>Feature sequence001 1662 613 gene locus_tag LOCUS_00010 1662 613 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_00010 2439 1669 gene locus_tag LOCUS_00020 gene coaX 2439 1669 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EB4 protein_id gnl|my_center|LOCUS_00020 3488 2439 gene locus_tag LOCUS_00030 gene birA 3488 2439 CDS product bifunctional ligase/repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HL18 protein_id gnl|my_center|LOCUS_00030 4421 3489 gene locus_tag LOCUS_00040 gene nadC 4421 3489 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880528.1 protein_id gnl|my_center|LOCUS_00040 5992 4418 gene locus_tag LOCUS_00050 gene purA 5992 4418 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RYB5 protein_id gnl|my_center|LOCUS_00050 7561 6008 gene locus_tag LOCUS_00060 gene guaB 7561 6008 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X168 protein_id gnl|my_center|LOCUS_00060 7633 8583 gene locus_tag LOCUS_00070 7633 8583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 8580 9710 gene locus_tag LOCUS_00080 gene menE 8580 9710 CDS product O-succinylbenzoic acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057063.1 protein_id gnl|my_center|LOCUS_00080 10312 9719 gene locus_tag LOCUS_00090 gene clpP 10312 9719 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4T6 protein_id gnl|my_center|LOCUS_00090 10767 10333 gene locus_tag LOCUS_00100 10767 10333 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721856.1 protein_id gnl|my_center|LOCUS_00100 11360 10815 gene locus_tag LOCUS_00110 11360 10815 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770997.1 protein_id gnl|my_center|LOCUS_00110 <12233 11373 gene locus_tag LOCUS_00120 <12233 11373 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888732.1:Fe-S cluster assembly protein SufD >Feature sequence002 1188 688 gene locus_tag LOCUS_00130 1188 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 1701 1234 gene locus_tag LOCUS_00140 1701 1234 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080908.1 protein_id gnl|my_center|LOCUS_00140 1849 3021 gene locus_tag LOCUS_00150 gene tyrS 1849 3021 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NGY5 protein_id gnl|my_center|LOCUS_00150 8428 3002 gene locus_tag LOCUS_00160 gene uvrA2 8428 3002 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MC61 protein_id gnl|my_center|LOCUS_00160 8553 8477 gene locus_tag LOCUS_t00010 8553 8477 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 9191 11254 gene locus_tag LOCUS_00170 9191 11254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 >Feature sequence003 437 706 gene locus_tag LOCUS_00180 437 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 1013 711 gene locus_tag LOCUS_00190 1013 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 1174 1695 gene locus_tag LOCUS_00200 1174 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 1682 2173 gene locus_tag LOCUS_00210 1682 2173 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229426.1 protein_id gnl|my_center|LOCUS_00210 3385 2816 gene locus_tag LOCUS_00220 3385 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 5127 3421 gene locus_tag LOCUS_00230 gene cysI 5127 3421 CDS product sulfite reductase [NADPH] hemoprotein beta-component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32213 protein_id gnl|my_center|LOCUS_00230 6222 5185 gene locus_tag LOCUS_00240 gene tsaD 6222 5185 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83C88 protein_id gnl|my_center|LOCUS_00240 6344 7267 gene locus_tag LOCUS_00250 6344 7267 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948550.1 protein_id gnl|my_center|LOCUS_00250 8948 7305 gene locus_tag LOCUS_00260 8948 7305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119050.1 protein_id gnl|my_center|LOCUS_00260 9479 8949 gene locus_tag LOCUS_00270 9479 8949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 10184 9501 gene locus_tag LOCUS_00280 10184 9501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 10955 10521 gene locus_tag LOCUS_00290 10955 10521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 >Feature sequence004 927 1538 gene locus_tag LOCUS_00300 927 1538 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120554.1 protein_id gnl|my_center|LOCUS_00300 1548 2327 gene locus_tag LOCUS_00310 1548 2327 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181838.1 protein_id gnl|my_center|LOCUS_00310 3317 2334 gene locus_tag LOCUS_00320 3317 2334 CDS product glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103110.1 protein_id gnl|my_center|LOCUS_00320 6888 3394 gene locus_tag LOCUS_00330 6888 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776615.1 protein_id gnl|my_center|LOCUS_00330 7504 6881 gene locus_tag LOCUS_00340 7504 6881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 8955 7501 gene locus_tag LOCUS_00350 8955 7501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 >Feature sequence005 1247 48 gene locus_tag LOCUS_00360 gene tuf 1247 48 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMZ0 protein_id gnl|my_center|LOCUS_00360 1351 1276 gene locus_tag LOCUS_t00020 1351 1276 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1492 1567 gene locus_tag LOCUS_t00030 1492 1567 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2320 1580 gene locus_tag LOCUS_00370 2320 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 2311 2832 gene locus_tag LOCUS_00380 2311 2832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 5316 2812 gene locus_tag LOCUS_00390 gene gyrA 5316 2812 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGW5 protein_id gnl|my_center|LOCUS_00390 7837 5342 gene locus_tag LOCUS_00400 gene gyrB 7837 5342 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZK5 protein_id gnl|my_center|LOCUS_00400 <9974 8290 gene locus_tag LOCUS_00410 <9974 8290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942954.1:membrane protein >Feature sequence006 1873 2841 gene locus_tag LOCUS_00420 gene pmi 1873 2841 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122560.1 protein_id gnl|my_center|LOCUS_00420 2927 3502 gene locus_tag LOCUS_00430 2927 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 3548 4693 gene locus_tag LOCUS_00440 gene dnaJ 3548 4693 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTY4 protein_id gnl|my_center|LOCUS_00440 4696 5193 gene locus_tag LOCUS_00450 4696 5193 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364507.1 protein_id gnl|my_center|LOCUS_00450 5214 5792 gene locus_tag LOCUS_00460 5214 5792 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817233.1 protein_id gnl|my_center|LOCUS_00460 5797 6669 gene locus_tag LOCUS_00470 5797 6669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 7801 6689 gene locus_tag LOCUS_00480 7801 6689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 9895 7802 gene locus_tag LOCUS_00490 9895 7802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 >Feature sequence007 1085 216 gene locus_tag LOCUS_00500 gene argB 1085 216 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59303 protein_id gnl|my_center|LOCUS_00500 2311 1091 gene locus_tag LOCUS_00510 gene argJ 2311 1091 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGC2 protein_id gnl|my_center|LOCUS_00510 3333 2308 gene locus_tag LOCUS_00520 3333 2308 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459299.1 protein_id gnl|my_center|LOCUS_00520 3832 3428 gene locus_tag LOCUS_00530 gene rplI1 3832 3428 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGH8 protein_id gnl|my_center|LOCUS_00530 4275 3847 gene locus_tag LOCUS_00540 gene rplM 4275 3847 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1G6 protein_id gnl|my_center|LOCUS_00540 4773 4363 gene locus_tag LOCUS_00550 4773 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 6703 4850 gene locus_tag LOCUS_00560 6703 4850 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460040.1 protein_id gnl|my_center|LOCUS_00560 7526 6786 gene locus_tag LOCUS_00570 7526 6786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 7670 7584 gene locus_tag LOCUS_t00040 7670 7584 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 7785 8384 gene locus_tag LOCUS_00580 gene coaE 7785 8384 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIP9 protein_id gnl|my_center|LOCUS_00580 >Feature sequence008 2199 478 gene locus_tag LOCUS_00590 2199 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 2497 4080 gene locus_tag LOCUS_00600 2497 4080 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277613.1 protein_id gnl|my_center|LOCUS_00600 4077 4997 gene locus_tag LOCUS_00610 gene oppB 4077 4997 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880879.1 protein_id gnl|my_center|LOCUS_00610 4994 5854 gene locus_tag LOCUS_00620 4994 5854 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388348.1 protein_id gnl|my_center|LOCUS_00620 5862 7571 gene locus_tag LOCUS_00630 5862 7571 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056770.1 protein_id gnl|my_center|LOCUS_00630 8394 7540 gene locus_tag LOCUS_00640 8394 7540 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888626.1 protein_id gnl|my_center|LOCUS_00640 >Feature sequence009 142 1914 gene locus_tag LOCUS_00650 gene ftsI 142 1914 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_00650 1911 3470 gene locus_tag LOCUS_00660 gene murE 1911 3470 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK84 protein_id gnl|my_center|LOCUS_00660 3474 4886 gene locus_tag LOCUS_00670 gene murF 3474 4886 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZSA1 protein_id gnl|my_center|LOCUS_00670 4880 6025 gene locus_tag LOCUS_00680 gene mraY 4880 6025 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZIF2 protein_id gnl|my_center|LOCUS_00680 6025 7341 gene locus_tag LOCUS_00690 gene murD 6025 7341 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C0D8 protein_id gnl|my_center|LOCUS_00690 7354 8430 gene locus_tag LOCUS_00700 7354 8430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 >Feature sequence010 820 744 gene locus_tag LOCUS_t00050 820 744 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2039 879 gene locus_tag LOCUS_00710 gene tgt 2039 879 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183P1 protein_id gnl|my_center|LOCUS_00710 2394 2143 gene locus_tag LOCUS_00720 2394 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 2742 2500 gene locus_tag LOCUS_00730 2742 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 3536 2901 gene locus_tag LOCUS_00740 3536 2901 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205235.1 protein_id gnl|my_center|LOCUS_00740 4811 3624 gene locus_tag LOCUS_00750 4811 3624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326116.1 protein_id gnl|my_center|LOCUS_00750 5168 6307 gene locus_tag LOCUS_00760 5168 6307 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957890.1 protein_id gnl|my_center|LOCUS_00760 6406 7452 gene locus_tag LOCUS_00770 gene adhC 6406 7452 CDS product NADP-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534096.1 protein_id gnl|my_center|LOCUS_00770 >Feature sequence011 1063 1140 gene locus_tag LOCUS_t00060 1063 1140 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1195 3081 gene locus_tag LOCUS_00780 gene speA 1195 3081 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72F01 protein_id gnl|my_center|LOCUS_00780 3095 4300 gene locus_tag LOCUS_00790 gene lys1 3095 4300 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937725.1 protein_id gnl|my_center|LOCUS_00790 4300 5475 gene locus_tag LOCUS_00800 gene nspC 4300 5475 CDS product carboxynorspermidine/carboxyspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74A53 protein_id gnl|my_center|LOCUS_00800 5490 6323 gene locus_tag LOCUS_00810 5490 6323 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937728.1 protein_id gnl|my_center|LOCUS_00810 6329 6829 gene locus_tag LOCUS_00820 6329 6829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932062.1 protein_id gnl|my_center|LOCUS_00820 6837 7409 gene locus_tag LOCUS_00830 6837 7409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 >Feature sequence012 1258 581 gene locus_tag LOCUS_00840 1258 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 4568 1251 gene locus_tag LOCUS_00850 4568 1251 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121231.1 protein_id gnl|my_center|LOCUS_00850 5260 4565 gene locus_tag LOCUS_00860 gene lolD 5260 4565 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL7 protein_id gnl|my_center|LOCUS_00860 6237 5257 gene locus_tag LOCUS_00870 6237 5257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 7087 6572 gene locus_tag LOCUS_00880 7087 6572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 >Feature sequence013 1487 786 gene locus_tag LOCUS_00890 gene lolD 1487 786 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73L25 protein_id gnl|my_center|LOCUS_00890 3072 1468 gene locus_tag LOCUS_00900 3072 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 3408 3109 gene locus_tag LOCUS_00910 3408 3109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 3978 3487 gene locus_tag LOCUS_00920 3978 3487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 4263 3985 gene locus_tag LOCUS_00930 4263 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921381.1 protein_id gnl|my_center|LOCUS_00930 6849 4588 gene locus_tag LOCUS_00940 6849 4588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 7523 6918 gene locus_tag LOCUS_00950 7523 6918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 >Feature sequence014 1426 923 gene locus_tag LOCUS_00960 1426 923 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583584.1 protein_id gnl|my_center|LOCUS_00960 1587 2603 gene locus_tag LOCUS_00970 1587 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123542.1 protein_id gnl|my_center|LOCUS_00970 2828 3181 gene locus_tag LOCUS_00980 2828 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 3290 3808 gene locus_tag LOCUS_00990 3290 3808 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S591 protein_id gnl|my_center|LOCUS_00990 3984 5003 gene locus_tag LOCUS_01000 gene glnII 3984 5003 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNZ8 protein_id gnl|my_center|LOCUS_01000 5394 5059 gene locus_tag LOCUS_01010 5394 5059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 5625 5810 gene locus_tag LOCUS_01020 5625 5810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 >Feature sequence015 698 3676 gene locus_tag LOCUS_01030 gene gcvP 698 3676 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MEH6 protein_id gnl|my_center|LOCUS_01030 3718 3975 gene locus_tag LOCUS_01040 3718 3975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 5252 3972 gene locus_tag LOCUS_01050 gene hflX 5252 3972 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBM1 protein_id gnl|my_center|LOCUS_01050 <7137 5342 gene locus_tag LOCUS_01060 <7137 5342 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933346.1:pyruvate, phosphate dikinase >Feature sequence016 839 4441 gene locus_tag LOCUS_01070 839 4441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 5046 4477 gene locus_tag LOCUS_01080 5046 4477 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_01080 <7120 5102 gene locus_tag LOCUS_01090 <7120 5102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000900432.1:penicillin-binding protein 2 >Feature sequence017 1978 695 gene locus_tag LOCUS_01100 gene pyrC 1978 695 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18C47 protein_id gnl|my_center|LOCUS_01100 2910 1975 gene locus_tag LOCUS_01110 gene pyrB 2910 1975 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK43 protein_id gnl|my_center|LOCUS_01110 3908 2907 gene locus_tag LOCUS_01120 3908 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51040 protein_id gnl|my_center|LOCUS_01120 3979 5055 gene locus_tag LOCUS_01130 gene prfA 3979 5055 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B9V1 protein_id gnl|my_center|LOCUS_01130 5048 5905 gene locus_tag LOCUS_01140 gene prmC 5048 5905 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RXR2 protein_id gnl|my_center|LOCUS_01140 <7114 5913 gene locus_tag LOCUS_01150 <7114 5913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007329904.1:tail-specific protease >Feature sequence018 1299 436 gene locus_tag LOCUS_01160 1299 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 2349 1309 gene locus_tag LOCUS_01170 gene mreB-1 2349 1309 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_01170 4369 3299 gene locus_tag LOCUS_01180 4369 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938351.1 protein_id gnl|my_center|LOCUS_01180 4457 5551 gene locus_tag LOCUS_01190 4457 5551 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460676.1 protein_id gnl|my_center|LOCUS_01190 6020 5586 gene locus_tag LOCUS_01200 6020 5586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 6481 6029 gene locus_tag LOCUS_01210 6481 6029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 <7015 6494 gene locus_tag LOCUS_01220 <7015 6494 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870741.1:biotin carboxylase >Feature sequence019 489 797 gene locus_tag LOCUS_01230 489 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 814 1680 gene locus_tag LOCUS_01240 814 1680 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 protein_id gnl|my_center|LOCUS_01240 1677 2216 gene locus_tag LOCUS_01250 gene hprT 1677 2216 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073575.1 protein_id gnl|my_center|LOCUS_01250 2231 2836 gene locus_tag LOCUS_01260 2231 2836 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084142.1 protein_id gnl|my_center|LOCUS_01260 4468 2855 gene locus_tag LOCUS_01270 4468 2855 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_01270 4551 5204 gene locus_tag LOCUS_01280 4551 5204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 6220 5195 gene locus_tag LOCUS_01290 6220 5195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 <6942 6278 gene locus_tag LOCUS_01300 <6942 6278 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P0DJM0:internalin-A >Feature sequence020 <1 1172 gene locus_tag LOCUS_01310 <1 1172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388448.1:histidine kinase 1193 2404 gene locus_tag LOCUS_01320 1193 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 3420 2410 gene locus_tag LOCUS_01330 3420 2410 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118643.1 protein_id gnl|my_center|LOCUS_01330 4409 3417 gene locus_tag LOCUS_01340 4409 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 5358 4417 gene locus_tag LOCUS_01350 5358 4417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 5829 5401 gene locus_tag LOCUS_01360 5829 5401 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719543.1 protein_id gnl|my_center|LOCUS_01360 5931 6617 gene locus_tag LOCUS_01370 5931 6617 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120140.1 protein_id gnl|my_center|LOCUS_01370 >Feature sequence021 232 804 gene locus_tag LOCUS_01380 gene rpsE 232 804 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CG3 protein_id gnl|my_center|LOCUS_01380 828 1262 gene locus_tag LOCUS_01390 gene rplO 828 1262 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FM72 protein_id gnl|my_center|LOCUS_01390 1269 2825 gene locus_tag LOCUS_01400 gene secY 1269 2825 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAJ1 protein_id gnl|my_center|LOCUS_01400 2852 3226 gene locus_tag LOCUS_01410 gene rpsM 2852 3226 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFS3 protein_id gnl|my_center|LOCUS_01410 3245 3805 gene locus_tag LOCUS_01420 3245 3805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 3828 4436 gene locus_tag LOCUS_01430 gene rpsD 3828 4436 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y6T6 protein_id