag LOCUS_00870 11764 12855 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC70 protein_id gnl|my_center|LOCUS_00870 >Feature sequence007 89 925 gene locus_tag LOCUS_00880 gene ykwC 89 925 CDS product putative oxidoreductase YkwC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34948 protein_id gnl|my_center|LOCUS_00880 1043 2302 gene locus_tag LOCUS_00890 gene araN 1043 2302 CDS product putative arabinose-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94528 protein_id gnl|my_center|LOCUS_00890 2326 3342 gene locus_tag LOCUS_00900 2326 3342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 3402 4184 gene locus_tag LOCUS_00910 3402 4184 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303949.1 protein_id gnl|my_center|LOCUS_00910 4202 5323 gene locus_tag LOCUS_00920 4202 5323 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228038.1 protein_id gnl|my_center|LOCUS_00920 5320 6351 gene locus_tag LOCUS_00930 gene adh 5320 6351 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324237.1 protein_id gnl|my_center|LOCUS_00930 6453 8213 gene locus_tag LOCUS_00940 6453 8213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 8248 9105 gene locus_tag LOCUS_00950 8248 9105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 9799 9113 gene locus_tag LOCUS_00960 9799 9113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 9945 11240 gene locus_tag LOCUS_00970 9945 11240 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390410.1 protein_id gnl|my_center|LOCUS_00970 11350 11730 gene locus_tag LOCUS_00980 gene crcB 11350 11730 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61389 protein_id gnl|my_center|LOCUS_00980 11727 12674 gene locus_tag LOCUS_00990 11727 12674 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY9 protein_id gnl|my_center|LOCUS_00990 >Feature sequence008 1088 474 gene locus_tag LOCUS_01000 1088 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 2170 1160 gene locus_tag LOCUS_01010 gene fmt 2170 1160 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GW4 protein_id gnl|my_center|LOCUS_01010 3645 2251 gene locus_tag LOCUS_01020 3645 2251 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460200.1 protein_id gnl|my_center|LOCUS_01020 4852 3656 gene locus_tag LOCUS_01030 4852 3656 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJ87 protein_id gnl|my_center|LOCUS_01030 5334 4852 gene locus_tag LOCUS_01040 5334 4852 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392703.1 protein_id gnl|my_center|LOCUS_01040 5985 5419 gene locus_tag LOCUS_01050 5985 5419 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933033.1 protein_id gnl|my_center|LOCUS_01050 6521 5982 gene locus_tag LOCUS_01060 6521 5982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 7492 6518 gene locus_tag LOCUS_01070 7492 6518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 7749 8075 gene locus_tag LOCUS_01080 7749 8075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 9112 8093 gene locus_tag LOCUS_01090 gene galE-1 9112 8093 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705040.1 protein_id gnl|my_center|LOCUS_01090 10454 9120 gene locus_tag LOCUS_01100 10454 9120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 11374 10454 gene locus_tag LOCUS_01110 11374 10454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 12703 11618 gene locus_tag LOCUS_01120 gene bplD 12703 11618 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929613.1 protein_id gnl|my_center|LOCUS_01120 13220 12711 gene locus_tag LOCUS_01130 13220 12711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 >Feature sequence009 2031 790 gene locus_tag LOCUS_01140 gene nuoD 2031 790 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GA5 protein_id gnl|my_center|LOCUS_01140 2642 2028 gene locus_tag LOCUS_01150 2642 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 3178 2654 gene locus_tag LOCUS_01160 3178 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 3379 3468 gene locus_tag LOCUS_t00010 3379 3468 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6792 3496 gene locus_tag LOCUS_01170 6792 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 9244 7979 gene locus_tag LOCUS_01180 gene ftsZ 9244 7979 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45500 protein_id gnl|my_center|LOCUS_01180 10461 9286 gene locus_tag LOCUS_01190 gene ftsA 10461 9286 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748E0 protein_id gnl|my_center|LOCUS_01190 11397 10480 gene locus_tag LOCUS_01200 11397 10480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 <12141 11397 gene locus_tag LOCUS_01210 <12141 11397 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YFT1:D-alanine--D-alanine ligase >Feature sequence010 3948 4841 gene locus_tag LOCUS_01220 3948 4841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 4896 5489 gene locus_tag LOCUS_01230 gene trpG 4896 5489 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943018.1 protein_id gnl|my_center|LOCUS_01230 5496 5957 gene locus_tag LOCUS_01240 5496 5957 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459010.1 protein_id gnl|my_center|LOCUS_01240 5950 6420 gene locus_tag LOCUS_01250 5950 6420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 6430 6774 gene locus_tag LOCUS_01260 6430 6774 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_01260 6759 7865 gene locus_tag LOCUS_01270 6759 7865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 7877 9919 gene locus_tag LOCUS_01280 7877 9919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 11200 9926 gene locus_tag LOCUS_01290 11200 9926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 <11813 11202 gene locus_tag LOCUS_01300 <11813 11202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S508:sulfate adenylyltransferase >Feature sequence011 314 1084 gene locus_tag LOCUS_01310 314 1084 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584118.1 protein_id gnl|my_center|LOCUS_01310 1111 1965 gene locus_tag LOCUS_01320 1111 1965 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338042.1 protein_id gnl|my_center|LOCUS_01320 1962 2750 gene locus_tag LOCUS_01330 1962 2750 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200881.1 protein_id gnl|my_center|LOCUS_01330 2767 3963 gene locus_tag LOCUS_01340 2767 3963 CDS product hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405472.1 protein_id gnl|my_center|LOCUS_01340 4022 5113 gene locus_tag LOCUS_01350 4022 5113 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_01350 5133 6179 gene locus_tag LOCUS_01360 5133 6179 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120389.1 protein_id gnl|my_center|LOCUS_01360 6236 6760 gene locus_tag LOCUS_01370 6236 6760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 7745 6765 gene locus_tag LOCUS_01380 7745 6765 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814134.1 protein_id gnl|my_center|LOCUS_01380 8849 7818 gene locus_tag LOCUS_01390 8849 7818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123542.1 protein_id gnl|my_center|LOCUS_01390 9025 9714 gene locus_tag LOCUS_01400 9025 9714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 10989 9757 gene locus_tag LOCUS_01410 10989 9757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 <11609 11036 gene locus_tag LOCUS_01420 <11609 11036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O67085:P-protein >Feature sequence012 6207 7643 gene locus_tag LOCUS_01430 6207 7643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_01430 9193 7673 gene locus_tag LOCUS_01440 9193 7673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 10321 9203 gene locus_tag LOCUS_01450 10321 9203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 11008 10325 gene locus_tag LOCUS_01460 11008 10325 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814522.1 protein_id gnl|my_center|LOCUS_01460 >Feature sequence013 <1 1616 gene locus_tag LOCUS_01470 <1 1616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q6HM12:chaperone protein ClpB 3119 1635 gene locus_tag LOCUS_01480 3119 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 3759 3124 gene locus_tag LOCUS_01490 3759 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 4656 3778 gene locus_tag LOCUS_01500 4656 3778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 6506 4884 gene locus_tag LOCUS_01510 gene pyrG 6506 4884 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJ86 protein_id gnl|my_center|LOCUS_01510 7401 7916 gene locus_tag LOCUS_01520 7401 7916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 7921 9756 gene locus_tag LOCUS_01530 gene sdhA 7921 9756 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224226.1 protein_id gnl|my_center|LOCUS_01530 9749 10525 gene locus_tag LOCUS_01540 9749 10525 CDS product fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726931.1 protein_id gnl|my_center|LOCUS_01540 >Feature sequence014 764 3991 gene locus_tag LOCUS_01550 764 3991 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0E1 protein_id gnl|my_center|LOCUS_01550 5191 4007 gene locus_tag LOCUS_01560 gene tyrS 5191 4007 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYU8 protein_id gnl|my_center|LOCUS_01560 5335 5805 gene locus_tag LOCUS_01570 5335 5805 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979852.1 protein_id gnl|my_center|LOCUS_01570 5872 8580 gene locus_tag LOCUS_01580 gene citB 5872 8580 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWD2 protein_id gnl|my_center|LOCUS_01580 8599 9108 gene locus_tag LOCUS_01590 8599 9108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 9128 10579 gene locus_tag LOCUS_01600 9128 10579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 >Feature sequence015 1329 1162 gene locus_tag LOCUS_01610 1329 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 4778 1326 gene locus_tag LOCUS_01620 4778 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 4962 5954 gene locus_tag LOCUS_01630 4962 5954 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448524.1 protein_id gnl|my_center|LOCUS_01630 7057 5921 gene locus_tag LOCUS_01640 7057 5921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 7319 7789 gene locus_tag LOCUS_01650 7319 7789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 7806 8372 gene locus_tag LOCUS_01660 7806 8372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 >Feature sequence016 1856 2089 gene locus_tag LOCUS_01670 1856 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 3073 2324 gene locus_tag LOCUS_01680 3073 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 4796 3093 gene locus_tag LOCUS_01690 4796 3093 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_233035.2 protein_id gnl|my_center|LOCUS_01690 5167 6735 gene locus_tag LOCUS_01700 5167 6735 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943658.1 protein_id gnl|my_center|LOCUS_01700 8165 6738 gene locus_tag LOCUS_01710 8165 6738 CDS product flotillin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764424.1 protein_id gnl|my_center|LOCUS_01710 8809 8216 gene locus_tag LOCUS_01720 8809 8216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 9489 8947 gene locus_tag LOCUS_01730 9489 8947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 10173 9514 gene locus_tag LOCUS_01740 10173 9514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 >Feature sequence017 <1 742 gene locus_tag LOCUS_01750 <1 742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405197.1:carboxypeptidase M32 2204 744 gene locus_tag LOCUS_01760 2204 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 2511 3602 gene locus_tag LOCUS_01770 gene aroC 2511 3602 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLM1 protein_id gnl|my_center|LOCUS_01770 3604 4362 gene locus_tag LOCUS_01780 3604 4362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 4414 4500 gene locus_tag LOCUS_t00020 4414 4500 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4554 5387 gene locus_tag LOCUS_01790 4554 5387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 6775 5744 gene locus_tag LOCUS_01800 gene korB 6775 5744 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121170.1 protein_id gnl|my_center|LOCUS_01800 8636 6792 gene locus_tag LOCUS_01810 gene korA 8636 6792 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324152.1 protein_id gnl|my_center|LOCUS_01810 9389 8820 gene locus_tag LOCUS_01820 9389 8820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 9878 9402 gene locus_tag LOCUS_01830 9878 9402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 9965 9888 gene locus_tag LOCUS_t00030 9965 9888 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence018 2654 1365 gene locus_tag LOCUS_01840 2654 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 3074 3592 gene locus_tag LOCUS_01850 3074 3592 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331069.1 protein_id gnl|my_center|LOCUS_01850 3671 4897 gene locus_tag LOCUS_01860 3671 4897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117743.1 protein_id gnl|my_center|LOCUS_01860 5509 4898 gene locus_tag LOCUS_01870 5509 4898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 5613 7904 gene locus_tag LOCUS_01880 5613 7904 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123369.1 protein_id gnl|my_center|LOCUS_01880 >Feature sequence019 4213 2207 gene locus_tag LOCUS_01890 4213 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 5112 4213 gene locus_tag LOCUS_01900 5112 4213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120923.1 protein_id gnl|my_center|LOCUS_01900 6171 5146 gene locus_tag LOCUS_01910 gene moxR 6171 5146 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_01910 6177 6341 gene locus_tag LOCUS_01920 6177 6341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 7429 6350 gene locus_tag LOCUS_01930 7429 6350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 >Feature sequence020 1070 774 gene locus_tag LOCUS_01940 gene groS 1070 774 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30780 protein_id gnl|my_center|LOCUS_01940 3077 1170 gene locus_tag LOCUS_01950 gene dnaK 3077 1170 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H59 protein_id gnl|my_center|LOCUS_01950 3680 3351 gene locus_tag LOCUS_01960 gene rbfA 3680 3351 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2Y9 protein_id gnl|my_center|LOCUS_01960 6039 3721 gene locus_tag LOCUS_01970 gene infB 6039 3721 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P17889 protein_id gnl|my_center|LOCUS_01970 7339 6089 gene locus_tag LOCUS_01980 gene nusA 7339 6089 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MC64 protein_id gnl|my_center|LOCUS_01980 8671 7454 gene locus_tag LOCUS_01990 8671 7454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 >Feature sequence021 262 1032 gene locus_tag LOCUS_02000 262 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 1639 2031 gene locus_tag LOCUS_02010 1639 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 2083 2961 gene locus_tag LOCUS_02020 2083 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 2995 3867 gene locus_tag LOCUS_02030 2995 3867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 3884 4315 gene locus_tag LOCUS_02040 3884 4315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 4312 5436 gene locus_tag LOCUS_02050 4312 5436 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875973.1 protein_id gnl|my_center|LOCUS_02050 5433 6209 gene locus_tag LOCUS_02060 5433 6209 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780983.1 protein_id gnl|my_center|LOCUS_02060 6230 7444 gene locus_tag LOCUS_02070 6230 7444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 7449 8276 gene locus_tag LOCUS_02080 7449 8276 CDS product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038826.1 protein_id gnl|my_center|LOCUS_02080 >Feature sequence022 135 962 gene locus_tag LOCUS_02090 gene suhB 135 962 CDS product fructose-1,6-bisphosphatase/inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67791 protein_id gnl|my_center|LOCUS_02090 1734 976 gene locus_tag LOCUS_02100 1734 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 1930 3606 gene locus_tag LOCUS_02110 1930 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 5919 3625 gene locus_tag LOCUS_02120 5919 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 7703 5919 gene locus_tag LOCUS_02130 7703 5919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 <8738 7730 gene locus_tag LOCUS_02140 <8738 7730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583661.1:2-alkenal reductase >Feature sequence023 5328 1261 gene locus_tag LOCUS_02150 5328 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 6961 5366 gene locus_tag LOCUS_02160 6961 5366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 8411 6951 gene locus_tag LOCUS_02170 8411 6951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 >Feature sequence024 165 971 gene locus_tag LOCUS_02180 165 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 999 2324 gene locus_tag LOCUS_02190 999 2324 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119046.1 protein_id gnl|my_center|LOCUS_02190 3884 2331 gene locus_tag LOCUS_02200 3884 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 6122 4056 gene locus_tag LOCUS_02210 6122 4056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 7548 6142 gene locus_tag LOCUS_02220 7548 6142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 7952 7698 gene locus_tag LOCUS_02230 7952 7698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 >Feature sequence025 44 119 gene locus_tag LOCUS_t00040 44 119 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 145 348 gene locus_tag LOCUS_02240 145 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 371 949 gene locus_tag LOCUS_02250 gene nusG 371 949 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y1 protein_id gnl|my_center|LOCUS_02250 962 1387 gene locus_tag LOCUS_02260 gene rplK 962 1387 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EG5 protein_id gnl|my_center|LOCUS_02260 1414 2106 gene locus_tag LOCUS_02270 gene rplA 1414 2106 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CYP6 protein_id gnl|my_center|LOCUS_02270 2126 2635 gene locus_tag LOCUS_02280 2126 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 2768 3157 gene locus_tag LOCUS_02290 gene rplL 2768 3157 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAX1 protein_id gnl|my_center|LOCUS_02290 3280 7065 gene locus_tag LOCUS_02300 gene rpoB 3280 7065 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CE09 protein_id gnl|my_center|LOCUS_02300 >Feature sequence026 1367 591 gene locus_tag LOCUS_02310 gene gcd1 1367 591 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859505.1 protein_id gnl|my_center|LOCUS_02310 2182 1364 gene locus_tag LOCUS_02320 2182 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 4050 2200 gene locus_tag LOCUS_02330 4050 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 4980 4186 gene locus_tag LOCUS_02340 4980 4186 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391964.1 protein_id gnl|my_center|LOCUS_02340 5707 4955 gene locus_tag LOCUS_02350 5707 4955 CDS product tagatose 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328799.1 protein_id gnl|my_center|LOCUS_02350 6672 5779 gene locus_tag LOCUS_02360 6672 5779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 7466 6714 gene locus_tag LOCUS_02370 7466 6714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 <8399 7519 gene locus_tag LOCUS_02380 <8399 7519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000432947.1:radical SAM protein >Feature sequence027 828 3014 gene locus_tag LOCUS_02390 828 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 3021 6161 gene locus_tag LOCUS_02400 3021 6161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 6255 7859 gene locus_tag LOCUS_02410 6255 7859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 >Feature sequence028 3 380 gene locus_tag LOCUS_02420 3 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 447 1577 gene locus_tag LOCUS_02430 447 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 2897 1593 gene locus_tag LOCUS_02440 2897 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 4001 2907 gene locus_tag LOCUS_02450 gene hisC2 4001 2907 CDS product histidinol-phosphate aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ68 protein_id gnl|my_center|LOCUS_02450 4144 5073 gene locus_tag LOCUS_02460 4144 5073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 5076 5798 gene locus_tag LOCUS_02470 5076 5798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 7020 5812 gene locus_tag LOCUS_02480 gene rumA 7020 5812 CDS product 23S rRNA (uracil-5-)-methyltransferase RumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546143.1 protein_id gnl|my_center|LOCUS_02480 7217 7888 gene locus_tag LOCUS_02490 gene spoU 7217 7888 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001969649.1 protein_id gnl|my_center|LOCUS_02490 >Feature sequence029 800 291 gene locus_tag LOCUS_02500 800 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 1013 1657 gene locus_tag LOCUS_02510 1013 1657 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258352.1 protein_id gnl|my_center|LOCUS_02510 1654 2364 gene locus_tag LOCUS_02520 1654 2364 CDS product D-arabino 3-hexulose 6-phosphate aldehyde lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120388.1 protein_id gnl|my_center|LOCUS_02520 2371 3393 gene locus_tag LOCUS_02530 2371 3393 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120389.1 protein_id gnl|my_center|LOCUS_02530 3427 4200 gene locus_tag LOCUS_02540 3427 4200 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958120.1 protein_id gnl|my_center|LOCUS_02540 4197 5087 gene locus_tag LOCUS_02550 4197 5087 CDS product myo-inositol catabolism protein IolH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120390.1 protein_id gnl|my_center|LOCUS_02550 5797 5093 gene locus_tag LOCUS_02560 5797 5093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 6730 5885 gene locus_tag LOCUS_02570 6730 5885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 >Feature sequence030 490 843 gene locus_tag LOCUS_02580 490 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 1099 2265 gene locus_tag LOCUS_02590 gene dnaN 1099 2265 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O84078 protein_id gnl|my_center|LOCUS_02590 3276 2350 gene locus_tag LOCUS_02600 gene moaA 3276 2350 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39757 protein_id gnl|my_center|LOCUS_02600 3437 4636 gene locus_tag LOCUS_02610 gene moeA 3437 4636 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057204.1 protein_id gnl|my_center|LOCUS_02610 4646 5173 gene locus_tag LOCUS_02620 gene moaC 4646 5173 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBW9 protein_id gnl|my_center|LOCUS_02620 5177 5776 gene locus_tag LOCUS_02630 5177 5776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02630 5784 6032 gene locus_tag LOCUS_02640 5784 6032 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057201.1 protein_id gnl|my_center|LOCUS_02640 6036 6479 gene locus_tag LOCUS_02650 gene moaE 6036 6479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057200.1 protein_id gnl|my_center|LOCUS_02650 6533 8035 gene locus_tag LOCUS_02660 gene gndA 6533 8035 CDS product 6-phosphogluconate dehydrogenase, NADP(+)-dependent, decarboxylating inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80859 protein_id gnl|my_center|LOCUS_02660 >Feature sequence031 336 722 gene locus_tag LOCUS_02670 gene purE 336 722 CDS product phosphoribosylaminoimidazole carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DYW9 protein_id gnl|my_center|LOCUS_02670 1319 738 gene locus_tag LOCUS_02680 gene plsC 1319 738 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873822.1 protein_id gnl|my_center|LOCUS_02680 2131 1460 gene locus_tag LOCUS_02690 gene cmk 2131 1460 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B9R0 protein_id gnl|my_center|LOCUS_02690 3477 2128 gene locus_tag LOCUS_02700 gene aroA 3477 2128 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QX9 protein_id gnl|my_center|LOCUS_02700 4314 3496 gene locus_tag LOCUS_02710 4314 3496 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545810.1 protein_id gnl|my_center|LOCUS_02710 5023 5697 gene locus_tag LOCUS_02720 5023 5697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 5675 6964 gene locus_tag LOCUS_02730 gene xseA 5675 6964 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXL8 protein_id gnl|my_center|LOCUS_02730 >Feature sequence032 1635 133 gene locus_tag LOCUS_02740 1635 133 CDS product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403981.1 protein_id gnl|my_center|LOCUS_02740 2554 1649 gene locus_tag LOCUS_02750 2554 1649 CDS product 2-deoxyribose-5-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403980.1 protein_id gnl|my_center|LOCUS_02750 3763 2561 gene locus_tag LOCUS_02760 3763 2561 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813169.1 protein_id gnl|my_center|LOCUS_02760 3802 4695 gene locus_tag LOCUS_02770 3802 4695 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727359.1 protein_id gnl|my_center|LOCUS_02770 5210 4662 gene locus_tag LOCUS_02780 5210 4662 CDS product NAD(P)H-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4D4 protein_id gnl|my_center|LOCUS_02780 5809 5207 gene locus_tag LOCUS_02790 gene thrH 5809 5207 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116438.1 protein_id gnl|my_center|LOCUS_02790 7305 5824 gene locus_tag LOCUS_02800 gene gltD 7305 5824 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330518.1 protein_id gnl|my_center|LOCUS_02800 <8071 7337 gene locus_tag LOCUS_02810 <8071 7337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_661305.1:glutamate synthase, large subunit >Feature sequence033 1119 115 gene locus_tag LOCUS_02820 gene bioB 1119 115 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CMG4 protein_id gnl|my_center|LOCUS_02820 2498 1116 gene locus_tag LOCUS_02830 gene bioA 2498 1116 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CT9 protein_id gnl|my_center|LOCUS_02830 3442 2558 gene locus_tag LOCUS_02840 3442 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 4029 3439 gene locus_tag LOCUS_02850 gene purN 4029 3439 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72E43 protein_id gnl|my_center|LOCUS_02850 4564 4043 gene locus_tag LOCUS_02860 4564 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 5685 4561 gene locus_tag LOCUS_02870 gene dnaJ 5685 4561 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WP1 protein_id gnl|my_center|LOCUS_02870 6348 5830 gene locus_tag LOCUS_02880 gene grpE 6348 5830 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0DJM3 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02880 7392 6436 gene locus_tag LOCUS_02890 gene pmi 7392 6436 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122560.1 protein_id gnl|my_center|LOCUS_02890 >Feature sequence034 3040 1364 gene locus_tag LOCUS_02900 3040 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 5450 3057 gene locus_tag LOCUS_02910 5450 3057 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122099.1 protein_id gnl|my_center|LOCUS_02910 7706 5472 gene locus_tag LOCUS_02920 7706 5472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117947.1 protein_id gnl|my_center|LOCUS_02920 >Feature sequence035 468 2150 gene locus_tag LOCUS_02930 468 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 2154 2807 gene locus_tag LOCUS_02940 2154 2807 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024290.1 protein_id gnl|my_center|LOCUS_02940 2850 3830 gene locus_tag LOCUS_02950 2850 3830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 5433 3853 gene locus_tag LOCUS_02960 5433 3853 CDS product two-component hybrid sensor and regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085076.1 protein_id gnl|my_center|LOCUS_02960 5797 5438 gene locus_tag LOCUS_02970 5797 5438 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969399.1 protein_id gnl|my_center|LOCUS_02970 7248 5800 gene locus_tag LOCUS_02980 7248 5800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02980 >Feature sequence036 296 1162 gene locus_tag LOCUS_02990 gene ilvE 296 1162 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336792.1 protein_id gnl|my_center|LOCUS_02990 1301 1822 gene locus_tag LOCUS_03000 1301 1822 CDS product excinuclease Uvr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357604.1 protein_id gnl|my_center|LOCUS_03000 1842 2909 gene locus_tag LOCUS_03010 