>Feature sequence001 1936 905 gene locus_tag LOCUS_00010 1936 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1952 2173 gene locus_tag LOCUS_00020 1952 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 4310 2964 gene locus_tag LOCUS_00030 4310 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121211.1 protein_id gnl|my_center|LOCUS_00030 6689 4377 gene locus_tag LOCUS_00040 6689 4377 CDS product filamin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121212.1 protein_id gnl|my_center|LOCUS_00040 7496 6771 gene locus_tag LOCUS_00050 7496 6771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 10900 7517 gene locus_tag LOCUS_00060 10900 7517 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121231.1 protein_id gnl|my_center|LOCUS_00060 11627 10905 gene locus_tag LOCUS_00070 gene lolD 11627 10905 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AT2 protein_id gnl|my_center|LOCUS_00070 12894 11620 gene locus_tag LOCUS_00080 gene ftsA 12894 11620 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122747.1 protein_id gnl|my_center|LOCUS_00080 13435 12905 gene locus_tag LOCUS_00090 13435 12905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 13969 13505 gene locus_tag LOCUS_00100 13969 13505 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121867.1 protein_id gnl|my_center|LOCUS_00100 15268 13973 gene locus_tag LOCUS_00110 15268 13973 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118182.1 protein_id gnl|my_center|LOCUS_00110 16530 15265 gene locus_tag LOCUS_00120 16530 15265 CDS product alkylhalidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117886.1 protein_id gnl|my_center|LOCUS_00120 17118 16561 gene locus_tag LOCUS_00130 17118 16561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 18472 17135 gene locus_tag LOCUS_00140 gene hemN 18472 17135 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120944.1 protein_id gnl|my_center|LOCUS_00140 19661 18492 gene locus_tag LOCUS_00150 19661 18492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 20881 19652 gene locus_tag LOCUS_00160 20881 19652 CDS product iron alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122942.1 protein_id gnl|my_center|LOCUS_00160 22350 20908 gene locus_tag LOCUS_00170 22350 20908 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122220.1 protein_id gnl|my_center|LOCUS_00170 23502 22414 gene locus_tag LOCUS_00180 23502 22414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122219.1 protein_id gnl|my_center|LOCUS_00180 25247 23535 gene locus_tag LOCUS_00190 25247 23535 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119651.1 protein_id gnl|my_center|LOCUS_00190 25510 25244 gene locus_tag LOCUS_00200 25510 25244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 27045 25513 gene locus_tag LOCUS_00210 27045 25513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 29247 27058 gene locus_tag LOCUS_00220 29247 27058 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121437.1 protein_id gnl|my_center|LOCUS_00220 29550 30056 gene locus_tag LOCUS_00230 gene marR 29550 30056 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546394.1 protein_id gnl|my_center|LOCUS_00230 31279 30053 gene locus_tag LOCUS_00240 gene adh 31279 30053 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123801.1 protein_id gnl|my_center|LOCUS_00240 31822 31304 gene locus_tag LOCUS_00250 31822 31304 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327230.1 protein_id gnl|my_center|LOCUS_00250 32195 33475 gene locus_tag LOCUS_00260 32195 33475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 35194 33791 gene locus_tag LOCUS_00270 35194 33791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 37082 35622 gene locus_tag LOCUS_00280 37082 35622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 38544 37207 gene locus_tag LOCUS_00290 38544 37207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 38828 40591 gene locus_tag LOCUS_00300 38828 40591 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_009278.2 protein_id gnl|my_center|LOCUS_00300 41280 40636 gene locus_tag LOCUS_00310 41280 40636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 41792 41424 gene locus_tag LOCUS_00320 41792 41424 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942008.1 protein_id gnl|my_center|LOCUS_00320 42549 41806 gene locus_tag LOCUS_00330 gene dtd3 42549 41806 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NI17 protein_id gnl|my_center|LOCUS_00330 42722 43651 gene locus_tag LOCUS_00340 gene trxB 42722 43651 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R7I9 protein_id gnl|my_center|LOCUS_00340 43652 45325 gene locus_tag LOCUS_00350 43652 45325 CDS product peptide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259368.1 protein_id gnl|my_center|LOCUS_00350 45322 46329 gene locus_tag LOCUS_00360 45322 46329 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118170.1 protein_id gnl|my_center|LOCUS_00360 46997 46326 gene locus_tag LOCUS_00370 46997 46326 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887660.1 protein_id gnl|my_center|LOCUS_00370 47175 48395 gene locus_tag LOCUS_00380 gene rumA 47175 48395 CDS product 23S rRNA (uracil-5-)-methyltransferase RumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546143.1 protein_id gnl|my_center|LOCUS_00380 48890 48408 gene locus_tag LOCUS_00390 48890 48408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 50056 49127 gene locus_tag LOCUS_00400 50056 49127 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143114.1 protein_id gnl|my_center|LOCUS_00400 50188 51288 gene locus_tag LOCUS_00410 gene hisC2 50188 51288 CDS product histidinol-phosphate aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ68 protein_id gnl|my_center|LOCUS_00410 51293 52609 gene locus_tag LOCUS_00420 51293 52609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 53783 52659 gene locus_tag LOCUS_00430 53783 52659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 54987 53851 gene locus_tag LOCUS_00440 54987 53851 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_345307.1 protein_id gnl|my_center|LOCUS_00440 62487 55015 gene locus_tag LOCUS_00450 62487 55015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 75046 62690 gene locus_tag LOCUS_00460 75046 62690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 79295 75507 gene locus_tag LOCUS_00470 79295 75507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 80744 79299 gene locus_tag LOCUS_00480 80744 79299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 82026 80761 gene locus_tag LOCUS_00490 82026 80761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 83825 82029 gene locus_tag LOCUS_00500 83825 82029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 84426 83896 gene locus_tag LOCUS_00510 84426 83896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 84664 85191 gene locus_tag LOCUS_00520 gene mutX 84664 85191 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59659 protein_id gnl|my_center|LOCUS_00520 88034 86067 gene locus_tag LOCUS_00530 gene manB 88034 86067 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104191.1 protein_id gnl|my_center|LOCUS_00530 89580 88150 gene locus_tag LOCUS_00540 89580 88150 CDS product UDP-N-acetylhexosamine pyrophosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 protein_id gnl|my_center|LOCUS_00540 89888 89577 gene locus_tag LOCUS_00550 89888 89577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 91843 90110 gene locus_tag LOCUS_00560 91843 90110 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957611.1 protein_id gnl|my_center|LOCUS_00560 93011 91923 gene locus_tag LOCUS_00570 93011 91923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785173.1 protein_id gnl|my_center|LOCUS_00570 94996 93065 gene locus_tag LOCUS_00580 gene gpi2 94996 93065 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330748.1 protein_id gnl|my_center|LOCUS_00580 95886 95005 gene locus_tag LOCUS_00590 95886 95005 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391331.1 protein_id gnl|my_center|LOCUS_00590 96528 96959 gene locus_tag LOCUS_00600 96528 96959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 97174 96953 gene locus_tag LOCUS_00610 97174 96953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 100086 97792 gene locus_tag LOCUS_00620 100086 97792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 100758 100123 gene locus_tag LOCUS_00630 100758 100123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 102036 100771 gene locus_tag LOCUS_00640 102036 100771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 104055 106064 gene locus_tag LOCUS_00650 104055 106064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 107292 106102 gene locus_tag LOCUS_00660 gene kamA 107292 106102 CDS product L-lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RHX4 protein_id gnl|my_center|LOCUS_00660 108096 107371 gene locus_tag LOCUS_00670 gene smuG1 108096 107371 CDS product single-strand selective monofunctional uracil DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122744.1 protein_id gnl|my_center|LOCUS_00670 109853 108093 gene locus_tag LOCUS_00680 109853 108093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 112566 112387 gene locus_tag LOCUS_00690 112566 112387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 112870 112691 gene locus_tag LOCUS_00700 112870 112691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 113023 113961 gene locus_tag LOCUS_00710 gene idh 113023 113961 CDS product myo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119305.1 protein_id gnl|my_center|LOCUS_00710 114059 115510 gene locus_tag LOCUS_00720 114059 115510 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227986.1 protein_id gnl|my_center|LOCUS_00720 115507 116589 gene locus_tag LOCUS_00730 115507 116589 CDS product 2-hydroxy-acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227985.1 protein_id gnl|my_center|LOCUS_00730 116841 116503 gene locus_tag LOCUS_00740 116841 116503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 117039 117854 gene locus_tag LOCUS_00750 117039 117854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 117993 118346 gene locus_tag LOCUS_00760 117993 118346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 118600 119766 gene locus_tag LOCUS_00770 gene dnaN 118600 119766 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O84078 protein_id gnl|my_center|LOCUS_00770 120602 119847 gene locus_tag LOCUS_00780 120602 119847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 120930 122129 gene locus_tag LOCUS_00790 gene moeA 120930 122129 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057204.1 protein_id gnl|my_center|LOCUS_00790 122227 122667 gene locus_tag LOCUS_00800 122227 122667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00800 122671 123276 gene locus_tag LOCUS_00810 122671 123276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00810 123276 123530 gene locus_tag LOCUS_00820 123276 123530 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057201.1 protein_id gnl|my_center|LOCUS_00820 123534 123989 gene locus_tag LOCUS_00830 gene moaE 123534 123989 CDS product molybdopterin-converting factor chain 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036203.1 protein_id gnl|my_center|LOCUS_00830 124044 125546 gene locus_tag LOCUS_00840 gene gnd 124044 125546 CDS product 6-phosphogluconate dehydrogenase, decarboxylating inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3XYQ5 protein_id gnl|my_center|LOCUS_00840 126016 125564 gene locus_tag LOCUS_00850 126016 125564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 128141 126741 gene locus_tag LOCUS_00860 gene miaB 128141 126741 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I2S3 protein_id gnl|my_center|LOCUS_00860 128548 128225 gene locus_tag LOCUS_00870 128548 128225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 128619 128834 gene locus_tag LOCUS_00880 128619 128834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 130058 129213 gene locus_tag LOCUS_00890 130058 129213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 130702 130058 gene locus_tag LOCUS_00900 130702 130058 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028708.1 protein_id gnl|my_center|LOCUS_00900 131436 132389 gene locus_tag LOCUS_00910 gene recA 131436 132389 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MBC8 protein_id gnl|my_center|LOCUS_00910 132409 133764 gene locus_tag LOCUS_00920 gene mnmE 132409 133764 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YLC5 protein_id gnl|my_center|LOCUS_00920 133761 135677 gene locus_tag LOCUS_00930 gene gidA2 133761 135677 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3XYK5 protein_id gnl|my_center|LOCUS_00930 135679 136281 gene locus_tag LOCUS_00940 135679 136281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 136716 137612 gene locus_tag LOCUS_00950 gene atpB 136716 137612 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGT0 protein_id gnl|my_center|LOCUS_00950 137696 137908 gene locus_tag LOCUS_00960 137696 137908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 137969 138517 gene locus_tag LOCUS_00970 gene atpF 137969 138517 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGS8 protein_id gnl|my_center|LOCUS_00970 138523 138921 gene locus_tag LOCUS_00980 138523 138921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 138965 140497 gene locus_tag LOCUS_00990 gene atpA2 138965 140497 CDS product ATP synthase subunit alpha 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZR99 protein_id gnl|my_center|LOCUS_00990 140545 141429 gene locus_tag LOCUS_01000 gene atpG 140545 141429 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQX9 protein_id gnl|my_center|LOCUS_01000 141468 142904 gene locus_tag LOCUS_01010 gene atpD 141468 142904 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLG8 protein_id gnl|my_center|LOCUS_01010 142911 143342 gene locus_tag LOCUS_01020 142911 143342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 143417 143492 gene locus_tag LOCUS_t00010 143417 143492 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence002 4496 2709 gene locus_tag LOCUS_01030 4496 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 6291 4711 gene locus_tag LOCUS_01040 6291 4711 CDS product 2,5-dioxovalerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038347.1 protein_id gnl|my_center|LOCUS_01040 7172 6333 gene locus_tag LOCUS_01050 gene hpaG 7172 6333 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122036.1 protein_id gnl|my_center|LOCUS_01050 7536 7225 gene locus_tag LOCUS_01060 7536 7225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 7616 8098 gene locus_tag LOCUS_01070 gene idnK 7616 8098 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMN3 protein_id gnl|my_center|LOCUS_01070 8106 8855 gene locus_tag LOCUS_01080 8106 8855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123725.1 protein_id gnl|my_center|LOCUS_01080 8852 9439 gene locus_tag LOCUS_01090 8852 9439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 10861 9830 gene locus_tag LOCUS_01100 10861 9830 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335012.1 protein_id gnl|my_center|LOCUS_01100 11928 11080 gene locus_tag LOCUS_01110 11928 11080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 13415 11925 gene locus_tag LOCUS_01120 gene uvrC 13415 11925 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPD6 protein_id gnl|my_center|LOCUS_01120 13472 14761 gene locus_tag LOCUS_01130 13472 14761 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812916.1 protein_id gnl|my_center|LOCUS_01130 14786 15916 gene locus_tag LOCUS_01140 14786 15916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 16052 16498 gene locus_tag LOCUS_01150 16052 16498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 16688 17650 gene locus_tag LOCUS_01160 16688 17650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 17727 18116 gene locus_tag LOCUS_01170 17727 18116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 19060 18128 gene locus_tag LOCUS_01180 gene panE 19060 18128 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749Q9 protein_id gnl|my_center|LOCUS_01180 20690 19074 gene locus_tag LOCUS_01190 gene nadB 20690 19074 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C48 protein_id gnl|my_center|LOCUS_01190 21608 20703 gene locus_tag LOCUS_01200 gene panC 21608 20703 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X0G6 protein_id gnl|my_center|LOCUS_01200 23174 21657 gene locus_tag LOCUS_01210 gene proS 23174 21657 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGJ7 protein_id gnl|my_center|LOCUS_01210 23343 24617 gene locus_tag LOCUS_01220 gene eno 23343 24617 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0DM31 protein_id gnl|my_center|LOCUS_01220 24699 25901 gene locus_tag LOCUS_01230 24699 