gnl|my_center|LOCUS_01430 4467 5465 gene locus_tag LOCUS_01440 gene rpoA 4467 5465 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFS6 protein_id gnl|my_center|LOCUS_01440 5505 6152 gene locus_tag LOCUS_01450 gene rplQ 5505 6152 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSL9 protein_id gnl|my_center|LOCUS_01450 >Feature sequence022 981 340 gene locus_tag LOCUS_01460 gene kdsB 981 340 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGT5 protein_id gnl|my_center|LOCUS_01460 1193 2416 gene locus_tag LOCUS_01470 gene trpB1 1193 2416 CDS product tryptophan synthase beta chain 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66923 protein_id gnl|my_center|LOCUS_01470 2413 3291 gene locus_tag LOCUS_01480 2413 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625866.1 protein_id gnl|my_center|LOCUS_01480 3762 3337 gene locus_tag LOCUS_01490 3762 3337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 5043 3913 gene locus_tag LOCUS_01500 5043 3913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 <6878 5073 gene locus_tag LOCUS_01510 <6878 5073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to D1BAB4:isoleucine--tRNA ligase >Feature sequence023 849 1841 gene locus_tag LOCUS_01520 gene mutY 849 1841 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404847.1 protein_id gnl|my_center|LOCUS_01520 3467 2037 gene locus_tag LOCUS_01530 gene mpl 3467 2037 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933145.1 protein_id gnl|my_center|LOCUS_01530 3590 4876 gene locus_tag LOCUS_01540 gene purD 3590 4876 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FPD1 protein_id gnl|my_center|LOCUS_01540 4929 5432 gene locus_tag LOCUS_01550 4929 5432 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583173.1 protein_id gnl|my_center|LOCUS_01550 5461 6750 gene locus_tag LOCUS_01560 gene glyA 5461 6750 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E008 protein_id gnl|my_center|LOCUS_01560 >Feature sequence024 1030 2412 gene locus_tag LOCUS_01570 gene arsA 1030 2412 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122622.1 protein_id gnl|my_center|LOCUS_01570 3365 2421 gene locus_tag LOCUS_01580 3365 2421 CDS product acetoin utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891503.1 protein_id gnl|my_center|LOCUS_01580 4556 3369 gene locus_tag LOCUS_01590 gene carA 4556 3369 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGJ6 protein_id gnl|my_center|LOCUS_01590 4695 6509 gene locus_tag LOCUS_01600 gene pckG 4695 6509 CDS product phosphoenolpyruvate carboxykinase [GTP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Y3 protein_id gnl|my_center|LOCUS_01600 >Feature sequence025 <1 1713 gene locus_tag LOCUS_01610 <1 1713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005807931.1:glutamate synthase subunit alpha 1737 3218 gene locus_tag LOCUS_01620 gene gltD 1737 3218 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_01620 3249 3830 gene locus_tag LOCUS_01630 gene thrH 3249 3830 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116438.1 protein_id gnl|my_center|LOCUS_01630 3839 4384 gene locus_tag LOCUS_01640 3839 4384 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339016.1 protein_id gnl|my_center|LOCUS_01640 5141 5446 gene locus_tag LOCUS_01650 5141 5446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 <6801 5580 gene locus_tag LOCUS_01660 <6801 5580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109363.1:N-acetylglucosamine-6-sulfatase >Feature sequence026 <1 858 gene locus_tag LOCUS_01670 <1 858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020932.1:phosphate ABC transporter permease subunit PstC 863 2533 gene locus_tag LOCUS_01680 863 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 2548 3366 gene locus_tag LOCUS_01690 gene pstB1 2548 3366 CDS product phosphate import ATP-binding protein PstB 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG82 protein_id gnl|my_center|LOCUS_01690 3404 4081 gene locus_tag LOCUS_01700 3404 4081 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLA8 protein_id gnl|my_center|LOCUS_01700 4177 4887 gene locus_tag LOCUS_01710 4177 4887 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986854.1 protein_id gnl|my_center|LOCUS_01710 4969 5724 gene locus_tag LOCUS_01720 4969 5724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 >Feature sequence027 568 32 gene locus_tag LOCUS_01730 gene rplF 568 32 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89J99 protein_id gnl|my_center|LOCUS_01730 979 581 gene locus_tag LOCUS_01740 gene rpsH 979 581 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5Q8 protein_id gnl|my_center|LOCUS_01740 1312 1007 gene locus_tag LOCUS_01750 gene rpsN 1312 1007 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F5U0 protein_id gnl|my_center|LOCUS_01750 1902 1333 gene locus_tag LOCUS_01760 gene rplE 1902 1333 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38517 protein_id gnl|my_center|LOCUS_01760 2144 1917 gene locus_tag LOCUS_01770 2144 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 2508 2146 gene locus_tag LOCUS_01780 gene rplN 2508 2146 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q927L7 protein_id gnl|my_center|LOCUS_01780 2787 2515 gene locus_tag LOCUS_01790 gene rpsQ 2787 2515 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7J7 protein_id gnl|my_center|LOCUS_01790 2995 2795 gene locus_tag LOCUS_01800 2995 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 3426 3004 gene locus_tag LOCUS_01810 gene rplP 3426 3004 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7J9 protein_id gnl|my_center|LOCUS_01810 4074 3439 gene locus_tag LOCUS_01820 gene rpsC 4074 3439 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW6 protein_id gnl|my_center|LOCUS_01820 4416 4078 gene locus_tag LOCUS_01830 gene rplV 4416 4078 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q927L2 protein_id gnl|my_center|LOCUS_01830 4687 4418 gene locus_tag LOCUS_01840 gene rpsS 4687 4418 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG43 protein_id gnl|my_center|LOCUS_01840 5537 4695 gene locus_tag LOCUS_01850 gene rplB 5537 4695 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CH7 protein_id gnl|my_center|LOCUS_01850 5842 5552 gene locus_tag LOCUS_01860 gene rplW 5842 5552 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL0 protein_id gnl|my_center|LOCUS_01860 6483 5863 gene locus_tag LOCUS_01870 gene rplD 6483 5863 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CRG1 protein_id gnl|my_center|LOCUS_01870 >Feature sequence028 2383 590 gene locus_tag LOCUS_01880 2383 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 3777 2383 gene locus_tag LOCUS_01890 3777 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 4780 3767 gene locus_tag LOCUS_01900 4780 3767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 5832 4777 gene locus_tag LOCUS_01910 gene batA 5832 4777 CDS product BatA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962311.1 protein_id gnl|my_center|LOCUS_01910 6443 5829 gene locus_tag LOCUS_01920 6443 5829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 >Feature sequence029 <1 853 gene locus_tag LOCUS_01930 <1 853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RJ87:aminotransferase 880 2286 gene locus_tag LOCUS_01940 880 2286 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460200.1 protein_id gnl|my_center|LOCUS_01940 2407 3417 gene locus_tag LOCUS_01950 gene fmt 2407 3417 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94463 protein_id gnl|my_center|LOCUS_01950 3461 4066 gene locus_tag LOCUS_01960 3461 4066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 4080 5036 gene locus_tag LOCUS_01970 4080 5036 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562946.1 protein_id gnl|my_center|LOCUS_01970 5125 5565 gene locus_tag LOCUS_01980 5125 5565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 >Feature sequence030 1 909 gene locus_tag LOCUS_01990 1 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 921 2453 gene locus_tag LOCUS_02000 921 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 2504 3154 gene locus_tag LOCUS_02010 2504 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 3937 3182 gene locus_tag LOCUS_02020 3937 3182 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391331.1 protein_id gnl|my_center|LOCUS_02020 4587 4384 gene locus_tag LOCUS_02030 4587 4384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 <6419 4606 gene locus_tag LOCUS_02040 <6419 4606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986981.1:capsular polysaccharide biosynthesis protein >Feature sequence031 912 28 gene locus_tag LOCUS_02050 912 28 CDS product regucalcin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181677.1 protein_id gnl|my_center|LOCUS_02050 2344 935 gene locus_tag LOCUS_02060 gene cysS 2344 935 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MGC2 protein_id gnl|my_center|LOCUS_02060 3182 2361 gene locus_tag LOCUS_02070 3182 2361 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326598.1 protein_id gnl|my_center|LOCUS_02070 3442 3206 gene locus_tag LOCUS_02080 3442 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 3853 3482 gene locus_tag LOCUS_02090 3853 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933022.1 protein_id gnl|my_center|LOCUS_02090 4288 3929 gene locus_tag LOCUS_02100 gene arsC 4288 3929 CDS product ArsC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001971937.1 protein_id gnl|my_center|LOCUS_02100 >Feature sequence032 <1 1333 gene locus_tag LOCUS_02110 <1 1333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P61667:DNA mismatch repair protein MutS 1330 2115 gene locus_tag LOCUS_02120 1330 2115 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403707.1 protein_id gnl|my_center|LOCUS_02120 2561 2289 gene locus_tag LOCUS_02130 gene hupB 2561 2289 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806049.1 protein_id gnl|my_center|LOCUS_02130 2914 2687 gene locus_tag LOCUS_02140 2914 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 3819 2911 gene locus_tag LOCUS_02150 3819 2911 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887003.1 protein_id gnl|my_center|LOCUS_02150 3972 4937 gene locus_tag LOCUS_02160 3972 4937 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIL5 protein_id gnl|my_center|LOCUS_02160 4970 5962 gene locus_tag LOCUS_02170 gene mdh 4970 5962 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4A2 protein_id gnl|my_center|LOCUS_02170 >Feature sequence033 2634 1 gene locus_tag LOCUS_02180 2634 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 4476 2716 gene locus_tag LOCUS_02190 4476 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 6091 4481 gene locus_tag LOCUS_02200 6091 4481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 >Feature sequence034 227 1030 gene locus_tag LOCUS_02210 gene mutM 227 1030 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O50606 protein_id gnl|my_center|LOCUS_02210 1969 1010 gene locus_tag LOCUS_02220 gene ribF 1969 1010 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VAV6 protein_id gnl|my_center|LOCUS_02220 2700 1969 gene locus_tag LOCUS_02230 2700 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 3698 2697 gene locus_tag LOCUS_02240 3698 2697 CDS product phosphoesterase RecJ-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392566.1 protein_id gnl|my_center|LOCUS_02240 5057 3756 gene locus_tag LOCUS_02250 5057 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02250 <6196 5061 gene locus_tag LOCUS_02260 <6196 5061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005770433.1:MFS transporter >Feature sequence035 940 641 gene locus_tag LOCUS_02270 940 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 2860 2258 gene locus_tag LOCUS_02280 gene yozB 2860 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964211.1 protein_id gnl|my_center|LOCUS_02280 <5955 2921 gene locus_tag LOCUS_02290 <5955 2921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121652.1:cytochrome c >Feature sequence036 297 1190 gene locus_tag LOCUS_02300 297 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 1211 4420 gene locus_tag LOCUS_02310 1211 4420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 4525 4438 gene locus_tag LOCUS_t00070 4525 4438 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4674 5198 gene locus_tag LOCUS_02320 4674 5198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 5203 5820 gene locus_tag LOCUS_02330 5203 5820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 >Feature sequence037 <1 552 gene locus_tag LOCUS_02340 <1 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962373.1:amidophosphoribosyltransferase 643 1233 gene locus_tag LOCUS_02350 643 1233 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328559.1 protein_id gnl|my_center|LOCUS_02350 1349 3055 gene locus_tag LOCUS_02360 1349 3055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 <5813 3091 gene locus_tag LOCUS_02370 <5813 3091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74C55:bifunctional uridylyltransferase/uridylyl-removing enzyme >Feature sequence038 1847 1404 gene locus_tag LOCUS_02380 1847 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 2101 2367 gene locus_tag LOCUS_02390 gene rpsO 2101 2367 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7V0 protein_id gnl|my_center|LOCUS_02390 2522 4768 gene locus_tag LOCUS_02400 gene pnp 2522 4768 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHN2 protein_id gnl|my_center|LOCUS_02400 4904 5713 gene locus_tag LOCUS_02410 4904 5713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 >Feature sequence039 3077 354 gene locus_tag LOCUS_02420 gene valS 3077 354 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KC74 protein_id gnl|my_center|LOCUS_02420 3839 3102 gene locus_tag LOCUS_02430 3839 3102 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337281.1 protein_id gnl|my_center|LOCUS_02430 3923 4162 gene locus_tag LOCUS_02440 3923 4162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 4569 4159 gene locus_tag LOCUS_02450 4569 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 4990 4562 gene locus_tag LOCUS_02460 4990 4562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 >Feature sequence040 434 1864 gene locus_tag LOCUS_02470 434 1864 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326676.1 protein_id gnl|my_center|LOCUS_02470 1920 3260 gene locus_tag LOCUS_02480 1920 3260 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123557.1 protein_id gnl|my_center|LOCUS_02480 4624 3263 gene locus_tag LOCUS_02490 4624 3263 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118376.1 protein_id gnl|my_center|LOCUS_02490 5520 4633 gene locus_tag LOCUS_02500 gene ans 5520 4633 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020718.1 protein_id gnl|my_center|LOCUS_02500 >Feature sequence041 <1 620 gene locus_tag LOCUS_02510 <1 620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224232.1:3-oxoacyl-ACP reductase 614 1699 gene locus_tag LOCUS_02520 614 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 1702 3210 gene locus_tag LOCUS_02530 1702 3210 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085058.1 protein_id gnl|my_center|LOCUS_02530 3224 4228 gene locus_tag LOCUS_02540 3224 4228 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085059.1 protein_id gnl|my_center|LOCUS_02540 4539 4225 gene locus_tag LOCUS_02550 4539 4225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970743.1 protein_id gnl|my_center|LOCUS_02550 >Feature sequence042 1388 531 gene locus_tag LOCUS_02560 1388 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 2043 1393 gene locus_tag LOCUS_02570 2043 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 2567 2040 gene locus_tag LOCUS_02580 gene sigH 2567 2040 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121971.1 protein_id gnl|my_center|LOCUS_02580 2854 4059 gene locus_tag LOCUS_02590 2854 4059 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368548.1 protein_id gnl|my_center|LOCUS_02590 4056 5003 gene locus_tag LOCUS_02600 4056 5003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 >Feature sequence043 375 644 gene locus_tag LOCUS_02610 375 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 2336 924 gene locus_tag LOCUS_02620 gene strI 2336 924 CDS product streptomycin biosynthesis protein StrI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123424.1 protein_id gnl|my_center|LOCUS_02620 3626 2490 gene locus_tag LOCUS_02630 3626 2490 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405503.1 protein_id gnl|my_center|LOCUS_02630 4270 3713 gene locus_tag LOCUS_02640 4270 3713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 4221 4445 gene locus_tag LOCUS_02650 4221 4445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 4499 4732 gene locus_tag LOCUS_02660 4499 4732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 4732 5118 gene locus_tag LOCUS_02670 4732 5118 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143544.1 protein_id gnl|my_center|LOCUS_02670 >Feature sequence044 2111 510 gene locus_tag LOCUS_02680 2111 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119050.1 protein_id gnl|my_center|LOCUS_02680 2641 2108 gene locus_tag LOCUS_02690 2641 2108 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120437.1 protein_id gnl|my_center|LOCUS_02690 <5382 3018 gene locus_tag LOCUS_02700 <5382 3018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031513.1:glycosyl hydrolase >Feature sequence045 112 1224 gene locus_tag LOCUS_02710 gene proB 112 1224 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKZ7 protein_id gnl|my_center|LOCUS_02710 1228 3327 gene locus_tag LOCUS_02720 1228 3327 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X0W5 protein_id gnl|my_center|LOCUS_02720 3757 3344 gene locus_tag LOCUS_02730 3757 3344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 4300 3764 gene locus_tag LOCUS_02740 gene dcd 4300 3764 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97N13 protein_id gnl|my_center|LOCUS_02740 <5370 4398 gene locus_tag LOCUS_02750 <5370 4398 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118593.1:oxidoreductase >Feature sequence046 <1 1768 gene locus_tag LOCUS_02760 <1 1768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121437.1:serine/threonine protein kinase 1900 3312 gene locus_tag LOCUS_02770 1900 3312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 3349 3606 gene locus_tag LOCUS_02780 3349 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 >Feature sequence047 <1 1493 gene locus_tag LOCUS_02790 <1 1493 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8T9Z5:outer membrane protein assembly factor BamA 1539 2081 gene locus_tag LOCUS_02800 1539 2081 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946255.1 protein_id gnl|my_center|LOCUS_02800 2112 3146 gene locus_tag LOCUS_02810 gene lpxD 2112 3146 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A014 protein_id gnl|my_center|LOCUS_02810 3155 4105 gene locus_tag LOCUS_02820 gene prs 3155 4105 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG56 protein_id gnl|my_center|LOCUS_02820 >Feature sequence048 <1 657 gene locus_tag LOCUS_02830 <1 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9WYZ5:tRNA dimethylallyltransferase 702 1520 gene locus_tag LOCUS_02840 gene nadK 702 1520 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZC0 protein_id gnl|my_center|LOCUS_02840 1809 3158 gene locus_tag LOCUS_02850 1809 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 3212 3979 gene locus_tag LOCUS_02860 3212 3979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 >Feature sequence049 <1 1036 gene locus_tag LOCUS_02870 <1 1036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942964.1:amine oxidase 1033 1803 gene locus_tag LOCUS_02880 1033 1803 