gene mcsB 1842 2909 CDS product protein-arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HPT7 protein_id gnl|my_center|LOCUS_03010 2952 5444 gene locus_tag LOCUS_03020 gene clpC 2952 5444 CDS product ATP-dependent Clp protease ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121080.1 protein_id gnl|my_center|LOCUS_03020 5466 5891 gene locus_tag LOCUS_03030 5466 5891 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770040.1 protein_id gnl|my_center|LOCUS_03030 6382 5888 gene locus_tag LOCUS_03040 gene ispF 6382 5888 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57708 protein_id gnl|my_center|LOCUS_03040 7086 6379 gene locus_tag LOCUS_03050 gene ispD 7086 6379 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P77 protein_id gnl|my_center|LOCUS_03050 7802 7083 gene locus_tag LOCUS_03060 gene pyrF 7802 7083 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ97 protein_id gnl|my_center|LOCUS_03060 >Feature sequence037 24 3050 gene locus_tag LOCUS_03070 24 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 3071 4408 gene locus_tag LOCUS_03080 3071 4408 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108686.1 protein_id gnl|my_center|LOCUS_03080 4427 5116 gene locus_tag LOCUS_03090 4427 5116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545169.1 protein_id gnl|my_center|LOCUS_03090 5169 6038 gene locus_tag LOCUS_03100 5169 6038 CDS product 5'-3' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67550 protein_id gnl|my_center|LOCUS_03100 6130 7005 gene locus_tag LOCUS_03110 gene hisG 6130 7005 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KB10 protein_id gnl|my_center|LOCUS_03110 >Feature sequence038 700 1194 gene locus_tag LOCUS_03120 gene fliW 700 1194 CDS product flagellar assembly factor FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96503 protein_id gnl|my_center|LOCUS_03120 1188 1505 gene locus_tag LOCUS_03130 1188 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 1724 4783 gene locus_tag LOCUS_03140 1724 4783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123552.1 protein_id gnl|my_center|LOCUS_03140 4829 5647 gene locus_tag LOCUS_03150 4829 5647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 5675 6121 gene locus_tag LOCUS_03160 5675 6121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 >Feature sequence039 1910 1644 gene locus_tag LOCUS_03170 1910 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 2071 2625 gene locus_tag LOCUS_03180 2071 2625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 2622 4382 gene locus_tag LOCUS_03190 2622 4382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 4453 5631 gene locus_tag LOCUS_03200 4453 5631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 6332 5679 gene locus_tag LOCUS_03210 gene nth 6332 5679 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGP4 protein_id gnl|my_center|LOCUS_03210 >Feature sequence040 1091 198 gene locus_tag LOCUS_03220 gene hemF 1091 198 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43898 protein_id gnl|my_center|LOCUS_03220 1483 1856 gene locus_tag LOCUS_tm00010 1483 1856 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 1954 3261 gene locus_tag LOCUS_03230 1954 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 3258 4121 gene locus_tag LOCUS_03240 3258 4121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 4215 4454 gene locus_tag LOCUS_03250 4215 4454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 4457 5407 gene locus_tag LOCUS_03260 4457 5407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 5404 6765 gene locus_tag LOCUS_03270 5404 6765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 6894 7241 gene locus_tag LOCUS_03280 6894 7241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 >Feature sequence041 400 1533 gene locus_tag LOCUS_03290 400 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 2414 1587 gene locus_tag LOCUS_03300 2414 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526695.1 protein_id gnl|my_center|LOCUS_03300 2584 4110 gene locus_tag LOCUS_03310 gene yqeZ 2584 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54465 protein_id gnl|my_center|LOCUS_03310 4107 4574 gene locus_tag LOCUS_03320 4107 4574 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812221.1 protein_id gnl|my_center|LOCUS_03320 4638 5648 gene locus_tag LOCUS_03330 4638 5648 CDS product UPF0365 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SJG0 protein_id gnl|my_center|LOCUS_03330 5677 6225 gene locus_tag LOCUS_03340 5677 6225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 6981 6235 gene locus_tag LOCUS_03350 6981 6235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 >Feature sequence042 1963 632 gene locus_tag LOCUS_03360 1963 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_03360 5418 1972 gene locus_tag LOCUS_03370 5418 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 7314 5593 gene locus_tag LOCUS_03380 gene deaD 7314 5593 CDS product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R2A4 protein_id gnl|my_center|LOCUS_03380 >Feature sequence043 542 2644 gene locus_tag LOCUS_03390 542 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 2641 5007 gene locus_tag LOCUS_03400 2641 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 5004 5348 gene locus_tag LOCUS_03410 5004 5348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 5383 5964 gene locus_tag LOCUS_03420 5383 5964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 6170 6913 gene locus_tag LOCUS_03430 6170 6913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 >Feature sequence044 1361 141 gene locus_tag LOCUS_03440 gene aroB 1361 141 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368549.1 protein_id gnl|my_center|LOCUS_03440 2284 1358 gene locus_tag LOCUS_03450 2284 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 3463 2288 gene locus_tag LOCUS_03460 3463 2288 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368548.1 protein_id gnl|my_center|LOCUS_03460 3687 4205 gene locus_tag LOCUS_03470 3687 4205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 4202 4771 gene locus_tag LOCUS_03480 4202 4771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 4815 6014 gene locus_tag LOCUS_03490 4815 6014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 >Feature sequence045 1331 2038 gene locus_tag LOCUS_03500 1331 2038 CDS product Tol-Pal system subunit TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597405.1 protein_id gnl|my_center|LOCUS_03500 2064 2489 gene locus_tag LOCUS_03510 gene tolR 2064 2489 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310275.1 protein_id gnl|my_center|LOCUS_03510 2821 3414 gene locus_tag LOCUS_03520 2821 3414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 5712 3616 gene locus_tag LOCUS_03530 gene ppk 5712 3616 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S646 protein_id gnl|my_center|LOCUS_03530 6069 5749 gene locus_tag LOCUS_03540 6069 5749 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLD9 protein_id gnl|my_center|LOCUS_03540 <7286 6293 gene locus_tag LOCUS_03550 <7286 6293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460040.1:molecular chaperone HtpG >Feature sequence046 436 1674 gene locus_tag LOCUS_03560 436 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 1689 2807 gene locus_tag LOCUS_03570 1689 2807 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140877.1 protein_id gnl|my_center|LOCUS_03570 2817 4058 gene locus_tag LOCUS_03580 2817 4058 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946586.1 protein_id gnl|my_center|LOCUS_03580 4055 4747 gene locus_tag LOCUS_03590 gene lolD 4055 4747 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45247 protein_id gnl|my_center|LOCUS_03590 5390 4773 gene locus_tag LOCUS_03600 gene ruvA 5390 4773 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FUI2 protein_id gnl|my_center|LOCUS_03600 6118 5387 gene locus_tag LOCUS_03610 gene dapB 6118 5387 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SF5 protein_id gnl|my_center|LOCUS_03610 7020 6130 gene locus_tag LOCUS_03620 gene dapA 7020 6130 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67216 protein_id gnl|my_center|LOCUS_03620 >Feature sequence047 3285 115 gene locus_tag LOCUS_03630 3285 115 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_03630 4478 3282 gene locus_tag LOCUS_03640 4478 3282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 5905 4475 gene locus_tag LOCUS_03650 5905 4475 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766157.1 protein_id gnl|my_center|LOCUS_03650 6580 5912 gene locus_tag LOCUS_03660 6580 5912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 >Feature sequence048 1280 201 gene locus_tag LOCUS_03670 gene mnmA 1280 201 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRK0 protein_id gnl|my_center|LOCUS_03670 1359 3791 gene locus_tag LOCUS_03680 1359 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 5129 3798 gene locus_tag LOCUS_03690 5129 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 5226 6383 gene locus_tag LOCUS_03700 gene tgt 5226 6383 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183P1 protein_id gnl|my_center|LOCUS_03700 6985 6458 gene locus_tag LOCUS_03710 6985 6458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 7146 7220 gene locus_tag LOCUS_t00050 7146 7220 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence049 2028 622 gene locus_tag LOCUS_03720 2028 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_03720 3441 2125 gene locus_tag LOCUS_03730 3441 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122547.1 protein_id gnl|my_center|LOCUS_03730 5771 3453 gene locus_tag LOCUS_03740 5771 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122548.1 protein_id gnl|my_center|LOCUS_03740 6440 5862 gene locus_tag LOCUS_03750 6440 5862 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140820.1 protein_id gnl|my_center|LOCUS_03750 >Feature sequence050 1052 3169 gene locus_tag LOCUS_03760 1052 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 3174 3965 gene locus_tag LOCUS_03770 3174 3965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 4023 5015 gene locus_tag LOCUS_03780 4023 5015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 6650 5637 gene locus_tag LOCUS_03790 6650 5637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 <7191 6666 gene locus_tag LOCUS_03800 <7191 6666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123323.1:squalene--hopene cyclase >Feature sequence051 <1 701 gene locus_tag LOCUS_03810 <1 701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118427.1:NADH-dependent dehydrogenase 722 1483 gene locus_tag LOCUS_03820 722 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086626.1 protein_id gnl|my_center|LOCUS_03820 1817 1485 gene locus_tag LOCUS_03830 1817 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 1954 2760 gene locus_tag LOCUS_03840 1954 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 3484 2774 gene locus_tag LOCUS_03850 3484 2774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 3700 4494 gene locus_tag LOCUS_03860 3700 4494 CDS product putative isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I073 protein_id gnl|my_center|LOCUS_03860 5935 4505 gene locus_tag LOCUS_03870 gene yflS 5935 4505 CDS product putative malate transporter YflS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34726 protein_id gnl|my_center|LOCUS_03870 >Feature sequence052 762 169 gene locus_tag LOCUS_03880 762 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 1139 759 gene locus_tag LOCUS_03890 1139 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 1750 1142 gene locus_tag LOCUS_03900 1750 1142 CDS product RNA polymerase sigma24 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405466.1 protein_id gnl|my_center|LOCUS_03900 2265 3350 gene locus_tag LOCUS_03910 gene nrdB 2265 3350 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MK81 protein_id gnl|my_center|LOCUS_03910 3400 6654 gene locus_tag LOCUS_03920 gene nrdA 3400 6654 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MK29 protein_id gnl|my_center|LOCUS_03920 7014 6766 gene locus_tag LOCUS_03930 7014 6766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 >Feature sequence053 2868 124 gene locus_tag LOCUS_03940 2868 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 3437 2865 gene locus_tag LOCUS_03950 3437 2865 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121244.1 protein_id gnl|my_center|LOCUS_03950 4052 5323 gene locus_tag LOCUS_03960 4052 5323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 >Feature sequence054 <1 1300 gene locus_tag LOCUS_03970 <1 1300 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RH49:putative glycine dehydrogenase (decarboxylating) subunit 2 1568 2032 gene locus_tag LOCUS_03980 1568 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 2213 5161 gene locus_tag LOCUS_03990 2213 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 5183 5566 gene locus_tag LOCUS_04000 5183 5566 CDS product heat-shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760336.1 protein_id gnl|my_center|LOCUS_04000 6121 5585 gene locus_tag LOCUS_04010 gene dcd 6121 5585 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97N13 protein_id gnl|my_center|LOCUS_04010 <7037 6187 gene locus_tag LOCUS_04020 <7037 6187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8F454:DNA helicase >Feature sequence055 <1 564 gene locus_tag LOCUS_04030 <1 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121741.1:ATPase AAA 569 1510 gene locus_tag LOCUS_04040 569 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121742.1 protein_id gnl|my_center|LOCUS_04040 1507 3591 gene locus_tag LOCUS_04050 1507 3591 CDS product inter-alpha-trypsin inhibitor heavy chain H2 [precursor] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121743.1 protein_id gnl|my_center|LOCUS_04050 >Feature sequence056 1548 181 gene locus_tag LOCUS_04060 gene GALNS 1548 181 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121664.1 protein_id gnl|my_center|LOCUS_04060 1665 2009 gene locus_tag LOCUS_04070 1665 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 2028 2606 gene locus_tag LOCUS_04080 2028 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 4030 2657 gene locus_tag LOCUS_04090 4030 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 5472 4108 gene locus_tag LOCUS_04100 5472 4108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 6034 5582 gene locus_tag LOCUS_04110 6034 5582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 6135 6440 gene locus_tag LOCUS_04120 6135 6440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 >Feature sequence057 443 1735 gene locus_tag LOCUS_04130 443 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 2086 3675 gene locus_tag LOCUS_04140 gene cimA 2086 3675 CDS product (R)-citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66682 protein_id gnl|my_center|LOCUS_04140 4508 3672 gene locus_tag LOCUS_04150 4508 3672 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880185.1 protein_id gnl|my_center|LOCUS_04150 5782 4523 gene locus_tag LOCUS_04160 gene thrC 5782 4523 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942338.1 protein_id gnl|my_center|LOCUS_04160 6306 5674 gene locus_tag LOCUS_04170 6306 5674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 6586 6317 gene locus_tag LOCUS_04180 gene icmT 6586 6317 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946190.1 protein_id gnl|my_center|LOCUS_04180 >Feature sequence058 126 905 gene locus_tag LOCUS_04190 126 905 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_04190 1576 926 gene locus_tag LOCUS_04200 1576 926 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932468.1 protein_id gnl|my_center|LOCUS_04200 1736 1812 gene locus_tag LOCUS_t00060 1736 1812 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1935 2618 gene locus_tag LOCUS_04210 1935 2618 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529371.1 protein_id gnl|my_center|LOCUS_04210 3807 2674 gene locus_tag LOCUS_04220 3807 2674 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901552.1 protein_id gnl|my_center|LOCUS_04220 4065 4418 gene locus_tag LOCUS_04230 4065 4418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545636.1 protein_id gnl|my_center|LOCUS_04230 4415 5035 gene locus_tag LOCUS_04240 gene coaE 4415 5035 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34932 protein_id gnl|my_center|LOCUS_04240 5081 6778 gene locus_tag LOCUS_04250 5081 6778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 >Feature sequence059 1382 981 gene locus_tag LOCUS_04260 gene rpsI 1382 981 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HPM5 protein_id gnl|my_center|LOCUS_04260 1869 1390 gene locus_tag LOCUS_04270 gene rplM 1869 1390 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1G6 protein_id gnl|my_center|LOCUS_04270 1960 2970 gene locus_tag LOCUS_04280 1960 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 2967 3473 gene locus_tag LOCUS_04290 gene bar 2967 3473 CDS product phosphinothricin N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21861 protein_id gnl|my_center|LOCUS_04290 4469 3477 gene locus_tag LOCUS_04300 gene mdh 4469 3477 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4A2 protein_id gnl|my_center|LOCUS_04300 5572 4517 gene locus_tag LOCUS_04310 5572 4517 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIL5 protein_id gnl|my_center|LOCUS_04310 5639 6580 gene locus_tag LOCUS_04320 5639 6580 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887003.1 protein_id gnl|my_center|LOCUS_04320 >Feature sequence060 1159 551 gene locus_tag LOCUS_04330 1159 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 2290 1754 gene locus_tag LOCUS_04340 2290 1754 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73LE0 protein_id gnl|my_center|LOCUS_04340 3056 2298 gene locus_tag LOCUS_04350 gene truC 3056 2298 CDS product tRNA pseudouridine synthase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTL4 protein_id gnl|my_center|LOCUS_04350 4132 3053 gene locus_tag LOCUS_04360 4132 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 5089 4178 gene locus_tag LOCUS_04370 5089 4178 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URI8 protein_id gnl|my_center|LOCUS_04370 6657 5089 gene locus_tag LOCUS_04380 6657 5089 CDS product Mn(2+) transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122489.1 protein_id gnl|my_center|LOCUS_04380 6901 6740 gene locus_tag LOCUS_04390 6901 6740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 >Feature sequence061 1358 855 gene locus_tag LOCUS_04400 1358 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 2671 1427 gene locus_tag LOCUS_04410 2671 1427 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122959.1 protein_id gnl|my_center|LOCUS_04410 3926 2694 gene locus_tag LOCUS_04420 3926 2694 CDS product polyvinyl alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122626.1 protein_id gnl|my_center|LOCUS_04420 4573 4091 gene locus_tag LOCUS_04430 4573 4091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 4669 5385 gene locus_tag LOCUS_04440 4669 5385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 6072 5395 gene locus_tag LOCUS_04450 gene glgC 6072 5395 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037912.1 protein_id gnl|my_center|LOCUS_04450 <6869 6078 gene locus_tag LOCUS_04460 <6869 6078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958577.1:phosphotransferase >Feature sequence062 1 912 gene locus_tag LOCUS_04470 1 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 909 1490 gene locus_tag LOCUS_04480 gene pabA 909 1490 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601848.1 protein_id gnl|my_center|LOCUS_04480 1435 2235 gene locus_tag LOCUS_04490 1435 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 2279 3058 gene locus_tag LOCUS_04500 gene folP 2279 3058 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHM1 protein_id gnl|my_center|LOCUS_04500 3065 3415 gene locus_tag LOCUS_04510 3065 3415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 3405 3896 gene locus_tag LOCUS_04520 gene folK 3405 3896 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943608.1 protein_id gnl|my_center|LOCUS_04520 5954 3924 gene locus_tag LOCUS_04530 5954 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 6803 6069 gene locus_tag LOCUS_04540 6803 6069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 >Feature sequence063 1280 435 gene locus_tag LOCUS_04550 1280 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 1912 1277 gene locus_tag LOCUS_04560 1912 1277 CDS product 3'-exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938381.1 protein_id gnl|my_center|LOCUS_04560 2951 1932 gene locus_tag LOCUS_04570 2951 1932 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669065.1 protein_id gnl|my_center|LOCUS_04570 3119 4318 gene locus_tag LOCUS_04580 3119 4318 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393062.1 protein_id gnl|my_center|LOCUS_04580 4396 5361 gene locus_tag LOCUS_04590 gene msrP 4396 5361 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NRB1 protein_id gnl|my_center|LOCUS_04590 5374 6201 gene locus_tag LOCUS_04600 5374 6201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 >Feature sequence064 2400 22 gene locus_tag LOCUS_04610 2400 22 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546857.1 protein_id gnl|my_center|LOCUS_04610 3865 2423 gene locus_tag LOCUS_04620 gene dnaB 3865 2423 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EG4 protein_id gnl|my_center|LOCUS_04620 4370 3903 gene locus_tag LOCUS_04630 gene rplI 4370 3903 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67830 protein_id gnl|my_center|LOCUS_04630 4926 4408 gene locus_tag LOCUS_04640 gene ssb 4926 4408 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59932 protein_id gnl|my_center|LOCUS_04640 5225 4929 gene locus_tag LOCUS_04650 5225 4929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 5801 5229 gene locus_tag LOCUS_04660 gene pth 5801 5229 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN75 protein_id gnl|my_center|LOCUS_04660 6553 5867 gene locus_tag LOCUS_04670 gene rplY 6553 5867 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FE7 protein_id gnl|my_center|LOCUS_04670 6690 6764 gene locus_tag LOCUS_t00070 6690 6764 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence065 2045 1032 gene locus_tag LOCUS_04680 2045 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 2251 3843 gene locus_tag LOCUS_04690 2251 3843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 3997 4977 gene locus_tag LOCUS_04700 3997 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 5107 6684 gene locus_tag LOCUS_04710 5107 6684 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937421.1 protein_id gnl|my_center|LOCUS_04710 >Feature sequence066 <1 776 gene locus_tag LOCUS_04720 <1 776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403982.1:aldehyde dehydrogenase 773 1606 gene locus_tag LOCUS_04730 gene pnp 773 1606 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y5V2 protein_id gnl|my_center|LOCUS_04730 2561 1596 gene locus_tag LOCUS_04740 gene rbsK 2561 1596 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCH0 protein_id gnl|my_center|LOCUS_04740 3981 2554 gene locus_tag LOCUS_04750 3981 2554 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120982.1 protein_id gnl|my_center|LOCUS_04750 6071 3981 gene locus_tag LOCUS_04760 6071 3981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 >Feature sequence067 1489 677 gene locus_tag LOCUS_04770 1489 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 3009 1486 gene locus_tag LOCUS_04780 3009 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405278.1 protein_id gnl|my_center|LOCUS_04780 5766 3325 gene locus_tag LOCUS_04790 5766 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 <6723 5763 gene locus_tag LOCUS_04800 <6723 5763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405282.1:VWA domain-containing protein >Feature sequence068 463 1674 gene locus_tag LOCUS_04810 gene metK 463 1674 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPS4 protein_id gnl|my_center|LOCUS_04810 1696 3135 gene locus_tag LOCUS_04820 gene ahcY 1696 3135 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCH5 protein_id gnl|my_center|LOCUS_04820 3226 4215 gene locus_tag LOCUS_04830 gene obg 3226 4215 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y6Z3 protein_id gnl|my_center|LOCUS_04830 4335 4529 gene locus_tag LOCUS_04840 4335 4529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 5958 4555 gene locus_tag LOCUS_04850 5958 4555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 <6643 6030 gene locus_tag LOCUS_04860 <6643 6030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001704161.1:putative isochorismatase hydrolase >Feature sequence069 3 638 gene locus_tag LOCUS_04870 3 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 766 1743 gene locus_tag LOCUS_04880 766 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 1740 2729 gene locus_tag LOCUS_04890 1740 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 3563 2748 gene locus_tag LOCUS_04900 3563 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 4441 3560 gene locus_tag LOCUS_04910 4441 3560 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124073.1 protein_id gnl|my_center|LOCUS_04910 6611 4494 gene locus_tag LOCUS_04920 6611 4494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 >Feature sequence070 1057 77 gene locus_tag LOCUS_04930 1057 77 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887649.1 protein_id gnl|my_center|LOCUS_04930 2394 1093 gene locus_tag LOCUS_04940 2394 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327912.1 protein_id gnl|my_center|LOCUS_04940 4716 2419 gene locus_tag LOCUS_04950 4716 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 4851 5354 gene locus_tag LOCUS_04960 4851 5354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 <6587 5454 gene locus_tag LOCUS_04970 <6587 5454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118678.1:heparan N-sulfatase >Feature sequence071 <1 976 gene locus_tag LOCUS_04980 <1 976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121095.1:choline-sulfatase 1082 3955 gene locus_tag LOCUS_04990 1082 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 3952 5340 gene locus_tag LOCUS_05000 3952 5340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 >Feature sequence072 1404 589 gene locus_tag LOCUS_05010 gene hpcH 1404 589 CDS product 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339509.1 protein_id gnl|my_center|LOCUS_05010 2247 1546 gene locus_tag LOCUS_05020 2247 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 2494 2991 gene locus_tag LOCUS_05030 2494 2991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 3798 3052 gene locus_tag LOCUS_05040 3798 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 5381 3951 gene locus_tag LOCUS_05050 5381 3951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 >Feature sequence073 3140 2430 gene locus_tag LOCUS_05060 3140 2430 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404835.1 protein_id gnl|my_center|LOCUS_05060 4125 3481 gene locus_tag LOCUS_05070 4125 3481 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338637.1 protein_id gnl|my_center|LOCUS_05070 4855 4214 gene locus_tag LOCUS_05080 4855 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 4950 5744 gene locus_tag LOCUS_05090 gene trpC 4950 5744 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CG4 protein_id gnl|my_center|LOCUS_05090 >Feature sequence074 552 103 gene locus_tag LOCUS_05100 gene mraZ 552 103 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07103 protein_id gnl|my_center|LOCUS_05100 770 1522 gene locus_tag LOCUS_05110 770 1522 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544951.1 protein_id gnl|my_center|LOCUS_05110 4305 1519 gene locus_tag LOCUS_05120 4305 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 5109 4375 gene locus_tag LOCUS_05130 5109 4375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 6544 5150 gene locus_tag LOCUS_05140 6544 5150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 >Feature sequence075 1852 362 gene locus_tag LOCUS_05150 1852 362 CDS product NADH dehydrogenase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257846.1 protein_id gnl|my_center|LOCUS_05150 3343 1859 gene locus_tag LOCUS_05160 3343 1859 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545185.1 protein_id