25901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 26521 25904 gene locus_tag LOCUS_01240 26521 25904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 26982 26548 gene locus_tag LOCUS_01250 26982 26548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 28440 26998 gene locus_tag LOCUS_01260 28440 26998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 29302 28448 gene locus_tag LOCUS_01270 29302 28448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 30279 29422 gene locus_tag LOCUS_01280 30279 29422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 31660 30575 gene locus_tag LOCUS_01290 31660 30575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 34790 31767 gene locus_tag LOCUS_01300 34790 31767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 38411 35184 gene locus_tag LOCUS_01310 38411 35184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 40176 38563 gene locus_tag LOCUS_01320 40176 38563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 42509 40173 gene locus_tag LOCUS_01330 42509 40173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 42657 43265 gene locus_tag LOCUS_01340 gene def 42657 43265 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SH6 protein_id gnl|my_center|LOCUS_01340 43274 43669 gene locus_tag LOCUS_01350 43274 43669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 45486 43663 gene locus_tag LOCUS_01360 45486 43663 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919618.1 protein_id gnl|my_center|LOCUS_01360 45879 46103 gene locus_tag LOCUS_01370 45879 46103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 49479 46225 gene locus_tag LOCUS_01380 gene nrdA 49479 46225 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MK29 protein_id gnl|my_center|LOCUS_01380 50607 49522 gene locus_tag LOCUS_01390 gene nrdB 50607 49522 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MK81 protein_id gnl|my_center|LOCUS_01390 51113 51730 gene locus_tag LOCUS_01400 gene sigW 51113 51730 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFL5 protein_id gnl|my_center|LOCUS_01400 51734 52135 gene locus_tag LOCUS_01410 51734 52135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 52132 52707 gene locus_tag LOCUS_01420 52132 52707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 54033 52723 gene locus_tag LOCUS_01430 gene folC 54033 52723 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965694.1 protein_id gnl|my_center|LOCUS_01430 54998 54078 gene locus_tag LOCUS_01440 gene accD 54998 54078 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJI7 protein_id gnl|my_center|LOCUS_01440 55561 55016 gene locus_tag LOCUS_01450 55561 55016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 56520 55747 gene locus_tag LOCUS_01460 gene truA 56520 55747 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q035B5 protein_id gnl|my_center|LOCUS_01460 56944 56522 gene locus_tag LOCUS_01470 56944 56522 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WT34 protein_id gnl|my_center|LOCUS_01470 57928 56951 gene locus_tag LOCUS_01480 gene manC 57928 56951 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403343.1 protein_id gnl|my_center|LOCUS_01480 60949 58076 gene locus_tag LOCUS_01490 60949 58076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 61183 62973 gene locus_tag LOCUS_01500 gene aspS 61183 62973 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32038 protein_id gnl|my_center|LOCUS_01500 63255 64820 gene locus_tag LOCUS_01510 63255 64820 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHH4 protein_id gnl|my_center|LOCUS_01510 64870 65208 gene locus_tag LOCUS_01520 gene glnB 64870 65208 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942480.1 protein_id gnl|my_center|LOCUS_01520 65422 67008 gene locus_tag LOCUS_01530 gene amt-1 65422 67008 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B15 protein_id gnl|my_center|LOCUS_01530 67043 67381 gene locus_tag LOCUS_01540 gene glnK 67043 67381 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941607.1 protein_id gnl|my_center|LOCUS_01540 67544 67882 gene locus_tag LOCUS_01550 gene glnB 67544 67882 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942480.1 protein_id gnl|my_center|LOCUS_01550 70185 67954 gene locus_tag LOCUS_01560 70185 67954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 70321 70989 gene locus_tag LOCUS_01570 70321 70989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 70986 72416 gene locus_tag LOCUS_01580 70986 72416 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403254.1 protein_id gnl|my_center|LOCUS_01580 72413 73609 gene locus_tag LOCUS_01590 72413 73609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 73606 76743 gene locus_tag LOCUS_01600 73606 76743 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_01600 77079 76780 gene locus_tag LOCUS_01610 gene ptsH 77079 76780 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198013.1 protein_id gnl|my_center|LOCUS_01610 78277 77645 gene locus_tag LOCUS_01620 gene pgsA 78277 77645 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942469.1 protein_id gnl|my_center|LOCUS_01620 78399 78896 gene locus_tag LOCUS_01630 gene coaD 78399 78896 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NPE0 protein_id gnl|my_center|LOCUS_01630 78927 80285 gene locus_tag LOCUS_01640 78927 80285 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651487.1 protein_id gnl|my_center|LOCUS_01640 80389 82254 gene locus_tag LOCUS_01650 80389 82254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 82321 83250 gene locus_tag LOCUS_01660 82321 83250 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036699.1 protein_id gnl|my_center|LOCUS_01660 85025 83256 gene locus_tag LOCUS_01670 gene ptsI 85025 83256 CDS product phosphoenolpyruvate-protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183J1 protein_id gnl|my_center|LOCUS_01670 85978 86838 gene locus_tag LOCUS_01680 gene pyrF 85978 86838 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SN8 protein_id gnl|my_center|LOCUS_01680 86835 87539 gene locus_tag LOCUS_01690 gene ispD 86835 87539 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8YAB5 protein_id gnl|my_center|LOCUS_01690 87536 88030 gene locus_tag LOCUS_01700 gene ispF 87536 88030 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWQ2 protein_id gnl|my_center|LOCUS_01700 88457 88023 gene locus_tag LOCUS_01710 88457 88023 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770040.1 protein_id gnl|my_center|LOCUS_01710 90989 88482 gene locus_tag LOCUS_01720 gene clpC 90989 88482 CDS product ATP-dependent Clp protease ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121080.1 protein_id gnl|my_center|LOCUS_01720 92090 91023 gene locus_tag LOCUS_01730 gene mcsB 92090 91023 CDS product protein-arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HPT7 protein_id gnl|my_center|LOCUS_01730 92647 92117 gene locus_tag LOCUS_01740 92647 92117 CDS product excinuclease Uvr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966468.1 protein_id gnl|my_center|LOCUS_01740 93656 92790 gene locus_tag LOCUS_01750 gene ilvE 93656 92790 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336792.1 protein_id gnl|my_center|LOCUS_01750 95658 93676 gene locus_tag LOCUS_01760 gene acsA 95658 93676 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNC6 protein_id gnl|my_center|LOCUS_01760 95742 96812 gene locus_tag LOCUS_01770 gene queA 95742 96812 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1BA48 protein_id gnl|my_center|LOCUS_01770 97456 96872 gene locus_tag LOCUS_01780 gene ruvC 97456 96872 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62HA7 protein_id gnl|my_center|LOCUS_01780 98273 97500 gene locus_tag LOCUS_01790 98273 97500 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MFA9 protein_id gnl|my_center|LOCUS_01790 99368 98295 gene locus_tag LOCUS_01800 gene recF 99368 98295 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG79 protein_id gnl|my_center|LOCUS_01800 100519 99365 gene locus_tag LOCUS_01810 100519 99365 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389780.1 protein_id gnl|my_center|LOCUS_01810 101262 100516 gene locus_tag LOCUS_01820 101262 100516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 101678 101259 gene locus_tag LOCUS_01830 101678 101259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140630.1 protein_id gnl|my_center|LOCUS_01830 102345 101737 gene locus_tag LOCUS_01840 102345 101737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 103026 102346 gene locus_tag LOCUS_01850 103026 102346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392134.1 protein_id gnl|my_center|LOCUS_01850 103494 103144 gene locus_tag LOCUS_01860 103494 103144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 105973 103574 gene locus_tag LOCUS_01870 105973 103574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 107064 106108 gene locus_tag LOCUS_01880 107064 106108 CDS product phosphate starvation-inducible protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545286.1 protein_id gnl|my_center|LOCUS_01880 107579 107079 gene locus_tag LOCUS_01890 107579 107079 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249819.1 protein_id gnl|my_center|LOCUS_01890 107800 109293 gene locus_tag LOCUS_01900 gene glgA2 107800 109293 CDS product glycogen synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747K8 protein_id gnl|my_center|LOCUS_01900 109369 111951 gene locus_tag LOCUS_01910 109369 111951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 114413 111990 gene locus_tag LOCUS_01920 114413 111990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 115007 119881 gene locus_tag LOCUS_01930 115007 119881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 122049 120172 gene locus_tag LOCUS_01940 122049 120172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 123574 122330 gene locus_tag LOCUS_01950 gene ycf84 123574 122330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143323.1 protein_id gnl|my_center|LOCUS_01950 124328 123582 gene locus_tag LOCUS_01960 gene kdsB 124328 123582 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MGP8 protein_id gnl|my_center|LOCUS_01960 124424 124765 gene locus_tag LOCUS_01970 gene moeB 124424 124765 CDS product rhodanese domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329766.1 protein_id gnl|my_center|LOCUS_01970 124818 126032 gene locus_tag LOCUS_01980 gene trpB1 124818 126032 CDS product tryptophan synthase beta chain 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66923 protein_id gnl|my_center|LOCUS_01980 126148 126921 gene locus_tag LOCUS_01990 126148 126921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564118.1 protein_id gnl|my_center|LOCUS_01990 127492 126932 gene locus_tag LOCUS_02000 gene lspA 127492 126932 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBI5 protein_id gnl|my_center|LOCUS_02000 128421 127504 gene locus_tag LOCUS_02010 128421 127504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 131262 128452 gene locus_tag LOCUS_02020 gene ileS 131262 128452 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46213 protein_id gnl|my_center|LOCUS_02020 131344 132408 gene locus_tag LOCUS_02030 gene yrbG 131344 132408 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210120.1 protein_id gnl|my_center|LOCUS_02030 133247 132432 gene locus_tag LOCUS_02040 gene tsf 133247 132432 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80700 protein_id gnl|my_center|LOCUS_02040 134327 133299 gene locus_tag LOCUS_02050 134327 133299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 134581 134657 gene locus_tag LOCUS_t00020 134581 134657 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 134789 135547 gene locus_tag LOCUS_02060 134789 135547 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879273.1 protein_id gnl|my_center|LOCUS_02060 135599 136033 gene locus_tag LOCUS_02070 gene aroQ 135599 136033 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52377 protein_id gnl|my_center|LOCUS_02070 137702 136086 gene locus_tag LOCUS_02080 137702 136086 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9FBN4 protein_id gnl|my_center|LOCUS_02080 138761 137742 gene locus_tag LOCUS_02090 138761 137742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 139491 138892 gene locus_tag LOCUS_02100 139491 138892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 140149 139511 gene locus_tag LOCUS_02110 gene rpoE 140149 139511 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XF4 protein_id gnl|my_center|LOCUS_02110 141041 140208 gene locus_tag LOCUS_02120 141041 140208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 142995 141559 gene locus_tag LOCUS_02130 142995 141559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 >Feature sequence003 580 1851 gene locus_tag LOCUS_02140 gene ndh 580 1851 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932061.1 protein_id gnl|my_center|LOCUS_02140 3802 1883 gene locus_tag LOCUS_02150 gene atsG 3802 1883 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121854.1 protein_id gnl|my_center|LOCUS_02150 3958 5442 gene locus_tag LOCUS_02160 3958 5442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 5480 7321 gene locus_tag LOCUS_02170 5480 7321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 7573 7331 gene locus_tag LOCUS_02180 7573 7331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 8615 7593 gene locus_tag LOCUS_02190 8615 7593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121407.1 protein_id gnl|my_center|LOCUS_02190 8746 10407 gene locus_tag LOCUS_02200 8746 10407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 10470 11693 gene locus_tag LOCUS_02210 10470 11693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117943.1 protein_id gnl|my_center|LOCUS_02210 11690 12778 gene locus_tag LOCUS_02220 11690 12778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 12838 14589 gene locus_tag LOCUS_02230 gene atsA 12838 14589 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122139.1 protein_id gnl|my_center|LOCUS_02230 14599 17529 gene locus_tag LOCUS_02240 14599 17529 CDS product L-sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117697.1 protein_id gnl|my_center|LOCUS_02240 18830 17526 gene locus_tag LOCUS_02250 18830 17526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123475.1 protein_id gnl|my_center|LOCUS_02250 22157 18912 gene locus_tag LOCUS_02260 22157 18912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 23733 22312 gene locus_tag LOCUS_02270 gene merA 23733 22312 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A0E4 protein_id gnl|my_center|LOCUS_02270 23732 25243 gene locus_tag LOCUS_02280 23732 25243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 25796 25251 gene locus_tag LOCUS_02290 25796 25251 CDS product 4-methyl-5(B-hydroxyethyl)-thiazole monophosphate biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143742.1 protein_id gnl|my_center|LOCUS_02290 26614 25793 gene locus_tag LOCUS_02300 26614 25793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 26738 28051 gene locus_tag LOCUS_02310 gene ugdH 26738 28051 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118525.1 protein_id gnl|my_center|LOCUS_02310 28150 28911 gene locus_tag LOCUS_02320 28150 28911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 29833 29003 gene locus_tag LOCUS_02330 gene rsmA 29833 29003 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z6K0 protein_id gnl|my_center|LOCUS_02330 30643 29849 gene locus_tag LOCUS_02340 gene trpC 30643 29849 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CG4 protein_id gnl|my_center|LOCUS_02340 30737 31369 gene locus_tag LOCUS_02350 30737 31369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 31470 32114 gene locus_tag LOCUS_02360 31470 32114 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338637.1 protein_id gnl|my_center|LOCUS_02360 32534 33259 gene locus_tag LOCUS_02370 32534 33259 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404835.1 protein_id gnl|my_center|LOCUS_02370 33322 36741 gene locus_tag LOCUS_02380 33322 36741 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256518.1 protein_id gnl|my_center|LOCUS_02380 36738 38156 gene locus_tag LOCUS_02390 36738 38156 CDS product polysulfide reductase chain C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404833.1 protein_id gnl|my_center|LOCUS_02390 38153 38707 gene locus_tag LOCUS_02400 38153 38707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02400 38709 39779 gene locus_tag LOCUS_02410 38709 39779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 39776 41077 gene locus_tag LOCUS_02420 39776 41077 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404830.1 protein_id gnl|my_center|LOCUS_02420 41070 41369 gene locus_tag LOCUS_02430 41070 41369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 41362 42909 gene locus_tag LOCUS_02440 41362 42909 