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942965.1 protein_id gnl|my_center|LOCUS_02880 1800 3065 gene locus_tag LOCUS_02890 1800 3065 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942966.1 protein_id gnl|my_center|LOCUS_02890 3062 3595 gene locus_tag LOCUS_02900 3062 3595 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942967.1 protein_id gnl|my_center|LOCUS_02900 3582 4364 gene locus_tag LOCUS_02910 3582 4364 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036519.1 protein_id gnl|my_center|LOCUS_02910 >Feature sequence050 797 1666 gene locus_tag LOCUS_02920 797 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 3109 1679 gene locus_tag LOCUS_02930 gene pykA 3109 1679 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UF82 protein_id gnl|my_center|LOCUS_02930 3900 3106 gene locus_tag LOCUS_02940 gene yycJ 3900 3106 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883514.1 protein_id gnl|my_center|LOCUS_02940 3976 4491 gene locus_tag LOCUS_02950 3976 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 <5106 4484 gene locus_tag LOCUS_02960 <5106 4484 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RHT7:Holliday junction ATP-dependent DNA helicase RuvB >Feature sequence051 <1 1173 gene locus_tag LOCUS_02970 <1 1173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123571.1:iduronate-2-sulfatase 2734 1322 gene locus_tag LOCUS_02980 2734 1322 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123803.1 protein_id gnl|my_center|LOCUS_02980 <5094 2753 gene locus_tag LOCUS_02990 <5094 2753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123804.1:cytochrome c >Feature sequence052 2224 770 gene locus_tag LOCUS_03000 gene glgA2 2224 770 CDS product glycogen synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747K8 protein_id gnl|my_center|LOCUS_03000 2456 3415 gene locus_tag LOCUS_03010 gene phoH 2456 3415 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117767.1 protein_id gnl|my_center|LOCUS_03010 >Feature sequence053 <1 631 gene locus_tag LOCUS_03020 <1 631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123682.1:arylsulfatase 2136 814 gene locus_tag LOCUS_03030 2136 814 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119046.1 protein_id gnl|my_center|LOCUS_03030 3073 2252 gene locus_tag LOCUS_03040 3073 2252 CDS product sorbitol-6-phosphate 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379285.1 protein_id gnl|my_center|LOCUS_03040 <4888 3103 gene locus_tag LOCUS_03050 <4888 3103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582809.1:L-sorbose 1-phosphate reductase >Feature sequence054 321 3326 gene locus_tag LOCUS_03060 gene secA 321 3326 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD18 protein_id gnl|my_center|LOCUS_03060 4197 3349 gene locus_tag LOCUS_03070 gene rsmA 4197 3349 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q837A7 protein_id gnl|my_center|LOCUS_03070 <4885 4228 gene locus_tag LOCUS_03080 <4885 4228 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RIT7:indole-3-glycerol phosphate synthase >Feature sequence055 2975 1821 gene locus_tag LOCUS_03090 2975 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 3076 3609 gene locus_tag LOCUS_03100 3076 3609 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327230.1 protein_id gnl|my_center|LOCUS_03100 3672 4754 gene locus_tag LOCUS_03110 3672 4754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 >Feature sequence056 630 1586 gene locus_tag LOCUS_03120 630 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 1641 2666 gene locus_tag LOCUS_03130 1641 2666 CDS product oxidoreductase/dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_602267.1 protein_id gnl|my_center|LOCUS_03130 3547 2669 gene locus_tag LOCUS_03140 3547 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 3675 4085 gene locus_tag LOCUS_03150 3675 4085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 >Feature sequence057 <1 1036 gene locus_tag LOCUS_03160 <1 1036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121186.1:UDP-N-acetylhexosamine pyrophosphorylase 1053 3023 gene locus_tag LOCUS_03170 gene pgm2 1053 3023 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748715.1 protein_id gnl|my_center|LOCUS_03170 4354 3041 gene locus_tag LOCUS_03180 gene pdhC 4354 3041 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE4 protein_id gnl|my_center|LOCUS_03180 >Feature sequence058 1313 729 gene locus_tag LOCUS_03190 1313 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03190 2165 1320 gene locus_tag LOCUS_03200 gene panC 2165 1320 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X0G6 protein_id gnl|my_center|LOCUS_03200 3719 2205 gene locus_tag LOCUS_03210 gene proS 3719 2205 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGJ7 protein_id gnl|my_center|LOCUS_03210 >Feature sequence059 632 330 gene locus_tag LOCUS_03220 632 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 1227 664 gene locus_tag LOCUS_03230 1227 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 2648 1584 gene locus_tag LOCUS_03240 2648 1584 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKJ7 protein_id gnl|my_center|LOCUS_03240 2820 4061 gene locus_tag LOCUS_03250 2820 4061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 >Feature sequence060 800 135 gene locus_tag LOCUS_03260 800 135 CDS product NAD dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733273.1 protein_id gnl|my_center|LOCUS_03260 911 2419 gene locus_tag LOCUS_03270 gene gltX 911 2419 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884C8 protein_id gnl|my_center|LOCUS_03270 2447 4132 gene locus_tag LOCUS_03280 gene glnS 2447 4132 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q727A5 protein_id gnl|my_center|LOCUS_03280 >Feature sequence061 715 1281 gene locus_tag LOCUS_03290 715 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03290 1260 2048 gene locus_tag LOCUS_03300 1260 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03300 2148 2447 gene locus_tag LOCUS_03310 2148 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03310 2452 3813 gene locus_tag LOCUS_03320 2452 3813 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_03320 3898 3824 gene locus_tag LOCUS_t00080 3898 3824 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 <4722 3964 gene locus_tag LOCUS_03330 <4722 3964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918028.1:TonB-dependent receptor >Feature sequence062 964 1359 gene locus_tag LOCUS_03340 964 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 2008 1349 gene locus_tag LOCUS_03350 2008 1349 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933377.1 protein_id gnl|my_center|LOCUS_03350 4368 2065 gene locus_tag LOCUS_03360 4368 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 >Feature sequence063 247 1722 gene locus_tag LOCUS_03370 gene zwf 247 1722 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WE89 protein_id gnl|my_center|LOCUS_03370 1722 2351 gene locus_tag LOCUS_03380 gene msrA1 1722 2351 CDS product peptide methionine sulfoxide reductase MsrA 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJK0 protein_id gnl|my_center|LOCUS_03380 2589 3371 gene locus_tag LOCUS_03390 2589 3371 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122515.1 protein_id gnl|my_center|LOCUS_03390 4498 3374 gene locus_tag LOCUS_03400 4498 3374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 >Feature sequence064 1996 674 gene locus_tag LOCUS_03410 1996 674 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIE4 protein_id gnl|my_center|LOCUS_03410 2660 2022 gene locus_tag LOCUS_03420 gene plsY 2660 2022 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66905 protein_id gnl|my_center|LOCUS_03420 4291 2696 gene locus_tag LOCUS_03430 gene serA 4291 2696 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKK8 protein_id gnl|my_center|LOCUS_03430 >Feature sequence065 162 1349 gene locus_tag LOCUS_03440 162 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 1352 2326 gene locus_tag LOCUS_03450 1352 2326 CDS product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224650.1 protein_id gnl|my_center|LOCUS_03450 2345 3787 gene locus_tag LOCUS_03460 2345 3787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120502.1 protein_id gnl|my_center|LOCUS_03460 4184 3810 gene locus_tag LOCUS_03470 gene rplS 4184 3810 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YK97 protein_id gnl|my_center|LOCUS_03470 >Feature sequence066 1064 2200 gene locus_tag LOCUS_03480 gene rho 1064 2200 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y691 protein_id gnl|my_center|LOCUS_03480 2273 4033 gene locus_tag LOCUS_03490 2273 4033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 >Feature sequence067 1941 1552 gene locus_tag LOCUS_03500 gene rplL 1941 1552 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y5 protein_id gnl|my_center|LOCUS_03500 2582 2070 gene locus_tag LOCUS_03510 gene rplJ 2582 2070 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZE22 protein_id gnl|my_center|LOCUS_03510 3283 2606 gene locus_tag LOCUS_03520 gene rplA 3283 2606 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z9A3 protein_id gnl|my_center|LOCUS_03520 3713 3291 gene locus_tag LOCUS_03530 gene rplK 3713 3291 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B6U1 protein_id gnl|my_center|LOCUS_03530 4297 3719 gene locus_tag LOCUS_03540 gene nusG 4297 3719 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y1 protein_id gnl|my_center|LOCUS_03540 >Feature sequence068 134 337 gene locus_tag LOCUS_03550 134 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 334 1161 gene locus_tag LOCUS_03560 gene menB 334 1161 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG66 protein_id gnl|my_center|LOCUS_03560 2507 1173 gene locus_tag LOCUS_03570 2507 1173 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLG1 protein_id gnl|my_center|LOCUS_03570 3879 2548 gene locus_tag LOCUS_03580 gene proA 3879 2548 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67166 protein_id gnl|my_center|LOCUS_03580 >Feature sequence069 2112 1411 gene locus_tag LOCUS_03590 2112 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 3276 2149 gene locus_tag LOCUS_03600 gene trmU 3276 2149 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJX6 protein_id gnl|my_center|LOCUS_03600 >Feature sequence070 <1 1560 gene locus_tag LOCUS_03610 <1 1560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118098.1:surface-associated protein cshA precursor 1964 3259 gene locus_tag LOCUS_03620 gene avtA 1964 3259 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458682.1 protein_id gnl|my_center|LOCUS_03620 >Feature sequence071 454 1050 gene locus_tag LOCUS_03630 454 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 1084 1401 gene locus_tag LOCUS_03640 1084 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 1420 1962 gene locus_tag LOCUS_03650 1420 1962 CDS product 4-methyl-5(B-hydroxyethyl)-thiazole monophosphate biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143742.1 protein_id gnl|my_center|LOCUS_03650 3291 2017 gene locus_tag LOCUS_03660 3291 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 >Feature sequence072 308 916 gene locus_tag LOCUS_03670 308 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 940 1680 gene locus_tag LOCUS_03680 940 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 1762 2229 gene locus_tag LOCUS_03690 1762 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 2616 2233 gene locus_tag LOCUS_03700 2616 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 4264 2693 gene locus_tag LOCUS_03710 gene pgi 4264 2693 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKY2 protein_id gnl|my_center|LOCUS_03710 >Feature sequence073 941 2428 gene locus_tag LOCUS_03720 gene lysS 941 2428 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37477 protein_id gnl|my_center|LOCUS_03720 2612 2935 gene locus_tag LOCUS_03730 2612 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 2996 3415 gene locus_tag LOCUS_03740 2996 3415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 4300 3425 gene locus_tag LOCUS_03750 4300 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 >Feature sequence074 1286 2614 gene locus_tag LOCUS_03760 1286 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 2658 3071 gene locus_tag LOCUS_03770 2658 3071 CDS product heat-shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760336.1 protein_id gnl|my_center|LOCUS_03770 >Feature sequence075 3 1442 gene locus_tag LOCUS_03780 3 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 1449 2744 gene locus_tag LOCUS_03790 1449 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327912.1 protein_id gnl|my_center|LOCUS_03790 2810 3454 gene locus_tag LOCUS_03800 gene ppiA 2810 3454 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MD29 protein_id gnl|my_center|LOCUS_03800 4174 3491 gene locus_tag LOCUS_03810 4174 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 >Feature sequence076 428 2137 gene locus_tag LOCUS_03820 428 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 >Feature sequence077 1388 15 gene locus_tag LOCUS_03830 1388 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404619.1 protein_id gnl|my_center|LOCUS_03830 2188 1385 gene locus_tag LOCUS_03840 2188 1385 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705171.1 protein_id gnl|my_center|LOCUS_03840 3781 2231 gene locus_tag LOCUS_03850 gene purH 3781 2231 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFK6 protein_id gnl|my_center|LOCUS_03850 >Feature sequence078 201 656 gene locus_tag LOCUS_03860 201 656 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941140.1 protein_id gnl|my_center|LOCUS_03860 723 1436 gene locus_tag LOCUS_03870 723 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903274.1 protein_id gnl|my_center|LOCUS_03870 2605 1358 gene locus_tag LOCUS_03880 2605 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 3261 2704 gene locus_tag LOCUS_03890 3261 2704 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259574.1 protein_id gnl|my_center|LOCUS_03890 3763 3377 gene locus_tag LOCUS_03900 3763 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056929.1 protein_id gnl|my_center|LOCUS_03900 >Feature sequence079 3833 3042 gene locus_tag LOCUS_03910 3833 3042 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932468.1 protein_id gnl|my_center|LOCUS_03910 >Feature sequence080 83 793 gene locus_tag LOCUS_03920 gene lplA_1 83 793 CDS product lipoate--protein ligase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883079.1 protein_id gnl|my_center|LOCUS_03920 2014 803 gene locus_tag LOCUS_03930 gene rumA 2014 803 CDS product 23S rRNA (uracil-5-)-methyltransferase RumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546143.1 protein_id gnl|my_center|LOCUS_03930 2119 2868 gene locus_tag LOCUS_03940 gene spoU 2119 2868 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001969649.1 protein_id gnl|my_center|LOCUS_03940 3888 2890 gene locus_tag LOCUS_03950 3888 2890 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259367.1 protein_id gnl|my_center|LOCUS_03950 >Feature sequence081 <1 624 gene locus_tag LOCUS_03960 <1 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941590.1:ABC transporter ATP-binding protein 1796 630 gene locus_tag LOCUS_03970 1796 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120602.1 protein_id gnl|my_center|LOCUS_03970 2683 1814 gene locus_tag LOCUS_03980 2683 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 >Feature sequence082 1854 1099 gene locus_tag LOCUS_03990 1854 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 3182 1914 gene locus_tag LOCUS_04000 3182 1914 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788605.1 protein_id gnl|my_center|LOCUS_04000 3472 3987 gene locus_tag LOCUS_04010 3472 3987 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313806.1 protein_id gnl|my_center|LOCUS_04010 >Feature sequence083 333 1625 gene locus_tag LOCUS_04020 gene pepP 333 1625 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_04020 1658 3190 gene locus_tag LOCUS_04030 gene arsA 1658 3190 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121409.1 protein_id gnl|my_center|LOCUS_04030 >Feature sequence084 1111 206 gene locus_tag LOCUS_04040 gene cysD 1111 206 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S508 protein_id gnl|my_center|LOCUS_04040 1587 1108 gene locus_tag LOCUS_04050 gene cysC 1587 1108 CDS product putative adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34577 protein_id gnl|my_center|LOCUS_04050 2421 1819 gene locus_tag LOCUS_04060 2421 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 2712 2425 gene locus_tag LOCUS_04070 2712 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 3662 2721 gene locus_tag LOCUS_04080 gene xerC 3662 2721 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQY6 protein_id gnl|my_center|LOCUS_04080 >Feature sequence085 85 1011 gene locus_tag LOCUS_04090 85 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 1287 2243 gene locus_tag LOCUS_04100 gene redB 1287 2243 CDS product colanic acid biosynthesis glycosyltransferase WcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972422.1 protein_id gnl|my_center|LOCUS_04100 2236 3123 gene locus_tag LOCUS_04110 2236 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 <4077 3162 gene locus_tag LOCUS_04120 <4077 3162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583069.1:2-amino-3-ketobutyrate CoA ligase >Feature sequence086 58 2514 gene locus_tag LOCUS_04130 58 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 3284 2526 gene locus_tag LOCUS_04140 3284 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810266.1 protein_id gnl|my_center|LOCUS_04140 3928 3281 gene locus_tag LOCUS_04150 3928 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 >Feature sequence087 <1 500 gene locus_tag LOCUS_04160 <1 500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74GM4:cytochrome c oxidase subunit 2 509 2953 gene locus_tag LOCUS_04170 509 2953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 2976 3785 gene locus_tag LOCUS_04180 2976 3785 CDS product tagatose 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328799.1 protein_id gnl|my_center|LOCUS_04180 >Feature sequence088 159 794 gene locus_tag LOCUS_04190 gene ruvA 159 794 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWL2 protein_id gnl|my_center|LOCUS_04190 1541 783 gene locus_tag LOCUS_04200 1541 783 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022744.1 protein_id gnl|my_center|LOCUS_04200 2677 1541 gene locus_tag LOCUS_04210 2677 1541 CDS product molybdenum cofactor biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404770.1 protein_id gnl|my_center|LOCUS_04210 3919 2702 gene locus_tag LOCUS_04220 gene thiH 3919 2702 CDS product thiamine biosynthesis protein ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962602.1 protein_id gnl|my_center|LOCUS_04220 >Feature sequence089 369 986 gene locus_tag LOCUS_04230 369 986 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406778.1 protein_id gnl|my_center|LOCUS_04230 983 3544 gene locus_tag LOCUS_04240 983 3544 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403467.1 protein_id gnl|my_center|LOCUS_04240 >Feature sequence090 1068 226 gene locus_tag LOCUS_04250 gene map 1068 226 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG27 protein_id gnl|my_center|LOCUS_04250 1196 2338 gene locus_tag LOCUS_04260 gene ybhE 1196 2338 CDS product 3-carboxymuconate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121679.1 protein_id gnl|my_center|LOCUS_04260 3607 2372 gene locus_tag LOCUS_04270 3607 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 >Feature sequence091 1463 2524 gene locus_tag LOCUS_04280 gene ctaA 1463 2524 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H039 protein_id gnl|my_center|LOCUS_04280 <3936 2625 gene locus_tag LOCUS_04290 <3936 2625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121109.1:9-O-acetylesterase >Feature sequence092 1213 482 gene locus_tag LOCUS_04300 1213 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 1338 2393 gene locus_tag LOCUS_04310 gene pyrD 1338 2393 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDI1 protein_id gnl|my_center|LOCUS_04310 2429 3400 gene locus_tag LOCUS_04320 2429 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 3486 3402 gene locus_tag LOCUS_t00090 3486 3402 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence093 1390 1620 gene locus_tag LOCUS_04330 gene phd 1390 1620 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923260.1 protein_id gnl|my_center|LOCUS_04330 1617 2000 gene locus_tag LOCUS_04340 gene doc 1617 2000 CDS product death-on-curing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921192.1 protein_id gnl|my_center|LOCUS_04340 2113 2475 gene locus_tag LOCUS_04350 2113 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 2486 2845 gene locus_tag LOCUS_04360 2486 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 <3911 2865 gene locus_tag LOCUS_04370 <3911 2865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970631.1:ATP-dependent DNA helicase RecQ >Feature sequence094 1709 2953 gene locus_tag LOCUS_04380 1709 2953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 3025 3834 gene locus_tag LOCUS_04390 3025 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 >Feature sequence095 759 280 gene locus_tag LOCUS_04400 759 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 1066 773 gene locus_tag LOCUS_04410 1066 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 2213 1128 gene locus_tag LOCUS_04420 2213 1128 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_04420 3405 2236 gene locus_tag LOCUS_04430 3405 2236 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529510.1 protein_id gnl|my_center|LOCUS_04430 >Feature sequence096 620 6 gene locus_tag LOCUS_04440 620 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 1420 689 gene locus_tag LOCUS_04450 1420 689 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705042.1 protein_id gnl|my_center|LOCUS_04450 1564 2493 gene locus_tag LOCUS_04460 gene trxB 1564 2493 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231058.1 protein_id gnl|my_center|LOCUS_04460 >Feature sequence097 1241 246 gene locus_tag LOCUS_04470 1241 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 2590 1376 gene locus_tag LOCUS_04480 2590 1376 CDS product iron alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122942.1 protein_id gnl|my_center|LOCUS_04480 <3892 2612 gene locus_tag LOCUS_04490 <3892 2612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122220.1:aldehyde dehydrogenase >Feature sequence098 1636 974 gene locus_tag LOCUS_04500 1636 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 3106 1649 gene locus_tag LOCUS_04510 3106 1649 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122518.1 protein_id gnl|my_center|LOCUS_04510 <3832 3114 gene locus_tag LOCUS_04520 <3832 3114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122517.1:endo-inulinase >Feature sequence099 <1 1595 gene locus_tag LOCUS_04530 <1 1595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118284.1:ABC transporter permease 1643 3562 gene locus_tag LOCUS_04540 1643 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 >Feature sequence100 <1 591 gene locus_tag LOCUS_04550 <1 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q92L45:signal recognition particle protein 1259 618 gene locus_tag LOCUS_04560 gene trpF 1259 618 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56320 protein_id gnl|my_center|LOCUS_04560 2803 1259 gene locus_tag LOCUS_04570 gene hemD 2803 1259 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943897.1 protein_id gnl|my_center|LOCUS_04570 3579 2785 gene locus_tag LOCUS_04580 3579 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 >Feature sequence101 46 534 gene locus_tag LOCUS_04590 gene folA 46 534 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EV2 protein_id gnl|my_center|LOCUS_04590 1446 538 gene locus_tag LOCUS_04600 1446 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 2383 1454 gene locus_tag LOCUS_04610 2383 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 2699 3553 gene locus_tag LOCUS_04620 gene ctaB 2699 3553 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S012 protein_id gnl|my_center|LOCUS_04620 >Feature sequence102 122 445 gene locus_tag LOCUS_04630 122 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 468 2264 gene locus_tag LOCUS_04640 468 2264 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118364.1 protein_id gnl|my_center|LOCUS_04640 2377 2844 gene locus_tag LOCUS_04650 2377 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 >Feature sequence103 508 595 gene locus_tag LOCUS_t00100 508 595 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2004 610 gene locus_tag LOCUS_04660 2004 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 3325 2057 gene locus_tag LOCUS_04670 gene glmM 3325 2057 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C70 protein_id gnl|my_center|LOCUS_04670 >Feature sequence104 <1 930 gene locus_tag LOCUS_04680 <1 930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120738.1:cytochrome c 977 1324 gene locus_tag LOCUS_04690 977 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975561.1 protein_id gnl|my_center|LOCUS_04690 >Feature sequence105 1601 2299 gene locus_tag LOCUS_04700 1601 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 3292 2303 gene locus_tag LOCUS_04710 gene fbp 3292 2303 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KP35 protein_id gnl|my_center|LOCUS_04710 >Feature sequence106 1283 189 gene locus_tag LOCUS_04720 1283 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 2197 1457 gene locus_tag LOCUS_04730 2197 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 3111 2347 gene locus_tag LOCUS_04740 3111 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 3739 3104 gene locus_tag LOCUS_04750 3739 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 >Feature sequence107 326 1414 gene locus_tag LOCUS_04760 gene pknB 326 1414 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328819.1 protein_id gnl|my_center|LOCUS_04760 3029 1689 gene locus_tag LOCUS_04770 3029 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 3376 3104 gene locus_tag LOCUS_04780 3376 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 >Feature sequence108 2934 2248 gene locus_tag LOCUS_04790 gene purQ 2934 2248 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S567 protein_id gnl|my_center|LOCUS_04790 <3713 2931 gene locus_tag LOCUS_04800 <3713 2931 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122609.1:2-keto-4-pentenoate hydratase >Feature sequence109 1163 1432 gene locus_tag LOCUS_04810 1163 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 1757 1458 gene locus_tag LOCUS_04820 1757 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920128.1 protein_id gnl|my_center|LOCUS_04820 1948 2379 gene locus_tag LOCUS_04830 1948 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 >Feature sequence110 <1 1070 gene locus_tag LOCUS_04840 <1 1070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121692.1:helicase 1111 1830 gene locus_tag LOCUS_04850 1111 1830 CDS product protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_04850 1839 2150 gene locus_tag LOCUS_04860 1839 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 >Feature sequence111 1849 791 gene locus_tag LOCUS_04870 1849 791 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119834.1 protein_id gnl|my_center|LOCUS_04870 2631 1951 gene locus_tag LOCUS_04880 2631 1951 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941823.1 protein_id gnl|my_center|LOCUS_04880 3635 2628 gene locus_tag LOCUS_04890 3635 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 >Feature sequence112 1606 2508 gene locus_tag LOCUS_04900 1606 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 2570 2800 gene locus_tag LOCUS_04910 gene rpmB 2570 2800 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WY96 protein_id gnl|my_center|LOCUS_04910 >Feature sequence113 713 1135 gene locus_tag LOCUS_04920 713 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 1199 1274 gene locus_tag LOCUS_t00110 1199 1274 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1365 1292 gene locus_tag LOCUS_t00120 1365 1292 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1480 1833 gene locus_tag LOCUS_04930 1480 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 2745 2110 gene locus_tag LOCUS_04940 2745 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 >Feature sequence114 1852 947 gene locus_tag LOCUS_04950 1852 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118532.1 protein_id gnl|my_center|LOCUS_04950 2879 1884 gene locus_tag LOCUS_04960 gene moxR 2879 1884 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121741.1 protein_id gnl|my_center|LOCUS_04960 >Feature sequence115 2 877 gene locus_tag LOCUS_04970 2 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 867 1364 gene locus_tag LOCUS_04980 gene ybeY 867 1364 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0T3 protein_id gnl|my_center|LOCUS_04980 1377 2018 gene locus_tag LOCUS_04990 1377 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392134.1 protein_id gnl|my_center|LOCUS_04990 2096 2650 gene locus_tag LOCUS_05000 2096 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 2720 3139 gene locus_tag LOCUS_05010 2720 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140630.1 protein_id gnl|my_center|LOCUS_05010 >Feature sequence116 1179 247 gene locus_tag LOCUS_05020 1179 247 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_05020 2749 1169 gene locus_tag LOCUS_05030 gene nnr 2749 1169 CDS product bifunctional NAD(P)H-hydrate repair enzyme Nnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIM0 protein_id gnl|my_center|LOCUS_05030 3153 2746 gene locus_tag LOCUS_05040 gene acpS 3153 2746 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z8M5 protein_id gnl|my_center|LOCUS_05040 >Feature sequence117 825 37 gene locus_tag LOCUS_05050 gene truA 825 37 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TU07 protein_id gnl|my_center|LOCUS_05050 1244 822 gene locus_tag LOCUS_05060 1244 822 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z8U7 protein_id gnl|my_center|LOCUS_05060 2257 1259 gene locus_tag LOCUS_05070 gene manC 2257 1259 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120825.1 protein_id gnl|my_center|LOCUS_05070 3220 2423 gene locus_tag LOCUS_05080 3220 2423 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VY8 protein_id gnl|my_center|LOCUS_05080 >Feature sequence118 2574 1861 gene locus_tag LOCUS_05090 gene menG 2574 1861 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59912 protein_id gnl|my_center|LOCUS_05090 <3545 2571 gene locus_tag LOCUS_05100 <3545 2571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q83DJ1:ATP-dependent Clp protease ATP-binding subunit ClpX >Feature sequence119 66 2048 gene locus_tag LOCUS_05110 gene acsA 66 2048 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNC6 protein_id gnl|my_center|LOCUS_05110 2110 2979 gene locus_tag LOCUS_05120 gene ilvE 2110 2979 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336792.1 protein_id gnl|my_center|LOCUS_05120 >Feature sequence120 <3530 1845 gene locus_tag LOCUS_05130 <3530 1845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B0B7N1:DNA-directed RNA polymerase subunit beta >Feature sequence121 3012 1240 gene locus_tag LOCUS_05140 3012 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 >Feature sequence122 >Feature sequence123 351 1211 gene locus_tag LOCUS_05150 351 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 1208 1843 gene locus_tag LOCUS_05160 1208 1843 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764500.1 protein_id gnl|my_center|LOCUS_05160 1840 3225 gene locus_tag LOCUS_05170 1840 3225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 >Feature sequence124 1178 144 gene locus_tag LOCUS_05180 1178 144 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097860.1 protein_id gnl|my_center|LOCUS_05180 2177 1191 gene locus_tag LOCUS_05190 2177 1191 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869431.1 protein_id gnl|my_center|LOCUS_05190 <3490 2269 gene locus_tag LOCUS_05200 <3490 2269 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528130.1:glutamate-1-semialdehyde 2,1-aminomutase >Feature sequence125 >Feature sequence126 2117 1536 gene locus_tag LOCUS_05210 gene ruvC 2117 1536 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHT5 protein_id gnl|my_center|LOCUS_05210 2901 2125 gene locus_tag LOCUS_05220 2901 2125 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULK2 protein_id gnl|my_center|LOCUS_05220 <3481 2901 gene locus_tag LOCUS_05230 <3481 2901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000775113.1:DNA replication/repair protein RecF >Feature sequence127 495 2612 gene locus_tag LOCUS_05240 495 2612 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888294.1 protein_id gnl|my_center|LOCUS_05240 2630 3034 gene locus_tag LOCUS_05250 2630 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 >Feature sequence128 2 469 gene locus_tag LOCUS_05260 2 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 466 1839 gene locus_tag LOCUS_05270 466 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 1887 2768 gene locus_tag LOCUS_05280 1887 2768 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLG6 protein_id gnl|my_center|LOCUS_05280 <3480 2769 gene locus_tag LOCUS_05290 <3480 2769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74H76:peptidylprolyl isomerase >Feature sequence129 1210 110 gene locus_tag LOCUS_05300 gene hisC 1210 110 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61000 protein_id gnl|my_center|LOCUS_05300 2529 1207 gene locus_tag LOCUS_05310 gene hisD 2529 1207 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NL02 protein_id gnl|my_center|LOCUS_05310 <3458 2534 gene locus_tag LOCUS_05320 <3458 2534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q72D86:GMP synthase [glutamine-hydrolyzing] >Feature sequence130 880 128 gene locus_tag LOCUS_05330 880 128 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_05330 2809 893 gene locus_tag LOCUS_05340 gene sdhA 2809 893 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050920.1 protein_id gnl|my_center|LOCUS_05340 >Feature sequence131 184 1203 gene locus_tag LOCUS_05350 184 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 1362 1829 gene locus_tag LOCUS_05360 1362 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 >Feature sequence132 2780 465 gene locus_tag LOCUS_05370 2780 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121404.1 protein_id gnl|my_center|LOCUS_05370 <3444 2870 gene locus_tag LOCUS_05380 <3444 2870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933192.1:Rab family protein >Feature sequence133 574 882 gene locus_tag LOCUS_05390 574 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 936 2261 gene locus_tag LOCUS_05400 936 2261 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250513.1 protein_id gnl|my_center|LOCUS_05400 2258 3193 gene locus_tag LOCUS_05410 gene yaeI 2258 3193 CDS product phosphodiesterase YaeI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37049 protein_id gnl|my_center|LOCUS_05410 >Feature sequence134 198 1127 gene locus_tag LOCUS_05420 198 1127 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036699.1 protein_id gnl|my_center|LOCUS_05420 <3412 1148 gene locus_tag LOCUS_05430 <3412 1148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023630.1:thioredoxin domain-containing protein >Feature sequence135 <1 1454 gene locus_tag LOCUS_05440 <1 1454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P24010:cytochrome c oxidase subunit 1 1488 2135 gene locus_tag LOCUS_05450 gene qoxC 1488 2135 CDS product quinol oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P34958 protein_id gnl|my_center|LOCUS_05450 2174 2857 gene locus_tag LOCUS_05460 2174 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 >Feature sequence136 1642 1289 gene locus_tag LOCUS_05470 1642 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 1742 2719 gene locus_tag LOCUS_05480 1742 2719 CDS product D-arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544949.1 protein_id gnl|my_center|LOCUS_05480 2728 3021 gene locus_tag LOCUS_05490 2728 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 >Feature sequence137 244 1605 gene locus_tag LOCUS_05500 gene thrC 244 1605 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383579.1 protein_id gnl|my_center|LOCUS_05500 1659 2477 gene locus_tag LOCUS_05510 1659 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545817.1 protein_id gnl|my_center|LOCUS_05510 <3333 2441 gene locus_tag LOCUS_05520 <3333 2441 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O66682:(R)-citramalate synthase >Feature sequence138 2047 863 gene locus_tag LOCUS_05530 2047 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 2151 2435 gene locus_tag LOCUS_05540 2151 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 <3328 2490 gene locus_tag LOCUS_05550 <3328 2490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O34500:manganese transport system membrane protein MntD >Feature sequence139 932 261 gene locus_tag LOCUS_05560 932 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 1167 937 gene locus_tag LOCUS_05570 1167 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 1416 2294 gene locus_tag LOCUS_05580 1416 2294 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545810.1 protein_id gnl|my_center|LOCUS_05580 >Feature sequence140 1499 216 gene locus_tag LOCUS_05590 1499 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 2478 1507 gene locus_tag LOCUS_05600 2478 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 3315 2596 gene locus_tag LOCUS_05610 3315 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 >Feature sequence141 404 802 gene locus_tag LOCUS_05620 404 802 CDS product acyl-CoA thioester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811622.1 protein_id gnl|my_center|LOCUS_05620 1355 825 gene locus_tag LOCUS_05630 gene aroK 1355 825 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RW93 protein_id gnl|my_center|LOCUS_05630 1420 1863 gene locus_tag LOCUS_05640 1420 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583213.1 protein_id gnl|my_center|LOCUS_05640 1960 2958 gene locus_tag LOCUS_05650 1960 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 >Feature sequence142 225 449 gene locus_tag LOCUS_05660 225 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 474 1010 gene locus_tag LOCUS_05670 474 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 1022 1417 gene locus_tag LOCUS_05680 1022 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 1437 2969 gene locus_tag LOCUS_05690 gene atpA 1437 2969 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDM3 protein_id gnl|my_center|LOCUS_05690 >Feature sequence143 574 1575 gene locus_tag LOCUS_05700 574 1575 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669065.1 protein_id gnl|my_center|LOCUS_05700 1588 2217 gene locus_tag LOCUS_05710 1588 2217 CDS product 3'-exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938381.1 protein_id gnl|my_center|LOCUS_05710 2855 2214 gene locus_tag LOCUS_05720 2855 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 >Feature sequence144 1657 179 gene locus_tag LOCUS_05730 1657 179 CDS product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119008.1 protein_id gnl|my_center|LOCUS_05730 3175 1793 gene locus_tag LOCUS_05740 gene aslA 3175 1793 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120007.1 