gnl|my_center|LOCUS_05160 5174 3345 gene locus_tag LOCUS_05170 5174 3345 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460436.1 protein_id gnl|my_center|LOCUS_05170 5610 5299 gene locus_tag LOCUS_05180 gene nuoK 5610 5299 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WED3 protein_id gnl|my_center|LOCUS_05180 6131 5607 gene locus_tag LOCUS_05190 6131 5607 CDS product NADH dehydrogenase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813221.1 protein_id gnl|my_center|LOCUS_05190 >Feature sequence076 149 65 gene locus_tag LOCUS_t00080 149 65 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1762 212 gene locus_tag LOCUS_05200 1762 212 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460435.1 protein_id gnl|my_center|LOCUS_05200 3296 1764 gene locus_tag LOCUS_05210 3296 1764 CDS product NADH dehydrogenase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257846.1 protein_id gnl|my_center|LOCUS_05210 5133 3298 gene locus_tag LOCUS_05220 5133 3298 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460436.1 protein_id gnl|my_center|LOCUS_05220 5446 5135 gene locus_tag LOCUS_05230 gene nuoK 5446 5135 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CWD6 protein_id gnl|my_center|LOCUS_05230 5989 5447 gene locus_tag LOCUS_05240 5989 5447 CDS product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531099.1 protein_id gnl|my_center|LOCUS_05240 >Feature sequence077 2390 4306 gene locus_tag LOCUS_05250 gene pepT2 2390 4306 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123684.1 protein_id gnl|my_center|LOCUS_05250 5124 4378 gene locus_tag LOCUS_05260 5124 4378 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_05260 5210 6076 gene locus_tag LOCUS_05270 gene ispH 5210 6076 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67625 protein_id gnl|my_center|LOCUS_05270 >Feature sequence078 <1 1005 gene locus_tag LOCUS_05280 <1 1005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942715.1:sulfurtransferase 3050 1134 gene locus_tag LOCUS_05290 3050 1134 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460263.1 protein_id gnl|my_center|LOCUS_05290 3321 3067 gene locus_tag LOCUS_05300 3321 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 3476 4753 gene locus_tag LOCUS_05310 3476 4753 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813306.1 protein_id gnl|my_center|LOCUS_05310 4850 5836 gene locus_tag LOCUS_05320 4850 5836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 6218 5826 gene locus_tag LOCUS_05330 6218 5826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 >Feature sequence079 1875 841 gene locus_tag LOCUS_05340 1875 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 4588 1967 gene locus_tag LOCUS_05350 4588 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 5997 4633 gene locus_tag LOCUS_05360 gene arsA 5997 4633 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122622.1 protein_id gnl|my_center|LOCUS_05360 >Feature sequence080 <1 793 gene locus_tag LOCUS_05370 <1 793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963228.1:gliding motility-associated ABC transporter permease subunit GldF 790 2439 gene locus_tag LOCUS_05380 790 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 2459 4306 gene locus_tag LOCUS_05390 2459 4306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 >Feature sequence081 1294 2382 gene locus_tag LOCUS_05400 gene manC 1294 2382 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403343.1 protein_id gnl|my_center|LOCUS_05400 2387 2803 gene locus_tag LOCUS_05410 2387 2803 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DRX8 protein_id gnl|my_center|LOCUS_05410 2805 3572 gene locus_tag LOCUS_05420 gene truA 2805 3572 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVY6 protein_id gnl|my_center|LOCUS_05420 3581 4309 gene locus_tag LOCUS_05430 3581 4309 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_05430 4328 5212 gene locus_tag LOCUS_05440 gene accD 4328 5212 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJI7 protein_id gnl|my_center|LOCUS_05440 >Feature sequence082 530 1219 gene locus_tag LOCUS_05450 530 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 1216 2439 gene locus_tag LOCUS_05460 1216 2439 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086334.1 protein_id gnl|my_center|LOCUS_05460 4009 2444 gene locus_tag LOCUS_05470 4009 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 4185 4042 gene locus_tag LOCUS_05480 4185 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 4145 5122 gene locus_tag LOCUS_05490 4145 5122 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869431.1 protein_id gnl|my_center|LOCUS_05490 5148 6194 gene locus_tag LOCUS_05500 gene nueB 5148 6194 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707837.1 protein_id gnl|my_center|LOCUS_05500 >Feature sequence083 <1 1140 gene locus_tag LOCUS_05510 <1 1140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011173864.1:Fe-S cluster assembly protein SufD 1158 1703 gene locus_tag LOCUS_05520 1158 1703 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770997.1 protein_id gnl|my_center|LOCUS_05520 1811 2251 gene locus_tag LOCUS_05530 1811 2251 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393869.1 protein_id gnl|my_center|LOCUS_05530 2263 2865 gene locus_tag LOCUS_05540 gene clpP 2263 2865 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4T6 protein_id gnl|my_center|LOCUS_05540 3986 2862 gene locus_tag LOCUS_05550 gene menE 3986 2862 CDS product O-succinylbenzoic acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057063.1 protein_id gnl|my_center|LOCUS_05550 5113 4121 gene locus_tag LOCUS_05560 gene menC 5113 4121 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJP8 protein_id gnl|my_center|LOCUS_05560 >Feature sequence084 451 1125 gene locus_tag LOCUS_05570 451 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 1131 1934 gene locus_tag LOCUS_05580 1131 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 1948 2829 gene locus_tag LOCUS_05590 gene folD 1948 2829 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIB4 protein_id gnl|my_center|LOCUS_05590 2848 3465 gene locus_tag LOCUS_05600 2848 3465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 3480 4295 gene locus_tag LOCUS_05610 gene proC 3480 4295 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P757 protein_id gnl|my_center|LOCUS_05610 4288 5289 gene locus_tag LOCUS_05620 gene rfaD 4288 5289 CDS product ADP-L-glycero-D-manno-heptose-6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHY3 protein_id gnl|my_center|LOCUS_05620 <6287 5294 gene locus_tag LOCUS_05630 <6287 5294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545770.1:3-deoxy-7-phosphoheptulonate synthase >Feature sequence085 984 97 gene locus_tag LOCUS_05640 984 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 1212 2945 gene locus_tag LOCUS_05650 1212 2945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 >Feature sequence086 <1 1237 gene locus_tag LOCUS_05660 <1 1237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P62061:arginine biosynthesis bifunctional protein ArgJ 1234 2121 gene locus_tag LOCUS_05670 gene argB 1234 2121 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59303 protein_id gnl|my_center|LOCUS_05670 2154 3356 gene locus_tag LOCUS_05680 gene argD 2154 3356 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG65 protein_id gnl|my_center|LOCUS_05680 3381 4328 gene locus_tag LOCUS_05690 gene argF 3381 4328 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG66 protein_id gnl|my_center|LOCUS_05690 4351 5577 gene locus_tag LOCUS_05700 gene argG 4351 5577 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59846 protein_id gnl|my_center|LOCUS_05700 5732 6127 gene locus_tag LOCUS_05710 gene nuoA 5732 6127 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEE0 protein_id gnl|my_center|LOCUS_05710 >Feature sequence087 2922 52 gene locus_tag LOCUS_05720 2922 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 >Feature sequence088 2141 3274 gene locus_tag LOCUS_05730 2141 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 3359 4435 gene locus_tag LOCUS_05740 gene idh 3359 4435 CDS product myo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119305.1 protein_id gnl|my_center|LOCUS_05740 4538 5989 gene locus_tag LOCUS_05750 4538 5989 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227986.1 protein_id gnl|my_center|LOCUS_05750 >Feature sequence089 256 1422 gene locus_tag LOCUS_05760 256 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 1521 3089 gene locus_tag LOCUS_05770 1521 3089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 3086 4684 gene locus_tag LOCUS_05780 gene yidJ 3086 4684 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122680.1 protein_id gnl|my_center|LOCUS_05780 >Feature sequence090 <1 2151 gene locus_tag LOCUS_05790 <1 2151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404269.1:7TM receptor with intracellular metal dependent phosphohydrolase 2207 2581 gene locus_tag LOCUS_05800 2207 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 2691 3380 gene locus_tag LOCUS_05810 2691 3380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392134.1 protein_id gnl|my_center|LOCUS_05810 3381 3992 gene locus_tag LOCUS_05820 3381 3992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 4046 4465 gene locus_tag LOCUS_05830 4046 4465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140630.1 protein_id gnl|my_center|LOCUS_05830 4468 5220 gene locus_tag LOCUS_05840 4468 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 >Feature sequence091 1712 309 gene locus_tag LOCUS_05850 1712 309 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_05850 2444 1758 gene locus_tag LOCUS_05860 2444 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 4273 2441 gene locus_tag LOCUS_05870 4273 2441 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933466.1 protein_id gnl|my_center|LOCUS_05870 4627 4295 gene locus_tag LOCUS_05880 4627 4295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 >Feature sequence092 <1 947 gene locus_tag LOCUS_05890 <1 947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119680.1:acetylxylan esterase 981 2900 gene locus_tag LOCUS_05900 981 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 2897 3931 gene locus_tag LOCUS_05910 2897 3931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 4697 3945 gene locus_tag LOCUS_05920 gene pcm 4697 3945 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJY2 protein_id gnl|my_center|LOCUS_05920 >Feature sequence093 1532 660 gene locus_tag LOCUS_05930 1532 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 5566 1559 gene locus_tag LOCUS_05940 5566 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 >Feature sequence094 486 1469 gene locus_tag LOCUS_05950 486 1469 CDS product HflK protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_05950 1466 2452 gene locus_tag LOCUS_05960 1466 2452 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72E95 protein_id gnl|my_center|LOCUS_05960 3309 2485 gene locus_tag LOCUS_05970 3309 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 5606 3672 gene locus_tag LOCUS_05980 gene atsG 5606 3672 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121854.1 protein_id gnl|my_center|LOCUS_05980 >Feature sequence095 <1 1763 gene locus_tag LOCUS_05990 <1 1763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405415.1:thiol:disulfide interchange protein DsbD 2163 1825 gene locus_tag LOCUS_06000 gene glnK 2163 1825 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941607.1 protein_id gnl|my_center|LOCUS_06000 2666 2328 gene locus_tag LOCUS_06010 gene glnB 2666 2328 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66513 protein_id gnl|my_center|LOCUS_06010 4068 2701 gene locus_tag LOCUS_06020 gene amt-1 4068 2701 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B15 protein_id gnl|my_center|LOCUS_06020 4631 4293 gene locus_tag LOCUS_06030 gene glnK 4631 4293 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941607.1 protein_id gnl|my_center|LOCUS_06030 <6022 4873 gene locus_tag LOCUS_06040 <6022 4873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460332.1:aspartate--tRNA ligase >Feature sequence096 >Feature sequence097 2809 1625 gene locus_tag LOCUS_06050 2809 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 2946 3098 gene locus_tag LOCUS_06060 2946 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 4139 3147 gene locus_tag LOCUS_06070 4139 3147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 4840 4133 gene locus_tag LOCUS_06080 4840 4133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 >Feature sequence098 993 250 gene locus_tag LOCUS_06090 gene phnC 993 250 CDS product phosphonates import ATP-binding protein PhnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FSE1 protein_id gnl|my_center|LOCUS_06090 2180 1059 gene locus_tag LOCUS_06100 2180 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 3610 2255 gene locus_tag LOCUS_06110 gene kdtA 3610 2255 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_06110 3628 4515 gene locus_tag LOCUS_06120 gene trpA 3628 4515 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H661 protein_id gnl|my_center|LOCUS_06120 4562 5494 gene locus_tag LOCUS_06130 gene miaA 4562 5494 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BP1 protein_id gnl|my_center|LOCUS_06130 >Feature sequence099 219 1562 gene locus_tag LOCUS_06140 219 1562 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903476.1 protein_id gnl|my_center|LOCUS_06140 1572 2510 gene locus_tag LOCUS_06150 gene yaeI 1572 2510 CDS product phosphodiesterase YaeI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37049 protein_id gnl|my_center|LOCUS_06150 2605 3294 gene locus_tag LOCUS_06160 gene aat 2605 3294 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGC5 protein_id gnl|my_center|LOCUS_06160 4541 3306 gene locus_tag LOCUS_06170 4541 3306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 4883 4641 gene locus_tag LOCUS_06180 4883 4641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 5027 5740 gene locus_tag LOCUS_06190 5027 5740 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337281.1 protein_id gnl|my_center|LOCUS_06190 >Feature sequence100 387 581 gene locus_tag LOCUS_06200 387 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 626 889 gene locus_tag LOCUS_06210 gene rpsQ1 626 889 CDS product 30S ribosomal protein S17 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A485 protein_id gnl|my_center|LOCUS_06210 970 1272 gene locus_tag LOCUS_06220 gene rplN 970 1272 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q927L7 protein_id gnl|my_center|LOCUS_06220 1274 1528 gene locus_tag LOCUS_06230 1274 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 1569 2126 gene locus_tag LOCUS_06240 gene rplE 1569 2126 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38517 protein_id gnl|my_center|LOCUS_06240 2161 2466 gene locus_tag LOCUS_06250 gene rpsN 2161 2466 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMD7 protein_id gnl|my_center|LOCUS_06250 2490 2888 gene locus_tag LOCUS_06260 gene rpsH 2490 2888 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC38 protein_id gnl|my_center|LOCUS_06260 2900 3436 gene locus_tag LOCUS_06270 gene rplF 2900 3436 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4E9 protein_id gnl|my_center|LOCUS_06270 3446 3802 gene locus_tag LOCUS_06280 gene rplR 3446 3802 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FM75 protein_id gnl|my_center|LOCUS_06280 3813 4442 gene locus_tag LOCUS_06290 3813 4442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 4588 4872 gene locus_tag LOCUS_06300 4588 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 >Feature sequence101 1504 203 gene locus_tag LOCUS_06310 1504 203 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120406.1 protein_id gnl|my_center|LOCUS_06310 1567 2958 gene locus_tag LOCUS_06320 gene mucD 1567 2958 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122202.1 protein_id gnl|my_center|LOCUS_06320 4415 3003 gene locus_tag LOCUS_06330 4415 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 5092 4412 gene locus_tag LOCUS_06340 5092 4412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 5495 5097 gene locus_tag LOCUS_06350 5495 5097 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458951.1 protein_id gnl|my_center|LOCUS_06350 5906 5505 gene locus_tag LOCUS_06360 5906 5505 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458951.1 protein_id gnl|my_center|LOCUS_06360 >Feature sequence102 <1 1761 gene locus_tag LOCUS_06370 <1 1761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142782.1:aminopeptidase 1952 1782 gene locus_tag LOCUS_06380 1952 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 2093 2785 gene locus_tag LOCUS_06390 2093 2785 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229715.1 protein_id gnl|my_center|LOCUS_06390 2846 3259 gene locus_tag LOCUS_06400 2846 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 3285 4757 gene locus_tag LOCUS_06410 gene glcD-1 3285 4757 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_06410 >Feature sequence103 722 24 gene locus_tag LOCUS_06420 722 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 1249 740 gene locus_tag LOCUS_06430 1249 740 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QU5 protein_id gnl|my_center|LOCUS_06430 1702 2538 gene locus_tag LOCUS_06440 gene hpaG 1702 2538 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122036.1 protein_id gnl|my_center|LOCUS_06440 2562 4142 gene locus_tag LOCUS_06450 2562 4142 CDS product 2,5-dioxovalerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038347.1 protein_id gnl|my_center|LOCUS_06450 >Feature sequence104 471 2231 gene locus_tag LOCUS_06460 gene argS 471 2231 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JYM8 protein_id gnl|my_center|LOCUS_06460 2359 2940 gene locus_tag LOCUS_06470 2359 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 3336 2995 gene locus_tag LOCUS_06480 gene erpA 3336 2995 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Z2 protein_id gnl|my_center|LOCUS_06480 3451 4479 gene locus_tag LOCUS_06490 3451 4479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 >Feature sequence105 818 354 gene locus_tag LOCUS_06500 818 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 1913 900 gene locus_tag LOCUS_06510 gene asd 1913 900 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q726Q8 protein_id gnl|my_center|LOCUS_06510 2160 2459 gene locus_tag LOCUS_06520 2160 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 2586 3395 gene locus_tag LOCUS_06530 2586 3395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331802.1 protein_id gnl|my_center|LOCUS_06530 4320 3421 gene locus_tag LOCUS_06540 4320 3421 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884430.1 protein_id gnl|my_center|LOCUS_06540 5734 4337 gene locus_tag LOCUS_06550 gene cca 5734 4337 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5D4 protein_id gnl|my_center|LOCUS_06550 >Feature sequence106 2931 421 gene locus_tag LOCUS_06560 2931 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 3506 2928 gene locus_tag LOCUS_06570 3506 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 4318 3503 gene locus_tag LOCUS_06580 4318 3503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 5503 4412 gene locus_tag LOCUS_06590 gene mreB 5503 4412 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575569.1 protein_id gnl|my_center|LOCUS_06590 >Feature sequence107 826 1722 gene locus_tag LOCUS_06600 gene atpB 826 1722 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DYT5 protein_id gnl|my_center|LOCUS_06600 1801 2013 gene locus_tag LOCUS_06610 1801 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 2080 2628 gene locus_tag LOCUS_06620 2080 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 2658 3050 gene locus_tag LOCUS_06630 2658 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 3087 4619 gene locus_tag LOCUS_06640 gene atpA2 3087 4619 CDS product ATP synthase subunit alpha 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZR99 protein_id gnl|my_center|LOCUS_06640 4672 5556 gene locus_tag LOCUS_06650 gene atpG 4672 5556 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z9S5 protein_id gnl|my_center|LOCUS_06650 >Feature sequence108 <1 767 gene locus_tag LOCUS_06660 <1 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I476:4-hydroxyproline 2-epimerase 768 2015 gene locus_tag LOCUS_06670 gene dadA 768 2015 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120365.1 protein_id gnl|my_center|LOCUS_06670 4055 2055 gene locus_tag LOCUS_06680 4055 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 <5774 4052 gene locus_tag LOCUS_06690 <5774 4052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118947.1:sulfatase >Feature sequence109 1262 300 gene locus_tag LOCUS_06700 gene xerD 1262 300 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46352 protein_id gnl|my_center|LOCUS_06700 1797 1279 gene locus_tag LOCUS_06710 1797 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 3699 1882 gene locus_tag LOCUS_06720 3699 1882 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118364.1 protein_id gnl|my_center|LOCUS_06720 4013 3696 gene locus_tag LOCUS_06730 4013 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 5518 4028 gene locus_tag LOCUS_06740 5518 4028 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969265.1 protein_id gnl|my_center|LOCUS_06740 >Feature sequence110 3541 2690 gene locus_tag LOCUS_06750 3541 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 4798 3626 gene locus_tag LOCUS_06760 4798 3626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 5617 5363 gene locus_tag LOCUS_06770 5617 5363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 >Feature sequence111 2532 1312 gene locus_tag LOCUS_06780 2532 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 3700 2585 gene locus_tag LOCUS_06790 3700 2585 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973578.1 protein_id gnl|my_center|LOCUS_06790 4659 3721 gene locus_tag LOCUS_06800 4659 3721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 5377 4712 gene locus_tag LOCUS_06810 5377 4712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 >Feature sequence112 1454 2398 gene locus_tag LOCUS_06820 1454 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 2459 3316 gene locus_tag LOCUS_06830 2459 3316 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085765.1 protein_id gnl|my_center|LOCUS_06830 3401 3889 gene locus_tag LOCUS_06840 3401 3889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 4482 5636 gene locus_tag LOCUS_06850 4482 5636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118495.1 protein_id gnl|my_center|LOCUS_06850 >Feature sequence113 2378 297 gene locus_tag LOCUS_06860 2378 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 4942 2771 gene locus_tag LOCUS_06870 4942 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 >Feature sequence114 <1 999 gene locus_tag LOCUS_06880 <1 999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5DZB6:alpha-1,4 glucan phosphorylase 996 1772 gene locus_tag LOCUS_06890 996 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 2642 1791 gene locus_tag LOCUS_06900 2642 1791 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329773.1 protein_id gnl|my_center|LOCUS_06900 2734 3441 gene locus_tag LOCUS_06910 2734 3441 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807283.1 protein_id gnl|my_center|LOCUS_06910 3737 4456 gene locus_tag LOCUS_06920 3737 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 4461 5399 gene locus_tag LOCUS_06930 gene pilD 4461 5399 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BJ8 protein_id gnl|my_center|LOCUS_06930 >Feature sequence115 1091 1588 gene locus_tag LOCUS_06940 1091 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 1585 1968 gene locus_tag LOCUS_06950 1585 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 1997 3313 gene locus_tag LOCUS_06960 1997 3313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 3368 4048 gene locus_tag LOCUS_06970 3368 4048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 >Feature sequence116 <1 844 gene locus_tag LOCUS_06980 <1 844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O32213:sulfite reductase [NADPH] hemoprotein beta-component 872 1441 gene locus_tag LOCUS_06990 872 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 1920 1438 gene locus_tag LOCUS_07000 1920 1438 CDS product NTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061454.1 protein_id gnl|my_center|LOCUS_07000 1985 2797 gene locus_tag LOCUS_07010 gene mutM 1985 2797 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O50606 protein_id gnl|my_center|LOCUS_07010 >Feature sequence117 232 1287 gene locus_tag LOCUS_07020 gene rfbE 232 1287 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121410.1 protein_id gnl|my_center|LOCUS_07020 1292 2371 gene locus_tag LOCUS_07030 gene tyv 1292 2371 CDS product CDP-tyvelose epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122066.1 protein_id gnl|my_center|LOCUS_07030 2400 3146 gene locus_tag LOCUS_07040 2400 3146 CDS product polyprenol phosphate mannosyl transferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122067.1 protein_id gnl|my_center|LOCUS_07040 3146 3805 gene locus_tag LOCUS_07050 3146 3805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 4879 3860 gene locus_tag LOCUS_07060 4879 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 >Feature sequence118 1863 187 gene locus_tag LOCUS_07070 gene leuA 1863 187 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97MC5 protein_id gnl|my_center|LOCUS_07070 2002 2577 gene locus_tag LOCUS_07080 2002 2577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 3483 2581 gene locus_tag LOCUS_07090 3483 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 4213 3569 gene locus_tag LOCUS_07100 4213 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 4758 4210 gene locus_tag LOCUS_07110 gene rpsH 4758 4210 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UW29 protein_id gnl|my_center|LOCUS_07110 >Feature sequence119 799 2367 gene locus_tag LOCUS_07120 799 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 2407 3594 gene locus_tag LOCUS_07130 2407 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117732.1 protein_id gnl|my_center|LOCUS_07130 3872 3588 gene locus_tag LOCUS_07140 gene acyP 3872 3588 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1Q0 protein_id gnl|my_center|LOCUS_07140 4002 4676 gene locus_tag LOCUS_07150 4002 4676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 <5559 4697 gene locus_tag LOCUS_07160 <5559 4697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87QT9:protein TolB >Feature sequence120 172 1017 gene locus_tag LOCUS_07170 172 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 1025 1816 gene locus_tag LOCUS_07180 gene troB 1025 1816 CDS product zinc ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678718.1 protein_id gnl|my_center|LOCUS_07180 1816 3309 gene locus_tag LOCUS_07190 gene mntB 1816 3309 CDS product manganese ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123736.1 protein_id gnl|my_center|LOCUS_07190 3315 4301 gene locus_tag LOCUS_07200 gene mntD 3315 4301 CDS product manganese transport system membrane protein MntD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34500 protein_id gnl|my_center|LOCUS_07200 4710 4384 gene locus_tag LOCUS_07210 4710 4384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 >Feature sequence121 1312 371 gene locus_tag LOCUS_07220 gene fcl 1312 371 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVN0 protein_id gnl|my_center|LOCUS_07220 2344 1328 gene locus_tag LOCUS_07230 gene gmd 2344 1328 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL63 protein_id gnl|my_center|LOCUS_07230 2466 2542 gene locus_tag LOCUS_t00090 2466 2542 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2584 3282 gene locus_tag LOCUS_07240 2584 3282 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823061.1 protein_id gnl|my_center|LOCUS_07240 3381 3680 gene locus_tag LOCUS_07250 3381 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 4473 3682 gene locus_tag LOCUS_07260 4473 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 <5555 4830 gene locus_tag LOCUS_07270 <5555 4830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O66911:UvrABC system protein A >Feature sequence122 850 1893 gene locus_tag LOCUS_07280 850 1893 CDS product glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971691.1 protein_id gnl|my_center|LOCUS_07280 2694 1909 gene locus_tag LOCUS_07290 2694 1909 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069020.1 protein_id gnl|my_center|LOCUS_07290 3928 2741 gene locus_tag LOCUS_07300 3928 2741 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72F23 protein_id gnl|my_center|LOCUS_07300 4004 5365 gene locus_tag LOCUS_07310 4004 5365 CDS product putative amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705460.1 protein_id gnl|my_center|LOCUS_07310 >Feature sequence123 3 899 gene locus_tag LOCUS_07320 3 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 902 3061 gene locus_tag LOCUS_07330 902 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 3065 4672 gene locus_tag LOCUS_07340 3065 4672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 >Feature sequence124 2745 4145 gene locus_tag LOCUS_07350 2745 4145 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122596.1 protein_id gnl|my_center|LOCUS_07350 4166 5152 gene locus_tag LOCUS_07360 4166 5152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118659.1 protein_id gnl|my_center|LOCUS_07360 >Feature sequence125 242 1456 gene locus_tag LOCUS_07370 242 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 2081 1461 gene locus_tag LOCUS_07380 2081 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 2548 2108 gene locus_tag LOCUS_07390 2548 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 3997 2555 gene locus_tag LOCUS_07400 3997 2555 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851858.1 protein_id gnl|my_center|LOCUS_07400 4867 4019 gene locus_tag LOCUS_07410 4867 4019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 >Feature sequence126 200 568 gene locus_tag LOCUS_07420 200 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404578.1 protein_id gnl|my_center|LOCUS_07420 1287 1772 gene locus_tag LOCUS_07430 1287 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 4091 2205 gene locus_tag LOCUS_07440 4091 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 5113 4220 gene locus_tag LOCUS_07450 5113 4220 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73MN3 protein_id gnl|my_center|LOCUS_07450 >Feature sequence127 3397 2150 gene locus_tag LOCUS_07460 3397 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 4446 3394 gene locus_tag LOCUS_07470 4446 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 <5337 4501 gene locus_tag LOCUS_07480 <5337 4501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3XYK0:ribosome-binding ATPase YchF >Feature sequence128 1181 864 gene locus_tag LOCUS_07490 1181 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 2210 1245 gene locus_tag LOCUS_07500 2210 1245 CDS product D-arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544949.1 protein_id gnl|my_center|LOCUS_07500 4054 2315 gene locus_tag LOCUS_07510 4054 2315 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957611.1 protein_id gnl|my_center|LOCUS_07510 5218 4130 gene locus_tag LOCUS_07520 5218 4130 CDS product mucin desulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068766.1 protein_id gnl|my_center|LOCUS_07520 >Feature sequence129 1470 91 gene locus_tag LOCUS_07530 1470 91 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_07530 2622 1492 gene locus_tag LOCUS_07540 2622 1492 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679701.1 protein_id gnl|my_center|LOCUS_07540 3230 2664 gene locus_tag LOCUS_07550 3230 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 3361 4122 gene locus_tag LOCUS_07560 3361 4122 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841479.1 protein_id gnl|my_center|LOCUS_07560 <5322 4131 gene locus_tag LOCUS_07570 <5322 4131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UPW5:citrate synthase >Feature sequence130 773 1489 gene locus_tag LOCUS_07580 773 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 1548 2681 gene locus_tag LOCUS_07590 1548 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782250.1 protein_id gnl|my_center|LOCUS_07590 3663 2737 gene locus_tag LOCUS_07600 3663 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603461.1 protein_id gnl|my_center|LOCUS_07600 4472 3660 gene locus_tag LOCUS_07610 4472 3660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 5318 4524 gene locus_tag LOCUS_07620 5318 4524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 >Feature sequence131 149 1627 gene locus_tag LOCUS_07630 149 1627 CDS product MucD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545685.1 protein_id gnl|my_center|LOCUS_07630 2220 1648 gene locus_tag LOCUS_07640 2220 1648 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460653.1 protein_id gnl|my_center|LOCUS_07640 2980 2252 gene locus_tag LOCUS_07650 gene bioC 2980 2252 CDS product malonyl-[acyl-carrier protein] O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMB1 protein_id gnl|my_center|LOCUS_07650 3573 2977 gene locus_tag LOCUS_07660 3573 2977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 4718 3570 gene locus_tag LOCUS_07670 gene bioF 4718 3570 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749W3 protein_id gnl|my_center|LOCUS_07670 >Feature sequence132 4942 2246 gene locus_tag LOCUS_07680 gene alaS 4942 2246 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG04 protein_id gnl|my_center|LOCUS_07680 >Feature sequence133 503 96 gene locus_tag LOCUS_07690 503 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 844 596 gene locus_tag LOCUS_07700 844 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 1302 1075 gene locus_tag LOCUS_07710 1302 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 2272 1316 gene locus_tag LOCUS_07720 2272 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 2359 3315 gene locus_tag LOCUS_07730 2359 3315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 3439 4785 gene locus_tag LOCUS_07740 gene tig 3439 4785 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q46108 protein_id gnl|my_center|LOCUS_07740 >Feature sequence134 221 1501 gene locus_tag LOCUS_07750 221 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120802.1 protein_id gnl|my_center|LOCUS_07750 2969 1557 gene locus_tag LOCUS_07760 2969 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_07760 4132 3158 gene locus_tag LOCUS_07770 4132 3158 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F5D8 protein_id gnl|my_center|LOCUS_07770 5159 4200 gene locus_tag LOCUS_07780 5159 4200 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_07780 >Feature sequence135 >Feature sequence136 3238 1766 gene locus_tag LOCUS_07790 3238 1766 CDS product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_07790 3911 3279 gene locus_tag LOCUS_07800 3911 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 4863 3937 gene locus_tag LOCUS_07810 4863 3937 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124073.1 protein_id gnl|my_center|LOCUS_07810 >Feature sequence137 2785 533 gene locus_tag LOCUS_07820 2785 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 >Feature sequence138 1300 311 gene locus_tag LOCUS_07830 1300 311 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840501.1 protein_id gnl|my_center|LOCUS_07830 1813 1319 gene locus_tag LOCUS_07840 1813 1319 CDS product HIT family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146469.1 protein_id gnl|my_center|LOCUS_07840 2034 3518 gene locus_tag LOCUS_07850 gene glgA1 2034 3518 CDS product glycogen synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74ED9 protein_id gnl|my_center|LOCUS_07850 >Feature sequence139 <1 839 gene locus_tag LOCUS_07860 <1 839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007324174.1:ABC transporter substrate-binding protein 843 2285 gene locus_tag LOCUS_07870 843 2285 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324174.1 protein_id gnl|my_center|LOCUS_07870 2689 2300 gene locus_tag LOCUS_07880 2689 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 2579 3310 gene locus_tag LOCUS_07890 2579 3310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 4767 3340 gene locus_tag LOCUS_07900 4767 3340 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120435.1 protein_id gnl|my_center|LOCUS_07900 >Feature sequence140 79 573 gene locus_tag LOCUS_07910 79 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 3557 588 gene locus_tag LOCUS_07920 gene secA 3557 588 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD18 protein_id gnl|my_center|LOCUS_07920 4525 3590 gene locus_tag LOCUS_07930 gene uxs 4525 3590 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942460.1 protein_id gnl|my_center|LOCUS_07930 >Feature sequence141 2310 1141 gene locus_tag LOCUS_07940 2310 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 3295 2435 gene locus_tag LOCUS_07950 3295 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 4207 3383 gene locus_tag LOCUS_07960 4207 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 >Feature sequence142 2393 1617 gene locus_tag LOCUS_07970 2393 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 4079 2466 gene locus_tag LOCUS_07980 4079 2466 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108986.1 protein_id gnl|my_center|LOCUS_07980 4228 4304 gene locus_tag LOCUS_t00100 4228 4304 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence143 <1 3723 gene locus_tag LOCUS_07990 <1 3723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74CY7:RecBCD enzyme subunit RecB >Feature sequence144 1478 576 gene locus_tag LOCUS_08000 1478 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324190.1 protein_id gnl|my_center|LOCUS_08000 2544 1471 gene locus_tag LOCUS_08010 gene moxR 2544 1471 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122095.1 protein_id gnl|my_center|LOCUS_08010 2595 2867 gene locus_tag LOCUS_08020 2595 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 3857 2976 gene locus_tag LOCUS_08030 3857 2976 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941571.1 protein_id gnl|my_center|LOCUS_08030 4669 3890 gene locus_tag LOCUS_08040 4669 3890 CDS product D-mannonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332279.1 protein_id gnl|my_center|LOCUS_08040 >Feature sequence145 2930 2067 gene locus_tag LOCUS_08050 gene hasC 2930 2067 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122140.1 protein_id gnl|my_center|LOCUS_08050 3095 3733 gene locus_tag LOCUS_08060 gene gpmB 3095 3733 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809593.1 protein_id gnl|my_center|LOCUS_08060 4995 3739 gene locus_tag LOCUS_08070 4995 3739 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 protein_id gnl|my_center|LOCUS_08070 >Feature sequence146 2224 2961 gene locus_tag LOCUS_08080 2224 2961 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387887.1 protein_id gnl|my_center|LOCUS_08080 2958 3764 gene locus_tag LOCUS_08090 2958 3764 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387888.1 protein_id gnl|my_center|LOCUS_08090 3783 4304 gene locus_tag LOCUS_08100 3783 4304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 >Feature sequence147 >Feature sequence148 1389 1123 gene locus_tag LOCUS_08110 gene rpsO 1389 1123 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B9J8 protein_id gnl|my_center|LOCUS_08110 1607 2086 gene locus_tag LOCUS_08120 1607 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 >Feature sequence149 102 308 gene locus_tag LOCUS_08130 102 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 487 2025 gene locus_tag LOCUS_08140 gene comM 487 2025 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_08140 2221 2628 gene locus_tag LOCUS_08150 2221 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 2744 2986 gene locus_tag LOCUS_08160 2744 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 3627 3037 gene locus_tag LOCUS_08170 3627 3037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 4495 3674 gene locus_tag LOCUS_08180 4495 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 4608 4853 gene locus_tag LOCUS_08190 4608 4853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 4921 4994 gene locus_tag LOCUS_t00110 4921 4994 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence150 <1 667 gene locus_tag LOCUS_08200 <1 667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919291.1:adenylate cyclase 760 1701 gene locus_tag LOCUS_08210 gene xynE 760 1701 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122022.1 protein_id gnl|my_center|LOCUS_08210 3501 1729 gene locus_tag LOCUS_08220 3501 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 >Feature sequence151 1129 380 gene locus_tag LOCUS_08230 1129 380 CDS product glycosyl hydrolase family 16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256962.1 protein_id gnl|my_center|LOCUS_08230 1751 1209 gene locus_tag LOCUS_08240 1751 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 3305 1836 gene locus_tag LOCUS_08250 3305 1836 CDS product putative GMC-type oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMV7 protein_id gnl|my_center|LOCUS_08250 3799 3365 gene locus_tag LOCUS_08260 3799 3365 CDS product cysteine desulfuration protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391222.1 protein_id gnl|my_center|LOCUS_08260 3949 4380 gene locus_tag LOCUS_08270 gene fur 3949 4380 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068305.1 protein_id gnl|my_center|LOCUS_08270 >Feature sequence152 1543 59 gene locus_tag LOCUS_08280 1543 59 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976195.1 protein_id gnl|my_center|LOCUS_08280 2066 1671 gene locus_tag LOCUS_08290 2066 1671 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392136.1 protein_id gnl|my_center|LOCUS_08290 3379 2063 gene locus_tag LOCUS_08300 gene deoA 3379 2063 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242311.1 protein_id gnl|my_center|LOCUS_08300 <4904 3643 gene locus_tag LOCUS_08310 <4904 3643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122141.1:UTP--glucose-1-phosphate uridylyltransferase >Feature sequence153 1509 583 gene locus_tag LOCUS_08320 1509 583 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103885.1 protein_id gnl|my_center|LOCUS_08320 1737 2687 gene locus_tag LOCUS_08330 1737 2687 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534956.1 protein_id gnl|my_center|LOCUS_08330 2748 3959 gene locus_tag LOCUS_08340 2748 3959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 4453 3983 gene locus_tag LOCUS_08350 4453 3983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 >Feature sequence154 2887 2147 gene locus_tag LOCUS_08360 2887 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 3460 3017 gene locus_tag LOCUS_08370 3460 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 3914 4615 gene locus_tag LOCUS_08380 gene queC 3914 4615 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92UN9 protein_id gnl|my_center|LOCUS_08380 >Feature sequence155 2001 571 gene locus_tag LOCUS_08390 2001 571 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172871.1 protein_id gnl|my_center|LOCUS_08390 2714 1998 gene locus_tag LOCUS_08400 2714 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 4360 2900 gene locus_tag LOCUS_08410 gene gatB 4360 2900 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66766 protein_id gnl|my_center|LOCUS_08410 >Feature sequence156 296 955 gene locus_tag LOCUS_08420 296 955 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404773.1 protein_id gnl|my_center|LOCUS_08420 1159 2202 gene locus_tag LOCUS_08430 1159 2202 CDS product AP endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_08430 2247 3389 gene locus_tag LOCUS_08440 2247 3389 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405244.1 protein_id gnl|my_center|LOCUS_08440 3393 4478 gene locus_tag LOCUS_08450 3393 4478 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096413.1 protein_id gnl|my_center|LOCUS_08450 >Feature sequence157 3682 317 gene locus_tag LOCUS_08460 3682 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 4818 3679 gene locus_tag LOCUS_08470 4818 3679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 >Feature sequence158 296 1096 gene locus_tag LOCUS_08480 296 1096 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582866.1 protein_id gnl|my_center|LOCUS_08480 1266 1514 gene locus_tag LOCUS_08490 1266 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 2014 3204 gene locus_tag LOCUS_08500 2014 3204 CDS product type III ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146906.1 protein_id gnl|my_center|LOCUS_08500 3470 3676 gene locus_tag LOCUS_08510 gene cspA 3470 3676 CDS product cold-shock protein CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558414.1 protein_id gnl|my_center|LOCUS_08510 3845 4420 gene locus_tag LOCUS_08520 3845 4420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 >Feature sequence159 818 1864 gene locus_tag LOCUS_08530 818 1864 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774558.1 protein_id gnl|my_center|LOCUS_08530 1869 3206 gene locus_tag LOCUS_08540 gene glmM 1869 3206 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXK7 protein_id gnl|my_center|LOCUS_08540 3289 4698 gene locus_tag LOCUS_08550 3289 4698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 >Feature sequence160 1235 144 gene locus_tag LOCUS_08560 1235 144 CDS product O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966323.1 protein_id gnl|my_center|LOCUS_08560 2275 1232 gene locus_tag LOCUS_08570 2275 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 3015 2284 gene locus_tag LOCUS_08580 3015 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 4198 3017 gene locus_tag LOCUS_08590 4198 3017 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390458.1 protein_id gnl|my_center|LOCUS_08590 <4810 4206 gene locus_tag LOCUS_08600 <4810 4206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918888.1:methyltransferase >Feature sequence161 520 1641 gene locus_tag LOCUS_08610 520 1641 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654729.1 protein_id gnl|my_center|LOCUS_08610 1663 2661 gene locus_tag LOCUS_08620 1663 2661 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWC5 protein_id gnl|my_center|LOCUS_08620 2667 3617 gene locus_tag LOCUS_08630 2667 3617 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVD3 protein_id gnl|my_center|LOCUS_08630 4514 3576 gene locus_tag LOCUS_08640 4514 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 4801 4511 gene locus_tag LOCUS_08650 4801 4511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 >Feature sequence162 8 1261 gene locus_tag LOCUS_08660 8 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 1273 2412 gene locus_tag LOCUS_08670 1273 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 >Feature sequence163 840 325 gene locus_tag LOCUS_08680 840 325 CDS product SOS error prone mutagenesis protein UmuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947431.1 protein_id gnl|my_center|LOCUS_08680 1906 935 gene locus_tag LOCUS_08690 1906 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 2370 2017 gene locus_tag LOCUS_08700 2370 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 3094 2531 gene locus_tag LOCUS_08710 3094 2531 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867226.1 protein_id gnl|my_center|LOCUS_08710 3844 3095 gene locus_tag LOCUS_08720 3844 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 >Feature sequence164 2329 410 gene locus_tag LOCUS_08730 gene atsG 2329 410 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121854.1 protein_id gnl|my_center|LOCUS_08730 2484 3974 gene locus_tag LOCUS_08740 2484 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 >Feature sequence165 525 1343 gene locus_tag LOCUS_08750 525 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 1386 2744 gene locus_tag LOCUS_08760 1386 2744 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118593.1 protein_id gnl|my_center|LOCUS_08760 2875 3111 gene locus_tag LOCUS_08770 2875 3111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 4230 3208 gene locus_tag LOCUS_08780 4230 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 >Feature sequence166 2473 2315 gene locus_tag LOCUS_08790 2473 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 4004 2466 gene locus_tag LOCUS_08800 4004 2466 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975674.1 protein_id gnl|my_center|LOCUS_08800 >Feature sequence167 2766 1849 gene locus_tag LOCUS_08810 2766 1849 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957836.1 protein_id gnl|my_center|LOCUS_08810 3549 3699 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tcaaccatcaccacttaactgtc 3700 4170 gene locus_tag LOCUS_08820 3700 4170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 >Feature sequence168 <1 1965 gene locus_tag LOCUS_08830 <1 1965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZZK5:DNA gyrase subunit B 2017 4665 gene locus_tag LOCUS_08840 2017 4665 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021593.1 protein_id gnl|my_center|LOCUS_08840 >Feature sequence169 1097 315 gene locus_tag LOCUS_08850 1097 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 1572 1198 gene locus_tag LOCUS_08860 1572 1198 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939303.1 protein_id gnl|my_center|LOCUS_08860 3009 1633 gene locus_tag LOCUS_08870 gene arsA 3009 1633 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122622.1 protein_id gnl|my_center|LOCUS_08870 4249 3086 gene locus_tag LOCUS_08880 4249 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 >Feature sequence170 275 1675 gene locus_tag LOCUS_08890 275 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 3165 1744 gene locus_tag LOCUS_08900 3165 1744 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_08900 3431 4483 gene locus_tag LOCUS_08910 3431 4483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 >Feature sequence171 276 1352 gene locus_tag LOCUS_08920 gene recF 276 1352 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8FA32 protein_id gnl|my_center|LOCUS_08920 1374 2147 gene locus_tag LOCUS_08930 1374 2147 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MFA9 protein_id gnl|my_center|LOCUS_08930 2193 2777 gene locus_tag LOCUS_08940 gene ruvC 2193 2777 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62HA7 protein_id gnl|my_center|LOCUS_08940 3402 2668 gene locus_tag LOCUS_08950 3402 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 <4645 3548 gene locus_tag LOCUS_08960 <4645 3548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to D1BA48:S-adenosylmethionine:tRNA ribosyltransferase-isomerase >Feature sequence172 1320 1051 gene locus_tag LOCUS_08970 1320 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 1900 1361 gene locus_tag LOCUS_08980 1900 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 2307 1930 gene locus_tag LOCUS_08990 2307 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 2543 2334 gene locus_tag LOCUS_09000 2543 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 4613 2715 gene locus_tag LOCUS_09010 4613 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 >Feature sequence173 >Feature sequence174 424 1275 gene locus_tag LOCUS_09020 424 1275 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJN6 protein_id gnl|my_center|LOCUS_09020 1272 2432 gene locus_tag LOCUS_09030 gene dxr 1272 2432 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1H0 protein_id gnl|my_center|LOCUS_09030 2446 3855 gene locus_tag LOCUS_09040 2446 3855 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JP75 protein_id gnl|my_center|LOCUS_09040 >Feature sequence175 122 2182 gene locus_tag LOCUS_09050 122 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 2179 3669 gene locus_tag LOCUS_09060 2179 3669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122305.1 protein_id gnl|my_center|LOCUS_09060 3999 3676 gene locus_tag LOCUS_09070 3999 3676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 >Feature sequence176 527 454 gene locus_tag LOCUS_t00120 527 454 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 666 1415 gene locus_tag LOCUS_09080 gene pyrH 666 1415 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97I64 protein_id gnl|my_center|LOCUS_09080 1498 2055 gene locus_tag LOCUS_09090 gene frr 1498 2055 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DQ9 protein_id gnl|my_center|LOCUS_09090 2103 3224 gene locus_tag LOCUS_09100 gene proB 2103 3224 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKZ7 protein_id gnl|my_center|LOCUS_09100 >Feature sequence177 1915 263 gene locus_tag LOCUS_09110 1915 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 2974 2099 gene locus_tag LOCUS_09120 2974 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 3896 3033 gene locus_tag LOCUS_09130 gene fdhD 3896 3033 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DEF2 protein_id gnl|my_center|LOCUS_09130 >Feature sequence178 548 1366 gene locus_tag LOCUS_09140 gene lpxA 548 1366 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43887 protein_id gnl|my_center|LOCUS_09140 1423 1800 gene locus_tag LOCUS_09150 1423 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144365.1 protein_id gnl|my_center|LOCUS_09150 1979 2692 gene locus_tag LOCUS_09160 1979 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 3404 3240 gene locus_tag LOCUS_09170 3404 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 >Feature sequence179 1439 90 gene locus_tag LOCUS_09180 1439 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 2978 1455 gene locus_tag LOCUS_09190 gene rbsA2 2978 1455 CDS product ribose import ATP-binding protein RbsA 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RDI1 protein_id gnl|my_center|LOCUS_09190 4034 2979 gene locus_tag LOCUS_09200 gene rbsB 4034 2979 CDS product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634030.1 protein_id gnl|my_center|LOCUS_09200 4540 4142 gene locus_tag LOCUS_09210 4540 4142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 >Feature sequence180 868 2031 gene locus_tag LOCUS_09220 868 2031 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957890.1 protein_id gnl|my_center|LOCUS_09220 2043 2480 gene locus_tag LOCUS_09230 2043 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 3557 2505 gene locus_tag LOCUS_09240 3557 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326116.1 protein_id gnl|my_center|LOCUS_09240 >Feature sequence181 <1 3577 gene locus_tag LOCUS_09250 <1 3577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941413.1:fibronectin type III 3671 3596 gene locus_tag LOCUS_t00130 3671 3596 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4010 4150 gene locus_tag LOCUS_09260 4010 4150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 >Feature sequence182 549 328 gene locus_tag LOCUS_09270 549 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 770 546 gene locus_tag LOCUS_09280 770 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 1586 1011 gene locus_tag LOCUS_09290 1586 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 2114 1749 gene locus_tag LOCUS_09300 2114 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 >Feature sequence183 924 2189 gene locus_tag LOCUS_09310 gene serS 924 2189 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1G4 protein_id gnl|my_center|LOCUS_09310 2235 3692 gene locus_tag LOCUS_09320 gene tilS 2235 3692 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C65 protein_id gnl|my_center|LOCUS_09320 >Feature sequence184 <1 525 gene locus_tag LOCUS_09330 <1 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118368.1:sodium:proton antiporter 522 848 gene locus_tag LOCUS_09340 522 848 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902381.1 protein_id gnl|my_center|LOCUS_09340 845 1255 gene locus_tag LOCUS_09350 845 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 1252 1503 gene locus_tag LOCUS_09360 1252 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09360 1503 2261 gene locus_tag LOCUS_09370 1503 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09370 2281 2889 gene locus_tag LOCUS_09380 2281 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 2894 4453 gene locus_tag LOCUS_09390 2894 4453 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_09390 >Feature sequence185 491 1750 gene locus_tag LOCUS_09400 491 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 1747 2721 gene locus_tag LOCUS_09410 1747 2721 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQR2 protein_id gnl|my_center|LOCUS_09410 2722 3363 gene locus_tag LOCUS_09420 2722 3363 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101103.1 