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403101.1 protein_id gnl|my_center|LOCUS_02440 42913 43635 gene locus_tag LOCUS_02450 42913 43635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 43632 44297 gene locus_tag LOCUS_02460 43632 44297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 44520 45776 gene locus_tag LOCUS_02470 44520 45776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 45773 46954 gene locus_tag LOCUS_02480 45773 46954 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932892.1 protein_id gnl|my_center|LOCUS_02480 46963 48207 gene locus_tag LOCUS_02490 46963 48207 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946586.1 protein_id gnl|my_center|LOCUS_02490 48204 48896 gene locus_tag LOCUS_02500 gene lolD 48204 48896 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MI37 protein_id gnl|my_center|LOCUS_02500 49535 48918 gene locus_tag LOCUS_02510 gene ruvA 49535 48918 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FUI2 protein_id gnl|my_center|LOCUS_02510 50263 49532 gene locus_tag LOCUS_02520 gene dapB 50263 49532 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WP2 protein_id gnl|my_center|LOCUS_02520 51165 50275 gene locus_tag LOCUS_02530 51165 50275 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869742.1 protein_id gnl|my_center|LOCUS_02530 51241 53043 gene locus_tag LOCUS_02540 gene lepA 51241 53043 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGU4 protein_id gnl|my_center|LOCUS_02540 53040 54635 gene locus_tag LOCUS_02550 53040 54635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 54777 56342 gene locus_tag LOCUS_02560 54777 56342 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SIV3 protein_id gnl|my_center|LOCUS_02560 57236 56358 gene locus_tag LOCUS_02570 gene oleB 57236 56358 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071875.1 protein_id gnl|my_center|LOCUS_02570 58261 57233 gene locus_tag LOCUS_02580 gene fabH 58261 57233 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123917.1 protein_id gnl|my_center|LOCUS_02580 59082 58276 gene locus_tag LOCUS_02590 gene fabI 59082 58276 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UG49 protein_id gnl|my_center|LOCUS_02590 59541 59086 gene locus_tag LOCUS_02600 gene fabZ 59541 59086 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFL4 protein_id gnl|my_center|LOCUS_02600 61075 59570 gene locus_tag LOCUS_02610 61075 59570 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118315.1 protein_id gnl|my_center|LOCUS_02610 61178 62770 gene locus_tag LOCUS_02620 61178 62770 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121424.1 protein_id gnl|my_center|LOCUS_02620 62775 64574 gene locus_tag LOCUS_02630 62775 64574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 65695 64571 gene locus_tag LOCUS_02640 65695 64571 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109381.1 protein_id gnl|my_center|LOCUS_02640 66345 65752 gene locus_tag LOCUS_02650 66345 65752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 66598 67827 gene locus_tag LOCUS_02660 66598 67827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 67996 68958 gene locus_tag LOCUS_02670 67996 68958 CDS product glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107655.1 protein_id gnl|my_center|LOCUS_02670 70206 68968 gene locus_tag LOCUS_02680 gene adh 70206 68968 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123801.1 protein_id gnl|my_center|LOCUS_02680 70298 71113 gene locus_tag LOCUS_02690 70298 71113 CDS product tagatose 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328799.1 protein_id gnl|my_center|LOCUS_02690 72017 71121 gene locus_tag LOCUS_02700 72017 71121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 72241 73752 gene locus_tag LOCUS_02710 72241 73752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 73758 75692 gene locus_tag LOCUS_02720 73758 75692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 75793 77670 gene locus_tag LOCUS_02730 gene rpoD 75793 77670 CDS product RNA polymerase sigma factor SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67464 protein_id gnl|my_center|LOCUS_02730 77758 78048 gene locus_tag LOCUS_02740 77758 78048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 78489 78085 gene locus_tag LOCUS_02750 78489 78085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 78692 78486 gene locus_tag LOCUS_02760 78692 78486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 79300 78707 gene locus_tag LOCUS_02770 gene recR 79300 78707 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SHY0 protein_id gnl|my_center|LOCUS_02770 79622 79308 gene locus_tag LOCUS_02780 79622 79308 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRX1 protein_id gnl|my_center|LOCUS_02780 80616 79735 gene locus_tag LOCUS_02790 80616 79735 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902154.1 protein_id gnl|my_center|LOCUS_02790 80719 81216 gene locus_tag LOCUS_02800 80719 81216 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143166.1 protein_id gnl|my_center|LOCUS_02800 81222 82082 gene locus_tag LOCUS_02810 81222 82082 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 protein_id gnl|my_center|LOCUS_02810 82085 82624 gene locus_tag LOCUS_02820 82085 82624 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393596.1 protein_id gnl|my_center|LOCUS_02820 82624 83262 gene locus_tag LOCUS_02830 82624 83262 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920056.1 protein_id gnl|my_center|LOCUS_02830 84203 83259 gene locus_tag LOCUS_02840 gene ribF 84203 83259 CDS product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090212.1 protein_id gnl|my_center|LOCUS_02840 84934 84200 gene locus_tag LOCUS_02850 84934 84200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 85941 84931 gene locus_tag LOCUS_02860 85941 84931 CDS product phosphoesterase RecJ-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392566.1 protein_id gnl|my_center|LOCUS_02860 88642 86033 gene locus_tag LOCUS_02870 88642 86033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 89864 88617 gene locus_tag LOCUS_02880 89864 88617 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337450.1 protein_id gnl|my_center|LOCUS_02880 89964 91505 gene locus_tag LOCUS_02890 89964 91505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 92306 91515 gene locus_tag LOCUS_02900 92306 91515 CDS product iron ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014216.1 protein_id gnl|my_center|LOCUS_02900 92803 92330 gene locus_tag LOCUS_02910 92803 92330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007332.1 protein_id gnl|my_center|LOCUS_02910 92989 95382 gene locus_tag LOCUS_02920 92989 95382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 95402 96550 gene locus_tag LOCUS_02930 95402 96550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 96674 98083 gene locus_tag LOCUS_02940 96674 98083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 100098 98080 gene locus_tag LOCUS_02950 100098 98080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 105503 100095 gene locus_tag LOCUS_02960 105503 100095 CDS product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087210.1 protein_id gnl|my_center|LOCUS_02960 107077 105617 gene locus_tag LOCUS_02970 107077 105617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 107892 107146 gene locus_tag LOCUS_02980 107892 107146 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_02980 107977 108843 gene locus_tag LOCUS_02990 107977 108843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 109559 108840 gene locus_tag LOCUS_03000 109559 108840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 110721 109564 gene locus_tag LOCUS_03010 110721 109564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 115049 110742 gene locus_tag LOCUS_03020 115049 110742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 115023 115163 gene locus_tag LOCUS_03030 115023 115163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 115321 116256 gene locus_tag LOCUS_03040 115321 116256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 116279 116863 gene locus_tag LOCUS_03050 gene trpG 116279 116863 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943018.1 protein_id gnl|my_center|LOCUS_03050 117009 117338 gene locus_tag LOCUS_03060 117009 117338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 117322 117801 gene locus_tag LOCUS_03070 117322 117801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 117808 118152 gene locus_tag LOCUS_03080 117808 118152 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_03080 118137 119240 gene locus_tag LOCUS_03090 118137 119240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 119254 121287 gene locus_tag LOCUS_03100 119254 121287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 122584 121310 gene locus_tag LOCUS_03110 122584 121310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 123517 122612 gene locus_tag LOCUS_03120 gene cysD 123517 122612 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S508 protein_id gnl|my_center|LOCUS_03120 124146 123541 gene locus_tag LOCUS_03130 gene cysC 124146 123541 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAQ1 protein_id gnl|my_center|LOCUS_03130 124705 124232 gene locus_tag LOCUS_03140 124705 124232 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ST9 protein_id gnl|my_center|LOCUS_03140 124782 127277 gene locus_tag LOCUS_03150 124782 127277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 127543 127262 gene locus_tag LOCUS_03160 127543 127262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 128473 127610 gene locus_tag LOCUS_03170 128473 127610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933356.1 protein_id gnl|my_center|LOCUS_03170 129269 128484 gene locus_tag LOCUS_03180 gene map 129269 128484 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG27 protein_id gnl|my_center|LOCUS_03180 130310 129321 gene locus_tag LOCUS_03190 130310 129321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 130419 131102 gene locus_tag LOCUS_03200 130419 131102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141352.1 protein_id gnl|my_center|LOCUS_03200 131099 132325 gene locus_tag LOCUS_03210 131099 132325 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189724.1 protein_id gnl|my_center|LOCUS_03210 132322 132894 gene locus_tag LOCUS_03220 gene pabA 132322 132894 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601855.1 protein_id gnl|my_center|LOCUS_03220 132917 133645 gene locus_tag LOCUS_03230 132917 133645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 >Feature sequence004 193 966 gene locus_tag LOCUS_03240 193 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 1012 1929 gene locus_tag LOCUS_03250 1012 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 2240 2539 gene locus_tag LOCUS_03260 gene fdxA 2240 2539 CDS product ferredoxin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY07 protein_id gnl|my_center|LOCUS_03260 2959 2711 gene locus_tag LOCUS_03270 2959 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 4063 5235 gene locus_tag LOCUS_03280 4063 5235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 5324 6178 gene locus_tag LOCUS_03290 5324 6178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 6339 9212 gene locus_tag LOCUS_03300 gene tolB 6339 9212 CDS product TolB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120765.1 protein_id gnl|my_center|LOCUS_03300 9952 9242 gene locus_tag LOCUS_03310 9952 9242 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865376.1 protein_id gnl|my_center|LOCUS_03310 12111 9949 gene locus_tag LOCUS_03320 12111 9949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 13673 12351 gene locus_tag LOCUS_03330 gene xseA 13673 12351 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E765 protein_id gnl|my_center|LOCUS_03330 14334 13651 gene locus_tag LOCUS_03340 14334 13651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 14750 14403 gene locus_tag LOCUS_03350 14750 14403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 15057 15896 gene locus_tag LOCUS_03360 gene tyrA 15057 15896 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943244.1 protein_id gnl|my_center|LOCUS_03360 15922 17268 gene locus_tag LOCUS_03370 gene aroA 15922 17268 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QX9 protein_id gnl|my_center|LOCUS_03370 17265 17936 gene locus_tag LOCUS_03380 gene cmk 17265 17936 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFN6 protein_id gnl|my_center|LOCUS_03380 19063 18677 gene locus_tag LOCUS_03390 gene purE 19063 18677 CDS product phosphoribosylaminoimidazole carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DYW9 protein_id gnl|my_center|LOCUS_03390 20043 19060 gene locus_tag LOCUS_03400 gene purC 20043 19060 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUW7 protein_id gnl|my_center|LOCUS_03400 22396 20246 gene locus_tag LOCUS_03410 22396 20246 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787020.1 protein_id gnl|my_center|LOCUS_03410 22730 22804 gene locus_tag LOCUS_t00030 22730 22804 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 24275 22842 gene locus_tag LOCUS_03420 24275 22842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 26176 24395 gene locus_tag LOCUS_03430 26176 24395 CDS product putative ABC transporter, ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702154.1 protein_id gnl|my_center|LOCUS_03430 26247 26714 gene locus_tag LOCUS_03440 26247 26714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 28181 26727 gene locus_tag LOCUS_03450 28181 26727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 28711 28202 gene locus_tag LOCUS_03460 28711 28202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 31438 28736 gene locus_tag LOCUS_03470 gene citB 31438 28736 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWD2 protein_id gnl|my_center|LOCUS_03470 31966 31496 gene locus_tag LOCUS_03480 31966 31496 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080908.1 protein_id gnl|my_center|LOCUS_03480 32162 33334 gene locus_tag LOCUS_03490 gene tyrS 32162 33334 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYU8 protein_id gnl|my_center|LOCUS_03490 36662 33372 gene locus_tag LOCUS_03500 36662 33372 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P63 protein_id gnl|my_center|LOCUS_03500 37082 37005 gene locus_tag LOCUS_t00040 37082 37005 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 37752 39872 gene locus_tag LOCUS_03510 37752 39872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 39911 40654 gene locus_tag LOCUS_03520 39911 40654 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P62035 protein_id gnl|my_center|LOCUS_03520 40739 42544 gene locus_tag LOCUS_03530 gene metX 40739 42544 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UG04 protein_id gnl|my_center|LOCUS_03530 43443 42541 gene locus_tag LOCUS_03540 43443 42541 CDS product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704134.1 protein_id gnl|my_center|LOCUS_03540 44138 43521 gene locus_tag LOCUS_03550 44138 43521 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958411.1 protein_id gnl|my_center|LOCUS_03550 45187 44198 gene locus_tag LOCUS_03560 45187 44198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 45463 46629 gene locus_tag LOCUS_03570 45463 46629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 47463 46633 gene locus_tag LOCUS_03580 47463 46633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 48071 48484 gene locus_tag LOCUS_03590 48071 48484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 48789 48559 gene locus_tag LOCUS_03600 48789 48559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 49125 48859 gene locus_tag LOCUS_03610 49125 48859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 49449 51920 gene locus_tag LOCUS_03620 gene hrpB 49449 51920 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942482.1 protein_id gnl|my_center|LOCUS_03620 52016 52363 gene locus_tag LOCUS_03630 52016 52363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 52378 53928 gene locus_tag LOCUS_03640 gene zwf 52378 53928 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WE89 protein_id gnl|my_center|LOCUS_03640 53925 54923 gene locus_tag LOCUS_03650 53925 54923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 55271 54987 gene locus_tag LOCUS_03660 55271 54987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 57309 58406 gene locus_tag LOCUS_03670 57309 58406 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546821.1 protein_id gnl|my_center|LOCUS_03670 58524 59468 gene locus_tag LOCUS_03680 58524 59468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 59559 61856 gene locus_tag LOCUS_03690 gene prc 59559 61856 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104769.1 protein_id gnl|my_center|LOCUS_03690 62730 61867 gene