protein_id gnl|my_center|LOCUS_05740 >Feature sequence145 1126 2013 gene locus_tag LOCUS_05750 gene glpG 1126 2013 CDS product rhomboid protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NMI8 protein_id gnl|my_center|LOCUS_05750 <3252 2016 gene locus_tag LOCUS_05760 <3252 2016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UG04:homoserine O-acetyltransferase >Feature sequence146 1245 46 gene locus_tag LOCUS_05770 gene mtlD 1245 46 CDS product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q185K5 protein_id gnl|my_center|LOCUS_05770 2581 1268 gene locus_tag LOCUS_05780 2581 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 <3238 2661 gene locus_tag LOCUS_05790 <3238 2661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002209518.1:adenosine kinase >Feature sequence147 409 1326 gene locus_tag LOCUS_05800 409 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 1349 1687 gene locus_tag LOCUS_05810 1349 1687 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_05810 1672 2760 gene locus_tag LOCUS_05820 1672 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 >Feature sequence148 120 992 gene locus_tag LOCUS_05830 120 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 1064 1939 gene locus_tag LOCUS_05840 gene hisG 1064 1939 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KB10 protein_id gnl|my_center|LOCUS_05840 >Feature sequence149 1091 2233 gene locus_tag LOCUS_05850 1091 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 >Feature sequence150 >Feature sequence151 730 302 gene locus_tag LOCUS_05860 730 302 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390116.1 protein_id gnl|my_center|LOCUS_05860 829 1896 gene locus_tag LOCUS_05870 gene rlmN 829 1896 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q819U3 protein_id gnl|my_center|LOCUS_05870 2578 1931 gene locus_tag LOCUS_05880 2578 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 2998 2615 gene locus_tag LOCUS_05890 2998 2615 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975605.1 protein_id gnl|my_center|LOCUS_05890 >Feature sequence152 672 2528 gene locus_tag LOCUS_05900 gene dnaG 672 2528 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKT6 protein_id gnl|my_center|LOCUS_05900 >Feature sequence153 1354 893 gene locus_tag LOCUS_05910 1354 893 CDS product putative tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H134 protein_id gnl|my_center|LOCUS_05910 1830 1351 gene locus_tag LOCUS_05920 gene smpB 1830 1351 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CG4 protein_id gnl|my_center|LOCUS_05920 2099 1887 gene locus_tag LOCUS_05930 2099 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 2200 2493 gene locus_tag LOCUS_05940 gene cutA 2200 2493 CDS product divalent cation tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226991.1 protein_id gnl|my_center|LOCUS_05940 2665 2510 gene locus_tag LOCUS_05950 2665 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 >Feature sequence154 784 209 gene locus_tag LOCUS_05960 gene def2 784 209 CDS product peptide deformylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIF5 protein_id gnl|my_center|LOCUS_05960 >Feature sequence155 1099 1563 gene locus_tag LOCUS_05970 gene folA 1099 1563 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MEC3 protein_id gnl|my_center|LOCUS_05970 1646 2899 gene locus_tag LOCUS_05980 gene lysA 1646 2899 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190627.1 protein_id gnl|my_center|LOCUS_05980 >Feature sequence156 780 1418 gene locus_tag LOCUS_05990 780 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 1428 2597 gene locus_tag LOCUS_06000 1428 2597 CDS product cycloartenol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123043.1 protein_id gnl|my_center|LOCUS_06000 >Feature sequence157 2339 1134 gene locus_tag LOCUS_06010 gene ftsA 2339 1134 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CLU9 protein_id gnl|my_center|LOCUS_06010 3101 2367 gene locus_tag LOCUS_06020 3101 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 >Feature sequence158 <3096 708 gene locus_tag LOCUS_06030 <3096 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122595.1:cytochrome c >Feature sequence159 <3069 1422 gene locus_tag LOCUS_06040 <3069 1422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O66962:tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG >Feature sequence160 896 465 gene locus_tag LOCUS_06050 896 465 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121867.1 protein_id gnl|my_center|LOCUS_06050 2152 911 gene locus_tag LOCUS_06060 2152 911 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118182.1 protein_id gnl|my_center|LOCUS_06060 <3067 2203 gene locus_tag LOCUS_06070 <3067 2203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117886.1:alkylhalidase >Feature sequence161 <1 609 gene locus_tag LOCUS_06080 <1 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007324174.1:ABC transporter substrate-binding protein 678 2177 gene locus_tag LOCUS_06090 gene arsA 678 2177 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119603.1 protein_id gnl|my_center|LOCUS_06090 >Feature sequence162 358 1833 gene locus_tag LOCUS_06100 gene atsA 358 1833 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118387.1 protein_id gnl|my_center|LOCUS_06100 2006 3031 gene locus_tag LOCUS_06110 2006 3031 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013491.1 protein_id gnl|my_center|LOCUS_06110 >Feature sequence163 1714 602 gene locus_tag LOCUS_06120 gene ampS 1714 602 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654739.1 protein_id gnl|my_center|LOCUS_06120 2971 1730 gene locus_tag LOCUS_06130 gene adk 2971 1730 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXV7 protein_id gnl|my_center|LOCUS_06130 >Feature sequence164 1631 984 gene locus_tag LOCUS_06140 1631 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 2205 1654 gene locus_tag LOCUS_06150 2205 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404832.1 protein_id gnl|my_center|LOCUS_06150 <3045 2208 gene locus_tag LOCUS_06160 <3045 2208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404833.1:polysulfide reductase chain C >Feature sequence165 2085 631 gene locus_tag LOCUS_06170 2085 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257880.1 protein_id gnl|my_center|LOCUS_06170 3035 2148 gene locus_tag LOCUS_06180 3035 2148 CDS product 8-oxoguanine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023475.1 protein_id gnl|my_center|LOCUS_06180 >Feature sequence166 49 1023 gene locus_tag LOCUS_06190 49 1023 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326200.1 protein_id gnl|my_center|LOCUS_06190 1686 1009 gene locus_tag LOCUS_06200 1686 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 1876 2685 gene locus_tag LOCUS_06210 1876 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 >Feature sequence167 1649 1269 gene locus_tag LOCUS_06220 gene gcvH 1649 1269 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F6Y8 protein_id gnl|my_center|LOCUS_06220 <3009 1705 gene locus_tag LOCUS_06230 <3009 1705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007337168.1:glucose-1-phosphate adenylyltransferase >Feature sequence168 <1 1170 gene locus_tag LOCUS_06240 <1 1170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532632.1:serine peptidase 1158 1949 gene locus_tag LOCUS_06250 1158 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 >Feature sequence169 208 741 gene locus_tag LOCUS_06260 208 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 <2974 771 gene locus_tag LOCUS_06270 <2974 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056518.1:serine protease >Feature sequence170 2026 1550 gene locus_tag LOCUS_06280 2026 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 <2961 2051 gene locus_tag LOCUS_06290 <2961 2051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5SJG0:UPF0365 protein >Feature sequence171 <1 923 gene locus_tag LOCUS_06300 <1 923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J5M6:phenylalanine--tRNA ligase beta subunit 937 1230 gene locus_tag LOCUS_06310 gene gatC 937 1230 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGY3 protein_id gnl|my_center|LOCUS_06310 1243 2712 gene locus_tag LOCUS_06320 gene gatA 1243 2712 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Y7 protein_id gnl|my_center|LOCUS_06320 >Feature sequence172 1114 1623 gene locus_tag LOCUS_06330 1114 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 <2930 1662 gene locus_tag LOCUS_06340 <2930 1662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EFR5:6-phosphogluconate dehydrogenase, decarboxylating >Feature sequence173 1101 595 gene locus_tag LOCUS_06350 gene tadA 1101 595 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFZ1 protein_id gnl|my_center|LOCUS_06350 1199 1480 gene locus_tag LOCUS_06360 1199 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 1434 2477 gene locus_tag LOCUS_06370 gene cysK 1434 2477 CDS product O-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A535 protein_id gnl|my_center|LOCUS_06370 >Feature sequence174 >Feature sequence175 2701 875 gene locus_tag LOCUS_06380 2701 875 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117792.1 protein_id gnl|my_center|LOCUS_06380 >Feature sequence176 539 688 gene locus_tag LOCUS_06390 539 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 1902 685 gene locus_tag LOCUS_06400 gene rhlE-2 1902 685 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941582.1 protein_id gnl|my_center|LOCUS_06400 1984 2796 gene locus_tag LOCUS_06410 gene gluQ 1984 2796 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BE3 protein_id gnl|my_center|LOCUS_06410 >Feature sequence177 <1 945 gene locus_tag LOCUS_06420 <1 945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120298.1:arylsulfatase 998 1306 gene locus_tag LOCUS_06430 998 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 >Feature sequence178 >Feature sequence179 1434 1126 gene locus_tag LOCUS_06440 gene nuoK1 1434 1126 CDS product NADH-quinone oxidoreductase subunit K 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G98 protein_id gnl|my_center|LOCUS_06440 2018 1455 gene locus_tag LOCUS_06450 2018 1455 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258757.1 protein_id gnl|my_center|LOCUS_06450 2586 2041 gene locus_tag LOCUS_06460 2586 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 >Feature sequence180 1354 413 gene locus_tag LOCUS_06470 gene mntA 1354 413 CDS product manganese-binding lipoprotein MntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34385 protein_id gnl|my_center|LOCUS_06470 1462 2136 gene locus_tag LOCUS_06480 gene sirR 1462 2136 CDS product iron-dependent repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_06480 >Feature sequence181 1482 427 gene locus_tag LOCUS_06490 gene des 1482 427 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34653 protein_id gnl|my_center|LOCUS_06490 >Feature sequence182 <1 1854 gene locus_tag LOCUS_06500 <1 1854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459098.1:elongation factor G 1858 2166 gene locus_tag LOCUS_06510 gene rpsJ 1858 2166 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMC3 protein_id gnl|my_center|LOCUS_06510 >Feature sequence183 >Feature sequence184 784 11 gene locus_tag LOCUS_06520 784 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 2777 765 gene locus_tag LOCUS_06530 gene uvrB 2777 765 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLV3 protein_id gnl|my_center|LOCUS_06530 >Feature sequence185 1315 566 gene locus_tag LOCUS_06540 gene uppS 1315 566 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFL9 protein_id gnl|my_center|LOCUS_06540 1396 1686 gene locus_tag LOCUS_06550 1396 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 <2795 1688 gene locus_tag LOCUS_06560 <2795 1688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118163.1:acetylglucosamine-6-sulfatase >Feature sequence186 <1 930 gene locus_tag LOCUS_06570 <1 930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KLK4:ATP-dependent RNA helicase DeaD 1747 977 gene locus_tag LOCUS_06580 1747 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120623.1 protein_id gnl|my_center|LOCUS_06580 >Feature sequence187 883 392 gene locus_tag LOCUS_06590 gene coaD 883 392 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DS2 protein_id gnl|my_center|LOCUS_06590 1027 1596 gene locus_tag LOCUS_06600 1027 1596 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869392.1 protein_id gnl|my_center|LOCUS_06600 1606 2103 gene locus_tag LOCUS_06610 1606 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 2122 2415 gene locus_tag LOCUS_06620 gene ptsH 2122 2415 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668605.1 protein_id gnl|my_center|LOCUS_06620 >Feature sequence188 1443 685 gene locus_tag LOCUS_06630 1443 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269372.1 protein_id gnl|my_center|LOCUS_06630 1613 1539 gene locus_tag LOCUS_t00130 1613 1539 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1723 2514 gene locus_tag LOCUS_06640 1723 2514 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072060.1 protein_id gnl|my_center|LOCUS_06640 >Feature sequence189 <2764 1181 gene locus_tag LOCUS_06650 <2764 1181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974111.1:aconitate hydratase >Feature sequence190 1729 779 gene locus_tag LOCUS_06660 1729 779 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331193.1 protein_id gnl|my_center|LOCUS_06660 1831 2514 gene locus_tag LOCUS_06670 1831 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 >Feature sequence191 932 60 gene locus_tag LOCUS_06680 932 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 2129 1014 gene locus_tag LOCUS_06690 gene hemH 2129 1014 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGU6 protein_id gnl|my_center|LOCUS_06690 <2759 2217 gene locus_tag LOCUS_06700 <2759 2217 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403969.1:protoporphyrinogen oxidase >Feature sequence192 <1 819 gene locus_tag LOCUS_06710 <1 819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9Z7F0:RNA polymerase sigma factor SigA 886 1176 gene locus_tag LOCUS_06720 886 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 1682 1269 gene locus_tag LOCUS_06730 1682 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 1897 1679 gene locus_tag LOCUS_06740 1897 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 >Feature sequence193 <1 647 gene locus_tag LOCUS_06750 <1 647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001179969.1:deoxyribodipyrimidine photo-lyase 663 2207 gene locus_tag LOCUS_06760 663 2207 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121705.1 protein_id gnl|my_center|LOCUS_06760 2523 2170 gene locus_tag LOCUS_06770 2523 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06770 >Feature sequence194 1780 1448 gene locus_tag LOCUS_06780 1780 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 2165 1815 gene locus_tag LOCUS_06790 2165 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 2489 2274 gene locus_tag LOCUS_06800 2489 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 >Feature sequence195 5 1159 gene locus_tag LOCUS_06810 5 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 1988 1161 gene locus_tag LOCUS_06820 1988 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 <2750 2056 gene locus_tag LOCUS_06830 <2750 2056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943733.1:DNA translocase FtsK >Feature sequence196 <1 1228 gene locus_tag LOCUS_06840 <1 1228 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q819T9:primosomal protein N' >Feature sequence197 249 980 gene locus_tag LOCUS_06850 249 980 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966927.1 protein_id gnl|my_center|LOCUS_06850 1060 2361 gene locus_tag LOCUS_06860 gene ybdG 1060 2361 CDS product small conductance mechanosensitive ion channel protein YbdG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070528.1 protein_id gnl|my_center|LOCUS_06860 >Feature sequence198 <1 603 gene locus_tag LOCUS_06870 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EK05:ribosomal RNA small subunit methyltransferase I 614 1537 gene locus_tag LOCUS_06880 614 1537 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931793.1 protein_id gnl|my_center|LOCUS_06880 <2709 1534 gene locus_tag LOCUS_06890 <2709 1534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C0SPA0:pullulanase >Feature sequence199 2034 556 gene locus_tag LOCUS_06900 2034 556 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869086.1 protein_id gnl|my_center|LOCUS_06900 >Feature sequence200 <1 612 gene locus_tag LOCUS_06910 <1 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9F2I9:methionine--tRNA ligase 1938 640 gene locus_tag LOCUS_06920 1938 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 <2673 1941 gene locus_tag LOCUS_06930 <2673 1941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P17731:histidinol-phosphate aminotransferase >Feature sequence201 >Feature sequence202 2470 1316 gene locus_tag LOCUS_06940 gene dxr 2470 1316 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1H0 protein_id gnl|my_center|LOCUS_06940 >Feature sequence203 21 545 gene locus_tag LOCUS_06950 21 545 CDS product putative 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN92 protein_id gnl|my_center|LOCUS_06950 652 1104 gene locus_tag LOCUS_06960 652 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 1117 1962 gene locus_tag LOCUS_06970 1117 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 >Feature sequence204 1936 929 gene locus_tag LOCUS_06980 1936 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39879 protein_id gnl|my_center|LOCUS_06980 >Feature sequence205 <2598 1580 gene locus_tag LOCUS_06990 <2598 1580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RM40:protein-arginine kinase >Feature sequence206 <1 803 gene locus_tag LOCUS_07000 <1 803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388495.1:phosphoribosyltransferase 819 1772 gene locus_tag LOCUS_07010 gene accD 819 1772 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJI7 protein_id gnl|my_center|LOCUS_07010 >Feature sequence207 <1 1665 gene locus_tag LOCUS_07020 <1 1665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YFV7:DNA-directed RNA polymerase subunit beta' 1741 2115 gene locus_tag LOCUS_07030 gene rpsL 1741 2115 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG52 protein_id gnl|my_center|LOCUS_07030 >Feature sequence208 717 448 gene locus_tag LOCUS_07040 717 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 1913 846 gene locus_tag LOCUS_07050 gene fbaA 1913 846 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962494.1 protein_id gnl|my_center|LOCUS_07050 2502 2017 gene locus_tag LOCUS_07060 2502 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 >Feature sequence209 2421 1090 gene locus_tag LOCUS_07070 gene pdhC 2421 1090 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A3CMZ5 protein_id gnl|my_center|LOCUS_07070 >Feature sequence210 1396 497 gene locus_tag LOCUS_07080 1396 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 2070 1465 gene locus_tag LOCUS_07090 2070 1465 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18B07 protein_id gnl|my_center|LOCUS_07090 >Feature sequence211 1453 1181 gene locus_tag LOCUS_07100 1453 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458022.1 protein_id gnl|my_center|LOCUS_07100 >Feature sequence212 601 2184 gene locus_tag LOCUS_07110 601 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 >Feature sequence213 <1 844 gene locus_tag LOCUS_07120 <1 844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392361.1:cell division protein FtsW 841 1977 gene locus_tag LOCUS_07130 gene murG 841 1977 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VDZ2 