protein_id gnl|my_center|LOCUS_09420 3354 3896 gene locus_tag LOCUS_09430 3354 3896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 >Feature sequence186 2362 3489 gene locus_tag LOCUS_09440 2362 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057110.1 protein_id gnl|my_center|LOCUS_09440 3547 4179 gene locus_tag LOCUS_09450 3547 4179 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706079.1 protein_id gnl|my_center|LOCUS_09450 >Feature sequence187 <1 1143 gene locus_tag LOCUS_09460 <1 1143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005789258.1:sulfatase 1295 3493 gene locus_tag LOCUS_09470 gene katG 1295 3493 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UUW9 protein_id gnl|my_center|LOCUS_09470 3531 4316 gene locus_tag LOCUS_09480 3531 4316 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121235.1 protein_id gnl|my_center|LOCUS_09480 >Feature sequence188 >Feature sequence189 >Feature sequence190 976 62 gene locus_tag LOCUS_09490 976 62 CDS product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393022.1 protein_id gnl|my_center|LOCUS_09490 1195 1809 gene locus_tag LOCUS_09500 1195 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 1820 2155 gene locus_tag LOCUS_09510 1820 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 2169 3779 gene locus_tag LOCUS_09520 gene mviN 2169 3779 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBG8 protein_id gnl|my_center|LOCUS_09520 >Feature sequence191 458 4066 gene locus_tag LOCUS_09530 458 4066 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHB7 protein_id gnl|my_center|LOCUS_09530 4150 4350 gene locus_tag LOCUS_09540 4150 4350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 >Feature sequence192 1652 879 gene locus_tag LOCUS_09550 1652 879 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071371.1 protein_id gnl|my_center|LOCUS_09550 3301 1730 gene locus_tag LOCUS_09560 gene purH 3301 1730 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEK8 protein_id gnl|my_center|LOCUS_09560 3391 3819 gene locus_tag LOCUS_09570 3391 3819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 >Feature sequence193 1706 432 gene locus_tag LOCUS_09580 1706 432 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140914.1 protein_id gnl|my_center|LOCUS_09580 1832 2962 gene locus_tag LOCUS_09590 1832 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 3557 4129 gene locus_tag LOCUS_09600 gene hupE 3557 4129 CDS product urease accessory protein UreJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073963.1 protein_id gnl|my_center|LOCUS_09600 >Feature sequence194 885 145 gene locus_tag LOCUS_09610 gene ubiE 885 145 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122034.1 protein_id gnl|my_center|LOCUS_09610 1667 882 gene locus_tag LOCUS_09620 1667 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 1860 2153 gene locus_tag LOCUS_09630 1860 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 2470 2240 gene locus_tag LOCUS_09640 2470 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 3489 2545 gene locus_tag LOCUS_09650 3489 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 >Feature sequence195 2182 992 gene locus_tag LOCUS_09660 2182 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 >Feature sequence196 >Feature sequence197 905 2320 gene locus_tag LOCUS_09670 905 2320 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5F2 protein_id gnl|my_center|LOCUS_09670 2317 3153 gene locus_tag LOCUS_09680 2317 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 >Feature sequence198 312 1211 gene locus_tag LOCUS_09690 gene ribF 312 1211 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJY1 protein_id gnl|my_center|LOCUS_09690 1837 1208 gene locus_tag LOCUS_09700 1837 1208 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920056.1 protein_id gnl|my_center|LOCUS_09700 2375 1830 gene locus_tag LOCUS_09710 2375 1830 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393596.1 protein_id gnl|my_center|LOCUS_09710 3236 2379 gene locus_tag LOCUS_09720 3236 2379 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 protein_id gnl|my_center|LOCUS_09720 3627 3241 gene locus_tag LOCUS_09730 3627 3241 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143166.1 protein_id gnl|my_center|LOCUS_09730 >Feature sequence199 1751 963 gene locus_tag LOCUS_09740 1751 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123784.1 protein_id gnl|my_center|LOCUS_09740 1958 2941 gene locus_tag LOCUS_09750 1958 2941 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222236.1 protein_id gnl|my_center|LOCUS_09750 2951 3187 gene locus_tag LOCUS_09760 2951 3187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 >Feature sequence200 2487 289 gene locus_tag LOCUS_09770 gene recD2 2487 289 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DN4 protein_id gnl|my_center|LOCUS_09770 3207 2521 gene locus_tag LOCUS_09780 3207 2521 CDS product phosphoglycolate phosphatase, bacterial inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532061.1 protein_id gnl|my_center|LOCUS_09780 >Feature sequence201 317 1744 gene locus_tag LOCUS_09790 317 1744 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121095.1 protein_id gnl|my_center|LOCUS_09790 >Feature sequence202 <1 1318 gene locus_tag LOCUS_09800 <1 1318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582815.1:L-fuculose kinase 1537 1334 gene locus_tag LOCUS_09810 1537 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 2419 1703 gene locus_tag LOCUS_09820 2419 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 2733 2413 gene locus_tag LOCUS_09830 2733 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 3834 2839 gene locus_tag LOCUS_09840 3834 2839 CDS product trans-2-enoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893529.1 protein_id gnl|my_center|LOCUS_09840 >Feature sequence203 598 1737 gene locus_tag LOCUS_09850 598 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 1759 3036 gene locus_tag LOCUS_09860 1759 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 >Feature sequence204 1313 294 gene locus_tag LOCUS_09870 gene apbE 1313 294 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44550 protein_id gnl|my_center|LOCUS_09870 2996 1314 gene locus_tag LOCUS_09880 gene nosR 2996 1314 CDS product NosR regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121575.1 protein_id gnl|my_center|LOCUS_09880 4220 3003 gene locus_tag LOCUS_09890 4220 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 >Feature sequence205 2943 286 gene locus_tag LOCUS_09900 2943 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125416.1 protein_id gnl|my_center|LOCUS_09900 3732 3049 gene locus_tag LOCUS_09910 3732 3049 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125415.1 protein_id gnl|my_center|LOCUS_09910 >Feature sequence206 65 745 gene locus_tag LOCUS_09920 65 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 824 2881 gene locus_tag LOCUS_09930 824 2881 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140331.1 protein_id gnl|my_center|LOCUS_09930 3451 3978 gene locus_tag LOCUS_09940 3451 3978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 >Feature sequence207 1804 569 gene locus_tag LOCUS_09950 1804 569 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123557.1 protein_id gnl|my_center|LOCUS_09950 2536 1832 gene locus_tag LOCUS_09960 2536 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 3387 2554 gene locus_tag LOCUS_09970 3387 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 <4200 3421 gene locus_tag LOCUS_09980 <4200 3421 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123802.1:NADH-dependent dehydrogenase >Feature sequence208 1807 1439 gene locus_tag LOCUS_09990 1807 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 1871 2701 gene locus_tag LOCUS_10000 1871 2701 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057728.1 protein_id gnl|my_center|LOCUS_10000 2698 3561 gene locus_tag LOCUS_10010 2698 3561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 >Feature sequence209 <1 682 gene locus_tag LOCUS_10020 <1 682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WJR8:argininosuccinate lyase 661 1743 gene locus_tag LOCUS_10030 661 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 1752 2579 gene locus_tag LOCUS_10040 1752 2579 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122505.1 protein_id gnl|my_center|LOCUS_10040 3685 2594 gene locus_tag LOCUS_10050 3685 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120927.1 protein_id gnl|my_center|LOCUS_10050 4062 3736 gene locus_tag LOCUS_10060 4062 3736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 >Feature sequence210 1191 2480 gene locus_tag LOCUS_10070 gene glgC 1191 2480 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674820.1 protein_id gnl|my_center|LOCUS_10070 2520 2900 gene locus_tag LOCUS_10080 gene gcvH 2520 2900 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D905 protein_id gnl|my_center|LOCUS_10080 >Feature sequence211 1744 1142 gene locus_tag LOCUS_10090 1744 1142 CDS product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546782.1 protein_id gnl|my_center|LOCUS_10090 1841 2701 gene locus_tag LOCUS_10100 1841 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 2733 3815 gene locus_tag LOCUS_10110 gene pgl 2733 3815 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CLN6 protein_id gnl|my_center|LOCUS_10110 >Feature sequence212 1408 851 gene locus_tag LOCUS_10120 1408 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 3009 1516 gene locus_tag LOCUS_10130 gene atsG 3009 1516 CDS product sulfatase atsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122623.1 protein_id gnl|my_center|LOCUS_10130 3798 3019 gene locus_tag LOCUS_10140 3798 3019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 >Feature sequence213 <1 1275 gene locus_tag LOCUS_10150 <1 1275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028847.1:alkaline phosphatase family protein 1551 2576 gene locus_tag LOCUS_10160 gene moxR 1551 2576 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122148.1 protein_id gnl|my_center|LOCUS_10160 2626 3546 gene locus_tag LOCUS_10170 2626 3546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120923.1 protein_id gnl|my_center|LOCUS_10170 >Feature sequence214 428 1603 gene locus_tag LOCUS_10180 428 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121211.1 protein_id gnl|my_center|LOCUS_10180 1621 4029 gene locus_tag LOCUS_10190 1621 4029 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121671.1 protein_id gnl|my_center|LOCUS_10190 >Feature sequence215 744 1088 gene locus_tag LOCUS_10200 744 1088 CDS product phenylpyruvate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125356.1 protein_id gnl|my_center|LOCUS_10200 1161 3059 gene locus_tag LOCUS_10210 1161 3059 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_10210 >Feature sequence216 1605 478 gene locus_tag LOCUS_10220 1605 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 2290 1580 gene locus_tag LOCUS_10230 2290 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 2772 2287 gene locus_tag LOCUS_10240 2772 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 3278 2769 gene locus_tag LOCUS_10250 3278 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 3756 3337 gene locus_tag LOCUS_10260 gene gspG 3756 3337 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005618920.1 protein_id gnl|my_center|LOCUS_10260 >Feature sequence217 >Feature sequence218 2243 120 gene locus_tag LOCUS_10270 2243 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 3803 2343 gene locus_tag LOCUS_10280 3803 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 >Feature sequence219 112 378 gene locus_tag LOCUS_10290 112 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 375 2087 gene locus_tag LOCUS_10300 375 2087 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119651.1 protein_id gnl|my_center|LOCUS_10300 2119 3207 gene locus_tag LOCUS_10310 2119 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122219.1 protein_id gnl|my_center|LOCUS_10310 >Feature sequence220 <1 506 gene locus_tag LOCUS_10320 <1 506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121414.1:L-proline 4-hydroxylase 519 1340 gene locus_tag LOCUS_10330 519 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 1350 2474 gene locus_tag LOCUS_10340 1350 2474 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976168.1 protein_id gnl|my_center|LOCUS_10340 2480 3115 gene locus_tag LOCUS_10350 2480 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 3677 3216 gene locus_tag LOCUS_10360 3677 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 >Feature sequence221 454 1083 gene locus_tag LOCUS_10370 gene nuoC1 454 1083 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MEX9 protein_id gnl|my_center|LOCUS_10370 1080 2258 gene locus_tag LOCUS_10380 gene nuoD1 1080 2258 CDS product NADH-quinone oxidoreductase subunit D 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WED7 protein_id gnl|my_center|LOCUS_10380 2271 3194 gene locus_tag LOCUS_10390 2271 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 >Feature sequence222 <1 2511 gene locus_tag LOCUS_10400 <1 2511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120793.1:L-sorbosone dehydrogenase 2528 3565 gene locus_tag LOCUS_10410 2528 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 >Feature sequence223 372 776 gene locus_tag LOCUS_10420 372 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 826 1395 gene locus_tag LOCUS_10430 826 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 1415 2896 gene locus_tag LOCUS_10440 1415 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 >Feature sequence224 618 1133 gene locus_tag LOCUS_10450 618 1133 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120138.1 protein_id gnl|my_center|LOCUS_10450 1130 2935 gene locus_tag LOCUS_10460 1130 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 3084 3572 gene locus_tag LOCUS_10470 3084 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 >Feature sequence225 1168 3006 gene locus_tag LOCUS_10480 1168 3006 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_009278.2 protein_id gnl|my_center|LOCUS_10480 3728 3003 gene locus_tag LOCUS_10490 3728 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 >Feature sequence226 1529 369 gene locus_tag LOCUS_10500 1529 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 1703 2761 gene locus_tag LOCUS_10510 1703 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 3703 2765 gene locus_tag LOCUS_10520 3703 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 3908 4027 gene locus_tag LOCUS_10530 3908 4027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 >Feature sequence227 1186 86 gene locus_tag LOCUS_10540 gene nuoH 1186 86 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7Q5 protein_id gnl|my_center|LOCUS_10540 2911 1193 gene locus_tag LOCUS_10550 gene nuoG 2911 1193 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403178.1 protein_id gnl|my_center|LOCUS_10550 <4044 2908 gene locus_tag LOCUS_10560 <4044 2908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000829484.1:NADH-quinone oxidoreductase subunit F >Feature sequence228 1578 535 gene locus_tag LOCUS_10570 1578 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118659.1 protein_id gnl|my_center|LOCUS_10570 2148 2561 gene locus_tag LOCUS_10580 gene vapC 2148 2561 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53WE5 protein_id gnl|my_center|LOCUS_10580 <4025 2574 gene locus_tag LOCUS_10590 <4025 2574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118999.1:cytochrome c >Feature sequence229 426 1151 gene locus_tag LOCUS_10600 426 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10600 1160 1798 gene locus_tag LOCUS_10610 1160 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10610 >Feature sequence230 <4016 1450 gene locus_tag LOCUS_10620 <4016 1450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120679.1:surface protein >Feature sequence231 1994 525 gene locus_tag LOCUS_10630 1994 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122684.1 protein_id gnl|my_center|LOCUS_10630 2137 2775 gene locus_tag LOCUS_10640 2137 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 >Feature sequence232 42 713 gene locus_tag LOCUS_10650 gene tptC 42 713 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038986.1 protein_id gnl|my_center|LOCUS_10650 717 1001 gene locus_tag LOCUS_10660 717 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 1010 1747 gene locus_tag LOCUS_10670 1010 1747 CDS product adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545472.1 protein_id gnl|my_center|LOCUS_10670 1797 3377 gene locus_tag LOCUS_10680 1797 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 >Feature sequence233 1421 450 gene locus_tag LOCUS_10690 1421 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 2485 1418 gene locus_tag LOCUS_10700 2485 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 >Feature sequence234 2201 552 gene locus_tag LOCUS_10710 2201 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 <3958 2328 gene locus_tag LOCUS_10720 <3958 2328 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583271.1:LemA family protein >Feature sequence235 2010 967 gene locus_tag LOCUS_10730 2010 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 2203 2128 gene locus_tag LOCUS_t00140 2203 2128 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2695 2282 gene locus_tag LOCUS_10740 gene atpC 2695 2282 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72E05 protein_id gnl|my_center|LOCUS_10740 <3949 2726 gene locus_tag LOCUS_10750 <3949 2726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DLG8:ATP synthase subunit beta >Feature sequence236 187 1158 gene locus_tag LOCUS_10760 187 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 1260 1176 gene locus_tag LOCUS_t00150 1260 1176 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1433 2899 gene locus_tag LOCUS_10770 1433 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 3357 2911 gene locus_tag LOCUS_10780 3357 2911 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888977.1 protein_id gnl|my_center|LOCUS_10780 3920 3360 gene locus_tag LOCUS_10790 3920 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 >Feature sequence237 2376 3596 gene locus_tag LOCUS_10800 gene arsA 2376 3596 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122187.1 protein_id gnl|my_center|LOCUS_10800 >Feature sequence238 1464 247 gene locus_tag LOCUS_10810 gene arsA 1464 247 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122622.1 protein_id gnl|my_center|LOCUS_10810 1495 1650 gene locus_tag LOCUS_10820 1495 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 1765 3135 gene locus_tag LOCUS_10830 gene aslA 1765 3135 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_10830 >Feature sequence239 503 2278 gene locus_tag LOCUS_10840 503 2278 CDS product glucan biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122835.1 protein_id gnl|my_center|LOCUS_10840 2306 3610 gene locus_tag LOCUS_10850 2306 3610 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120027.1 protein_id gnl|my_center|LOCUS_10850 >Feature sequence240 1990 2940 gene locus_tag LOCUS_10860 1990 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 >Feature sequence241 837 88 gene locus_tag LOCUS_10870 837 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 1511 837 gene locus_tag LOCUS_10880 1511 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 2722 1733 gene locus_tag LOCUS_10890 2722 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 3549 2830 gene locus_tag LOCUS_10900 3549 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 >Feature sequence242 187 768 gene locus_tag LOCUS_10910 187 768 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404273.1 protein_id gnl|my_center|LOCUS_10910 1382 765 gene locus_tag LOCUS_10920 1382 765 CDS product thiamine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965038.1 protein_id gnl|my_center|LOCUS_10920 2268 1402 gene locus_tag LOCUS_10930 2268 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 2864 2265 gene locus_tag LOCUS_10940 gene ribE 2864 2265 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224640.1 protein_id gnl|my_center|LOCUS_10940 >Feature sequence243 <1 1157 gene locus_tag LOCUS_10950 <1 1157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023630.1:thioredoxin domain-containing protein 1867 1154 gene locus_tag LOCUS_10960 gene menG 1867 1154 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4C2 protein_id gnl|my_center|LOCUS_10960 3485 1893 gene locus_tag LOCUS_10970 3485 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 >Feature sequence244 1097 309 gene locus_tag LOCUS_10980 1097 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 1804 1115 gene locus_tag LOCUS_10990 1804 1115 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117823.1 protein_id gnl|my_center|LOCUS_10990 3394 1871 gene locus_tag LOCUS_11000 3394 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 >Feature sequence245 1732 446 gene locus_tag LOCUS_11010 gene pyrC 1732 446 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK42 protein_id gnl|my_center|LOCUS_11010 2688 1729 gene locus_tag LOCUS_11020 gene pyrB 2688 1729 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2K5 protein_id gnl|my_center|LOCUS_11020 3227 2685 gene locus_tag LOCUS_11030 gene pyrR 3227 2685 CDS product bifunctional protein PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59011 protein_id gnl|my_center|LOCUS_11030 <3829 3302 gene locus_tag LOCUS_11040 <3829 3302 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010706578.1:helicase >Feature sequence246 1424 396 gene locus_tag LOCUS_11050 gene ilvC 1424 396 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67289 protein_id gnl|my_center|LOCUS_11050 1959 1483 gene locus_tag LOCUS_11060 gene ilvN 1959 1483 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545180.1 protein_id gnl|my_center|LOCUS_11060 2052 1976 gene locus_tag LOCUS_t00160 2052 1976 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence247 168 389 gene locus_tag LOCUS_11070 168 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 1546 386 gene locus_tag LOCUS_11080 gene iscS 1546 386 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND52 protein_id gnl|my_center|LOCUS_11080 1944 1543 gene locus_tag LOCUS_11090 1944 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 3810 1948 gene locus_tag LOCUS_11100 3810 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701839.1 protein_id gnl|my_center|LOCUS_11100 >Feature sequence248 959 2047 gene locus_tag LOCUS_11110 959 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701837.1 protein_id gnl|my_center|LOCUS_11110 2878 3609 gene locus_tag LOCUS_11120 2878 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 >Feature sequence249 1191 463 gene locus_tag LOCUS_11130 1191 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405037.1 protein_id gnl|my_center|LOCUS_11130 3308 1260 gene locus_tag LOCUS_11140 3308 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 >Feature sequence250 <1 562 gene locus_tag LOCUS_11150 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118057.1:iduronate-2-sulfatase 615 3068 gene locus_tag LOCUS_11160 615 3068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 <3786 3094 gene locus_tag LOCUS_11170 <3786 3094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010944011.1:multidrug transporter AcrB >Feature sequence251 1230 868 gene locus_tag LOCUS_11180 gene panD 1230 868 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFS0 protein_id gnl|my_center|LOCUS_11180 1387 2655 gene locus_tag LOCUS_11190 1387 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 3366 2731 gene locus_tag LOCUS_11200 3366 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 >Feature sequence252 1040 711 gene locus_tag LOCUS_11210 1040 711 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331456.1 protein_id gnl|my_center|LOCUS_11210 1157 1282 gene locus_tag LOCUS_11220 1157 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 1279 2226 gene locus_tag LOCUS_11230 1279 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 2308 3162 gene locus_tag LOCUS_11240 2308 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 >Feature sequence253 103 603 gene locus_tag LOCUS_11250 103 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 702 1775 gene locus_tag LOCUS_11260 gene fbaA 702 1775 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962494.1 protein_id gnl|my_center|LOCUS_11260 1885 2868 gene locus_tag LOCUS_11270 gene tal 1885 2868 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63W00 protein_id gnl|my_center|LOCUS_11270 >Feature sequence254 850 1866 gene locus_tag LOCUS_11280 850 1866 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330234.1 protein_id gnl|my_center|LOCUS_11280 1926 2864 gene locus_tag LOCUS_11290 1926 2864 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330235.1 protein_id gnl|my_center|LOCUS_11290 2861 3595 gene locus_tag LOCUS_11300 2861 3595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 >Feature sequence255 1284 520 gene locus_tag LOCUS_11310 gene hisF 1284 520 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBC1 protein_id gnl|my_center|LOCUS_11310 3066 1306 gene locus_tag LOCUS_11320 3066 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 <3716 3120 gene locus_tag LOCUS_11330 <3716 3120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9CHB1:transcription termination factor Rho >Feature sequence256 2317 1538 gene locus_tag LOCUS_11340 gene suhB 2317 1538 CDS product inositol phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022640.1 protein_id gnl|my_center|LOCUS_11340 2979 2290 gene locus_tag LOCUS_11350 2979 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 <3716 2970 gene locus_tag LOCUS_11360 <3716 2970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021201.1:ABC transporter ATP-binding protein >Feature sequence257 77 2 gene locus_tag LOCUS_t00170 77 2 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 468 1091 gene locus_tag LOCUS_11370 468 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 1945 1295 gene locus_tag LOCUS_11380 1945 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106963.1 protein_id gnl|my_center|LOCUS_11380 3190 1961 gene locus_tag LOCUS_11390 3190 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 >Feature sequence258 <3700 1261 gene locus_tag LOCUS_11400 <3700 1261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118605.1:glucose dehydrogenase >Feature sequence259 >Feature sequence260 <1 1316 gene locus_tag LOCUS_11410 <1 1316 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228473.1:mercury(II) reductase >Feature sequence261 1526 1771 gene locus_tag LOCUS_11420 1526 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 1821 2627 gene locus_tag LOCUS_11430 1821 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 2642 2959 gene locus_tag LOCUS_11440 gene trxA 2642 2959 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7M1B9 protein_id gnl|my_center|LOCUS_11440 <3655 2971 gene locus_tag LOCUS_11450 <3655 2971 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KCB3:1,4-dihydroxy-2-naphthoate octaprenyltransferase >Feature sequence262 636 1745 gene locus_tag LOCUS_11460 636 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 1751 2257 gene locus_tag LOCUS_11470 1751 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 2310 2810 gene locus_tag LOCUS_11480 2310 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 >Feature sequence263 <1 593 gene locus_tag LOCUS_11490 <1 593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258815.1:pyruvate, phosphate dikinase 668 2002 gene locus_tag LOCUS_11500 gene hflX 668 2002 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDT2 protein_id gnl|my_center|LOCUS_11500 3186 2017 gene locus_tag LOCUS_11510 3186 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 >Feature sequence264 990 1691 gene locus_tag LOCUS_11520 990 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 1718 2047 gene locus_tag LOCUS_11530 1718 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 2120 2428 gene locus_tag LOCUS_11540 2120 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 >Feature sequence265 <1 2101 gene locus_tag LOCUS_11550 <1 2101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WHG9:transcription-repair-coupling factor 2094 3125 gene locus_tag LOCUS_11560 2094 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 >Feature sequence266 357 749 gene locus_tag LOCUS_11570 357 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 1724 777 gene locus_tag LOCUS_11580 1724 777 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUQ5 protein_id gnl|my_center|LOCUS_11580 3346 1730 gene locus_tag LOCUS_11590 gene nadB 3346 1730 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C48 protein_id gnl|my_center|LOCUS_11590 >Feature sequence267 <1 1252 gene locus_tag LOCUS_11600 <1 1252 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UMU0:phosphoenolpyruvate-protein phosphotransferase 1500 2594 gene locus_tag LOCUS_11610 gene pilM 1500 2594 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_11610 2607 3296 gene locus_tag LOCUS_11620 2607 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 >Feature sequence268 1319 2668 gene locus_tag LOCUS_11630 1319 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 >Feature sequence269 1581 184 gene locus_tag LOCUS_11640 1581 184 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651487.1 protein_id gnl|my_center|LOCUS_11640 2072 1578 gene locus_tag LOCUS_11650 gene coaD 2072 1578 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EQJ2 protein_id gnl|my_center|LOCUS_11650 2199 2798 gene locus_tag LOCUS_11660 2199 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 2798 3319 gene locus_tag LOCUS_11670 gene pgpA 2798 3319 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GV2 protein_id gnl|my_center|LOCUS_11670 >Feature sequence270 267 139 gene locus_tag LOCUS_11680 267 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 1748 762 gene locus_tag LOCUS_11690 gene fla 1748 762 CDS product flagellar filament 41 kDa core protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P11089 protein_id gnl|my_center|LOCUS_11690 2673 1876 gene locus_tag LOCUS_11700 2673 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 3017 2715 gene locus_tag LOCUS_11710 3017 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 >Feature sequence271 1677 121 gene locus_tag LOCUS_11720 gene murE 1677 121 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK84 protein_id gnl|my_center|LOCUS_11720 3350 1674 gene locus_tag LOCUS_11730 3350 1674 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545621.1 protein_id gnl|my_center|LOCUS_11730 >Feature sequence272 2290 1280 gene locus_tag LOCUS_11740 2290 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 2807 2283 gene locus_tag LOCUS_11750 2807 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 3172 2882 gene locus_tag LOCUS_11760 3172 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 >Feature sequence273 423 217 gene locus_tag LOCUS_11770 423 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 486 2420 gene locus_tag LOCUS_11780 486 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 2456 3262 gene locus_tag LOCUS_11790 2456 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 3556 3470 gene locus_tag LOCUS_t00180 3556 3470 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence274 2256 544 gene locus_tag LOCUS_11800 2256 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 2918 2448 gene locus_tag LOCUS_11810 2918 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 >Feature sequence275 370 891 gene locus_tag LOCUS_11820 370 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 917 1651 gene locus_tag LOCUS_11830 917 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 2552 1665 gene locus_tag LOCUS_11840 2552 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 2724 3023 gene locus_tag LOCUS_11850 2724 3023 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771072.1 protein_id gnl|my_center|LOCUS_11850 >Feature sequence276 1214 45 gene locus_tag LOCUS_11860 gene lpxB1 1214 45 CDS product lipid-A-disaccharide synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVR9 protein_id gnl|my_center|LOCUS_11860 2166 1225 gene locus_tag LOCUS_11870 gene gnnA 2166 1225 CDS product UDP-N-acetylglucosamine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_11870 2875 2180 gene locus_tag LOCUS_11880 gene lolD1 2875 2180 CDS product lipoprotein-releasing system ATP-binding protein LolD 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU16 protein_id gnl|my_center|LOCUS_11880 <3547 2868 gene locus_tag LOCUS_11890 <3547 2868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389453.1:LolC/E family lipoprotein releasing system, protein >Feature sequence277 155 805 gene locus_tag LOCUS_11900 155 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 969 1925 gene locus_tag LOCUS_11910 969 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 1952 2389 gene locus_tag LOCUS_11920 1952 2389 CDS product flagellar hook capping protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392298.1 protein_id gnl|my_center|LOCUS_11920 2424 3275 gene locus_tag LOCUS_11930 gene flgG 2424 3275 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23446 protein_id gnl|my_center|LOCUS_11930 >Feature sequence278 66 2042 gene locus_tag LOCUS_11940 66 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121107.1 protein_id gnl|my_center|LOCUS_11940 2055 3335 gene locus_tag LOCUS_11950 2055 3335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327912.1 protein_id gnl|my_center|LOCUS_11950 >Feature sequence279 91 1578 gene locus_tag LOCUS_11960 91 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 1580 2254 gene locus_tag LOCUS_11970 1580 2254 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257887.1 protein_id gnl|my_center|LOCUS_11970 >Feature sequence280 712 272 gene locus_tag LOCUS_11980 712 272 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X185 protein_id gnl|my_center|LOCUS_11980 1128 733 gene locus_tag LOCUS_11990 1128 733 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X184 protein_id gnl|my_center|LOCUS_11990 1355 2941 gene locus_tag LOCUS_12000 1355 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 >Feature sequence281 3 437 gene locus_tag LOCUS_12010 3 437 CDS product flagellar protein FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKF5 protein_id gnl|my_center|LOCUS_12010 439 810 gene locus_tag LOCUS_12020 439 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 859 1080 gene locus_tag LOCUS_12030 859 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 1487 1077 gene locus_tag LOCUS_12040 1487 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 2086 1484 gene locus_tag LOCUS_12050 gene nadD 2086 1484 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WUM4 protein_id gnl|my_center|LOCUS_12050 3450 2086 gene locus_tag LOCUS_12060 3450 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 >Feature sequence282 889 407 gene locus_tag LOCUS_12070 889 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 1925 873 gene locus_tag LOCUS_12080 gene dinB 1925 873 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZY20 protein_id gnl|my_center|LOCUS_12080 2969 1980 gene locus_tag LOCUS_12090 gene qor 2969 1980 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647231.1 protein_id gnl|my_center|LOCUS_12090 >Feature sequence283 2801 948 gene locus_tag LOCUS_12100 2801 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 >Feature sequence284 >Feature sequence285 1747 905 gene locus_tag LOCUS_12110 1747 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 2820 2083 gene locus_tag LOCUS_12120 2820 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 3255 2866 gene locus_tag LOCUS_12130 3255 2866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 >Feature sequence286 600 965 gene locus_tag LOCUS_12140 600 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 988 1722 gene locus_tag LOCUS_12150 988 1722 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888738.1 protein_id gnl|my_center|LOCUS_12150 1774 3180 gene locus_tag LOCUS_12160 1774 3180 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259322.1 protein_id gnl|my_center|LOCUS_12160 >Feature sequence287 2367 1111 gene locus_tag LOCUS_12170 gene lysA 2367 1111 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190627.1 protein_id gnl|my_center|LOCUS_12170 >Feature sequence288 1228 2559 gene locus_tag LOCUS_12180 1228 2559 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222757.1 protein_id gnl|my_center|LOCUS_12180 <3417 2556 gene locus_tag LOCUS_12190 <3417 2556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122176.1:thiol-disulfide isomerase >Feature sequence289 681 2030 gene locus_tag LOCUS_12200 gene GALNS 681 2030 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121616.1 protein_id gnl|my_center|LOCUS_12200 >Feature sequence290 2065 2976 gene locus_tag LOCUS_12210 gene cas1 2065 2976 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS0 protein_id gnl|my_center|LOCUS_12210 2943 3278 gene locus_tag LOCUS_12220 2943 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 >Feature sequence291 1039 2277 gene locus_tag LOCUS_12230 1039 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 >Feature sequence292 <1 641 gene locus_tag LOCUS_12240 <1 641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142321.1:RNA helicase 657 1055 gene locus_tag LOCUS_12250 gene msrB 657 1055 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I016 protein_id gnl|my_center|LOCUS_12250 1404 2006 gene locus_tag LOCUS_12260 1404 2006 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903191.1 protein_id gnl|my_center|LOCUS_12260 >Feature sequence293 6 221 gene locus_tag LOCUS_12270 6 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 359 1582 gene locus_tag LOCUS_12280 359 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 2350 2111 gene locus_tag LOCUS_12290 2350 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 2592 3407 gene locus_tag LOCUS_12300 2592 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 >Feature sequence294 434 1699 gene locus_tag LOCUS_12310 434 1699 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942966.1 protein_id gnl|my_center|LOCUS_12310 1750 2547 gene locus_tag LOCUS_12320 1750 2547 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036519.1 protein_id gnl|my_center|LOCUS_12320 >Feature sequence295 912 61 gene locus_tag LOCUS_12330 912 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 1046 2170 gene locus_tag LOCUS_12340 1046 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 2182 2745 gene locus_tag LOCUS_12350 2182 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 >Feature sequence296 895 248 gene locus_tag LOCUS_12360 895 248 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881633.1 protein_id gnl|my_center|LOCUS_12360 2079 892 gene locus_tag LOCUS_12370 2079 892 CDS product glycerate 2-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296434.1 protein_id gnl|my_center|LOCUS_12370 <3400 2121 gene locus_tag LOCUS_12380 <3400 2121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007328924.1:ribonuclease E >Feature sequence297 373 1746 gene locus_tag LOCUS_12390 gene crtI 373 1746 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118443.1 protein_id gnl|my_center|LOCUS_12390 1750 2049 gene locus_tag LOCUS_12400 gene clpS 1750 2049 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NMQ1 protein_id gnl|my_center|LOCUS_12400 2042 2500 gene locus_tag LOCUS_12410 2042 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 >Feature sequence298 356 1450 gene locus_tag LOCUS_12420 356 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 1447 2394 gene locus_tag LOCUS_12430 1447 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 2398 3141 gene locus_tag LOCUS_12440 2398 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 >Feature sequence299 1931 1005 gene locus_tag LOCUS_12450 1931 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 3258 1963 gene locus_tag LOCUS_12460 gene murD 3258 1963 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F6L6 protein_id gnl|my_center|LOCUS_12460 >Feature sequence300 1252 437 gene locus_tag LOCUS_12470 1252 437 CDS product putative oxidoreductase EphD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700844.1 protein_id gnl|my_center|LOCUS_12470 1351 2481 gene locus_tag LOCUS_12480 1351 2481 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403060.1 protein_id gnl|my_center|LOCUS_12480 3366 2686 gene locus_tag LOCUS_12490 gene wzm 3366 2686 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63RJ0 protein_id gnl|my_center|LOCUS_12490 >Feature sequence301 <1 951 gene locus_tag LOCUS_12500 <1 951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009940935.1:LPS biosynthesis protein 1197 2156 gene locus_tag LOCUS_12510 1197 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 >Feature sequence302 2266 3150 gene locus_tag LOCUS_12520 2266 3150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 >Feature sequence303 433 849 gene locus_tag LOCUS_12530 433 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 1120 884 gene locus_tag LOCUS_12540 1120 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 1240 2622 gene locus_tag LOCUS_12550 1240 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 3127 2681 gene locus_tag LOCUS_12560 3127 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 >Feature sequence304 2907 2560 gene locus_tag LOCUS_12570 2907 2560 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931759.1 protein_id gnl|my_center|LOCUS_12570 >Feature sequence305 3168 1552 gene locus_tag LOCUS_12580 3168 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 >Feature sequence306 527 1957 gene locus_tag LOCUS_12590 527 1957 CDS product O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963532.1 protein_id gnl|my_center|LOCUS_12590 1994 2938 gene locus_tag LOCUS_12600 1994 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 >Feature sequence307 <1 1776 gene locus_tag LOCUS_12610 <1 1776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q05873:valine--tRNA ligase 2164 1796 gene locus_tag LOCUS_12620 2164 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 2276 2351 gene locus_tag LOCUS_t00190 2276 2351 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence308 2557 1265 gene locus_tag LOCUS_12630 2557 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121211.1 protein_id gnl|my_center|LOCUS_12630 >Feature sequence309 897 1406 gene locus_tag LOCUS_12640 897 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 1458 2099 gene locus_tag LOCUS_12650 gene rpe 1458 2099 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A1H8 protein_id gnl|my_center|LOCUS_12650 <3261 2118 gene locus_tag LOCUS_12660 <3261 2118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to D1B616:putative K(+)-stimulated pyrophosphate-energized sodium pump >Feature sequence310 489 25 gene locus_tag LOCUS_12670 489 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 1984 521 gene locus_tag LOCUS_12680 gene lysS 1984 521 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I3U577 protein_id gnl|my_center|LOCUS_12680 >Feature sequence311 <1 972 gene locus_tag LOCUS_12690 <1 972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005479643.1:peptide ABC transporter permease 974 1450 gene locus_tag LOCUS_12700 974 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 1462 2316 gene locus_tag LOCUS_12710 1462 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 >Feature sequence312 167 595 gene locus_tag LOCUS_12720 167 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 595 1539 gene locus_tag LOCUS_12730 595 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 2775 1801 gene locus_tag LOCUS_12740 2775 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 3102 3026 gene locus_tag LOCUS_t00200 3102 3026 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence313 1731 484 gene locus_tag LOCUS_12750 1731 484 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957740.1 protein_id gnl|my_center|LOCUS_12750 2846 1743 gene locus_tag LOCUS_12760 2846 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 >Feature sequence314 2103 2636 gene locus_tag LOCUS_12770 2103 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 >Feature sequence315 114 1409 gene locus_tag LOCUS_12780 114 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 >Feature sequence316 1 780 gene locus_tag LOCUS_12790 1 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 1812 784 gene locus_tag LOCUS_12800 gene yjjN 1812 784 CDS product zinc-type alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119735.1 protein_id gnl|my_center|LOCUS_12800 1949 2410 gene locus_tag LOCUS_12810 1949 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332434.1 protein_id gnl|my_center|LOCUS_12810 2433 3101 gene locus_tag LOCUS_12820 2433 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 >Feature sequence317 881 1573 gene locus_tag LOCUS_12830 881 1573 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057460.1 protein_id gnl|my_center|LOCUS_12830 2472 1702 gene locus_tag LOCUS_12840 2472 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123730.1 protein_id gnl|my_center|LOCUS_12840 3012 2488 gene locus_tag LOCUS_12850 3012 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 >Feature sequence318 1054 332 gene locus_tag LOCUS_12860 1054 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 2614 1058 gene locus_tag LOCUS_12870 2614 1058 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403101.1 protein_id gnl|my_center|LOCUS_12870 2943 2611 gene locus_tag LOCUS_12880 2943 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 >Feature sequence319 1357 347 gene locus_tag LOCUS_12890 1357 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 1467 2984 gene locus_tag LOCUS_12900 1467 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 >Feature sequence320 913 227 gene locus_tag LOCUS_12910 913 227 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405245.1 protein_id gnl|my_center|LOCUS_12910 1520 1086 gene locus_tag LOCUS_12920 1520 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 1732 1926 gene locus_tag LOCUS_12930 1732 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 3067 1928 gene locus_tag LOCUS_12940 3067 1928 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405503.1 protein_id gnl|my_center|LOCUS_12940 >Feature sequence321 525 139 gene locus_tag LOCUS_12950 525 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 1034 633 gene locus_tag LOCUS_12960 1034 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 2251 1106 gene locus_tag LOCUS_12970 2251 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 >Feature sequence322 2541 1699 gene locus_tag LOCUS_12980 2541 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 2880 2596 gene locus_tag LOCUS_12990 2880 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 >Feature sequence323 1896 772 gene locus_tag LOCUS_13000 1896 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 <3157 1907 gene locus_tag LOCUS_13010 <3157 1907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120737.1:sulfatase >Feature sequence324 61 495 gene locus_tag LOCUS_13020 61 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 474 638 gene locus_tag LOCUS_13030 474 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 687 1676 gene locus_tag LOCUS_13040 gene wzz 687 1676 CDS product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073078.1 protein_id gnl|my_center|LOCUS_13040 >Feature sequence325 >Feature sequence326 1459 527 gene locus_tag LOCUS_13050 gene wbmG 1459 527 CDS product nucleotide sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038685.1 protein_id gnl|my_center|LOCUS_13050 2477 1545 gene locus_tag LOCUS_13060 gene wbmH 2477 1545 CDS product nucleotide sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807090.1 protein_id gnl|my_center|LOCUS_13060 <3146 2507 gene locus_tag LOCUS_13070 <3146 2507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003807086.1:asparagine synthetase B >Feature sequence327 <1 906 gene locus_tag LOCUS_13080 <1 906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035434.1:phospholipase D family protein 1227 910 gene locus_tag LOCUS_13090 1227 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 1964 1239 gene locus_tag LOCUS_13100 gene prpC 1964 1239 CDS product protein phosphatase PrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34779 protein_id gnl|my_center|LOCUS_13100 <3124 2055 gene locus_tag LOCUS_13110 <3124 2055 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121692.1:helicase >Feature sequence328 1150 449 gene locus_tag LOCUS_13120 1150 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 1396 2682 gene locus_tag LOCUS_13130 gene pepP 1396 2682 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_13130 >Feature sequence329 <1 723 gene locus_tag LOCUS_13140 <1 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64RB9:signal recognition particle protein 1363 716 gene locus_tag LOCUS_13150 gene trpF 1363 716 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X4E3 protein_id gnl|my_center|LOCUS_13150 2898 1360 gene locus_tag LOCUS_13160 2898 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460180.1 protein_id gnl|my_center|LOCUS_13160 >Feature sequence330 2231 477 gene locus_tag LOCUS_13170 gene msbA 2231 477 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_13170 3101 2316 gene locus_tag LOCUS_13180 3101 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 >Feature sequence331 >Feature sequence332 562 876 gene locus_tag LOCUS_13190 562 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 881 1477 gene locus_tag LOCUS_13200 gene recR 881 1477 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SHY0 protein_id gnl|my_center|LOCUS_13200 1530 1730 gene locus_tag LOCUS_13210 1530 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 1727 2125 gene locus_tag LOCUS_13220 1727 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 2468 2166 gene locus_tag LOCUS_13230 2468 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 <3096 2556 gene locus_tag LOCUS_13240 <3096 2556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3XWZ6:RNA polymerase sigma factor SigA >Feature sequence333 1688 603 gene locus_tag LOCUS_13250 1688 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 >Feature sequence334 76 1 gene locus_tag LOCUS_t00210 76 1 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 342 752 gene locus_tag LOCUS_13260 342 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 745 3024 gene locus_tag LOCUS_13270 745 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 >Feature sequence335 <1 1155 gene locus_tag LOCUS_13280 <1 1155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q97KI2:histidinol dehydrogenase 1162 2268 gene locus_tag LOCUS_13290 gene hisC 1162 2268 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61000 protein_id gnl|my_center|LOCUS_13290 2241 2843 gene locus_tag LOCUS_13300 gene hisB 2241 2843 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60885 protein_id gnl|my_center|LOCUS_13300 >Feature sequence336 >Feature sequence337 2 952 gene locus_tag LOCUS_13310 2 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 1026 1751 gene locus_tag LOCUS_13320 1026 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 1910 2488 gene locus_tag LOCUS_13330 1910 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 >Feature sequence338 255 542 gene locus_tag LOCUS_13340 255 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 819 580 gene locus_tag LOCUS_13350 819 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 1121 2236 gene locus_tag LOCUS_13360 1121 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 <3077 2336 gene locus_tag LOCUS_13370 <3077 2336 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120982.1:sulfatase >Feature sequence339 624 854 gene locus_tag LOCUS_13380 624 854 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943111.1 protein_id gnl|my_center|LOCUS_13380 854 1261 gene locus_tag LOCUS_13390 gene vapC 854 1261 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AB8 protein_id gnl|my_center|LOCUS_13390 1275 1715 gene locus_tag LOCUS_13400 1275 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 2200 1820 gene locus_tag LOCUS_13410 2200 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 >Feature sequence340 35 124 gene locus_tag LOCUS_t00220 35 124 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1924 905 gene locus_tag LOCUS_13420 1924 905 CDS product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066920.1 protein_id gnl|my_center|LOCUS_13420 2371 1937 gene locus_tag LOCUS_13430 2371 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 >Feature sequence341 1175 2275 gene locus_tag LOCUS_13440 1175 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 >Feature sequence342 838 1590 gene locus_tag LOCUS_13450 838 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 2908 1616 gene locus_tag LOCUS_13460 2908 1616 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118166.1 protein_id gnl|my_center|LOCUS_13460 >Feature sequence343 166 1218 gene locus_tag LOCUS_13470 166 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 1291 2397 gene locus_tag LOCUS_13480 1291 2397 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121284.1 protein_id gnl|my_center|LOCUS_13480 2996 2394 gene locus_tag LOCUS_13490 2996 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13490 >Feature sequence344 3 302 gene locus_tag LOCUS_13500 3 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 >Feature sequence345 1622 654 gene locus_tag LOCUS_13510 1622 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 2569 1640 gene locus_tag LOCUS_13520 2569 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 >Feature sequence346 2389 1490 gene locus_tag LOCUS_13530 2389 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118532.1 protein_id gnl|my_center|LOCUS_13530 <3049 2467 gene locus_tag LOCUS_13540 <3049 2467 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007335040.1:ATPase AAA >Feature sequence347 2640 1315 gene locus_tag LOCUS_13550 2640 1315 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118427.1 protein_id gnl|my_center|LOCUS_13550 >Feature sequence348 2071 1130 gene locus_tag LOCUS_13560 2071 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 2474 2061 gene locus_tag LOCUS_13570 2474 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 2601 2828 gene locus_tag LOCUS_13580 2601 2828 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943901.1 protein_id gnl|my_center|LOCUS_13580 >Feature sequence349 >Feature sequence350 1130 27 gene locus_tag LOCUS_13590 gene lpsB 1130 27 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208294.1 protein_id gnl|my_center|LOCUS_13590 2071 1127 gene locus_tag LOCUS_13600 2071 1127 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207641.1 protein_id gnl|my_center|LOCUS_13600 2350 2568 gene locus_tag LOCUS_13610 2350 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 >Feature sequence351 1432 413 gene locus_tag LOCUS_13620 1432 413 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808862.1 protein_id gnl|my_center|LOCUS_13620 <3044 1493 gene locus_tag LOCUS_13630 <3044 1493 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009937746.1:MFS transporter >Feature sequence352 <1 570 gene locus_tag LOCUS_13640 <1 570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119307.1:PIG-L domain-containing protein 1861 554 gene locus_tag LOCUS_13650 1861 554 CDS product chloramphenicol resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123639.1 protein_id gnl|my_center|LOCUS_13650 2621 1869 gene locus_tag LOCUS_13660 2621 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918966.1 protein_id gnl|my_center|LOCUS_13660 >Feature sequence353 1633 215 gene locus_tag LOCUS_13670 1633 215 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085058.1 protein_id gnl|my_center|LOCUS_13670 2754 1723 gene locus_tag LOCUS_13680 2754 1723 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085057.1 protein_id gnl|my_center|LOCUS_13680 3037 2795 gene locus_tag LOCUS_13690 3037 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 >Feature sequence354 <3035 451 gene locus_tag LOCUS_13700 <3035 451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YFV7:DNA-directed RNA polymerase subunit beta' >Feature sequence355 >Feature sequence356 1344 805 gene locus_tag LOCUS_13710 1344 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 2198 1461 gene locus_tag LOCUS_13720 2198 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120331.1 protein_id gnl|my_center|LOCUS_13720 >Feature sequence357 553 1638 gene locus_tag LOCUS_13730 553 1638 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJD1 