locus_tag LOCUS_03700 gene prmC 62730 61867 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q727D9 protein_id gnl|my_center|LOCUS_03700 63880 62741 gene locus_tag LOCUS_03710 gene prfA 63880 62741 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFW0 protein_id gnl|my_center|LOCUS_03710 63934 64977 gene locus_tag LOCUS_03720 63934 64977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51040 protein_id gnl|my_center|LOCUS_03720 64994 67333 gene locus_tag LOCUS_03730 64994 67333 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930732.1 protein_id gnl|my_center|LOCUS_03730 67436 67951 gene locus_tag LOCUS_03740 67436 67951 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460661.1 protein_id gnl|my_center|LOCUS_03740 67948 68907 gene locus_tag LOCUS_03750 gene pyrB 67948 68907 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DP5 protein_id gnl|my_center|LOCUS_03750 68904 70190 gene locus_tag LOCUS_03760 gene pyrC 68904 70190 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK42 protein_id gnl|my_center|LOCUS_03760 70240 70959 gene locus_tag LOCUS_03770 70240 70959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 70961 71422 gene locus_tag LOCUS_03780 70961 71422 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931832.1 protein_id gnl|my_center|LOCUS_03780 72900 71386 gene locus_tag LOCUS_03790 72900 71386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 73073 73157 gene locus_tag LOCUS_t00050 73073 73157 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 74165 73194 gene locus_tag LOCUS_03800 74165 73194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 74717 74385 gene locus_tag LOCUS_03810 74717 74385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 74770 75111 gene locus_tag LOCUS_03820 74770 75111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 76199 75135 gene locus_tag LOCUS_03830 76199 75135 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903871.1 protein_id gnl|my_center|LOCUS_03830 76381 77097 gene locus_tag LOCUS_03840 76381 77097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 78056 77094 gene locus_tag LOCUS_03850 gene hemB 78056 77094 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLQ6 protein_id gnl|my_center|LOCUS_03850 78240 78593 gene locus_tag LOCUS_03860 78240 78593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 78653 80512 gene locus_tag LOCUS_03870 78653 80512 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_03870 80986 83508 gene locus_tag LOCUS_03880 gene gyrB 80986 83508 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z8R3 protein_id gnl|my_center|LOCUS_03880 83613 86231 gene locus_tag LOCUS_03890 83613 86231 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021593.1 protein_id gnl|my_center|LOCUS_03890 86895 86239 gene locus_tag LOCUS_03900 86895 86239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 86966 87730 gene locus_tag LOCUS_03910 86966 87730 CDS product histidinol phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257802.1 protein_id gnl|my_center|LOCUS_03910 88215 87715 gene locus_tag LOCUS_03920 88215 87715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 88476 88401 gene locus_tag LOCUS_t00060 88476 88401 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 88771 91287 gene locus_tag LOCUS_03930 88771 91287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 91290 91952 gene locus_tag LOCUS_03940 91290 91952 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267143.1 protein_id gnl|my_center|LOCUS_03940 91949 92398 gene locus_tag LOCUS_03950 91949 92398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 92430 93140 gene locus_tag LOCUS_03960 92430 93140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 93302 93377 gene locus_tag LOCUS_t00070 93302 93377 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 93429 94631 gene locus_tag LOCUS_03970 gene tuf 93429 94631 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMZ0 protein_id gnl|my_center|LOCUS_03970 94675 94750 gene locus_tag LOCUS_t00080 94675 94750 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 94781 94993 gene locus_tag LOCUS_03980 94781 94993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 94990 95565 gene locus_tag LOCUS_03990 gene nusG 94990 95565 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y1 protein_id gnl|my_center|LOCUS_03990 95582 96004 gene locus_tag LOCUS_04000 gene rplK 95582 96004 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085792.1 protein_id gnl|my_center|LOCUS_04000 96026 96718 gene locus_tag LOCUS_04010 gene rplA 96026 96718 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CYP6 protein_id gnl|my_center|LOCUS_04010 96737 97240 gene locus_tag LOCUS_04020 gene rplJ 96737 97240 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q727C9 protein_id gnl|my_center|LOCUS_04020 97370 97762 gene locus_tag LOCUS_04030 gene rplL 97370 97762 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y5 protein_id gnl|my_center|LOCUS_04030 97902 101687 gene locus_tag LOCUS_04040 gene rpoB 97902 101687 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B0B7N1 protein_id gnl|my_center|LOCUS_04040 101749 105849 gene locus_tag LOCUS_04050 gene rpoC 101749 105849 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z999 protein_id gnl|my_center|LOCUS_04050 105942 106319 gene locus_tag LOCUS_04060 gene rpsL 105942 106319 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG52 protein_id gnl|my_center|LOCUS_04060 106216 106431 gene locus_tag LOCUS_04070 106216 106431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 106443 106826 gene locus_tag LOCUS_04080 gene rpsG 106443 106826 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38526 protein_id gnl|my_center|LOCUS_04080 106924 109026 gene locus_tag LOCUS_04090 gene fusA 106924 109026 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFP4 protein_id gnl|my_center|LOCUS_04090 109054 109362 gene locus_tag LOCUS_04100 gene rpsJ 109054 109362 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV9 protein_id gnl|my_center|LOCUS_04100 109483 110136 gene locus_tag LOCUS_04110 gene rplC 109483 110136 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7K6 protein_id gnl|my_center|LOCUS_04110 110140 110781 gene locus_tag LOCUS_04120 gene rplD 110140 110781 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFP8 protein_id gnl|my_center|LOCUS_04120 110778 111068 gene locus_tag LOCUS_04130 gene rplW 110778 111068 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66433 protein_id gnl|my_center|LOCUS_04130 111156 111932 gene locus_tag LOCUS_04140 gene rplB 111156 111932 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CH7 protein_id gnl|my_center|LOCUS_04140 111954 112223 gene locus_tag LOCUS_04150 gene rpsS 111954 112223 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PLX5 protein_id gnl|my_center|LOCUS_04150 112589 113224 gene locus_tag LOCUS_04160 gene rpsC 112589 113224 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW6 protein_id gnl|my_center|LOCUS_04160 113237 113659 gene locus_tag LOCUS_04170 gene rplP 113237 113659 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7J9 protein_id gnl|my_center|LOCUS_04170 113676 113867 gene locus_tag LOCUS_04180 gene rpmC 113676 113867 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QG2 protein_id gnl|my_center|LOCUS_04180 113896 114153 gene locus_tag LOCUS_04190 gene rpsQ1 113896 114153 CDS product 30S ribosomal protein S17 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A485 protein_id gnl|my_center|LOCUS_04190 114200 114562 gene locus_tag LOCUS_04200 gene rplN 114200 114562 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q927L7 protein_id gnl|my_center|LOCUS_04200 114564 114821 gene locus_tag LOCUS_04210 114564 114821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 114842 115393 gene locus_tag LOCUS_04220 gene rplE 114842 115393 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38517 protein_id gnl|my_center|LOCUS_04220 115758 116156 gene locus_tag LOCUS_04230 gene rpsH 115758 116156 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WH80 protein_id gnl|my_center|LOCUS_04230 116163 116705 gene locus_tag LOCUS_04240 gene rplF 116163 116705 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4E9 protein_id gnl|my_center|LOCUS_04240 116716 117072 gene locus_tag LOCUS_04250 gene rplR 116716 117072 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG31 protein_id gnl|my_center|LOCUS_04250 117082 117723 gene locus_tag LOCUS_04260 117082 117723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 117713 118153 gene locus_tag LOCUS_04270 gene rplO 117713 118153 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749A6 protein_id gnl|my_center|LOCUS_04270 118190 119707 gene locus_tag LOCUS_04280 gene secY 118190 119707 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG28 protein_id gnl|my_center|LOCUS_04280 119736 120167 gene locus_tag LOCUS_04290 gene rpsM 119736 120167 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFS3 protein_id gnl|my_center|LOCUS_04290 >Feature sequence005 1914 505 gene locus_tag LOCUS_04300 1914 505 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_04300 2112 4142 gene locus_tag LOCUS_04310 2112 4142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 4219 6066 gene locus_tag LOCUS_04320 gene wbmC 4219 6066 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064738.1 protein_id gnl|my_center|LOCUS_04320 6063 7265 gene locus_tag LOCUS_04330 6063 7265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 7608 8327 gene locus_tag LOCUS_04340 7608 8327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 8681 10192 gene locus_tag LOCUS_04350 8681 10192 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117731.1 protein_id gnl|my_center|LOCUS_04350 10240 11427 gene locus_tag LOCUS_04360 10240 11427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117732.1 protein_id gnl|my_center|LOCUS_04360 11699 11421 gene locus_tag LOCUS_04370 11699 11421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 11838 12500 gene locus_tag LOCUS_04380 11838 12500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 13794 12553 gene locus_tag LOCUS_04390 13794 12553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 13987 15045 gene locus_tag LOCUS_04400 13987 15045 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKJ7 protein_id gnl|my_center|LOCUS_04400 15460 15993 gene locus_tag LOCUS_04410 15460 15993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 16046 16387 gene locus_tag LOCUS_04420 16046 16387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314414.1 protein_id gnl|my_center|LOCUS_04420 17196 16411 gene locus_tag LOCUS_04430 gene lpxA 17196 16411 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63T24 protein_id gnl|my_center|LOCUS_04430 18542 17202 gene locus_tag LOCUS_04440 gene lpxC/fabZ 18542 17202 CDS product bifunctional enzyme LpxC/FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBX0 protein_id gnl|my_center|LOCUS_04440 18640 18852 gene locus_tag LOCUS_04450 18640 18852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 20458 18902 gene locus_tag LOCUS_04460 20458 18902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 21235 20573 gene locus_tag LOCUS_04470 21235 20573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 22475 21510 gene locus_tag LOCUS_04480 gene aroE 22475 21510 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RI72 protein_id gnl|my_center|LOCUS_04480 23262 22435 gene locus_tag LOCUS_04490 23262 22435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 24059 23352 gene locus_tag LOCUS_04500 24059 23352 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811326.1 protein_id gnl|my_center|LOCUS_04500 24096 25001 gene locus_tag LOCUS_04510 24096 25001 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329773.1 protein_id gnl|my_center|LOCUS_04510 25796 25020 gene locus_tag LOCUS_04520 25796 25020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 28303 25793 gene locus_tag LOCUS_04530 28303 25793 CDS product alpha-1,4 glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKZ5 protein_id gnl|my_center|LOCUS_04530 29483 28326 gene locus_tag LOCUS_04540 gene galM 29483 28326 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ38 protein_id gnl|my_center|LOCUS_04540 31403 29565 gene locus_tag LOCUS_04550 gene mutL 31403 29565 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAX3 protein_id gnl|my_center|LOCUS_04550 31788 31522 gene locus_tag LOCUS_04560 31788 31522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 31957 32874 gene locus_tag LOCUS_04570 31957 32874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 33864 32881 gene locus_tag LOCUS_04580 gene tal 33864 32881 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63W00 protein_id gnl|my_center|LOCUS_04580 35012 33939 gene locus_tag LOCUS_04590 gene fbaA 35012 33939 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704732.1 protein_id gnl|my_center|LOCUS_04590 35609 35109 gene locus_tag LOCUS_04600 35609 35109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 35701 36117 gene locus_tag LOCUS_04610 35701 36117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 36386 36141 gene locus_tag LOCUS_04620 36386 36141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 36632 37870 gene locus_tag LOCUS_04630 36632 37870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 43350 37912 gene locus_tag LOCUS_04640 43350 37912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 43734 43650 gene locus_tag LOCUS_t00090 43734 43650 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 45342 43804 gene locus_tag LOCUS_04650 gene nuoN 45342 43804 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEC9 protein_id gnl|my_center|LOCUS_04650 46882 45344 gene locus_tag LOCUS_04660 46882 45344 CDS product NADH dehydrogenase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257846.1 protein_id gnl|my_center|LOCUS_04660 48719 46884 gene locus_tag LOCUS_04670 48719 46884 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460436.1 protein_id gnl|my_center|LOCUS_04670 49032 48721 gene locus_tag LOCUS_04680 gene nuoK 49032 48721 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CWD6 protein_id gnl|my_center|LOCUS_04680 49581 49033 gene locus_tag LOCUS_04690 gene nuoJ 49581 49033 CDS product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087674.1 protein_id gnl|my_center|LOCUS_04690 50142 49585 gene locus_tag LOCUS_04700 gene nuoI 50142 49585 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1Q5 protein_id gnl|my_center|LOCUS_04700 51262 50180 gene locus_tag LOCUS_04710 gene nuoH2 51262 50180 CDS product NADH-quinone oxidoreductase subunit H 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746T2 protein_id gnl|my_center|LOCUS_04710 53005 51287 gene locus_tag LOCUS_04720 gene nuoG 53005 51287 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403178.1 protein_id gnl|my_center|LOCUS_04720 54921 53002 gene locus_tag LOCUS_04730 54921 53002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 56170 54935 gene locus_tag LOCUS_04740 gene nuoD 56170 54935 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GA5 protein_id gnl|my_center|LOCUS_04740 56781 56167 gene locus_tag LOCUS_04750 56781 56167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 57312 56791 gene locus_tag LOCUS_04760 57312 56791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 57519 57608 gene locus_tag LOCUS_t00100 57519 57608 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 60884 57633 gene locus_tag LOCUS_04770 60884 57633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 61691 60987 gene locus_tag LOCUS_04780 61691 60987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 63333 62059 gene locus_tag LOCUS_04790 gene ftsZ 63333 62059 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK72 protein_id gnl|my_center|LOCUS_04790 64559 63363 gene locus_tag LOCUS_04800 gene ftsA 64559 63363 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG66 protein_id gnl|my_center|LOCUS_04800 65367 64567 gene locus_tag LOCUS_04810 65367 64567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 66419 65469 gene locus_tag LOCUS_04820 gene ddl 66419 65469 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFT1 protein_id gnl|my_center|LOCUS_04820 68629 66389 gene locus_tag LOCUS_04830 68629 66389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 69815 68679 gene locus_tag LOCUS_04840 gene murG 69815 68679 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VDZ2 protein_id gnl|my_center|LOCUS_04840 70954 69812 gene locus_tag LOCUS_04850 70954 69812 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460697.1 protein_id gnl|my_center|LOCUS_04850 71966 70980 gene locus_tag LOCUS_04860 71966 70980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 73299 72001 gene locus_tag LOCUS_04870 gene murD 73299 72001 