protein_id gnl|my_center|LOCUS_07130 >Feature sequence214 <1 1588 gene locus_tag LOCUS_07140 <1 1588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011014011.1:multidrug ABC transporter ATP-binding protein 1797 1585 gene locus_tag LOCUS_07150 1797 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 >Feature sequence215 2482 1403 gene locus_tag LOCUS_07160 2482 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 >Feature sequence216 >Feature sequence217 95 784 gene locus_tag LOCUS_07170 95 784 CDS product Tol-Pal system subunit TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_07170 815 1234 gene locus_tag LOCUS_07180 gene exbD2 815 1234 CDS product transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085366.1 protein_id gnl|my_center|LOCUS_07180 2033 1239 gene locus_tag LOCUS_07190 gene pksC 2033 1239 CDS product polyketide biosynthesis malonyl CoA-acyl carrier protein transacylase PksC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34825 protein_id gnl|my_center|LOCUS_07190 >Feature sequence218 196 1095 gene locus_tag LOCUS_07200 196 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 1955 978 gene locus_tag LOCUS_07210 1955 978 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73N23 protein_id gnl|my_center|LOCUS_07210 <2516 1952 gene locus_tag LOCUS_07220 <2516 1952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002678884.1:HflK protein >Feature sequence219 <2511 1752 gene locus_tag LOCUS_07230 <2511 1752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9RDN0:aldose 1-epimerase >Feature sequence220 384 1796 gene locus_tag LOCUS_07240 384 1796 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0W2 protein_id gnl|my_center|LOCUS_07240 2423 1818 gene locus_tag LOCUS_07250 2423 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 >Feature sequence221 >Feature sequence222 >Feature sequence223 >Feature sequence224 >Feature sequence225 >Feature sequence226 251 511 gene locus_tag LOCUS_07260 251 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 963 592 gene locus_tag LOCUS_07270 963 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 >Feature sequence227 576 1586 gene locus_tag LOCUS_07280 576 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 >Feature sequence228 474 1697 gene locus_tag LOCUS_07290 474 1697 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466242.1 protein_id gnl|my_center|LOCUS_07290 >Feature sequence229 <1 1813 gene locus_tag LOCUS_07300 <1 1813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061214.1:ABC-ATPase UvrA >Feature sequence230 828 1931 gene locus_tag LOCUS_07310 gene leuB 828 1931 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CFL3 protein_id gnl|my_center|LOCUS_07310 >Feature sequence231 <1 624 gene locus_tag LOCUS_07320 <1 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007324152.1:2-oxoglutarate ferredoxin oxidoreductase subunit alpha 636 1655 gene locus_tag LOCUS_07330 gene korB 636 1655 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121170.1 protein_id gnl|my_center|LOCUS_07330 1713 1886 gene locus_tag LOCUS_07340 1713 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 >Feature sequence232 2089 878 gene locus_tag LOCUS_07350 2089 878 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_07350 >Feature sequence233 735 1655 gene locus_tag LOCUS_07360 735 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 >Feature sequence234 341 685 gene locus_tag LOCUS_07370 341 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 682 1485 gene locus_tag LOCUS_07380 gene rpsD 682 1485 CDS product RNA polymerase sigma factor sigma-28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883005.1 protein_id gnl|my_center|LOCUS_07380 1501 2361 gene locus_tag LOCUS_07390 1501 2361 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389595.1 protein_id gnl|my_center|LOCUS_07390 >Feature sequence235 1416 739 gene locus_tag LOCUS_07400 1416 739 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403103.1 protein_id gnl|my_center|LOCUS_07400 <2426 1413 gene locus_tag LOCUS_07410 <2426 1413 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963070.1:cytochrome-c oxidase >Feature sequence236 72 494 gene locus_tag LOCUS_07420 72 494 CDS product cysteine desulfuration protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391222.1 protein_id gnl|my_center|LOCUS_07420 1676 498 gene locus_tag LOCUS_07430 1676 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 2300 1686 gene locus_tag LOCUS_07440 2300 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 >Feature sequence237 1333 1136 gene locus_tag LOCUS_07450 1333 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 >Feature sequence238 578 1600 gene locus_tag LOCUS_07460 gene gap1 578 1600 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMR8 protein_id gnl|my_center|LOCUS_07460 >Feature sequence239 1062 112 gene locus_tag LOCUS_07470 gene ddl 1062 112 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJD5 protein_id gnl|my_center|LOCUS_07470 <2400 1076 gene locus_tag LOCUS_07480 <2400 1076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460695.1:UDP-N-acetylenolpyruvoylglucosamine reductase >Feature sequence240 1895 1041 gene locus_tag LOCUS_07490 1895 1041 CDS product beta-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803721.1 protein_id gnl|my_center|LOCUS_07490 >Feature sequence241 668 300 gene locus_tag LOCUS_07500 668 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 >Feature sequence242 186 1253 gene locus_tag LOCUS_07510 gene plsX 186 1253 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J364 protein_id gnl|my_center|LOCUS_07510 1272 2261 gene locus_tag LOCUS_07520 1272 2261 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460503.1 protein_id gnl|my_center|LOCUS_07520 >Feature sequence243 <2384 1350 gene locus_tag LOCUS_07530 <2384 1350 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EYJ5:sulfate adenylyltransferase subunit 1 >Feature sequence244 1904 417 gene locus_tag LOCUS_07540 1904 417 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123682.1 protein_id gnl|my_center|LOCUS_07540 >Feature sequence245 1731 601 gene locus_tag LOCUS_07550 1731 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 >Feature sequence246 361 2142 gene locus_tag LOCUS_07560 361 2142 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UHW9 protein_id gnl|my_center|LOCUS_07560 >Feature sequence247 1830 457 gene locus_tag LOCUS_07570 gene yqeZ 1830 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54465 protein_id gnl|my_center|LOCUS_07570 >Feature sequence248 >Feature sequence249 <2340 1036 gene locus_tag LOCUS_07580 <2340 1036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202061.1:arylsulfatase >Feature sequence250 >Feature sequence251 >Feature sequence252 <1 1746 gene locus_tag LOCUS_07590 <1 1746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942486.1:sugar ABC transporter substrate-binding protein >Feature sequence253 826 329 gene locus_tag LOCUS_07600 826 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 1026 1487 gene locus_tag LOCUS_07610 1026 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 1601 1676 gene locus_tag LOCUS_t00140 1601 1676 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 <2335 1726 gene locus_tag LOCUS_07620 <2335 1726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007339018.1:acyl-[ACP]--phospholipid O-acyltransferase >Feature sequence254 <1 1764 gene locus_tag LOCUS_07630 <1 1764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0C6P6B2:DNA topoisomerase 1779 2075 gene locus_tag LOCUS_07640 1779 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 >Feature sequence255 <1 1134 gene locus_tag LOCUS_07650 <1 1134 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582815.1:L-fuculose kinase 1574 1143 gene locus_tag LOCUS_07660 1574 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328395.1 protein_id gnl|my_center|LOCUS_07660 >Feature sequence256 95 694 gene locus_tag LOCUS_07670 95 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 697 1677 gene locus_tag LOCUS_07680 697 1677 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707194.1 protein_id gnl|my_center|LOCUS_07680 >Feature sequence257 566 1633 gene locus_tag LOCUS_07690 566 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 >Feature sequence258 356 1414 gene locus_tag LOCUS_07700 356 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002346258.1 protein_id gnl|my_center|LOCUS_07700 1700 1428 gene locus_tag LOCUS_07710 1700 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 >Feature sequence259 >Feature sequence260 1399 839 gene locus_tag LOCUS_07720 1399 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07720 <2264 1738 gene locus_tag LOCUS_07730 <2264 1738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3XWS2:shikimate dehydrogenase (NADP(+)) >Feature sequence261 >Feature sequence262 >Feature sequence263 >Feature sequence264 <1 662 gene locus_tag LOCUS_07740 <1 662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S4K5:exodeoxyribonuclease 7 large subunit 1205 654 gene locus_tag LOCUS_07750 1205 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 >Feature sequence265 840 19 gene locus_tag LOCUS_07760 840 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327229.1 protein_id gnl|my_center|LOCUS_07760 >Feature sequence266 >Feature sequence267 1042 434 gene locus_tag LOCUS_07770 1042 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 >Feature sequence268 1672 227 gene locus_tag LOCUS_07780 1672 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 >Feature sequence269 >Feature sequence270 >Feature sequence271 <1 1439 gene locus_tag LOCUS_07790 <1 1439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q747C7:60 kDa chaperonin <2174 1553 gene locus_tag LOCUS_07800 <2174 1553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A029:lipoyl synthase >Feature sequence272 <2168 1402 gene locus_tag LOCUS_07810 <2168 1402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8TM18:pyruvate carboxylase >Feature sequence273 <1 1062 gene locus_tag LOCUS_07820 <1 1062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74GA5:NADH-quinone oxidoreductase subunit D 1064 1615 gene locus_tag LOCUS_07830 gene nuoE 1064 1615 CDS product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224830.1 protein_id gnl|my_center|LOCUS_07830 >Feature sequence274 >Feature sequence275 393 1004 gene locus_tag LOCUS_07840 393 1004 CDS product alkylated DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479964.1 protein_id gnl|my_center|LOCUS_07840 1114 1632 gene locus_tag LOCUS_07850 1114 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 >Feature sequence276 1645 983 gene locus_tag LOCUS_07860 1645 983 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257775.1 protein_id gnl|my_center|LOCUS_07860 >Feature sequence277 958 476 gene locus_tag LOCUS_07870 958 476 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255696.1 protein_id gnl|my_center|LOCUS_07870 1607 1050 gene locus_tag LOCUS_07880 1607 1050 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808789.1 protein_id gnl|my_center|LOCUS_07880 2149 1604 gene locus_tag LOCUS_07890 2149 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 >Feature sequence278 1174 371 gene locus_tag LOCUS_07900 gene phnE 1174 371 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095111.1 protein_id gnl|my_center|LOCUS_07900 1857 1171 gene locus_tag LOCUS_07910 gene phnC2 1857 1171 CDS product phosphonates import ATP-binding protein PhnC 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q882S0 protein_id gnl|my_center|LOCUS_07910 >Feature sequence279 725 1678 gene locus_tag LOCUS_07920 gene pdxA 725 1678 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMZ2 protein_id gnl|my_center|LOCUS_07920 >Feature sequence280 1161 1724 gene locus_tag LOCUS_07930 1161 1724 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943377.1 protein_id gnl|my_center|LOCUS_07930 >Feature sequence281 2017 149 gene locus_tag LOCUS_07940 gene fadE10 2017 149 CDS product putative acyl-CoA dehydrogenase FadE10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WQF7 protein_id gnl|my_center|LOCUS_07940 >Feature sequence282 261 779 gene locus_tag LOCUS_07950 261 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969419.1 protein_id gnl|my_center|LOCUS_07950 1786 770 gene locus_tag LOCUS_07960 1786 770 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482282.1 protein_id gnl|my_center|LOCUS_07960 >Feature sequence283 544 239 gene locus_tag LOCUS_07970 544 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 1540 872 gene locus_tag LOCUS_07980 1540 872 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268716.1 protein_id gnl|my_center|LOCUS_07980 <2127 1537 gene locus_tag LOCUS_07990 <2127 1537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118436.1:DNA ligase-associated DEXH box helicase >Feature sequence284 1036 1677 gene locus_tag LOCUS_08000 1036 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 >Feature sequence285 660 307 gene locus_tag LOCUS_08010 660 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 >Feature sequence286 <1 1443 gene locus_tag LOCUS_08020 <1 1443 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74H59:chaperone protein DnaK 1544 1840 gene locus_tag LOCUS_08030 gene groS 1544 1840 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1B0 protein_id gnl|my_center|LOCUS_08030 >Feature sequence287 >Feature sequence288 2 1483 gene locus_tag LOCUS_08040 2 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 >Feature sequence289 954 2039 gene locus_tag LOCUS_08050 gene nrdB 954 2039 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MK81 protein_id gnl|my_center|LOCUS_08050 >Feature sequence290 872 1741 gene locus_tag LOCUS_08060 872 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 >Feature sequence291 831 1205 gene locus_tag LOCUS_08070 831 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 1285 1677 gene locus_tag LOCUS_08080 gene arsC 1285 1677 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938935.1 protein_id gnl|my_center|LOCUS_08080 >Feature sequence292 <1 1161 gene locus_tag LOCUS_08090 <1 1161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P60789:elongation factor 4 >Feature sequence293 >Feature sequence294 1871 1089 gene locus_tag LOCUS_08100 1871 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 >Feature sequence295 1296 751 gene locus_tag LOCUS_08110 1296 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 >Feature sequence296 471 983 gene locus_tag LOCUS_08120 471 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 >Feature sequence297 <2008 1076 gene locus_tag LOCUS_08130 <2008 1076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UVG2:xylose isomerase >Feature sequence298 <1 1290 gene locus_tag LOCUS_08140 <1 1290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXI6:dihydrolipoyl dehydrogenase >Feature sequence299 >Feature sequence300 1 576 gene locus_tag LOCUS_08150 1 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 1009 593 gene locus_tag LOCUS_08160 1009 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 >Feature sequence301 <1966 138 gene locus_tag LOCUS_08170 <1966 138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118605.1:glucose dehydrogenase >Feature sequence302 136 1494 gene locus_tag LOCUS_08180 136 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 >Feature sequence303 895 1155 gene locus_tag LOCUS_08190 895 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 1233 1769 gene locus_tag LOCUS_08200 1233 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 >Feature sequence304 600 527 gene locus_tag LOCUS_t00150 600 527 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 667 1383 gene locus_tag LOCUS_08210 gene pyrH 667 1383 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97I64 protein_id gnl|my_center|LOCUS_08210 >Feature sequence305 <1 1022 gene locus_tag LOCUS_08220 <1 1022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120944.1:coproporphyrinogen III oxidase 1046 1600 gene locus_tag LOCUS_08230 1046 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 >Feature sequence306 <1 579 gene locus_tag LOCUS_08240 <1 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DLM1:chorismate synthase 589 1269 gene locus_tag LOCUS_08250 589 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 1333 1418 gene locus_tag LOCUS_t00160 1333 1418 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence307 >Feature sequence308 1129 239 gene locus_tag LOCUS_08260 1129 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 >Feature sequence309 1276 728 gene locus_tag LOCUS_08270 gene qcrA 1276 728 CDS product menaquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46911 protein_id gnl|my_center|LOCUS_08270 >Feature sequence310 >Feature sequence311 441 710 gene locus_tag LOCUS_08280 441 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 1284 733 gene locus_tag LOCUS_08290 1284 733 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977514.1 protein_id gnl|my_center|LOCUS_08290 1918 1433 gene locus_tag LOCUS_08300 1918 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 >Feature sequence312 >Feature sequence313 1500 1213 gene locus_tag LOCUS_08310 1500 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 >Feature sequence314 <1909 242 gene locus_tag LOCUS_08320 <1909 242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942486.1:sugar ABC transporter substrate-binding protein >Feature sequence315 1726 491 gene locus_tag LOCUS_08330 1726 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 >Feature sequence316 <1904 648 gene locus_tag LOCUS_08340 <1904 648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941581.1:heme ABC transporter ATPase >Feature sequence317 1070 147 gene locus_tag LOCUS_08350 1070 147 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URI8 protein_id gnl|my_center|LOCUS_08350 1480 1136 gene locus_tag LOCUS_08360 1480 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 >Feature sequence318 <1 664 gene locus_tag LOCUS_08370 <1 664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941182.1:IclR family transcriptional regulator >Feature sequence319 282 1172 gene locus_tag LOCUS_08380 282 1172 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329773.1 protein_id gnl|my_center|LOCUS_08380 >Feature sequence320 274 1413 gene locus_tag LOCUS_08390 gene cyaA 274 1413 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123079.1 protein_id gnl|my_center|LOCUS_08390 >Feature sequence321 >Feature sequence322 <1887 812 gene locus_tag LOCUS_08400 <1887 812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460749.1:flagellar biosynthesis protein FlhA >Feature sequence323 606 394 gene locus_tag LOCUS_08410 606 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 1679 690 gene locus_tag LOCUS_08420 1679 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 >Feature sequence324 <1 1691 gene locus_tag LOCUS_08430 <1 1691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A5I305:1-deoxy-D-xylulose-5-phosphate synthase >Feature sequence325 1840 1367 gene locus_tag LOCUS_08440 1840 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 >Feature sequence326 1790 426 gene locus_tag LOCUS_08450 1790 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 >Feature sequence327 652 254 gene locus_tag LOCUS_08460 652 254 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_08460 1056 649 gene locus_tag LOCUS_08470 1056 649 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458951.1 protein_id gnl|my_center|LOCUS_08470 1661 1053 gene locus_tag LOCUS_08480 1661 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 >Feature sequence328 1247 774 gene locus_tag LOCUS_08490 1247 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 >Feature sequence329 <1873 168 gene locus_tag