protein_id gnl|my_center|LOCUS_13730 2044 2577 gene locus_tag LOCUS_13740 2044 2577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 2652 2972 gene locus_tag LOCUS_13750 2652 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 >Feature sequence358 >Feature sequence359 2103 982 gene locus_tag LOCUS_13760 2103 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 >Feature sequence360 1334 213 gene locus_tag LOCUS_13770 1334 213 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704988.1 protein_id gnl|my_center|LOCUS_13770 1460 2710 gene locus_tag LOCUS_13780 1460 2710 CDS product quinohemoprotein ethanol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117995.1 protein_id gnl|my_center|LOCUS_13780 >Feature sequence361 596 1231 gene locus_tag LOCUS_13790 596 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 1464 2246 gene locus_tag LOCUS_13800 1464 2246 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082969.1 protein_id gnl|my_center|LOCUS_13800 2567 2262 gene locus_tag LOCUS_13810 2567 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 >Feature sequence362 339 1127 gene locus_tag LOCUS_13820 339 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 1124 2602 gene locus_tag LOCUS_13830 1124 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 2853 2599 gene locus_tag LOCUS_13840 2853 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 >Feature sequence363 >Feature sequence364 1438 629 gene locus_tag LOCUS_13850 1438 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 >Feature sequence365 654 2453 gene locus_tag LOCUS_13860 654 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 >Feature sequence366 455 814 gene locus_tag LOCUS_13870 455 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056929.1 protein_id gnl|my_center|LOCUS_13870 811 1995 gene locus_tag LOCUS_13880 811 1995 CDS product 3-chlorobenzoate-3,4-dioxygenase dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122559.1 protein_id gnl|my_center|LOCUS_13880 >Feature sequence367 2729 1590 gene locus_tag LOCUS_13890 gene murG 2729 1590 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VDZ2 protein_id gnl|my_center|LOCUS_13890 >Feature sequence368 <1 675 gene locus_tag LOCUS_13900 <1 675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393478.1:AMP-dependent ligase 1511 2185 gene locus_tag LOCUS_13910 1511 2185 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933918.1 protein_id gnl|my_center|LOCUS_13910 2224 2484 gene locus_tag LOCUS_13920 2224 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 >Feature sequence369 >Feature sequence370 <1 775 gene locus_tag LOCUS_13930 <1 775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123571.1:iduronate-2-sulfatase <2937 823 gene locus_tag LOCUS_13940 <2937 823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119295.1:cytochrome c >Feature sequence371 1520 864 gene locus_tag LOCUS_13950 1520 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 1708 2877 gene locus_tag LOCUS_13960 1708 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 >Feature sequence372 1791 2720 gene locus_tag LOCUS_13970 1791 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 >Feature sequence373 2 1951 gene locus_tag LOCUS_13980 2 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 >Feature sequence374 <1 889 gene locus_tag LOCUS_13990 <1 889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q747C7:60 kDa chaperonin 1041 2291 gene locus_tag LOCUS_14000 1041 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202697.1 protein_id gnl|my_center|LOCUS_14000 >Feature sequence375 <1 957 gene locus_tag LOCUS_14010 <1 957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74BU1:bifunctional ligase/repressor BirA 957 1697 gene locus_tag LOCUS_14020 gene coaX 957 1697 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5R1 protein_id gnl|my_center|LOCUS_14020 1712 2518 gene locus_tag LOCUS_14030 gene trpA 1712 2518 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AI3 protein_id gnl|my_center|LOCUS_14030 >Feature sequence376 >Feature sequence377 1370 84 gene locus_tag LOCUS_14040 1370 84 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957671.1 protein_id gnl|my_center|LOCUS_14040 <2897 1367 gene locus_tag LOCUS_14050 <2897 1367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879167.1:phenylacetate--CoA ligase >Feature sequence378 126 49 gene locus_tag LOCUS_t00230 126 49 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 327 1640 gene locus_tag LOCUS_14060 gene xylA 327 1640 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVG2 protein_id gnl|my_center|LOCUS_14060 >Feature sequence379 365 2458 gene locus_tag LOCUS_14070 365 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120992.1 protein_id gnl|my_center|LOCUS_14070 >Feature sequence380 268 1062 gene locus_tag LOCUS_14080 268 1062 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804151.1 protein_id gnl|my_center|LOCUS_14080 1059 2117 gene locus_tag LOCUS_14090 1059 2117 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978349.1 protein_id gnl|my_center|LOCUS_14090 >Feature sequence381 258 1793 gene locus_tag LOCUS_14100 258 1793 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123682.1 protein_id gnl|my_center|LOCUS_14100 >Feature sequence382 893 462 gene locus_tag LOCUS_14110 gene hisI 893 462 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZS0 protein_id gnl|my_center|LOCUS_14110 1011 2669 gene locus_tag LOCUS_14120 1011 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 2871 2683 gene locus_tag LOCUS_14130 2871 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 >Feature sequence383 866 2308 gene locus_tag LOCUS_14140 866 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203365.1 protein_id gnl|my_center|LOCUS_14140 >Feature sequence384 >Feature sequence385 <1 1689 gene locus_tag LOCUS_14150 <1 1689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NJR3:carbamoyl-phosphate synthase (glutamine-hydrolyzing) 1705 2556 gene locus_tag LOCUS_14160 gene purU 1705 2556 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67681 protein_id gnl|my_center|LOCUS_14160 >Feature sequence386 1463 678 gene locus_tag LOCUS_14170 1463 678 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460169.1 protein_id gnl|my_center|LOCUS_14170 1824 1471 gene locus_tag LOCUS_14180 gene arsC 1824 1471 CDS product ArsC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001971937.1 protein_id gnl|my_center|LOCUS_14180 >Feature sequence387 >Feature sequence388 879 106 gene locus_tag LOCUS_14190 gene thiG 879 106 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KF4 protein_id gnl|my_center|LOCUS_14190 1523 876 gene locus_tag LOCUS_14200 1523 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 2159 1524 gene locus_tag LOCUS_14210 2159 1524 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788060.1 protein_id gnl|my_center|LOCUS_14210 2362 2159 gene locus_tag LOCUS_14220 2362 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 >Feature sequence389 1278 919 gene locus_tag LOCUS_14230 gene rplT 1278 919 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKP6 protein_id gnl|my_center|LOCUS_14230 1537 1319 gene locus_tag LOCUS_14240 1537 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 1953 1597 gene locus_tag LOCUS_14250 1953 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 2731 1946 gene locus_tag LOCUS_14260 2731 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 >Feature sequence390 1606 569 gene locus_tag LOCUS_14270 gene prfB 1606 569 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P28367 protein_id gnl|my_center|LOCUS_14270 2516 1752 gene locus_tag LOCUS_14280 gene cysH 2516 1752 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XV36 protein_id gnl|my_center|LOCUS_14280 >Feature sequence391 <2834 1018 gene locus_tag LOCUS_14290 <2834 1018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004525850.1:DNA topoisomerase III >Feature sequence392 366 100 gene locus_tag LOCUS_14300 366 100 CDS product UPF0235 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z854 protein_id gnl|my_center|LOCUS_14300 520 1362 gene locus_tag LOCUS_14310 520 1362 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057816.1 protein_id gnl|my_center|LOCUS_14310 2233 1376 gene locus_tag LOCUS_14320 2233 1376 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258992.1 protein_id gnl|my_center|LOCUS_14320 <2834 2214 gene locus_tag LOCUS_14330 <2834 2214 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876081.1:excinuclease ABC subunit B >Feature sequence393 >Feature sequence394 1262 777 gene locus_tag LOCUS_14340 gene eco 1262 777 CDS product ecotin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I088 protein_id gnl|my_center|LOCUS_14340 2264 1332 gene locus_tag LOCUS_14350 2264 1332 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I583 protein_id gnl|my_center|LOCUS_14350 2827 2300 gene locus_tag LOCUS_14360 2827 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 >Feature sequence395 429 7 gene locus_tag LOCUS_14370 429 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 1012 434 gene locus_tag LOCUS_14380 1012 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 1904 1071 gene locus_tag LOCUS_14390 1904 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 >Feature sequence396 1167 58 gene locus_tag LOCUS_14400 gene flgI 1167 58 CDS product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748F5 protein_id gnl|my_center|LOCUS_14400 1846 1178 gene locus_tag LOCUS_14410 gene flgH 1846 1178 CDS product flagellar L-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIX2 protein_id gnl|my_center|LOCUS_14410 2684 1818 gene locus_tag LOCUS_14420 2684 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 2812 2684 gene locus_tag LOCUS_14430 2812 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 >Feature sequence397 >Feature sequence398 1335 1 gene locus_tag LOCUS_14440 1335 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118694.1 protein_id gnl|my_center|LOCUS_14440 1497 2270 gene locus_tag LOCUS_14450 1497 2270 CDS product integral membrane protein TerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705173.1 protein_id gnl|my_center|LOCUS_14450 2805 2305 gene locus_tag LOCUS_14460 2805 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 >Feature sequence399 >Feature sequence400 897 214 gene locus_tag LOCUS_14470 897 214 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114346.1 protein_id gnl|my_center|LOCUS_14470 1008 2006 gene locus_tag LOCUS_14480 1008 2006 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228161.1 protein_id gnl|my_center|LOCUS_14480 >Feature sequence401 1699 962 gene locus_tag LOCUS_14490 1699 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14490 2255 1701 gene locus_tag LOCUS_14500 2255 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14500 2794 2255 gene locus_tag LOCUS_14510 2794 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 >Feature sequence402 415 209 gene locus_tag LOCUS_14520 415 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 454 1887 gene locus_tag LOCUS_14530 454 1887 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SIV3 protein_id gnl|my_center|LOCUS_14530 <2784 1903 gene locus_tag LOCUS_14540 <2784 1903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071875.1:alpha/beta hydrolase >Feature sequence403 933 517 gene locus_tag LOCUS_14550 933 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 2472 1069 gene locus_tag LOCUS_14560 2472 1069 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120737.1 protein_id gnl|my_center|LOCUS_14560 >Feature sequence404 808 2361 gene locus_tag LOCUS_14570 808 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 >Feature sequence405 546 2012 gene locus_tag LOCUS_14580 gene pepA 546 2012 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WC3 protein_id gnl|my_center|LOCUS_14580 >Feature sequence406 >Feature sequence407 <1 537 gene locus_tag LOCUS_14590 <1 537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118432.1:general secretion pathway protein GspD >Feature sequence408 >Feature sequence409 698 150 gene locus_tag LOCUS_14600 698 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 2479 1337 gene locus_tag LOCUS_14610 2479 1337 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_345307.1 protein_id gnl|my_center|LOCUS_14610 >Feature sequence410 2581 260 gene locus_tag LOCUS_14620 2581 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 >Feature sequence411 2400 1357 gene locus_tag LOCUS_14630 2400 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 >Feature sequence412 1145 654 gene locus_tag LOCUS_14640 1145 654 CDS product azurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYW1 protein_id gnl|my_center|LOCUS_14640 >Feature sequence413 1542 517 gene locus_tag LOCUS_14650 1542 517 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_14650 1702 2700 gene locus_tag LOCUS_14660 1702 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 >Feature sequence414 362 1024 gene locus_tag LOCUS_14670 362 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14670 1871 1032 gene locus_tag LOCUS_14680 1871 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 >Feature sequence415 >Feature sequence416 772 20 gene locus_tag LOCUS_14690 772 20 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122635.1 protein_id gnl|my_center|LOCUS_14690 >Feature sequence417 2063 1041 gene locus_tag LOCUS_14700 2063 1041 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_14700 <2722 2099 gene locus_tag LOCUS_14710 <2722 2099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021097.1:dolichyl-phosphate beta-D-mannosyltransferase >Feature sequence418 618 73 gene locus_tag LOCUS_14720 618 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 1032 685 gene locus_tag LOCUS_14730 1032 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 1292 1618 gene locus_tag LOCUS_14740 1292 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 2702 1638 gene locus_tag LOCUS_14750 gene pyrD 2702 1638 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DBI7 protein_id gnl|my_center|LOCUS_14750 >Feature sequence419 >Feature sequence420 >Feature sequence421 564 1799 gene locus_tag LOCUS_14760 564 1799 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119140.1 protein_id gnl|my_center|LOCUS_14760 1876 2118 gene locus_tag LOCUS_14770 1876 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 2126 2341 gene locus_tag LOCUS_14780 2126 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 >Feature sequence422 1724 417 gene locus_tag LOCUS_14790 1724 417 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788605.1 protein_id gnl|my_center|LOCUS_14790 1987 2514 gene locus_tag LOCUS_14800 1987 2514 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815169.1 protein_id gnl|my_center|LOCUS_14800 >Feature sequence423 258 1232 gene locus_tag LOCUS_14810 258 1232 CDS product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224650.1 protein_id gnl|my_center|LOCUS_14810 >Feature sequence424 2140 1073 gene locus_tag LOCUS_14820 2140 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 <2690 2184 gene locus_tag LOCUS_14830 <2690 2184 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085740.1:gluconolactonase >Feature sequence425 2235 745 gene locus_tag LOCUS_14840 2235 745 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118024.1 protein_id gnl|my_center|LOCUS_14840 >Feature sequence426 803 879 gene locus_tag LOCUS_t00240 803 879 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 980 1738 gene locus_tag LOCUS_14850 980 1738 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868539.1 protein_id gnl|my_center|LOCUS_14850 1790 2224 gene locus_tag LOCUS_14860 gene aroQ 1790 2224 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52377 protein_id gnl|my_center|LOCUS_14860 >Feature sequence427 <2679 583 gene locus_tag LOCUS_14870 <2679 583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122099.1:membrane protein >Feature sequence428 2612 1548 gene locus_tag LOCUS_14880 gene galM 2612 1548 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ38 protein_id gnl|my_center|LOCUS_14880 >Feature sequence429 439 1692 gene locus_tag LOCUS_14890 439 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 >Feature sequence430 <1 582 gene locus_tag LOCUS_14900 <1 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121362.1:xylose isomerase <2646 596 gene locus_tag LOCUS_14910 <2646 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119295.1:cytochrome c >Feature sequence431 215 628 gene locus_tag LOCUS_14920 215 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 667 1131 gene locus_tag LOCUS_14930 667 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 1152 1547 gene locus_tag LOCUS_14940 1152 1547 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975605.1 protein_id gnl|my_center|LOCUS_14940 2573 1572 gene locus_tag LOCUS_14950 2573 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 >Feature sequence432 >Feature sequence433 472 873 gene locus_tag LOCUS_14960 472 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 970 1404 gene locus_tag LOCUS_14970 970 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 2030 1458 gene locus_tag LOCUS_14980 2030 1458 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250601.1 protein_id gnl|my_center|LOCUS_14980 <2625 2027 gene locus_tag LOCUS_14990 <2625 2027 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q6HCJ1:nicotinate phosphoribosyltransferase >Feature sequence434 1823 504 gene locus_tag LOCUS_15000 1823 504 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119046.1 protein_id gnl|my_center|LOCUS_15000 >Feature sequence435 <1 1771 gene locus_tag LOCUS_15010 <1 1771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q73J81:transcription elongation factor GreA >Feature sequence436 <2607 1092 gene locus_tag LOCUS_15020 <2607 1092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118945.1:azurin >Feature sequence437 582 2069 gene locus_tag LOCUS_15030 582 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122305.1 protein_id gnl|my_center|LOCUS_15030 >Feature sequence438 <2598 91 gene locus_tag LOCUS_15040 <2598 91 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121568.1:xanthan lyase >Feature sequence439 >Feature sequence440 161 1630 gene locus_tag LOCUS_15050 161 1630 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869086.1 protein_id gnl|my_center|LOCUS_15050 >Feature sequence441 387 776 gene locus_tag LOCUS_15060 387 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 1033 1956 gene locus_tag LOCUS_15070 1033 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117866.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15070 >Feature sequence442 <1 524 gene locus_tag LOCUS_15080 <1 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118315.1:phytoene dehydrogenase 553 993 gene locus_tag LOCUS_15090 gene fabZ 553 993 CDS product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121723.1 protein_id gnl|my_center|LOCUS_15090 1000 1818 gene locus_tag LOCUS_15100 gene fabI 1000 1818 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UG49 protein_id gnl|my_center|LOCUS_15100 >Feature sequence443 373 2085 gene locus_tag LOCUS_15110 373 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 2201 2503 gene locus_tag LOCUS_15120 2201 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 >Feature sequence444 <1 1252 gene locus_tag LOCUS_15130 <1 1252 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120368.1:N-acetylgalactosamine-6-sulfatase 1318 2229 gene locus_tag LOCUS_15140 1318 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 >Feature sequence445 <1 606 gene locus_tag LOCUS_15150 <1 606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583238.1:type II secretion system protein GspE 610 2301 gene locus_tag LOCUS_15160 gene pilB 610 2301 CDS product type IV fimbrial assembly protein PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123902.1 protein_id gnl|my_center|LOCUS_15160 >Feature sequence446 681 1103 gene locus_tag LOCUS_15170 681 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 1100 1924 gene locus_tag LOCUS_15180 1100 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 >Feature sequence447 >Feature sequence448 1832 693 gene locus_tag LOCUS_15190 1832 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 <2567 1953 gene locus_tag LOCUS_15200 <2567 1953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957740.1:methyltransferase >Feature sequence449 473 1468 gene locus_tag LOCUS_15210 gene gmd 473 1468 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJ72 protein_id gnl|my_center|LOCUS_15210 >Feature sequence450 1387 320 gene locus_tag LOCUS_15220 1387 320 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942836.1 protein_id gnl|my_center|LOCUS_15220 1487 2215 gene locus_tag LOCUS_15230 gene hisA 1487 2215 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIB4 protein_id gnl|my_center|LOCUS_15230 >Feature sequence451 622 1650 gene locus_tag LOCUS_15240 gene lpxD 622 1650 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHC2 protein_id gnl|my_center|LOCUS_15240 >Feature sequence452 2020 887 gene locus_tag LOCUS_15250 2020 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 >Feature sequence453 161 1174 gene locus_tag LOCUS_15260 161 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 1808 1617 gene locus_tag LOCUS_15270 1808 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 2229 1852 gene locus_tag LOCUS_15280 2229 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933022.1 protein_id gnl|my_center|LOCUS_15280 >Feature sequence454 455 1930 gene locus_tag LOCUS_15290 455 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 >Feature sequence455 2333 351 gene locus_tag LOCUS_15300 2333 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 >Feature sequence456 1517 1642 gene locus_tag LOCUS_15310 1517 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 >Feature sequence457 <2518 235 gene locus_tag LOCUS_15320 <2518 235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682238.1:guanylate cyclase >Feature sequence458 <2515 1291 gene locus_tag LOCUS_15330 <2515 1291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249525.1:ABC transporter substrate-binding protein >Feature sequence459 <1 1323 gene locus_tag LOCUS_15340 <1 1323 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3DJA2:adenylosuccinate lyase >Feature sequence460 2353 1880 gene locus_tag LOCUS_15350 gene rpsG 2353 1880 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38526 protein_id gnl|my_center|LOCUS_15350 >Feature sequence461 601 1125 gene locus_tag LOCUS_15360 gene sodC2 601 1125 CDS product superoxide dismutase [Cu-Zn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDZ3 protein_id gnl|my_center|LOCUS_15360 >Feature sequence462 1578 304 gene locus_tag LOCUS_15370 1578 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331975.1 protein_id gnl|my_center|LOCUS_15370 2500 1622 gene locus_tag LOCUS_15380 2500 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 >Feature sequence463 1456 911 gene locus_tag LOCUS_15390 gene hslV 1456 911 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXU1 protein_id gnl|my_center|LOCUS_15390 1924 1511 gene locus_tag LOCUS_15400 1924 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 >Feature sequence464 <1 1241 gene locus_tag LOCUS_15410 <1 1241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002225480.1:peptidase >Feature sequence465 1338 313 gene locus_tag LOCUS_15420 1338 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 >Feature sequence466 1064 645 gene locus_tag LOCUS_15430 gene exbD 1064 645 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071947.1 protein_id gnl|my_center|LOCUS_15430 1870 1061 gene locus_tag LOCUS_15440 1870 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 2481 1927 gene locus_tag LOCUS_15450 2481 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 >Feature sequence467 1600 296 gene locus_tag LOCUS_15460 1600 296 CDS product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267913.1 protein_id gnl|my_center|LOCUS_15460 2380 1604 gene locus_tag LOCUS_15470 2380 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 >Feature sequence468 >Feature sequence469 >Feature sequence470 1600 593 gene locus_tag LOCUS_15480 1600 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 >Feature sequence471 904 2160 gene locus_tag LOCUS_15490 904 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 >Feature sequence472 <1 1248 gene locus_tag LOCUS_15500 <1 1248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073080.1:sugar transporter 1289 2281 gene locus_tag LOCUS_15510 1289 2281 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734411.1 protein_id gnl|my_center|LOCUS_15510 >Feature sequence473 <1 538 gene locus_tag LOCUS_15520 <1 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q6HL18:bifunctional ligase/repressor BirA 619 1317 gene locus_tag LOCUS_15530 619 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 >Feature sequence474 997 878 gene locus_tag LOCUS_15540 997 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 >Feature sequence475 1315 374 gene locus_tag LOCUS_15550 gene wbmH 1315 374 CDS product nucleotide sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807090.1 protein_id gnl|my_center|LOCUS_15550 >Feature sequence476 643 170 gene locus_tag LOCUS_15560 643 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 1087 689 gene locus_tag LOCUS_15570 1087 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 2418 1696 gene locus_tag LOCUS_15580 2418 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 >Feature sequence477 1096 710 gene locus_tag LOCUS_15590 1096 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 <2417 1202 gene locus_tag LOCUS_15600 <2417 1202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888294.1:oligopeptidase A >Feature sequence478 561 1400 gene locus_tag LOCUS_15610 561 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 >Feature sequence479 1839 853 gene locus_tag LOCUS_15620 1839 853 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_15620 2407 2255 gene locus_tag LOCUS_15630 2407 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 >Feature sequence480 >Feature sequence481 3 224 gene locus_tag LOCUS_15640 3 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 245 1123 gene locus_tag LOCUS_15650 245 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 >Feature sequence482 1333 437 gene locus_tag LOCUS_15660 1333 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 >Feature sequence483 <1 699 gene locus_tag LOCUS_15670 <1 699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015369257.1:alcohol dehydrogenase >Feature sequence484 149 1222 gene locus_tag LOCUS_15680 gene draG 149 1222 CDS product ADP-ribosylglycohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038051.1 protein_id gnl|my_center|LOCUS_15680 1308 2162 gene locus_tag LOCUS_15690 1308 2162 CDS product TIGR02452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027437.1 protein_id gnl|my_center|LOCUS_15690 >Feature sequence485 1493 1032 gene locus_tag LOCUS_15700 1493 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 >Feature sequence486 <1 1209 gene locus_tag LOCUS_15710 <1 1209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003722633.1:PAS domain-containing sensor histidine kinase 1215 1928 gene locus_tag LOCUS_15720 1215 1928 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865376.1 protein_id gnl|my_center|LOCUS_15720 >Feature sequence487 340 1386 gene locus_tag LOCUS_15730 340 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 >Feature sequence488 268 837 gene locus_tag LOCUS_15740 268 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 844 2130 gene locus_tag LOCUS_15750 844 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 >Feature sequence489 473 1576 gene locus_tag LOCUS_15760 473 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_15760 >Feature sequence490 1944 1228 gene locus_tag LOCUS_15770 gene purQ 1944 1228 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S567 protein_id gnl|my_center|LOCUS_15770 >Feature sequence491 573 1952 gene locus_tag LOCUS_15780 573 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 >Feature sequence492 1684 2226 gene locus_tag LOCUS_15790 gene rpoE 1684 2226 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QY01 protein_id gnl|my_center|LOCUS_15790 >Feature sequence493 644 1153 gene locus_tag LOCUS_15800 644 1153 