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F6L6 protein_id gnl|my_center|LOCUS_04870 74413 73301 gene locus_tag LOCUS_04880 gene mraY 74413 73301 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9P5 protein_id gnl|my_center|LOCUS_04880 75804 74407 gene locus_tag LOCUS_04890 gene murF 75804 74407 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I7F9Q4 protein_id gnl|my_center|LOCUS_04890 77363 75804 gene locus_tag LOCUS_04900 gene murE 77363 75804 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK84 protein_id gnl|my_center|LOCUS_04900 79162 77360 gene locus_tag LOCUS_04910 79162 77360 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545621.1 protein_id gnl|my_center|LOCUS_04910 80492 79533 gene locus_tag LOCUS_04920 gene rsmH 80492 79533 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ5 protein_id gnl|my_center|LOCUS_04920 81080 80628 gene locus_tag LOCUS_04930 gene mraZ 81080 80628 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q039S3 protein_id gnl|my_center|LOCUS_04930 81259 82026 gene locus_tag LOCUS_04940 81259 82026 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393019.1 protein_id gnl|my_center|LOCUS_04940 84775 82031 gene locus_tag LOCUS_04950 84775 82031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 85640 84843 gene locus_tag LOCUS_04960 85640 84843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 87350 85674 gene locus_tag LOCUS_04970 87350 85674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 88215 87394 gene locus_tag LOCUS_04980 gene nadK 88215 87394 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRQ7 protein_id gnl|my_center|LOCUS_04980 89253 88309 gene locus_tag LOCUS_04990 gene miaA 89253 88309 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MBD2 protein_id gnl|my_center|LOCUS_04990 89908 89294 gene locus_tag LOCUS_05000 89908 89294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 90958 89945 gene locus_tag LOCUS_05010 gene trpA 90958 89945 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X4E8 protein_id gnl|my_center|LOCUS_05010 90842 92161 gene locus_tag LOCUS_05020 gene kdtA 90842 92161 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_05020 92367 93275 gene locus_tag LOCUS_05030 92367 93275 CDS product phosphonates-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016927.1 protein_id gnl|my_center|LOCUS_05030 93334 94062 gene locus_tag LOCUS_05040 gene phnC 93334 94062 CDS product phosphonates import ATP-binding protein PhnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73P71 protein_id gnl|my_center|LOCUS_05040 94059 94898 gene locus_tag LOCUS_05050 gene phnE 94059 94898 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191092.1 protein_id gnl|my_center|LOCUS_05050 95818 94895 gene locus_tag LOCUS_05060 95818 94895 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204290.1 protein_id gnl|my_center|LOCUS_05060 95852 95776 gene locus_tag LOCUS_t00110 95852 95776 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 97400 95922 gene locus_tag LOCUS_05070 97400 95922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 98098 97397 gene locus_tag LOCUS_05080 98098 97397 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I694 protein_id gnl|my_center|LOCUS_05080 98390 98956 gene locus_tag LOCUS_05090 98390 98956 CDS product ribosomal RNA small subunit methyltransferase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P856 protein_id gnl|my_center|LOCUS_05090 99697 98966 gene locus_tag LOCUS_05100 99697 98966 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73J56 protein_id gnl|my_center|LOCUS_05100 101433 99679 gene locus_tag LOCUS_05110 101433 99679 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096407.1 protein_id gnl|my_center|LOCUS_05110 102707 101451 gene locus_tag LOCUS_05120 102707 101451 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325333.1 protein_id gnl|my_center|LOCUS_05120 102867 104063 gene locus_tag LOCUS_05130 102867 104063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 104053 105033 gene locus_tag LOCUS_05140 104053 105033 CDS product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224650.1 protein_id gnl|my_center|LOCUS_05140 105071 106510 gene locus_tag LOCUS_05150 105071 106510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120502.1 protein_id gnl|my_center|LOCUS_05150 109922 106518 gene locus_tag LOCUS_05160 109922 106518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 110379 110011 gene locus_tag LOCUS_05170 gene rplS 110379 110011 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FJK8 protein_id gnl|my_center|LOCUS_05170 111074 110376 gene locus_tag LOCUS_05180 gene trmD 111074 110376 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2G4 protein_id gnl|my_center|LOCUS_05180 111912 111133 gene locus_tag LOCUS_05190 111912 111133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 112115 113218 gene locus_tag LOCUS_05200 gene ychF 112115 113218 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HAG1 protein_id gnl|my_center|LOCUS_05200 >Feature sequence006 88 828 gene locus_tag LOCUS_05210 88 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 836 3085 gene locus_tag LOCUS_05220 836 3085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 3092 4000 gene locus_tag LOCUS_05230 3092 4000 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791099.1 protein_id gnl|my_center|LOCUS_05230 4012 4944 gene locus_tag LOCUS_05240 4012 4944 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I583 protein_id gnl|my_center|LOCUS_05240 4975 5511 gene locus_tag LOCUS_05250 gene eco 4975 5511 CDS product ecotin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I088 protein_id gnl|my_center|LOCUS_05250 5570 5884 gene locus_tag LOCUS_05260 5570 5884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 6089 7480 gene locus_tag LOCUS_05270 6089 7480 CDS product DEAD/DEAH box family ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_05270 7541 7711 gene locus_tag LOCUS_05280 7541 7711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 7771 8697 gene locus_tag LOCUS_05290 7771 8697 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124073.1 protein_id gnl|my_center|LOCUS_05290 8725 9357 gene locus_tag LOCUS_05300 8725 9357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 9354 10856 gene locus_tag LOCUS_05310 9354 10856 CDS product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_05310 10972 12798 gene locus_tag LOCUS_05320 10972 12798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114297.1 protein_id gnl|my_center|LOCUS_05320 12884 15445 gene locus_tag LOCUS_05330 gene leuS 12884 15445 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q837N5 protein_id gnl|my_center|LOCUS_05330 15449 16288 gene locus_tag LOCUS_05340 gene lpxI 15449 16288 CDS product UDP-2,3-diacylglucosamine pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919776.1 protein_id gnl|my_center|LOCUS_05340 17537 16272 gene locus_tag LOCUS_05350 gene gci 17537 16272 CDS product D-galactarolactone cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CEQ8 protein_id gnl|my_center|LOCUS_05350 18299 17841 gene locus_tag LOCUS_05360 18299 17841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 18585 18292 gene locus_tag LOCUS_05370 gene clpS 18585 18292 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MLY4 protein_id gnl|my_center|LOCUS_05370 19985 18594 gene locus_tag LOCUS_05380 gene crtI 19985 18594 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118443.1 protein_id gnl|my_center|LOCUS_05380 20315 20058 gene locus_tag LOCUS_05390 20315 20058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 21584 20343 gene locus_tag LOCUS_05400 gene fabF 21584 20343 CDS product beta-ketoacyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118441.1 protein_id gnl|my_center|LOCUS_05400 23247 21667 gene locus_tag LOCUS_05410 23247 21667 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941974.1 protein_id gnl|my_center|LOCUS_05410 24082 23327 gene locus_tag LOCUS_05420 24082 23327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 25895 24393 gene locus_tag LOCUS_05430 25895 24393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122305.1 protein_id gnl|my_center|LOCUS_05430 28176 25879 gene locus_tag LOCUS_05440 28176 25879 CDS product cytochrome oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119647.1 protein_id gnl|my_center|LOCUS_05440 28355 28431 gene locus_tag LOCUS_t00120 28355 28431 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 30478 28547 gene locus_tag LOCUS_05450 30478 28547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 31921 30554 gene locus_tag LOCUS_05460 31921 30554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 31901 32077 gene locus_tag LOCUS_05470 31901 32077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 32122 33597 gene locus_tag LOCUS_05480 32122 33597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 34554 33625 gene locus_tag LOCUS_05490 34554 33625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 34941 34660 gene locus_tag LOCUS_05500 34941 34660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 35627 34992 gene locus_tag LOCUS_05510 35627 34992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 36526 35627 gene locus_tag LOCUS_05520 36526 35627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880994.1 protein_id gnl|my_center|LOCUS_05520 37341 36568 gene locus_tag LOCUS_05530 37341 36568 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390199.1 protein_id gnl|my_center|LOCUS_05530 38285 37338 gene locus_tag LOCUS_05540 38285 37338 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403123.1 protein_id gnl|my_center|LOCUS_05540 38580 39248 gene locus_tag LOCUS_05550 38580 39248 CDS product phosphoglycolate phosphatase, bacterial inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975723.1 protein_id gnl|my_center|LOCUS_05550 39297 41495 gene locus_tag LOCUS_05560 gene recD2 39297 41495 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DN4 protein_id gnl|my_center|LOCUS_05560 41492 43447 gene locus_tag LOCUS_05570 41492 43447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121017.1 protein_id gnl|my_center|LOCUS_05570 43671 43444 gene locus_tag LOCUS_05580 43671 43444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 43799 44224 gene locus_tag LOCUS_05590 43799 44224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 44226 45146 gene locus_tag LOCUS_05600 44226 45146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 45363 46829 gene locus_tag LOCUS_05610 45363 46829 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122594.1 protein_id gnl|my_center|LOCUS_05610 46850 47860 gene locus_tag LOCUS_05620 46850 47860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119567.1 protein_id gnl|my_center|LOCUS_05620 47863 49779 gene locus_tag LOCUS_05630 47863 49779 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119224.1 protein_id gnl|my_center|LOCUS_05630 51150 49786 gene locus_tag LOCUS_05640 51150 49786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 52204 51182 gene locus_tag LOCUS_05650 gene prfB 52204 51182 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1R5 protein_id gnl|my_center|LOCUS_05650 53074 52358 gene locus_tag LOCUS_05660 gene cysH 53074 52358 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z460 protein_id gnl|my_center|LOCUS_05660 53288 53878 gene locus_tag LOCUS_05670 gene gmhA 53288 53878 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNX7 protein_id gnl|my_center|LOCUS_05670 53889 55301 gene locus_tag LOCUS_05680 gene cca 53889 55301 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5D4 protein_id gnl|my_center|LOCUS_05680 55298 56191 gene locus_tag LOCUS_05690 55298 56191 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884430.1 protein_id gnl|my_center|LOCUS_05690 57026 56217 gene locus_tag LOCUS_05700 57026 56217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331802.1 protein_id gnl|my_center|LOCUS_05700 57483 57145 gene locus_tag LOCUS_05710 57483 57145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 57684 58697 gene locus_tag LOCUS_05720 gene asd 57684 58697 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q726Q8 protein_id gnl|my_center|LOCUS_05720 58780 59241 gene locus_tag LOCUS_05730 58780 59241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 59362 60237 gene locus_tag LOCUS_05740 59362 60237 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545798.1 protein_id gnl|my_center|LOCUS_05740 61324 60275 gene locus_tag LOCUS_05750 61324 60275 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392074.1 protein_id gnl|my_center|LOCUS_05750 61323 61517 gene locus_tag LOCUS_05760 61323 61517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 62253 61531 gene locus_tag LOCUS_05770 62253 61531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 63151 62291 gene locus_tag LOCUS_05780 63151 62291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 63974 63141 gene locus_tag LOCUS_05790 63974 63141 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269101.1 protein_id gnl|my_center|LOCUS_05790 64038 64406 gene locus_tag LOCUS_05800 64038 64406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 64527 66293 gene locus_tag LOCUS_05810 64527 66293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 66705 72977 gene locus_tag LOCUS_05820 66705 72977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 73055 73131 gene locus_tag LOCUS_t00130 73055 73131 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 <91457 73421 gene locus_tag LOCUS_05830 <91457 73421 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941413.1:fibronectin type III >Feature sequence007 1415 522 gene locus_tag LOCUS_05840 1415 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 3671 1431 gene locus_tag LOCUS_05850 3671 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 6328 3668 gene locus_tag LOCUS_05860 6328 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 8646 6325 gene locus_tag LOCUS_05870 8646 6325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 9579 8707 gene locus_tag LOCUS_05880 9579 8707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 12154 9557 gene locus_tag LOCUS_05890 12154 9557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 13535 12162 gene locus_tag LOCUS_05900 gene GALNS 13535 12162 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121931.1 protein_id gnl|my_center|LOCUS_05900 14313 13690 gene locus_tag LOCUS_05910 14313 13690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 14532 14329 gene locus_tag LOCUS_05920 14532 14329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 14834 14583 gene locus_tag LOCUS_05930 14834 14583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 15591 15097 gene locus_tag LOCUS_05940 15591 15097 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73LE0 protein_id gnl|my_center|LOCUS_05940 16399 15641 gene locus_tag LOCUS_05950 gene truC 16399 15641 CDS product tRNA pseudouridine synthase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTL4 protein_id gnl|my_center|LOCUS_05950 17529 16396 gene locus_tag LOCUS_05960 17529 16396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 18487 17573 gene locus_tag LOCUS_05970 18487 17573 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URI8 protein_id gnl|my_center|LOCUS_05970 20058 18487 gene locus_tag LOCUS_05980 20058 18487 CDS product Mn(2+) transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122489.1 protein_id gnl|my_center|LOCUS_05980 21534 20137 gene locus_tag LOCUS_05990 21534 20137 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_05990 22348 21536 gene locus_tag LOCUS_06000 22348 21536 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117794.1 protein_id gnl|my_center|LOCUS_06000 23141 22389 gene locus_tag LOCUS_06010 gene rph 23141 22389 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5T5 protein_id gnl|my_center|LOCUS_06010 24574 23213 gene locus_tag LOCUS_06020 24574 23213 CDS product Ysh1p: subunit of polyadenylation factor I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404676.1 protein_id gnl|my_center|LOCUS_06020 24999 24571 gene locus_tag LOCUS_06030 24999 24571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 25080 26651 gene locus_tag LOCUS_06040 gene purH 25080 26651 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFK6 protein_id gnl|my_center|LOCUS_06040 26731 27504 gene locus_tag LOCUS_06050 26731 27504 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705171.1 protein_id gnl|my_center|LOCUS_06050 27525 28901 gene locus_tag LOCUS_06060 27525 28901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404619.1 protein_id gnl|my_center|LOCUS_06060 29021 30250 gene locus_tag LOCUS_06070 gene adk 29021 30250 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXV7 protein_id gnl|my_center|LOCUS_06070 30288 31409 gene locus_tag LOCUS_06080 gene ampS 30288 31409 