LOCUS_08500 <1873 168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804353.1:potassium transporter >Feature sequence330 326 1066 gene locus_tag LOCUS_08510 326 1066 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73J56 protein_id gnl|my_center|LOCUS_08510 1620 1018 gene locus_tag LOCUS_08520 1620 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 >Feature sequence331 931 473 gene locus_tag LOCUS_08530 931 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 <1858 928 gene locus_tag LOCUS_08540 <1858 928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001255158.1:flagellar protein export ATPase FliI >Feature sequence332 <1856 658 gene locus_tag LOCUS_08550 <1856 658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119047.1:alcohol dehydrogenase >Feature sequence333 644 225 gene locus_tag LOCUS_08560 644 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 952 641 gene locus_tag LOCUS_08570 952 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 1464 949 gene locus_tag LOCUS_08580 1464 949 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118368.1 protein_id gnl|my_center|LOCUS_08580 >Feature sequence334 >Feature sequence335 <1850 635 gene locus_tag LOCUS_08590 <1850 635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919291.1:adenylate cyclase >Feature sequence336 >Feature sequence337 929 303 gene locus_tag LOCUS_08600 929 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 1158 973 gene locus_tag LOCUS_08610 1158 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 1498 >1848 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttagcttgcggacaggccttgtttaaacacta >Feature sequence338 1472 822 gene locus_tag LOCUS_08620 1472 822 CDS product putative phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705604.1 protein_id gnl|my_center|LOCUS_08620 1581 1733 gene locus_tag LOCUS_08630 1581 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 >Feature sequence339 823 104 gene locus_tag LOCUS_08640 gene ispD 823 104 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HPT2 protein_id gnl|my_center|LOCUS_08640 1553 837 gene locus_tag LOCUS_08650 gene pyrF 1553 837 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654067.1 protein_id gnl|my_center|LOCUS_08650 >Feature sequence340 <1 1066 gene locus_tag LOCUS_08660 <1 1066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267302.1:helicase >Feature sequence341 766 1713 gene locus_tag LOCUS_08670 gene uppP2 766 1713 CDS product undecaprenyl-diphosphatase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTE2 protein_id gnl|my_center|LOCUS_08670 >Feature sequence342 478 1338 gene locus_tag LOCUS_08680 478 1338 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099029.1 protein_id gnl|my_center|LOCUS_08680 >Feature sequence343 726 130 gene locus_tag LOCUS_08690 726 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 1504 719 gene locus_tag LOCUS_08700 1504 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 >Feature sequence344 >Feature sequence345 707 231 gene locus_tag LOCUS_08710 707 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 <1804 785 gene locus_tag LOCUS_08720 <1804 785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261760.1:phosphotransferase >Feature sequence346 >Feature sequence347 <1 1521 gene locus_tag LOCUS_08730 <1 1521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020571.1:DNA mismatch repair protein >Feature sequence348 <1796 640 gene locus_tag LOCUS_08740 <1796 640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O67030:tRNA modification GTPase MnmE >Feature sequence349 1548 517 gene locus_tag LOCUS_08750 1548 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 >Feature sequence350 <1792 1140 gene locus_tag LOCUS_08760 <1792 1140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015706057.1:membrane protein >Feature sequence351 >Feature sequence352 1505 327 gene locus_tag LOCUS_08770 1505 327 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887074.1 protein_id gnl|my_center|LOCUS_08770 >Feature sequence353 1187 648 gene locus_tag LOCUS_08780 1187 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 >Feature sequence354 <1 505 gene locus_tag LOCUS_08790 <1 505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O84498:transcription termination factor Rho >Feature sequence355 1677 139 gene locus_tag LOCUS_08800 gene paaK-2 1677 139 CDS product phenylacetate-coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CD7 protein_id gnl|my_center|LOCUS_08800 >Feature sequence356 >Feature sequence357 >Feature sequence358 277 1650 gene locus_tag LOCUS_08810 277 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 >Feature sequence359 1406 1696 gene locus_tag LOCUS_08820 1406 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 >Feature sequence360 >Feature sequence361 <1 634 gene locus_tag LOCUS_08830 <1 634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391478.1:GntR family transcriptional regulator >Feature sequence362 639 965 gene locus_tag LOCUS_08840 639 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 >Feature sequence363 193 1269 gene locus_tag LOCUS_08850 gene ugpC 193 1269 CDS product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QPU2 protein_id gnl|my_center|LOCUS_08850 >Feature sequence364 >Feature sequence365 >Feature sequence366 <1753 810 gene locus_tag LOCUS_08860 <1753 810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000651487.1:MFS transporter >Feature sequence367 298 876 gene locus_tag LOCUS_08870 298 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 1282 932 gene locus_tag LOCUS_08880 1282 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 >Feature sequence368 >Feature sequence369 >Feature sequence370 1437 970 gene locus_tag LOCUS_08890 1437 970 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933122.1 protein_id gnl|my_center|LOCUS_08890 >Feature sequence371 <1 1203 gene locus_tag LOCUS_08900 <1 1203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117793.1:acetylglucosamine-6-sulfatase 1457 1642 gene locus_tag LOCUS_08910 1457 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 >Feature sequence372 <1 877 gene locus_tag LOCUS_08920 <1 877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KG23:4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) 862 1713 gene locus_tag LOCUS_08930 862 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 >Feature sequence373 >Feature sequence374 >Feature sequence375 <1 1272 gene locus_tag LOCUS_08940 <1 1272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946472.1:helicase >Feature sequence376 206 1492 gene locus_tag LOCUS_08950 206 1492 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122793.1 protein_id gnl|my_center|LOCUS_08950 >Feature sequence377 <1727 137 gene locus_tag LOCUS_08960 <1727 137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000790938.1:thermitase >Feature sequence378 81 1487 gene locus_tag LOCUS_08970 gene argH 81 1487 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZY2 protein_id gnl|my_center|LOCUS_08970 >Feature sequence379 213 1394 gene locus_tag LOCUS_08980 gene nahK 213 1394 CDS product mucin desulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813305.1 protein_id gnl|my_center|LOCUS_08980 >Feature sequence380 >Feature sequence381 910 287 gene locus_tag LOCUS_08990 910 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 1218 1129 gene locus_tag LOCUS_t00170 1218 1129 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence382 1340 747 gene locus_tag LOCUS_09000 gene recR 1340 747 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMH0 protein_id gnl|my_center|LOCUS_09000 >Feature sequence383 <1 512 gene locus_tag LOCUS_09010 <1 512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940437.1:octaprenyl-diphosphate synthase 513 1166 gene locus_tag LOCUS_09020 513 1166 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005346.1 protein_id gnl|my_center|LOCUS_09020 1183 1662 gene locus_tag LOCUS_09030 1183 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 >Feature sequence384 >Feature sequence385 >Feature sequence386 1143 523 gene locus_tag LOCUS_09040 1143 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 1702 1280 gene locus_tag LOCUS_09050 1702 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 >Feature sequence387 <1702 974 gene locus_tag LOCUS_09060 <1702 974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000568473.1:NADH-quinone oxidoreductase subunit L >Feature sequence388 475 1197 gene locus_tag LOCUS_09070 gene cysH 475 1197 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CNZ6 protein_id gnl|my_center|LOCUS_09070 >Feature sequence389 36 899 gene locus_tag LOCUS_09080 36 899 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141322.1 protein_id gnl|my_center|LOCUS_09080 <1696 904 gene locus_tag LOCUS_09090 <1696 904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118984.1:transcriptional regulator >Feature sequence390 >Feature sequence391 >Feature sequence392 >Feature sequence393 >Feature sequence394 >Feature sequence395 1321 776 gene locus_tag LOCUS_09100 1321 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 >Feature sequence396 <1 1138 gene locus_tag LOCUS_09110 <1 1138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957671.1:acetyl-CoA acetyltransferase >Feature sequence397 1042 281 gene locus_tag LOCUS_09120 1042 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 <1654 1039 gene locus_tag LOCUS_09130 <1654 1039 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393521.1:xylulokinase >Feature sequence398 <1 559 gene locus_tag LOCUS_09140 <1 559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009889552.1:sodium:proton antiporter >Feature sequence399 >Feature sequence400 408 860 gene locus_tag LOCUS_09150 408 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 <1647 915 gene locus_tag LOCUS_09160 <1647 915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963877.1:thiamine pyrophosphokinase >Feature sequence401 <1 1110 gene locus_tag LOCUS_09170 <1 1110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3DJA2:adenylosuccinate lyase >Feature sequence402 >Feature sequence403 1152 436 gene locus_tag LOCUS_09180 1152 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 >Feature sequence404 132 1325 gene locus_tag LOCUS_09190 132 1325 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946586.1 protein_id gnl|my_center|LOCUS_09190 >Feature sequence405 <1 871 gene locus_tag LOCUS_09200 <1 871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122437.1:cytochrome CBB3 >Feature sequence406 >Feature sequence407 1343 60 gene locus_tag LOCUS_09210 1343 60 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272631.1 protein_id gnl|my_center|LOCUS_09210 >Feature sequence408 982 449 gene locus_tag LOCUS_09220 982 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 <1624 1002 gene locus_tag LOCUS_09230 <1624 1002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P23446:flagellar basal-body rod protein FlgG >Feature sequence409 478 867 gene locus_tag LOCUS_09240 478 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 >Feature sequence410 >Feature sequence411 >Feature sequence412 >Feature sequence413 <1 1122 gene locus_tag LOCUS_09250 <1 1122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8CNY4:trigger factor >Feature sequence414 426 70 gene locus_tag LOCUS_09260 426 70 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BD4 protein_id gnl|my_center|LOCUS_09260 <1598 504 gene locus_tag LOCUS_09270 <1598 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090850.1:ATP-dependent helicase >Feature sequence415 <1 1345 gene locus_tag LOCUS_09280 <1 1345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122518.1:sulfatase >Feature sequence416 950 174 gene locus_tag LOCUS_09290 950 174 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390199.1 protein_id gnl|my_center|LOCUS_09290 >Feature sequence417 >Feature sequence418 <1584 556 gene locus_tag LOCUS_09300 <1584 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WG80:ribosomal RNA small subunit methyltransferase H >Feature sequence419 >Feature sequence420 122 325 gene locus_tag LOCUS_09310 122 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 322 987 gene locus_tag LOCUS_09320 gene thiE1 322 987 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962598.1 protein_id gnl|my_center|LOCUS_09320 >Feature sequence421 >Feature sequence422 <1 640 gene locus_tag LOCUS_09330 <1 640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000971179.1:ATP-dependent Clp protease ATP-binding subunit ClpC 732 1148 gene locus_tag LOCUS_09340 gene ndk 732 1148 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJK7 protein_id gnl|my_center|LOCUS_09340 >Feature sequence423 >Feature sequence424 393 1550 gene locus_tag LOCUS_09350 393 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 >Feature sequence425 894 223 gene locus_tag LOCUS_09360 894 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 >Feature sequence426 >Feature sequence427 >Feature sequence428 368 117 gene locus_tag LOCUS_09370 368 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 1337 768 gene locus_tag LOCUS_09380 1337 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 >Feature sequence429 1441 821 gene locus_tag LOCUS_09390 1441 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 >Feature sequence430 1215 481 gene locus_tag LOCUS_09400 1215 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 1366 1217 gene locus_tag LOCUS_09410 1366 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 >Feature sequence431 728 12 gene locus_tag LOCUS_09420 728 12 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143673.1 protein_id gnl|my_center|LOCUS_09420 <1549 725 gene locus_tag LOCUS_09430 <1549 725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140783.1:carbohydrate kinase >Feature sequence432 <1 827 gene locus_tag LOCUS_09440 <1 827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814149.1:RNA degradosome polyphosphate kinase >Feature sequence433 243 1298 gene locus_tag LOCUS_09450 gene recA 243 1298 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58254 protein_id gnl|my_center|LOCUS_09450 >Feature sequence434 <1 619 gene locus_tag LOCUS_09460 <1 619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005901943.1:lipid-A-disaccharide synthase 1530 598 gene locus_tag LOCUS_09470 1530 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 >Feature sequence435 >Feature sequence436 >Feature sequence437 1499 285 gene locus_tag LOCUS_09480 1499 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 >Feature sequence438 >Feature sequence439 192 704 gene locus_tag LOCUS_09490 192 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 >Feature sequence440 177 476 gene locus_tag LOCUS_09500 177 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 485 937 gene locus_tag LOCUS_09510 485 937 CDS product flagellar protein FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKF5 protein_id gnl|my_center|LOCUS_09510 981 1283 gene locus_tag LOCUS_09520 981 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 >Feature sequence441 >Feature sequence442 <1505 216 gene locus_tag LOCUS_09530 <1505 216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RGY5:aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B >Feature sequence443 >Feature sequence444 >Feature sequence445 >Feature sequence446 722 1450 gene locus_tag LOCUS_09540 722 1450 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329136.1 protein_id gnl|my_center|LOCUS_09540 >Feature sequence447 >Feature sequence448 1057 278 gene locus_tag LOCUS_09550 1057 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 >Feature sequence449 602 306 gene locus_tag LOCUS_09560 602 306 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953396.1 protein_id gnl|my_center|LOCUS_09560 >Feature sequence450 1043 540 gene locus_tag LOCUS_09570 1043 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 >Feature sequence451 447 1070 gene locus_tag LOCUS_09580 447 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 >Feature sequence452 <1485 441 gene locus_tag LOCUS_09590 <1485 441 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545212.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence453 165 812 gene locus_tag LOCUS_09600 gene infC 165 812 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q728R6 protein_id gnl|my_center|LOCUS_09600 835 1206 gene locus_tag LOCUS_09610 gene crcB 835 1206 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U893 protein_id gnl|my_center|LOCUS_09610 >Feature sequence454 851 1357 gene locus_tag LOCUS_09620 851 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 >Feature sequence455 1175 375 gene locus_tag LOCUS_09630 gene lpxA 1175 375 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBR2 protein_id gnl|my_center|LOCUS_09630 1480 1199 gene locus_tag LOCUS_09640 1480 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 >Feature sequence456 715 1206 gene locus_tag LOCUS_09650 gene msrA 715 1206 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87JF2 protein_id gnl|my_center|LOCUS_09650 >Feature sequence457 <1478 967 gene locus_tag LOCUS_09660 <1478 967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011227988.1:transcriptional regulator >Feature sequence458 1412 657 gene locus_tag LOCUS_09670 1412 657 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933559.1 protein_id gnl|my_center|LOCUS_09670 >Feature sequence459 <1474 581 gene locus_tag LOCUS_09680 <1474 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A5HXP7:chromosomal replication initiator protein DnaA >Feature sequence460 >Feature sequence461 402 1043 gene locus_tag LOCUS_09690 402 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 >Feature sequence462 <1472 615 gene locus_tag LOCUS_09700 <1472 615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5F835:arginine--tRNA ligase >Feature sequence463 >Feature sequence464 >Feature sequence465 609 316 gene locus_tag LOCUS_09710 609 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 1197 613 gene locus_tag LOCUS_09720 gene pth 1197 613 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG54 protein_id gnl|my_center|LOCUS_09720 >Feature sequence466 >Feature sequence467 >Feature sequence468 <1461 399 gene locus_tag LOCUS_09730 <1461 399 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119047.1:alcohol dehydrogenase >Feature sequence469 >Feature sequence470 >Feature sequence471 <1 1154 gene locus_tag LOCUS_09740 <1 1154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9RSP3:threonine--tRNA ligase >Feature sequence472 617 333 gene locus_tag LOCUS_09750 gene clpS 617 333 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DET2 protein_id gnl|my_center|LOCUS_09750 >Feature sequence473 >Feature sequence474 >Feature sequence475 >Feature sequence476 >Feature sequence477 1309 152 gene locus_tag LOCUS_09760 1309 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 >Feature sequence478 >Feature sequence479 >Feature sequence480 828 1100 gene locus_tag LOCUS_09770 828 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 1157 1411 gene locus_tag LOCUS_09780 1157 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 >Feature sequence481 >Feature sequence482 393 1382 gene locus_tag LOCUS_09790 393 1382 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104885.1 protein_id gnl|my_center|LOCUS_09790 >Feature sequence483 <1 856 gene locus_tag LOCUS_09800 <1 856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NJR3:carbamoyl-phosphate synthase (glutamine-hydrolyzing) >Feature sequence484 <1425 695 gene locus_tag LOCUS_09810 <1425 695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004599366.1:cation:proton antiporter >Feature sequence485 <1424 310 gene locus_tag LOCUS_09820 <1424 310 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118902.1:UDP-N-acetyl-D-glucosamine