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5A2 protein_id gnl|my_center|LOCUS_15800 >Feature sequence494 480 115 gene locus_tag LOCUS_15810 480 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 741 1499 gene locus_tag LOCUS_15820 741 1499 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086579.1 protein_id gnl|my_center|LOCUS_15820 >Feature sequence495 >Feature sequence496 <1 1258 gene locus_tag LOCUS_15830 <1 1258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122409.1:9-O-acetylesterase >Feature sequence497 399 1679 gene locus_tag LOCUS_15840 gene proA 399 1679 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKZ6 protein_id gnl|my_center|LOCUS_15840 1676 2209 gene locus_tag LOCUS_15850 1676 2209 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329717.1 protein_id gnl|my_center|LOCUS_15850 >Feature sequence498 2136 1006 gene locus_tag LOCUS_15860 2136 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 >Feature sequence499 <1 1428 gene locus_tag LOCUS_15870 <1 1428 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120298.1:arylsulfatase >Feature sequence500 >Feature sequence501 478 978 gene locus_tag LOCUS_15880 478 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 >Feature sequence502 >Feature sequence503 2 574 gene locus_tag LOCUS_15890 2 574 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TB07 protein_id gnl|my_center|LOCUS_15890 734 1930 gene locus_tag LOCUS_15900 734 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 >Feature sequence504 441 202 gene locus_tag LOCUS_15910 441 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 1951 530 gene locus_tag LOCUS_15920 gene arsA 1951 530 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_15920 >Feature sequence505 209 859 gene locus_tag LOCUS_15930 209 859 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001152804.1 protein_id gnl|my_center|LOCUS_15930 869 2053 gene locus_tag LOCUS_15940 869 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 >Feature sequence506 141 890 gene locus_tag LOCUS_15950 141 890 CDS product polyprenol phosphate mannosyl transferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122067.1 protein_id gnl|my_center|LOCUS_15950 1005 1136 gene locus_tag LOCUS_15960 1005 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 >Feature sequence507 831 13 gene locus_tag LOCUS_15970 831 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 >Feature sequence508 659 126 gene locus_tag LOCUS_15980 659 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 888 1733 gene locus_tag LOCUS_15990 888 1733 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406703.1 protein_id gnl|my_center|LOCUS_15990 >Feature sequence509 1380 277 gene locus_tag LOCUS_16000 1380 277 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK07 protein_id gnl|my_center|LOCUS_16000 2174 1389 gene locus_tag LOCUS_16010 2174 1389 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462044.1 protein_id gnl|my_center|LOCUS_16010 >Feature sequence510 1282 929 gene locus_tag LOCUS_16020 gene rplS 1282 929 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJV3 protein_id gnl|my_center|LOCUS_16020 1977 1297 gene locus_tag LOCUS_16030 gene trmD 1977 1297 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2G4 protein_id gnl|my_center|LOCUS_16030 >Feature sequence511 >Feature sequence512 <2249 375 gene locus_tag LOCUS_16040 <2249 375 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532918.1:short-chain dehydrogenase >Feature sequence513 199 1614 gene locus_tag LOCUS_16050 199 1614 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545212.1 protein_id gnl|my_center|LOCUS_16050 >Feature sequence514 <2247 360 gene locus_tag LOCUS_16060 <2247 360 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122437.1:cytochrome CBB3 >Feature sequence515 162 956 gene locus_tag LOCUS_16070 gene rnc 162 956 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E314 protein_id gnl|my_center|LOCUS_16070 >Feature sequence516 692 216 gene locus_tag LOCUS_16080 692 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 >Feature sequence517 1 1524 gene locus_tag LOCUS_16090 gene nadE 1 1524 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938901.1 protein_id gnl|my_center|LOCUS_16090 >Feature sequence518 759 1253 gene locus_tag LOCUS_16100 759 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 >Feature sequence519 <2227 1585 gene locus_tag LOCUS_16110 <2227 1585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005459031.1:peptide ABC transporter permease >Feature sequence520 <1 2121 gene locus_tag LOCUS_16120 <1 2121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117959.1:glycosyl hydrolase >Feature sequence521 <1 1689 gene locus_tag LOCUS_16130 <1 1689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P17922:phenylalanine--tRNA ligase beta subunit 1707 2000 gene locus_tag LOCUS_16140 gene gatC 1707 2000 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGY3 protein_id gnl|my_center|LOCUS_16140 >Feature sequence522 625 59 gene locus_tag LOCUS_16150 625 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 1024 716 gene locus_tag LOCUS_16160 1024 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 1105 2118 gene locus_tag LOCUS_16170 1105 2118 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403637.1 protein_id gnl|my_center|LOCUS_16170 >Feature sequence523 1495 422 gene locus_tag LOCUS_16180 1495 422 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249527.1 protein_id gnl|my_center|LOCUS_16180 <2213 1509 gene locus_tag LOCUS_16190 <2213 1509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879212.1:alpha/beta hydrolase >Feature sequence524 1588 596 gene locus_tag LOCUS_16200 1588 596 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_16200 2211 1594 gene locus_tag LOCUS_16210 2211 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 >Feature sequence525 581 339 gene locus_tag LOCUS_16220 581 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 <2209 863 gene locus_tag LOCUS_16230 <2209 863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9Z999:DNA-directed RNA polymerase subunit beta' >Feature sequence526 907 1581 gene locus_tag LOCUS_16240 907 1581 CDS product phospholipid N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962328.1 protein_id gnl|my_center|LOCUS_16240 >Feature sequence527 >Feature sequence528 <2200 1515 gene locus_tag LOCUS_16250 <2200 1515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011181677.1:regucalcin-like protein >Feature sequence529 218 1630 gene locus_tag LOCUS_16260 218 1630 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403101.1 protein_id gnl|my_center|LOCUS_16260 >Feature sequence530 1143 658 gene locus_tag LOCUS_16270 1143 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 >Feature sequence531 >Feature sequence532 <1 932 gene locus_tag LOCUS_16280 <1 932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028088.1:formate dehydrogenase 943 2001 gene locus_tag LOCUS_16290 gene ctaA 943 2001 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H039 protein_id gnl|my_center|LOCUS_16290 >Feature sequence533 902 51 gene locus_tag LOCUS_16300 gene prmC 902 51 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748B2 protein_id gnl|my_center|LOCUS_16300 1013 1861 gene locus_tag LOCUS_16310 1013 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 >Feature sequence534 1975 308 gene locus_tag LOCUS_16320 1975 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 >Feature sequence535 1 858 gene locus_tag LOCUS_16330 1 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933356.1 protein_id gnl|my_center|LOCUS_16330 936 1217 gene locus_tag LOCUS_16340 936 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 >Feature sequence536 >Feature sequence537 682 341 gene locus_tag LOCUS_16350 682 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 <2117 1097 gene locus_tag LOCUS_16360 <2117 1097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119142.1:sialidase >Feature sequence538 941 1744 gene locus_tag LOCUS_16370 941 1744 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122635.1 protein_id gnl|my_center|LOCUS_16370 >Feature sequence539 1259 255 gene locus_tag LOCUS_16380 1259 255 CDS product 4-hydroxyproline 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I476 protein_id gnl|my_center|LOCUS_16380 <2102 1302 gene locus_tag LOCUS_16390 <2102 1302 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972975.1:D-amino-acid dehydrogenase >Feature sequence540 699 773 gene locus_tag LOCUS_t00250 699 773 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 933 1883 gene locus_tag LOCUS_16400 933 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 >Feature sequence541 1746 1015 gene locus_tag LOCUS_16410 1746 1015 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392145.1 protein_id gnl|my_center|LOCUS_16410 >Feature sequence542 1708 149 gene locus_tag LOCUS_16420 1708 149 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123733.1 protein_id gnl|my_center|LOCUS_16420 >Feature sequence543 >Feature sequence544 2065 590 gene locus_tag LOCUS_16430 2065 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 >Feature sequence545 >Feature sequence546 <1 1301 gene locus_tag LOCUS_16440 <1 1301 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120440.1:cytochrome c >Feature sequence547 1255 965 gene locus_tag LOCUS_16450 1255 965 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325302.1 protein_id gnl|my_center|LOCUS_16450 <2050 1261 gene locus_tag LOCUS_16460 <2050 1261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123663.1:NAD(P) transhydrogenase subunit alpha >Feature sequence548 905 207 gene locus_tag LOCUS_16470 905 207 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416112.1 protein_id gnl|my_center|LOCUS_16470 1562 921 gene locus_tag LOCUS_16480 1562 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 >Feature sequence549 <1 771 gene locus_tag LOCUS_16490 <1 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9RY41:GTP cyclohydrolase 1 type 2 1534 1659 gene locus_tag LOCUS_16500 1534 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 >Feature sequence550 1515 421 gene locus_tag LOCUS_16510 1515 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 >Feature sequence551 919 1080 gene locus_tag LOCUS_16520 919 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 >Feature sequence552 908 1570 gene locus_tag LOCUS_16530 908 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 1711 1583 gene locus_tag LOCUS_16540 1711 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 >Feature sequence553 <1 1661 gene locus_tag LOCUS_16550 <1 1661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P56881:threonine--tRNA ligase >Feature sequence554 <1 1277 gene locus_tag LOCUS_16560 <1 1277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118263.1:iduronate-2-sulfatase >Feature sequence555 <2005 835 gene locus_tag LOCUS_16570 <2005 835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P12042:phosphoribosylformylglycinamidine synthase subunit PurL >Feature sequence556 >Feature sequence557 53 128 gene locus_tag LOCUS_t00260 53 128 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 <2005 150 gene locus_tag LOCUS_16580 <2005 150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P9WQF7:putative acyl-CoA dehydrogenase FadE10 >Feature sequence558 221 1321 gene locus_tag LOCUS_16590 221 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 >Feature sequence559 <2002 371 gene locus_tag LOCUS_16600 <2002 371 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003405970.1:membrane protein >Feature sequence560 1 438 gene locus_tag LOCUS_16610 1 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 471 779 gene locus_tag LOCUS_16620 gene rpsJ 471 779 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV9 protein_id gnl|my_center|LOCUS_16620 898 1539 gene locus_tag LOCUS_16630 gene rplC 898 1539 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5X5 protein_id gnl|my_center|LOCUS_16630 >Feature sequence561 202 993 gene locus_tag LOCUS_16640 202 993 CDS product iron ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014216.1 protein_id gnl|my_center|LOCUS_16640 <1990 1003 gene locus_tag LOCUS_16650 <1990 1003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118163.1:acetylglucosamine-6-sulfatase >Feature sequence562 1101 169 gene locus_tag LOCUS_16660 1101 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 1988 1203 gene locus_tag LOCUS_16670 1988 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 >Feature sequence563 <1 646 gene locus_tag LOCUS_16680 <1 646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403312.1:nucleoside transporter NupC 705 1379 gene locus_tag LOCUS_16690 705 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 1382 1639 gene locus_tag LOCUS_16700 1382 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 >Feature sequence564 >Feature sequence565 >Feature sequence566 506 1090 gene locus_tag LOCUS_16710 506 1090 CDS product cysteine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833331.1 protein_id gnl|my_center|LOCUS_16710 1132 1839 gene locus_tag LOCUS_16720 gene coxM 1132 1839 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709066.1 protein_id gnl|my_center|LOCUS_16720 >Feature sequence567 999 229 gene locus_tag LOCUS_16730 999 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852139.1 protein_id gnl|my_center|LOCUS_16730 1043 1423 gene locus_tag LOCUS_16740 1043 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 >Feature sequence568 1952 885 gene locus_tag LOCUS_16750 1952 885 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_16750 >Feature sequence569 <1975 1384 gene locus_tag LOCUS_16760 <1975 1384 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007325333.1:glycosyl transferase >Feature sequence570 646 86 gene locus_tag LOCUS_16770 646 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 1974 643 gene locus_tag LOCUS_16780 1974 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 >Feature sequence571 <1 541 gene locus_tag LOCUS_16790 <1 541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UES1:pyruvate carboxylase 1226 606 gene locus_tag LOCUS_16800 gene sodA 1226 606 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HDP2 protein_id gnl|my_center|LOCUS_16800 1858 1301 gene locus_tag LOCUS_16810 gene tadA 1858 1301 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMH4 protein_id gnl|my_center|LOCUS_16810 >Feature sequence572 <1 1367 gene locus_tag LOCUS_16820 <1 1367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117969.1:cytochrome c >Feature sequence573 >Feature sequence574 411 1193 gene locus_tag LOCUS_16830 411 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 >Feature sequence575 >Feature sequence576 >Feature sequence577 >Feature sequence578 >Feature sequence579 138 1280 gene locus_tag LOCUS_16840 138 1280 CDS product sodium:phosphate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261239.1 protein_id gnl|my_center|LOCUS_16840 >Feature sequence580 >Feature sequence581 750 1679 gene locus_tag LOCUS_16850 750 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 >Feature sequence582 >Feature sequence583 <1 532 gene locus_tag LOCUS_16860 <1 532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121570.1:N-acetylgalactosamine-6-sulfatase 619 1362 gene locus_tag LOCUS_16870 619 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 >Feature sequence584 180 1562 gene locus_tag LOCUS_16880 180 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120350.1 protein_id gnl|my_center|LOCUS_16880 >Feature sequence585 1288 509 gene locus_tag LOCUS_16890 1288 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 >Feature sequence586 988 218 gene locus_tag LOCUS_16900 988 218 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098575.1 protein_id gnl|my_center|LOCUS_16900 >Feature sequence587 403 1716 gene locus_tag LOCUS_16910 403 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 >Feature sequence588 <1907 423 gene locus_tag LOCUS_16920 <1907 423 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YHY9:GMP synthase [glutamine-hydrolyzing] >Feature sequence589 <1899 1384 gene locus_tag LOCUS_16930 <1899 1384 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122793.1:dehydrogenase >Feature sequence590 785 369 gene locus_tag LOCUS_16940 gene queF 785 369 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HLK3 protein_id gnl|my_center|LOCUS_16940 <1892 789 gene locus_tag LOCUS_16950 <1892 789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8THA6:magnesium transporter MgtE >Feature sequence591 1420 26 gene locus_tag LOCUS_16960 1420 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 1792 1460 gene locus_tag LOCUS_16970 1792 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 >Feature sequence592 <1 660 gene locus_tag LOCUS_16980 <1 660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8F3J9:HPr kinase/phosphorylase >Feature sequence593 >Feature sequence594 663 331 gene locus_tag LOCUS_16990 663 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 742 1587 gene locus_tag LOCUS_17000 742 1587 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3W0 protein_id gnl|my_center|LOCUS_17000 1584 1817 gene locus_tag LOCUS_17010 1584 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 >Feature sequence595 366 1241 gene locus_tag LOCUS_17020 366 1241 CDS product PPK2 family polyphosphate--nucleotide phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789758.1 protein_id gnl|my_center|LOCUS_17020 <1863 1270 gene locus_tag LOCUS_17030 <1863 1270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707673.1:transporter >Feature sequence596 196 1212 gene locus_tag LOCUS_17040 196 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 1298 1423 gene locus_tag LOCUS_17050 1298 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17050 >Feature sequence597 <1841 1200 gene locus_tag LOCUS_17060 <1841 1200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9CEQ8:D-galactarolactone cycloisomerase >Feature sequence598 801 1232 gene locus_tag LOCUS_17070 801 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 >Feature sequence599 944 45 gene locus_tag LOCUS_17080 944 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 1832 945 gene locus_tag LOCUS_17090 1832 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 >Feature sequence600 1189 236 gene locus_tag LOCUS_17100 1189 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 >Feature sequence601 730 203 gene locus_tag LOCUS_17110 730 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 <1830 744 gene locus_tag LOCUS_17120 <1830 744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107901.1:sulfatase >Feature sequence602 <1 1084 gene locus_tag LOCUS_17130 <1 1084 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122139.1:N-acetylgalactosamine-6-sulfatase >Feature sequence603 <1825 1244 gene locus_tag LOCUS_17140 <1825 1244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121033.1:flotillin family protein >Feature sequence604 <1 856 gene locus_tag LOCUS_17150 <1 856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to I7F9Q4:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase >Feature sequence605 592 137 gene locus_tag LOCUS_17160 gene dtd 592 137 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZI9 protein_id gnl|my_center|LOCUS_17160 1633 626 gene locus_tag LOCUS_17170 gene cysK1 1633 626 CDS product O-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WP55 protein_id gnl|my_center|LOCUS_17170 >Feature sequence606 >Feature sequence607 1003 1584 gene locus_tag LOCUS_17180 gene def 1003 1584 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SH6 protein_id gnl|my_center|LOCUS_17180 >Feature sequence608 >Feature sequence609 31 1029 gene locus_tag LOCUS_17190 31 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 >Feature sequence610 2 121 gene locus_tag LOCUS_17200 2 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 397 735 gene locus_tag LOCUS_17210 397 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 858 1682 gene locus_tag LOCUS_17220 858 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 >Feature sequence611 >Feature sequence612 >Feature sequence613 1300 428 gene locus_tag LOCUS_17230 1300 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 >Feature sequence614 64 1593 gene locus_tag LOCUS_17240 64 1593 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117992.1 protein_id gnl|my_center|LOCUS_17240 >Feature sequence615 >Feature sequence616 437 1198 gene locus_tag LOCUS_17250 gene flgF 437 1198 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89F17 protein_id gnl|my_center|LOCUS_17250 >Feature sequence617 <1 966 gene locus_tag LOCUS_17260 <1 966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NKV3:cysteine desulfurase 971 1420 gene locus_tag LOCUS_17270 971 1420 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_17270 >Feature sequence618 1005 250 gene locus_tag LOCUS_17280 1005 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 1405 1481 gene locus_tag LOCUS_t00270 1405 1481 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence619 1179 442 gene locus_tag LOCUS_17290 1179 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 1486 1401 gene locus_tag LOCUS_t00280 1486 1401 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence620 >Feature sequence621 254 1279 gene locus_tag LOCUS_17300 gene fliM 254 1279 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4G0 protein_id gnl|my_center|LOCUS_17300 1276 1524 gene locus_tag LOCUS_17310 1276 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 >Feature sequence622 >Feature sequence623 <1753 164 gene locus_tag LOCUS_17320 <1753 164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87MM3:fatty acid oxidation complex subunit alpha >Feature sequence624 >Feature sequence625 >Feature sequence626 >Feature sequence627 1681 545 gene locus_tag LOCUS_17330 gene rnhC 1681 545 CDS product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z6J1 protein_id gnl|my_center|LOCUS_17330 >Feature sequence628 <1 1605 gene locus_tag LOCUS_17340 <1 1605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257750.1:succinate dehydrogenase flavoprotein subunit >Feature sequence629 >Feature sequence630 1677 283 gene locus_tag LOCUS_17350 gene accC 1677 283 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048423.1 protein_id gnl|my_center|LOCUS_17350 >Feature sequence631 >Feature sequence632 930 388 gene locus_tag LOCUS_17360 930 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 >Feature sequence633 >Feature sequence634 1560 925 gene locus_tag LOCUS_17370 1560 925 CDS product KHG-KDPG bifunctional aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144255.1 protein_id gnl|my_center|LOCUS_17370 >Feature sequence635 >Feature sequence636 <1 700 gene locus_tag LOCUS_17380 <1 700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122306.1:large multi-functional protein <1702 812 gene locus_tag LOCUS_17390 <1702 812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086980.1:epimerase >Feature sequence637 <1 694 gene locus_tag LOCUS_17400 <1 694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942483.1:haloacid dehalogenase >Feature sequence638 >Feature sequence639 <1685 247 gene locus_tag LOCUS_17410 <1685 247 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122680.1:sulfatase >Feature sequence640 183 884 gene locus_tag LOCUS_17420 183 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 875 1546 gene locus_tag LOCUS_17430 875 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 >Feature sequence641 <1671 993 gene locus_tag LOCUS_17440 <1671 993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005815367.1:thiol:disulfide interchange protein >Feature sequence642 <1 1642 gene locus_tag LOCUS_17450 <1 1642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to D1B616:putative K(+)-stimulated pyrophosphate-energized sodium pump >Feature sequence643 >Feature sequence644 914 195 gene locus_tag LOCUS_17460 914 195 CDS product pyrrolidone-carboxylate peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868563.1 protein_id gnl|my_center|LOCUS_17460 1474 884 gene locus_tag LOCUS_17470 1474 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 >Feature sequence645 1283 546 gene locus_tag LOCUS_17480 1283 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 >Feature sequence646 652 59 gene locus_tag LOCUS_17490 652 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 <1638 775 gene locus_tag LOCUS_17500 <1638 775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016776.1:disulfide isomerase >Feature sequence647 >Feature sequence648 1428 1189 gene locus_tag LOCUS_17510 gene acpP 1428 1189 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43709 protein_id gnl|my_center|LOCUS_17510 >Feature sequence649 >Feature sequence650 <1628 873 gene locus_tag LOCUS_17520 <1628 873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007330748.1:glucosamine-6-phosphate deaminase >Feature sequence651 <1 626 gene locus_tag LOCUS_17530 <1 626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122885.1:alanine glycine permease 908 684 gene locus_tag LOCUS_17540 908 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 1011 1541 gene locus_tag LOCUS_17550 1011 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 >Feature sequence652 >Feature sequence653 >Feature sequence654 <1612 921 gene locus_tag LOCUS_17560 <1612 921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546161.1:flagellar motor stator protein MotA >Feature sequence655 1012 674 gene locus_tag LOCUS_17570 1012 674 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522276.1 protein_id gnl|my_center|LOCUS_17570 >Feature sequence656 <1601 587 gene locus_tag LOCUS_17580 <1601 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119647.1:cytochrome oxidase >Feature sequence657 >Feature sequence658 <1 950 gene locus_tag LOCUS_17590 <1 950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003807055.1:perosamine synthetase >Feature sequence659 1256 549 gene locus_tag LOCUS_17600 1256 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 1585 1436 gene locus_tag LOCUS_17610 1585 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 >Feature sequence660 1261 800 gene locus_tag LOCUS_17620 1261 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 >Feature sequence661 <1 574 gene locus_tag LOCUS_17630 <1 574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974582.1:hydroxyacid dehydrogenase <1577 1031 gene locus_tag LOCUS_17640 <1577 1031 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005466255.1:glutamate-1-semialdehyde 2,1-aminomutase >Feature sequence662 >Feature sequence663 <1561 587 gene locus_tag LOCUS_17650 <1561 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120681.1:sulfatase >Feature sequence664 1342 77 gene locus_tag LOCUS_17660 1342 77 CDS product DUF4432 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704678.1 protein_id gnl|my_center|LOCUS_17660 >Feature sequence665 >Feature sequence666 <1 1303 gene locus_tag LOCUS_17670 <1 1303 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119292.1:oxidoreductase >Feature sequence667 1432 668 gene locus_tag LOCUS_17680 1432 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123952.1 protein_id gnl|my_center|LOCUS_17680 >Feature sequence668 714 244 gene locus_tag LOCUS_17690 714 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 992 819 gene locus_tag LOCUS_17700 992 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 1252 1470 gene locus_tag LOCUS_17710 1252 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 >Feature sequence669 <1 810 gene locus_tag LOCUS_17720 <1 810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763609.1:malate dehydrogenase 1125 817 gene locus_tag LOCUS_17730 1125 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 >Feature sequence670 668 1525 gene locus_tag LOCUS_17740 668 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 >Feature sequence671 <1 1366 gene locus_tag LOCUS_17750 <1 1366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013368537.1:dehydrogenase >Feature sequence672 >Feature sequence673 >Feature sequence674 >Feature sequence675 1 741 gene locus_tag LOCUS_17760 1 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 >Feature sequence676 >Feature sequence677 >Feature sequence678 <1504 219 gene locus_tag LOCUS_17770 <1504 219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RIW9:homoserine dehydrogenase >Feature sequence679 >Feature sequence680