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654739.1 protein_id gnl|my_center|LOCUS_06080 31415 32425 gene locus_tag LOCUS_06090 31415 32425 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWC5 protein_id gnl|my_center|LOCUS_06090 32433 33383 gene locus_tag LOCUS_06100 32433 33383 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK53 protein_id gnl|my_center|LOCUS_06100 34280 33342 gene locus_tag LOCUS_06110 34280 33342 CDS product bifunctional 3-dehydroquinate synthase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545527.1 protein_id gnl|my_center|LOCUS_06110 34972 34277 gene locus_tag LOCUS_06120 34972 34277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 36856 35222 gene locus_tag LOCUS_06130 36856 35222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 38549 36969 gene locus_tag LOCUS_06140 gene pgi 38549 36969 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKY2 protein_id gnl|my_center|LOCUS_06140 40176 38554 gene locus_tag LOCUS_06150 gene ilvD 40176 38554 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF68 protein_id gnl|my_center|LOCUS_06150 40340 41416 gene locus_tag LOCUS_06160 gene pheA 40340 41416 CDS product P-protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67085 protein_id gnl|my_center|LOCUS_06160 41463 42635 gene locus_tag LOCUS_06170 41463 42635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 43383 42682 gene locus_tag LOCUS_06180 43383 42682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 43557 44588 gene locus_tag LOCUS_06190 43557 44588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123542.1 protein_id gnl|my_center|LOCUS_06190 44661 45641 gene locus_tag LOCUS_06200 44661 45641 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086447.1 protein_id gnl|my_center|LOCUS_06200 46157 45645 gene locus_tag LOCUS_06210 46157 45645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 47260 46214 gene locus_tag LOCUS_06220 47260 46214 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120389.1 protein_id gnl|my_center|LOCUS_06220 48371 47280 gene locus_tag LOCUS_06230 48371 47280 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_06230 49608 48412 gene locus_tag LOCUS_06240 49608 48412 CDS product hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 protein_id gnl|my_center|LOCUS_06240 50413 49625 gene locus_tag LOCUS_06250 50413 49625 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200881.1 protein_id gnl|my_center|LOCUS_06250 51264 50410 gene locus_tag LOCUS_06260 51264 50410 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338042.1 protein_id gnl|my_center|LOCUS_06260 52077 51292 gene locus_tag LOCUS_06270 52077 51292 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584118.1 protein_id gnl|my_center|LOCUS_06270 53754 52096 gene locus_tag LOCUS_06280 53754 52096 CDS product dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085758.1 protein_id gnl|my_center|LOCUS_06280 54486 53851 gene locus_tag LOCUS_06290 54486 53851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 55745 54483 gene locus_tag LOCUS_06300 gene fabB 55745 54483 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769613.1 protein_id gnl|my_center|LOCUS_06300 56475 55867 gene locus_tag LOCUS_06310 56475 55867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 57075 56629 gene locus_tag LOCUS_06320 57075 56629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 57410 57733 gene locus_tag LOCUS_06330 57410 57733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 59474 57744 gene locus_tag LOCUS_06340 59474 57744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 59558 59959 gene locus_tag LOCUS_06350 59558 59959 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X184 protein_id gnl|my_center|LOCUS_06350 59986 60420 gene locus_tag LOCUS_06360 59986 60420 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKF2 protein_id gnl|my_center|LOCUS_06360 60442 60876 gene locus_tag LOCUS_06370 60442 60876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 60937 62496 gene locus_tag LOCUS_06380 60937 62496 CDS product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B6C7 protein_id gnl|my_center|LOCUS_06380 62515 63561 gene locus_tag LOCUS_06390 gene fliG 62515 63561 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860698.1 protein_id gnl|my_center|LOCUS_06390 63548 64216 gene locus_tag LOCUS_06400 63548 64216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 64213 65535 gene locus_tag LOCUS_06410 64213 65535 CDS product EscN/YscN/HrcN family type III secretion system ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870076.1 protein_id gnl|my_center|LOCUS_06410 65532 66002 gene locus_tag LOCUS_06420 65532 66002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 65989 66636 gene locus_tag LOCUS_06430 65989 66636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 67035 67769 gene locus_tag LOCUS_06440 67035 67769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 67796 68233 gene locus_tag LOCUS_06450 67796 68233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 68265 69116 gene locus_tag LOCUS_06460 gene flgG 68265 69116 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23446 protein_id gnl|my_center|LOCUS_06460 69142 69675 gene locus_tag LOCUS_06470 69142 69675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 69693 70721 gene locus_tag LOCUS_06480 69693 70721 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183958.1 protein_id gnl|my_center|LOCUS_06480 70714 70962 gene locus_tag LOCUS_06490 70714 70962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 71088 71399 gene locus_tag LOCUS_06500 71088 71399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 71396 72151 gene locus_tag LOCUS_06510 71396 72151 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272500.1 protein_id gnl|my_center|LOCUS_06510 72169 72438 gene locus_tag LOCUS_06520 72169 72438 CDS product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392308.1 protein_id gnl|my_center|LOCUS_06520 72435 73196 gene locus_tag LOCUS_06530 gene fliR 72435 73196 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZE7 protein_id gnl|my_center|LOCUS_06530 73210 74313 gene locus_tag LOCUS_06540 gene flhB 73210 74313 CDS product flagellar biosynthetic protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35538 protein_id gnl|my_center|LOCUS_06540 74317 76554 gene locus_tag LOCUS_06550 gene flhA 74317 76554 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359159.1 protein_id gnl|my_center|LOCUS_06550 76572 77690 gene locus_tag LOCUS_06560 76572 77690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 78046 78873 gene locus_tag LOCUS_06570 gene rpsD 78046 78873 CDS product RNA polymerase sigma factor sigma-28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883005.1 protein_id gnl|my_center|LOCUS_06570 78885 79745 gene locus_tag LOCUS_06580 78885 79745 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389595.1 protein_id gnl|my_center|LOCUS_06580 79767 80636 gene locus_tag LOCUS_06590 79767 80636 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385167.1 protein_id gnl|my_center|LOCUS_06590 80633 80908 gene locus_tag LOCUS_06600 80633 80908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 81079 81840 gene locus_tag LOCUS_06610 81079 81840 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U631 protein_id gnl|my_center|LOCUS_06610 81869 82651 gene locus_tag LOCUS_06620 81869 82651 CDS product flagellar basal body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081929.1 protein_id gnl|my_center|LOCUS_06620 82651 83484 gene locus_tag LOCUS_06630 82651 83484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 83456 84124 gene locus_tag LOCUS_06640 gene flgH 83456 84124 CDS product flagellar L-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIX2 protein_id gnl|my_center|LOCUS_06640 84135 85244 gene locus_tag LOCUS_06650 gene flgI 84135 85244 CDS product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748F5 protein_id gnl|my_center|LOCUS_06650 85247 85567 gene locus_tag LOCUS_06660 85247 85567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 85554 86084 gene locus_tag LOCUS_06670 85554 86084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 86087 89149 gene locus_tag LOCUS_06680 86087 89149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 >Feature sequence008 856 2190 gene locus_tag LOCUS_06690 856 2190 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120406.1 protein_id gnl|my_center|LOCUS_06690 2499 3773 gene locus_tag LOCUS_06700 2499 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 3777 4649 gene locus_tag LOCUS_06710 3777 4649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 5929 4718 gene locus_tag LOCUS_06720 5929 4718 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118049.1 protein_id gnl|my_center|LOCUS_06720 6506 5973 gene locus_tag LOCUS_06730 6506 5973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 7327 6503 gene locus_tag LOCUS_06740 7327 6503 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230430.1 protein_id gnl|my_center|LOCUS_06740 7517 8446 gene locus_tag LOCUS_06750 7517 8446 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036050.1 protein_id gnl|my_center|LOCUS_06750 9421 8471 gene locus_tag LOCUS_06760 9421 8471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 9619 9840 gene locus_tag LOCUS_06770 9619 9840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 10042 10287 gene locus_tag LOCUS_06780 10042 10287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 11618 10266 gene locus_tag LOCUS_06790 gene arsA 11618 10266 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122622.1 protein_id gnl|my_center|LOCUS_06790 12531 11629 gene locus_tag LOCUS_06800 12531 11629 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119121.1 protein_id gnl|my_center|LOCUS_06800 12725 14089 gene locus_tag LOCUS_06810 12725 14089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074039.1 protein_id gnl|my_center|LOCUS_06810 14222 15058 gene locus_tag LOCUS_06820 14222 15058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 18722 15072 gene locus_tag LOCUS_06830 18722 15072 CDS product L-sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120793.1 protein_id gnl|my_center|LOCUS_06830 27874 18872 gene locus_tag LOCUS_06840 27874 18872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 29774 28371 gene locus_tag LOCUS_06850 29774 28371 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120737.1 protein_id gnl|my_center|LOCUS_06850 33832 29780 gene locus_tag LOCUS_06860 33832 29780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 33922 35010 gene locus_tag LOCUS_06870 33922 35010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 35083 36189 gene locus_tag LOCUS_06880 35083 36189 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121284.1 protein_id gnl|my_center|LOCUS_06880 36827 36186 gene locus_tag LOCUS_06890 36827 36186 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140007.1 protein_id gnl|my_center|LOCUS_06890 37694 36921 gene locus_tag LOCUS_06900 37694 36921 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121235.1 protein_id gnl|my_center|LOCUS_06900 39903 37738 gene locus_tag LOCUS_06910 39903 37738 CDS product catalase peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814129.1 protein_id gnl|my_center|LOCUS_06910 41692 40082 gene locus_tag LOCUS_06920 41692 40082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 41844 42950 gene locus_tag LOCUS_06930 gene mtnA 41844 42950 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6ULQ4 protein_id gnl|my_center|LOCUS_06930 42962 44938 gene locus_tag LOCUS_06940 42962 44938 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066909.1 protein_id gnl|my_center|LOCUS_06940 46677 44980 gene locus_tag LOCUS_06950 46677 44980 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819869.1 protein_id gnl|my_center|LOCUS_06950 48307 46700 gene locus_tag LOCUS_06960 48307 46700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 49397 48324 gene locus_tag LOCUS_06970 49397 48324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 50848 49451 gene locus_tag LOCUS_06980 50848 49451 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203533.1 protein_id gnl|my_center|LOCUS_06980 53868 50875 gene locus_tag LOCUS_06990 53868 50875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 53998 54861 gene locus_tag LOCUS_07000 53998 54861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 56249 54882 gene locus_tag LOCUS_07010 56249 54882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_07010 57627 56314 gene locus_tag LOCUS_07020 57627 56314 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123557.1 protein_id gnl|my_center|LOCUS_07020 59270 57639 gene locus_tag LOCUS_07030 59270 57639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 59381 60724 gene locus_tag LOCUS_07040 59381 60724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 62739 60721 gene locus_tag LOCUS_07050 62739 60721 CDS product thiol-disulfide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122176.1 protein_id gnl|my_center|LOCUS_07050 63633 62830 gene locus_tag LOCUS_07060 63633 62830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 63927 63670 gene locus_tag LOCUS_07070 63927 63670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 64402 63965 gene locus_tag LOCUS_07080 64402 63965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 65021 64602 gene locus_tag LOCUS_07090 65021 64602 CDS product cysteine desulfuration protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391222.1 protein_id gnl|my_center|LOCUS_07090 65154 65615 gene locus_tag LOCUS_07100 gene fur 65154 65615 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068305.1 protein_id gnl|my_center|LOCUS_07100 65637 67100 gene locus_tag LOCUS_07110 gene cysS 65637 67100 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MGC2 protein_id gnl|my_center|LOCUS_07110 67939 67112 gene locus_tag LOCUS_07120 67939 67112 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326598.1 protein_id gnl|my_center|LOCUS_07120 68135 67953 gene locus_tag LOCUS_07130 68135 67953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 69090 69497 gene locus_tag LOCUS_07140 69090 69497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 69676 70851 gene locus_tag LOCUS_07150 69676 70851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 70962 72002 gene locus_tag LOCUS_07160 70962 72002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 71999 75094 gene locus_tag LOCUS_07170 71999 75094 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790618.1 protein_id gnl|my_center|LOCUS_07170 77525 75105 gene locus_tag LOCUS_07180 77525 75105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 79025 77610 gene locus_tag LOCUS_07190 79025 77610 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118263.1 protein_id gnl|my_center|LOCUS_07190 79149 79862 gene locus_tag LOCUS_07200 79149 79862 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122635.1 protein_id gnl|my_center|LOCUS_07200 81296 79863 gene locus_tag LOCUS_07210 81296 79863 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118263.1 protein_id gnl|my_center|LOCUS_07210 81665 81330 gene locus_tag LOCUS_07220 81665 81330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122309.1 protein_id gnl|my_center|LOCUS_07220 83170 81821 gene locus_tag LOCUS_07230 gene GALNS 83170 81821 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121616.1 protein_id gnl|my_center|LOCUS_07230 >Feature sequence009 506 1357 gene locus_tag LOCUS_07240 506 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117736.1 protein_id gnl|my_center|LOCUS_07240 1375 1938 gene locus_tag LOCUS_07250 1375 1938 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122524.1 protein_id gnl|my_center|LOCUS_07250 1968 2774 gene locus_tag LOCUS_07260 1968 2774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 2787 4124 gene locus_tag LOCUS_07270 2787 4124 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119046.1 protein_id gnl|my_center|LOCUS_07270 5667 4135 gene locus_tag LOCUS_07280 5667 4135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 7908 5839 gene locus_tag LOCUS_07290 7908 5839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 9482 7926 gene locus_tag LOCUS_07300 9482 7926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 9733 9479 gene locus_tag LOCUS_07310 9733 9479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 10047 11312 gene locus_tag LOCUS_07320 10047 11312 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120681.1 protein_id gnl|my_center|LOCUS_07320 11383 13872 gene locus_tag LOCUS_07330 11383 13872 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120680.1 protein_id gnl|my_center|LOCUS_07330 13859 16849 gene locus_tag LOCUS_07340 13859 16849 CDS product surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_07340 