dehydrogenase >Feature sequence486 >Feature sequence487 121 930 gene locus_tag LOCUS_09830 121 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 >Feature sequence488 >Feature sequence489 125 703 gene locus_tag LOCUS_09840 125 703 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140820.1 protein_id gnl|my_center|LOCUS_09840 >Feature sequence490 >Feature sequence491 >Feature sequence492 >Feature sequence493 <1413 229 gene locus_tag LOCUS_09850 <1413 229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117896.1:arylsulfatase >Feature sequence494 >Feature sequence495 >Feature sequence496 1 1161 gene locus_tag LOCUS_09860 1 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 >Feature sequence497 <1 1038 gene locus_tag LOCUS_09870 <1 1038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A9J2:uronate isomerase >Feature sequence498 >Feature sequence499 >Feature sequence500 <1 579 gene locus_tag LOCUS_09880 <1 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q97MC5:2-isopropylmalate synthase >Feature sequence501 668 204 gene locus_tag LOCUS_09890 668 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332434.1 protein_id gnl|my_center|LOCUS_09890 >Feature sequence502 382 1134 gene locus_tag LOCUS_09900 382 1134 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081998.1 protein_id gnl|my_center|LOCUS_09900 >Feature sequence503 3 1043 gene locus_tag LOCUS_09910 3 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 >Feature sequence504 1082 402 gene locus_tag LOCUS_09920 1082 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 >Feature sequence505 >Feature sequence506 1283 207 gene locus_tag LOCUS_09930 1283 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122219.1 protein_id gnl|my_center|LOCUS_09930 >Feature sequence507 627 214 gene locus_tag LOCUS_09940 627 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 1386 652 gene locus_tag LOCUS_09950 1386 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 >Feature sequence508 >Feature sequence509 273 839 gene locus_tag LOCUS_09960 273 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 >Feature sequence510 >Feature sequence511 >Feature sequence512 <1382 562 gene locus_tag LOCUS_09970 <1382 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RK07:riboflavin biosynthesis protein RibD >Feature sequence513 960 403 gene locus_tag LOCUS_09980 gene efp 960 403 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BH0 protein_id gnl|my_center|LOCUS_09980 >Feature sequence514 >Feature sequence515 <1 813 gene locus_tag LOCUS_09990 <1 813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NHD7:aminotransferase <1378 849 gene locus_tag LOCUS_10000 <1378 849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113380.1:AI-2E family transporter >Feature sequence516 >Feature sequence517 >Feature sequence518 1107 436 gene locus_tag LOCUS_10010 1107 436 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704884.1 protein_id gnl|my_center|LOCUS_10010 >Feature sequence519 >Feature sequence520 >Feature sequence521 >Feature sequence522 <1 1072 gene locus_tag LOCUS_10020 <1 1072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S2S3:cysteine desulfurase >Feature sequence523 1261 131 gene locus_tag LOCUS_10030 1261 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 >Feature sequence524 1060 386 gene locus_tag LOCUS_10040 1060 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 >Feature sequence525 3 296 gene locus_tag LOCUS_10050 3 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 <1346 284 gene locus_tag LOCUS_10060 <1346 284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZTY0:uroporphyrinogen decarboxylase >Feature sequence526 >Feature sequence527 <1 929 gene locus_tag LOCUS_10070 <1 929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003531053.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence528 696 358 gene locus_tag LOCUS_10080 gene glnB 696 358 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66513 protein_id gnl|my_center|LOCUS_10080 <1338 735 gene locus_tag LOCUS_10090 <1338 735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q88B15:ammonium transporter >Feature sequence529 784 377 gene locus_tag LOCUS_10100 gene azu 784 377 CDS product azurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMF6 protein_id gnl|my_center|LOCUS_10100 >Feature sequence530 >Feature sequence531 <1 1006 gene locus_tag LOCUS_10110 <1 1006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CPE1:S-adenosylmethionine synthase >Feature sequence532 204 719 gene locus_tag LOCUS_10120 204 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 >Feature sequence533 601 206 gene locus_tag LOCUS_10130 601 206 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141388.1 protein_id gnl|my_center|LOCUS_10130 <1335 598 gene locus_tag LOCUS_10140 <1335 598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707899.1:biopolymer transporter TonB >Feature sequence534 12 85 gene locus_tag LOCUS_t00180 12 85 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 546 103 gene locus_tag LOCUS_10150 546 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 743 564 gene locus_tag LOCUS_10160 743 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 >Feature sequence535 >Feature sequence536 >Feature sequence537 714 58 gene locus_tag LOCUS_10170 714 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 >Feature sequence538 >Feature sequence539 >Feature sequence540 759 352 gene locus_tag LOCUS_10180 gene yuxK 759 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40761 protein_id gnl|my_center|LOCUS_10180 864 1280 gene locus_tag LOCUS_10190 gene hisI 864 1280 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAY5 protein_id gnl|my_center|LOCUS_10190 >Feature sequence541 176 523 gene locus_tag LOCUS_10200 176 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 824 600 gene locus_tag LOCUS_10210 824 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 >Feature sequence542 983 270 gene locus_tag LOCUS_10220 gene phoB 983 270 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941763.1 protein_id gnl|my_center|LOCUS_10220 >Feature sequence543 >Feature sequence544 <1 879 gene locus_tag LOCUS_10230 <1 879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121660.1:arylsulfatase >Feature sequence545 >Feature sequence546 <1305 272 gene locus_tag LOCUS_10240 <1305 272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085377.1:serine peptidase >Feature sequence547 >Feature sequence548 <1 751 gene locus_tag LOCUS_10250 <1 751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RT64:pyruvate dehydrogenase E1 component subunit alpha >Feature sequence549 <1297 137 gene locus_tag LOCUS_10260 <1297 137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8F0W3:transcription elongation factor GreA >Feature sequence550 160 492 gene locus_tag LOCUS_10270 160 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 778 620 gene locus_tag LOCUS_10280 778 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 >Feature sequence551 >Feature sequence552 100 495 gene locus_tag LOCUS_10290 100 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 >Feature sequence553 133 1023 gene locus_tag LOCUS_10300 133 1023 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941571.1 protein_id gnl|my_center|LOCUS_10300 >Feature sequence554 <1281 778 gene locus_tag LOCUS_10310 <1281 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005775503.1:AraC family transcriptional regulator >Feature sequence555 941 93 gene locus_tag LOCUS_10320 gene kdsA 941 93 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZFK4 protein_id gnl|my_center|LOCUS_10320 >Feature sequence556 <1 508 gene locus_tag LOCUS_10330 <1 508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000198892.1:pyruvate dehydrogenase subunit beta 531 1265 gene locus_tag LOCUS_10340 531 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 >Feature sequence557 >Feature sequence558 225 1157 gene locus_tag LOCUS_10350 225 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962314.1 protein_id gnl|my_center|LOCUS_10350 >Feature sequence559 <1270 112 gene locus_tag LOCUS_10360 <1270 112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000449765.1:anthranilate synthase component I >Feature sequence560 >Feature sequence561 874 452 gene locus_tag LOCUS_10370 874 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 >Feature sequence562 >Feature sequence563 341 682 gene locus_tag LOCUS_10380 341 682 CDS product stress responsive protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329772.1 protein_id gnl|my_center|LOCUS_10380 >Feature sequence564 245 1096 gene locus_tag LOCUS_10390 245 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 >Feature sequence565 >Feature sequence566 >Feature sequence567 992 27 gene locus_tag LOCUS_10400 gene accA 992 27 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DB5 protein_id gnl|my_center|LOCUS_10400 >Feature sequence568 >Feature sequence569 >Feature sequence570 267 1130 gene locus_tag LOCUS_10410 267 1130 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203172.1 protein_id gnl|my_center|LOCUS_10410 >Feature sequence571 1251 316 gene locus_tag LOCUS_10420 1251 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 >Feature sequence572 511 266 gene locus_tag LOCUS_10430 511 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 <1247 690 gene locus_tag LOCUS_10440 <1247 690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967826.1:mechanosensitive ion channel protein >Feature sequence573 >Feature sequence574 >Feature sequence575 1051 245 gene locus_tag LOCUS_10450 1051 245 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888F0 protein_id gnl|my_center|LOCUS_10450 >Feature sequence576 <1 561 gene locus_tag LOCUS_10460 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869365.1:carbon starvation protein A 999 586 gene locus_tag LOCUS_10470 999 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 >Feature sequence577 126 896 gene locus_tag LOCUS_10480 126 896 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLS4 protein_id gnl|my_center|LOCUS_10480 >Feature sequence578 >Feature sequence579 225 1226 gene locus_tag LOCUS_10490 gene rfaD 225 1226 CDS product ADP-L-glycero-D-manno-heptose-6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHY3 protein_id gnl|my_center|LOCUS_10490 >Feature sequence580 >Feature sequence581 >Feature sequence582 <1 698 gene locus_tag LOCUS_10500 <1 698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UGP4:endonuclease III >Feature sequence583 <1 663 gene locus_tag LOCUS_10510 <1 663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118043.1:cytochrome c >Feature sequence584 >Feature sequence585 >Feature sequence586 1 954 gene locus_tag LOCUS_10520 gene pilC 1 954 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_10520 >Feature sequence587 707 1021 gene locus_tag LOCUS_10530 707 1021 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228822.1 protein_id gnl|my_center|LOCUS_10530 >Feature sequence588 >Feature sequence589 >Feature sequence590 >Feature sequence591 524 324 gene locus_tag LOCUS_10540 524 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 >Feature sequence592 <1211 474 gene locus_tag LOCUS_10550 <1211 474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UG49:enoyl-[acyl-carrier-protein] reductase [NADH] >Feature sequence593 782 525 gene locus_tag LOCUS_10560 782 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 >Feature sequence594 >Feature sequence595 >Feature sequence596 <1199 62 gene locus_tag LOCUS_10570 <1199 62 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460435.1:NADH-quinone oxidoreductase subunit N >Feature sequence597 <1198 74 gene locus_tag LOCUS_10580 <1198 74 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964093.1:DNA recombination protein RmuC >Feature sequence598 <1 598 gene locus_tag LOCUS_10590 <1 598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117906.1:sulfatase >Feature sequence599 >Feature sequence600 790 632 gene locus_tag LOCUS_10600 790 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 1093 935 gene locus_tag LOCUS_10610 1093 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 >Feature sequence601 1040 78 gene locus_tag LOCUS_10620 gene rpsB 1040 78 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67809 protein_id gnl|my_center|LOCUS_10620 >Feature sequence602 <1 1147 gene locus_tag LOCUS_10630 <1 1147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941157.1:ATP-dependent protease >Feature sequence603 <1 924 gene locus_tag LOCUS_10640 <1 924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011402848.1:alpha/beta hydrolase >Feature sequence604 >Feature sequence605 1138 80 gene locus_tag LOCUS_10650 gene queA 1138 80 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1BA48 protein_id gnl|my_center|LOCUS_10650 >Feature sequence606 >Feature sequence607 >Feature sequence608 1062 658 gene locus_tag LOCUS_10660 1062 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 1171 1079 gene locus_tag LOCUS_t00190 1171 1079 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence609 381 136 gene locus_tag LOCUS_10670 381 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 559 365 gene locus_tag LOCUS_10680 559 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 >Feature sequence610 >Feature sequence611 >Feature sequence612 >Feature sequence613 <1 934 gene locus_tag LOCUS_10690 <1 934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119251.1:transporter >Feature sequence614 >Feature sequence615 >Feature sequence616 313 540 gene locus_tag LOCUS_10700 313 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 >Feature sequence617 <1 642 gene locus_tag LOCUS_10710 <1 642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000516556.1:sporulation initiation inhibitor Soj >Feature sequence618 <1 733 gene locus_tag LOCUS_10720 <1 733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O67085:P-protein 1152 730 gene locus_tag LOCUS_10730 1152 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 >Feature sequence619 1053 742 gene locus_tag LOCUS_10740 1053 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 >Feature sequence620 >Feature sequence621 3 749 gene locus_tag LOCUS_10750 3 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 742 990 gene locus_tag LOCUS_10760 742 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 >Feature sequence622 >Feature sequence623 <1144 377 gene locus_tag LOCUS_10770 <1144 377 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_345307.1:glycosyl transferase family 1 >Feature sequence624 <1142 190 gene locus_tag LOCUS_10780 <1142 190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203736.1:2,6-beta-D-fructofuranosidase >Feature sequence625 >Feature sequence626 <1 937 gene locus_tag LOCUS_10790 <1 937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q182U4:tryptophan--tRNA ligase >Feature sequence627 >Feature sequence628 >Feature sequence629 >Feature sequence630 >Feature sequence631 182 1117 gene locus_tag LOCUS_10800 182 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 >Feature sequence632 >Feature sequence633 >Feature sequence634 1 468 gene locus_tag LOCUS_10810 1 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 >Feature sequence635 >Feature sequence636 >Feature sequence637 >Feature sequence638 >Feature sequence639 >Feature sequence640 >Feature sequence641 <1 500 gene locus_tag LOCUS_10820 <1 500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022002.1:sodium/hydrogen exchanger <1110 562 gene locus_tag LOCUS_10830 <1110 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9Z7K8:elongation factor Ts >Feature sequence642 <1109 520 gene locus_tag LOCUS_10840 <1109 520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404676.1:Ysh1p: subunit of polyadenylation factor I >Feature sequence643 >Feature sequence644 <1108 152 gene locus_tag LOCUS_10850 <1108 152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533662.1:peptidoglycan-binding protein >Feature sequence645 >Feature sequence646 >Feature sequence647 >Feature sequence648 >Feature sequence649 >Feature sequence650 >Feature sequence651 >Feature sequence652 >Feature sequence653 >Feature sequence654 <1086 257 gene locus_tag LOCUS_10860 <1086 257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058116.1:GTP-binding protein >Feature sequence655 >Feature sequence656 <1081 486 gene locus_tag LOCUS_10870 <1081 486 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869334.1:aspartate--tRNA ligase >Feature sequence657 >Feature sequence658 299 604 gene locus_tag LOCUS_10880 299 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 597 881 gene locus_tag LOCUS_10890 597 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 >Feature sequence659 >Feature sequence660 >Feature sequence661 >Feature sequence662 >Feature sequence663 >Feature sequence664 >Feature sequence665 >Feature sequence666 >Feature sequence667 138 974 gene locus_tag LOCUS_10900 138 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 >Feature sequence668 719 369 gene locus_tag LOCUS_10910 719 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 >Feature sequence669 >Feature sequence670 >Feature sequence671 >Feature sequence672 >Feature sequence673 1021 491 gene locus_tag LOCUS_10920 1021 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 >Feature sequence674 >Feature sequence675 414 677 gene locus_tag LOCUS_10930 414 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 >Feature sequence676 >Feature sequence677 1 414 gene locus_tag LOCUS_10940 1 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 665 441 gene locus_tag LOCUS_10950 665 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 >Feature sequence678 <1 608 gene locus_tag LOCUS_10960 <1 608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003101612.1:hydrolase >Feature sequence679 1045 485 gene locus_tag LOCUS_10970 1045 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 >Feature sequence680 65 140 gene locus_tag LOCUS_t00200 65 140 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 582 148 gene locus_tag LOCUS_10980 gene atpC 582 148 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72E05 protein_id gnl|my_center|LOCUS_10980 >Feature sequence681 <1038 34 gene locus_tag LOCUS_10990 <1038 34 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A5I580:flagellar biosynthetic protein FliR >Feature sequence682 <1 945 gene locus_tag LOCUS_11000 <1 945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WI85:4-alpha-glucanotransferase >Feature sequence683 >Feature sequence684 >Feature sequence685 >Feature sequence686 >Feature sequence687 >Feature sequence688 >Feature sequence689 >Feature sequence690 >Feature sequence691 >Feature sequence692 >Feature sequence693 1026 250 gene locus_tag LOCUS_11010 1026 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 >Feature sequence694 >Feature sequence695 >Feature sequence696 >Feature sequence697 >Feature sequence698 587 663 gene locus_tag LOCUS_t00210 587 663 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence699 2 289 gene locus_tag LOCUS_11020 2 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 293 619 gene locus_tag LOCUS_11030 293 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 >Feature sequence700 >Feature sequence701 <1 902 gene locus_tag LOCUS_11040 <1 902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122595.1:cytochrome c >Feature sequence702 >Feature sequence703 >Feature sequence704 >Feature sequence705 >Feature sequence706 >Feature sequence707 104 544 gene locus_tag LOCUS_11050 104 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 >Feature sequence708 <1 634 gene locus_tag LOCUS_11060 <1 634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q83DI0:UDP-N-acetylglucosamine 1-carboxyvinyltransferase >Feature sequence709 >Feature sequence710