16953 19796 gene locus_tag LOCUS_07350 16953 19796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 19914 20129 gene locus_tag LOCUS_07360 19914 20129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 21076 20174 gene locus_tag LOCUS_07370 21076 20174 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110480.1 protein_id gnl|my_center|LOCUS_07370 21664 22518 gene locus_tag LOCUS_07380 21664 22518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 23139 22549 gene locus_tag LOCUS_07390 23139 22549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 23213 23914 gene locus_tag LOCUS_07400 23213 23914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036017.1 protein_id gnl|my_center|LOCUS_07400 25555 23918 gene locus_tag LOCUS_07410 25555 23918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 27031 25706 gene locus_tag LOCUS_07420 27031 25706 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118427.1 protein_id gnl|my_center|LOCUS_07420 27155 29407 gene locus_tag LOCUS_07430 27155 29407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 30034 29444 gene locus_tag LOCUS_07440 gene gspG 30034 29444 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308483.1 protein_id gnl|my_center|LOCUS_07440 30497 30021 gene locus_tag LOCUS_07450 30497 30021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 30496 30651 gene locus_tag LOCUS_07460 30496 30651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 30648 31886 gene locus_tag LOCUS_07470 30648 31886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 32850 31897 gene locus_tag LOCUS_07480 32850 31897 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056968.1 protein_id gnl|my_center|LOCUS_07480 34264 32891 gene locus_tag LOCUS_07490 34264 32891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 34503 37925 gene locus_tag LOCUS_07500 34503 37925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 37922 38098 gene locus_tag LOCUS_07510 37922 38098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 38095 40350 gene locus_tag LOCUS_07520 38095 40350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 41714 40356 gene locus_tag LOCUS_07530 41714 40356 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_07530 41869 42261 gene locus_tag LOCUS_07540 41869 42261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933022.1 protein_id gnl|my_center|LOCUS_07540 42387 42312 gene locus_tag LOCUS_t00140 42387 42312 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 42740 44584 gene locus_tag LOCUS_07550 gene deaD 42740 44584 CDS product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EA75 protein_id gnl|my_center|LOCUS_07550 44634 48206 gene locus_tag LOCUS_07560 44634 48206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 48216 49547 gene locus_tag LOCUS_07570 48216 49547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_07570 49547 51067 gene locus_tag LOCUS_07580 49547 51067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 52057 51209 gene locus_tag LOCUS_07590 52057 51209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 53412 52147 gene locus_tag LOCUS_07600 53412 52147 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118167.1 protein_id gnl|my_center|LOCUS_07600 54433 53417 gene locus_tag LOCUS_07610 54433 53417 CDS product D-isomer specific 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064103.1 protein_id gnl|my_center|LOCUS_07610 54437 54823 gene locus_tag LOCUS_07620 54437 54823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056929.1 protein_id gnl|my_center|LOCUS_07620 54841 56004 gene locus_tag LOCUS_07630 54841 56004 CDS product 3-chlorobenzoate-3,4-dioxygenase dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122559.1 protein_id gnl|my_center|LOCUS_07630 56282 56488 gene locus_tag LOCUS_07640 56282 56488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 56780 57337 gene locus_tag LOCUS_07650 gene rpoE 56780 57337 CDS product RNA polymerase sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229256.1 protein_id gnl|my_center|LOCUS_07650 57433 58647 gene locus_tag LOCUS_07660 57433 58647 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258727.1 protein_id gnl|my_center|LOCUS_07660 59115 58660 gene locus_tag LOCUS_07670 59115 58660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 protein_id gnl|my_center|LOCUS_07670 60034 59186 gene locus_tag LOCUS_07680 60034 59186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 60335 60934 gene locus_tag LOCUS_07690 60335 60934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 60984 61499 gene locus_tag LOCUS_07700 60984 61499 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81E75 protein_id gnl|my_center|LOCUS_07700 61934 62836 gene locus_tag LOCUS_07710 61934 62836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 63035 63691 gene locus_tag LOCUS_07720 63035 63691 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 protein_id gnl|my_center|LOCUS_07720 63927 65129 gene locus_tag LOCUS_07730 63927 65129 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179969.1 protein_id gnl|my_center|LOCUS_07730 65163 65339 gene locus_tag LOCUS_07740 65163 65339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 65431 66240 gene locus_tag LOCUS_07750 65431 66240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 66594 67172 gene locus_tag LOCUS_07760 66594 67172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 67191 68429 gene locus_tag LOCUS_07770 67191 68429 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266740.1 protein_id gnl|my_center|LOCUS_07770 68501 69202 gene locus_tag LOCUS_07780 68501 69202 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942965.1 protein_id gnl|my_center|LOCUS_07780 69392 69210 gene locus_tag LOCUS_07790 69392 69210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 69429 70460 gene locus_tag LOCUS_07800 gene cfaA 69429 70460 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636703.2 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07800 70510 71307 gene locus_tag LOCUS_07810 70510 71307 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036519.1 protein_id gnl|my_center|LOCUS_07810 71304 72344 gene locus_tag LOCUS_07820 71304 72344 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942955.1 protein_id gnl|my_center|LOCUS_07820 72394 73677 gene locus_tag LOCUS_07830 72394 73677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120802.1 protein_id gnl|my_center|LOCUS_07830 73692 74384 gene locus_tag LOCUS_07840 73692 74384 CDS product amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022907.1 protein_id gnl|my_center|LOCUS_07840 75686 74403 gene locus_tag LOCUS_07850 75686 74403 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272631.1 protein_id gnl|my_center|LOCUS_07850 77245 75833 gene locus_tag LOCUS_07860 77245 75833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_07860 78392 77418 gene locus_tag LOCUS_07870 78392 77418 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F5D8 protein_id gnl|my_center|LOCUS_07870 79337 78465 gene locus_tag LOCUS_07880 79337 78465 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_07880 79529 81046 gene locus_tag LOCUS_07890 79529 81046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 >Feature sequence010 567 1334 gene locus_tag LOCUS_07900 567 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 1349 2515 gene locus_tag LOCUS_07910 1349 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119080.1 protein_id gnl|my_center|LOCUS_07910 2546 3166 gene locus_tag LOCUS_07920 2546 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 3227 4165 gene locus_tag LOCUS_07930 gene ftsY 3227 4165 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZS49 protein_id gnl|my_center|LOCUS_07930 4281 5402 gene locus_tag LOCUS_07940 gene aroB 4281 5402 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWN8 protein_id gnl|my_center|LOCUS_07940 5425 6042 gene locus_tag LOCUS_07950 5425 6042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 6039 6830 gene locus_tag LOCUS_07960 gene lpxA 6039 6830 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FS50 protein_id gnl|my_center|LOCUS_07960 6905 7282 gene locus_tag LOCUS_07970 6905 7282 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009348588.1 protein_id gnl|my_center|LOCUS_07970 7602 8219 gene locus_tag LOCUS_07980 7602 8219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 8216 8626 gene locus_tag LOCUS_07990 8216 8626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 9521 9216 gene locus_tag LOCUS_08000 9521 9216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 9662 11017 gene locus_tag LOCUS_08010 9662 11017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 11075 11881 gene locus_tag LOCUS_08020 11075 11881 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WK86 protein_id gnl|my_center|LOCUS_08020 11894 13045 gene locus_tag LOCUS_08030 11894 13045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 13050 13883 gene locus_tag LOCUS_08040 13050 13883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 14339 14043 gene locus_tag LOCUS_08050 14339 14043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 14287 15285 gene locus_tag LOCUS_08060 14287 15285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 15406 16326 gene locus_tag LOCUS_08070 gene pimF 15406 16326 CDS product putative glycosyltransferases inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMX5 protein_id gnl|my_center|LOCUS_08070 16316 17038 gene locus_tag LOCUS_08080 16316 17038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 18212 17070 gene locus_tag LOCUS_08090 18212 17070 CDS product dTDP-4-amino-4,6-dideoxy-D-glucose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950550.1 protein_id gnl|my_center|LOCUS_08090 19392 18331 gene locus_tag LOCUS_08100 19392 18331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 20804 19392 gene locus_tag LOCUS_08110 20804 19392 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532721.1 protein_id gnl|my_center|LOCUS_08110 22614 20794 gene locus_tag LOCUS_08120 22614 20794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 22808 22611 gene locus_tag LOCUS_08130 22808 22611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 25313 25552 gene locus_tag LOCUS_08140 25313 25552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 26243 27109 gene locus_tag LOCUS_08150 26243 27109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 27133 28188 gene locus_tag LOCUS_08160 gene rfbB 27133 28188 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C7J0 protein_id gnl|my_center|LOCUS_08160 28185 29060 gene locus_tag LOCUS_08170 gene rfbA 28185 29060 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32EG4 protein_id gnl|my_center|LOCUS_08170 29165 30376 gene locus_tag LOCUS_08180 gene metK 29165 30376 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPS4 protein_id gnl|my_center|LOCUS_08180 30400 31839 gene locus_tag LOCUS_08190 gene ahcY 30400 31839 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEG8 protein_id gnl|my_center|LOCUS_08190 31929 32918 gene locus_tag LOCUS_08200 31929 32918 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460894.1 protein_id gnl|my_center|LOCUS_08200 33239 33406 gene locus_tag LOCUS_08210 33239 33406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 35181 33580 gene locus_tag LOCUS_08220 35181 33580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 35864 35178 gene locus_tag LOCUS_08230 35864 35178 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706456.1 protein_id gnl|my_center|LOCUS_08230 36665 35877 gene locus_tag LOCUS_08240 gene yaaA 36665 35877 CDS product UPF0246 protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z9R5 protein_id gnl|my_center|LOCUS_08240 36687 37622 gene locus_tag LOCUS_08250 gene fdhD 36687 37622 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBW0 protein_id gnl|my_center|LOCUS_08250 37699 38547 gene locus_tag LOCUS_08260 37699 38547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 38554 38943 gene locus_tag LOCUS_08270 38554 38943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 38992 41292 gene locus_tag LOCUS_08280 38992 41292 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028088.1 protein_id gnl|my_center|LOCUS_08280 41306 42358 gene locus_tag LOCUS_08290 gene ctaA 41306 42358 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CZN9 protein_id gnl|my_center|LOCUS_08290 42454 42954 gene locus_tag LOCUS_08300 42454 42954 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118368.1 protein_id gnl|my_center|LOCUS_08300 42951 43277 gene locus_tag LOCUS_08310 42951 43277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 43274 43687 gene locus_tag LOCUS_08320 43274 43687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 43684 43935 gene locus_tag LOCUS_08330 43684 43935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 43935 44693 gene locus_tag LOCUS_08340 43935 44693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08340 44715 45305 gene locus_tag LOCUS_08350 44715 45305 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335819.1 protein_id gnl|my_center|LOCUS_08350 45309 46868 gene locus_tag LOCUS_08360 45309 46868 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_08360 46870 48354 gene locus_tag LOCUS_08370 46870 48354 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967807.1 protein_id gnl|my_center|LOCUS_08370 48359 48694 gene locus_tag LOCUS_08380 48359 48694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 48691 50508 gene locus_tag LOCUS_08390 48691 50508 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118364.1 protein_id gnl|my_center|LOCUS_08390 50632 53031 gene locus_tag LOCUS_08400 50632 53031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 53185 53736 gene locus_tag LOCUS_08410 53185 53736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 53815 54777 gene locus_tag LOCUS_08420 gene xerD 53815 54777 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46352 protein_id gnl|my_center|LOCUS_08420 54852 55094 gene locus_tag LOCUS_08430 gene purS 54852 55094 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92AN7 protein_id gnl|my_center|LOCUS_08430 55094 55930 gene locus_tag LOCUS_08440 55094 55930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 55937 56650 gene locus_tag LOCUS_08450 gene purQ 55937 56650 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S567 protein_id gnl|my_center|LOCUS_08450 56647 58977 gene locus_tag LOCUS_08460 gene purL 56647 58977 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P12042 protein_id gnl|my_center|LOCUS_08460 58985 60901 gene locus_tag LOCUS_08470 gene purF 58985 60901 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_08470 63335 61614 gene locus_tag LOCUS_08480 63335 61614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 66071 63366 gene locus_tag LOCUS_08490 gene glnD 66071 63366 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C55 protein_id gnl|my_center|LOCUS_08490 66633 67853 gene locus_tag LOCUS_08500 66633 67853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 67857 70553 gene locus_tag LOCUS_08510 67857 70553 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942486.1 protein_id gnl|my_center|LOCUS_08510 70597 71592 gene locus_tag LOCUS_08520 70597 71592 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734411.1 protein_id gnl|my_center|LOCUS_08520 71691 72239 gene locus_tag LOCUS_08530 71691 72239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 >Feature sequence011 <1 2698 gene locus_tag LOCUS_08540 <1 2698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682238.1:guanylate cyclase 3286 2708 gene locus_tag LOCUS_08550 3286 2708 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_08550 5827 3308 gene locus_tag LOCUS_08560 5827 3308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 6363 5824 gene locus_tag LOCUS_08570 6363 5824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 7229 6360 gene locus_tag LOCUS_08580 7229 6360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 8265 7240 gene locus_tag LOCUS_08590 gene mreB-1 8265 7240 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_08590 9257 8403 gene locus_tag LOCUS_08600 gene lgt 9257 8403 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7P2 protein_id gnl|my_center|LOCUS_08600 10366 9257 gene locus_tag LOCUS_08610 10366 9257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_08610 10565 11653 gene locus_tag LOCUS_08620 10565 11653 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460676.1 protein_id gnl|my_center|LOCUS_08620 12180 11686 gene locus_tag LOCUS_08630 12180 11686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 12614 12156 gene locus_tag LOCUS_08640 12614 12156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 14001 12616 gene locus_tag LOCUS_08650 gene accC 14001 12616 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048423.1 protein_id gnl|my_center|LOCUS_08650 14482 14015 gene locus_tag LOCUS_08660 gene accB 14482 14015 CDS product biotin carboxyl carrier protein of acetyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37799 protein_id gnl|my_center|LOCUS_08660 16976 14655 gene locus_tag LOCUS_08670 16976 14655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 18908 17046 gene locus_tag LOCUS_08680 18908 17046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 20548 18923 gene locus_tag LOCUS_08690 20548 18923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 21324 20545 gene locus_tag LOCUS_08700 gene gldF 21324 20545 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_08700 22421 21324 gene locus_tag LOCUS_08710 22421 21324 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_08710 23286 22498 gene locus_tag LOCUS_08720 gene coaX 23286 22498 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8N6 protein_id gnl|my_center|LOCUS_08720 24323 23283 gene locus_tag LOCUS_08730 gene birA 24323 23283 CDS product bifunctional ligase/repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HL18 protein_id gnl|my_center|LOCUS_08730 25281 24331 gene locus_tag LOCUS_08740 gene nadC 25281 24331 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880528.1 protein_id gnl|my_center|LOCUS_08740 26823 25282 gene locus_tag LOCUS_08750 gene purA 26823 25282 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CQK1 protein_id gnl|my_center|LOCUS_08750 28436 26889 gene locus_tag LOCUS_08760 gene guaB 28436 26889 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X168 protein_id gnl|my_center|LOCUS_08760 28945 29574 gene locus_tag LOCUS_08770 28945 29574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 29556 30839 gene locus_tag LOCUS_08780 gene menE 29556 30839 CDS product O-succinylbenzoic acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057063.1 protein_id gnl|my_center|LOCUS_08780 31429 30836 gene locus_tag LOCUS_08790 gene clpP 31429 30836 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4T6 protein_id gnl|my_center|LOCUS_08790 31895 31449 gene locus_tag LOCUS_08800 gene rpiB 31895 31449 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880713.1 protein_id gnl|my_center|LOCUS_08800 32540 31995 gene locus_tag LOCUS_08810 32540 31995 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770997.1 protein_id gnl|my_center|LOCUS_08810 33913 32543 gene locus_tag LOCUS_08820 33913 32543 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173864.1 protein_id gnl|my_center|LOCUS_08820 35337 33931 gene locus_tag LOCUS_08830 gene sufB 35337 33931 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224697.1 protein_id gnl|my_center|LOCUS_08830 36119 35364 gene locus_tag LOCUS_08840 36119 35364 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888738.1 protein_id gnl|my_center|LOCUS_08840 36594 36139 gene locus_tag LOCUS_08850 gene furR1 36594 36139 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880763.1 protein_id gnl|my_center|LOCUS_08850 36988 36728 gene locus_tag LOCUS_08860 36988 36728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 37167 38651 gene locus_tag LOCUS_08870 gene glyQS 37167 38651 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UEU9 protein_id gnl|my_center|LOCUS_08870 40381 38663 gene locus_tag LOCUS_08880 gene recJ 40381 38663 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_08880 43225 40436 gene locus_tag LOCUS_08890 gene secD 43225 40436 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971714.1 protein_id gnl|my_center|LOCUS_08890 43603 43256 gene locus_tag LOCUS_08900 43603 43256 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931759.1 protein_id gnl|my_center|LOCUS_08900 45081 43675 gene locus_tag LOCUS_08910 45081 43675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 45767 45162 gene locus_tag LOCUS_08920 45767 45162 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903191.1 protein_id gnl|my_center|LOCUS_08920 46506 46108 gene locus_tag LOCUS_08930 gene msrB 46506 46108 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UGX7 protein_id gnl|my_center|LOCUS_08930 47744 46524 gene locus_tag LOCUS_08940 gene rhlE 47744 46524 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E175 protein_id gnl|my_center|LOCUS_08940 47922 48656 gene locus_tag LOCUS_08950 47922 48656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 49048 48650 gene locus_tag LOCUS_08960 49048 48650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 50270 49284 gene locus_tag LOCUS_08970 50270 49284 CDS product mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023661.1 protein_id gnl|my_center|LOCUS_08970 51841 50438 gene locus_tag LOCUS_08980 51841 50438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 53056 51845 gene locus_tag LOCUS_08990 53056 51845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 54141 53053 gene locus_tag LOCUS_09000 54141 53053 CDS product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009940935.1 protein_id gnl|my_center|LOCUS_09000 55214 54138 gene locus_tag LOCUS_09010 gene pslL 55214 54138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003160261.1 protein_id gnl|my_center|LOCUS_09010 56268 55219 gene locus_tag LOCUS_09020 56268 55219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 56879 56265 gene locus_tag LOCUS_09030 56879 56265 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786661.1 protein_id gnl|my_center|LOCUS_09030 57790 56993 gene locus_tag LOCUS_09040 57790 56993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 58703 57861 gene locus_tag LOCUS_09050 58703 57861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118871.1 protein_id gnl|my_center|LOCUS_09050 60003 58708 gene locus_tag LOCUS_09060 60003 58708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 60576 60010 gene locus_tag LOCUS_09070 60576 60010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 61733 60573 gene locus_tag LOCUS_09080 61733 60573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 62718 61723 gene locus_tag LOCUS_09090 62718 61723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 63672 62881 gene locus_tag LOCUS_09100 63672 62881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 64367 63657 gene locus_tag LOCUS_09110 64367 63657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 65482 64523 gene locus_tag LOCUS_09120 65482 64523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 66706 65501 gene locus_tag LOCUS_09130 66706 65501 CDS product membrane-bound O-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379730.1 protein_id gnl|my_center|LOCUS_09130 >Feature sequence012 498 1967 gene locus_tag LOCUS_09140 gene gatB 498 1967 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGY5 protein_id gnl|my_center|LOCUS_09140 2100 2882 gene locus_tag LOCUS_09150 2100 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 2879 4309 gene locus_tag LOCUS_09160 2879 4309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 4296 4919 gene locus_tag LOCUS_09170 4296 4919 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069550.1 protein_id gnl|my_center|LOCUS_09170 4916 5317 gene locus_tag LOCUS_09180 4916 5317 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458951.1 protein_id gnl|my_center|LOCUS_09180 5328 5726 gene locus_tag LOCUS_09190 5328 5726 CDS product biopolymer transporter protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707897.1 protein_id gnl|my_center|LOCUS_09190 5731 6405 gene locus_tag LOCUS_09200 5731 6405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 6405 7814 gene locus_tag LOCUS_09210 6405 7814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 8121 7852 gene locus_tag LOCUS_09220 8121 7852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 8196 9497 gene locus_tag LOCUS_09230 8196 9497 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120406.1 protein_id gnl|my_center|LOCUS_09230 9565 11886 gene locus_tag LOCUS_09240 9565 11886 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_09240 12596 11883 gene locus_tag LOCUS_09250 gene menG 12596 11883 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4C2 protein_id gnl|my_center|LOCUS_09250 14187 12622 gene locus_tag LOCUS_09260 14187 12622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 14324 14680 gene locus_tag LOCUS_09270 gene ihfB 14324 14680 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXP8 protein_id gnl|my_center|LOCUS_09270 14709 16052 gene locus_tag LOCUS_09280 14709 16052 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903476.1 protein_id gnl|my_center|LOCUS_09280 16060 17004 gene locus_tag LOCUS_09290 gene yaeI 16060 17004 CDS product phosphodiesterase YaeI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37049 protein_id gnl|my_center|LOCUS_09290 17039 17728 gene locus_tag LOCUS_09300 gene aat 17039 17728 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H233 protein_id gnl|my_center|LOCUS_09300 19047 17737 gene locus_tag LOCUS_09310 19047 17737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 19397 19149 gene locus_tag LOCUS_09320 19397 19149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 19514 20248 gene locus_tag LOCUS_09330 19514 20248 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337281.1 protein_id gnl|my_center|LOCUS_09330 20279 23023 gene locus_tag LOCUS_09340 gene valS 20279 23023 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KC74 protein_id gnl|my_center|LOCUS_09340 23402 23034 gene locus_tag LOCUS_09350 23402 23034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 23511 23586 gene locus_tag LOCUS_t00150 23511 23586 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 23674 25497 gene locus_tag LOCUS_09360 23674 25497 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957983.1 protein_id gnl|my_center|LOCUS_09360 27812 25509 gene locus_tag LOCUS_09370 27812 25509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 29032 27833 gene locus_tag LOCUS_09380 29032 27833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 29251 29036 gene locus_tag LOCUS_09390 29251 29036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 29347 30816 gene locus_tag LOCUS_09400 29347 30816 CDS product L-fuculose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582815.1 protein_id gnl|my_center|LOCUS_09400 31045 30833 gene locus_tag LOCUS_09410 31045 30833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 31764 31219 gene locus_tag LOCUS_09420 31764 31219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263795.1 protein_id gnl|my_center|LOCUS_09420 33029 32025 gene locus_tag LOCUS_09430 33029 32025 CDS product trans-2-enoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893529.1 protein_id gnl|my_center|LOCUS_09430 33135 35249 gene locus_tag LOCUS_09440 33135 35249 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888294.1 protein_id gnl|my_center|LOCUS_09440 35278 35664 gene locus_tag LOCUS_09450 35278 35664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 35661 36602 gene locus_tag LOCUS_09460 35661 36602 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403526.1 protein_id gnl|my_center|LOCUS_09460 36693 37973 gene locus_tag LOCUS_09470 gene proA 36693 37973 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKZ6 protein_id gnl|my_center|LOCUS_09470 37970 38509 gene locus_tag LOCUS_09480 37970 38509 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329717.1 protein_id gnl|my_center|LOCUS_09480 38511 39845 gene locus_tag LOCUS_09490 38511 39845 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLG1 protein_id gnl|my_center|LOCUS_09490 40756 39851 gene locus_tag LOCUS_09500 40756 39851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 40906 42282 gene locus_tag LOCUS_09510 40906 42282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 42345 43556 gene locus_tag LOCUS_09520 gene adh 42345 43556 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123801.1 protein_id gnl|my_center|LOCUS_09520 43560 44891 gene locus_tag LOCUS_09530 43560 44891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123104.1 protein_id gnl|my_center|LOCUS_09530 45018 45413 gene locus_tag LOCUS_09540 45018 45413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 46734 45478 gene locus_tag LOCUS_09550 46734 45478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121732.1 protein_id gnl|my_center|LOCUS_09550 46854 48452 gene locus_tag LOCUS_09560 46854 48452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 49589 48471 gene locus_tag LOCUS_09570 49589 48471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 49788 50171 gene locus_tag LOCUS_09580 49788 50171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700904.1 protein_id gnl|my_center|LOCUS_09580 50560 50177 gene locus_tag LOCUS_09590 50560 50177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 50679 51026 gene locus_tag LOCUS_09600 50679 51026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 51101 53239 gene locus_tag LOCUS_09610 51101 53239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 54047 53277 gene locus_tag LOCUS_09620 gene tpiA 54047 53277 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLU0 protein_id gnl|my_center|LOCUS_09620 55300 54104 gene locus_tag LOCUS_09630 gene pgk 55300 54104 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HYC0 protein_id gnl|my_center|LOCUS_09630 56416 55394 gene locus_tag LOCUS_09640 gene gap1 56416 55394 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NG48 protein_id gnl|my_center|LOCUS_09640 57125 56559 gene locus_tag LOCUS_09650 gene pncA 57125 56559 CDS product bifunctional pyrazinamidase/nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880618.1 protein_id gnl|my_center|LOCUS_09650 58327 57122 gene locus_tag LOCUS_09660 58327 57122 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYU5 protein_id gnl|my_center|LOCUS_09660 58586 59989 gene locus_tag LOCUS_09670 gene amt-1 58586 59989 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B15 protein_id gnl|my_center|LOCUS_09670 60013 60351 gene locus_tag LOCUS_09680 gene glnB 60013 60351 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225869.1 protein_id gnl|my_center|LOCUS_09680 61638 60484 gene locus_tag LOCUS_09690 61638 60484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 62805 61849 gene locus_tag LOCUS_09700 62805 61849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 62880 64184 gene locus_tag LOCUS_09710 62880 64184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 >Feature sequence013 1421 921 gene locus_tag LOCUS_09720 1421 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 1620 2549 gene locus_tag LOCUS_09730 1620 2549 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121362.1 protein_id gnl|my_center|LOCUS_09730 7701 2563 gene locus_tag LOCUS_09740 7701 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 9032 7704 gene locus_tag LOCUS_09750 9032 7704 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119046.1 protein_id gnl|my_center|LOCUS_09750 9756 9055 gene locus_tag LOCUS_09760 9756 9055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 11093 9768 gene locus_tag LOCUS_09770 11093 9768 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_09770 12062 11115 gene locus_tag LOCUS_09780 12062 11115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 12168 12962 gene locus_tag LOCUS_09790 12168 12962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918966.1 protein_id gnl|my_center|LOCUS_09790 13039 14262 gene locus_tag LOCUS_09800 13039 14262 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119366.1 protein_id gnl|my_center|LOCUS_09800 15077 14259 gene locus_tag LOCUS_09810 15077 14259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 15198 16244 gene locus_tag LOCUS_09820 15198 16244 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120800.1 protein_id gnl|my_center|LOCUS_09820 16256 19600 gene locus_tag LOCUS_09830 16256 19600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 19624 20478 gene locus_tag LOCUS_09840 19624 20478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 21924 20506 gene locus_tag LOCUS_09850 21924 20506 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120555.1 protein_id gnl|my_center|LOCUS_09850 22608 21943 gene locus_tag LOCUS_09860 22608 21943 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405245.1 protein_id gnl|my_center|LOCUS_09860 23328 22630 gene locus_tag LOCUS_09870 23328 22630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 24013 23549 gene locus_tag LOCUS_09880 24013 23549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 25155 24193 gene locus_tag LOCUS_09890 25155 24193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122544.1 protein_id gnl|my_center|LOCUS_09890 26055 25231 gene locus_tag LOCUS_09900 26055 25231 CDS product syringomycin biosynthesis enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331388.1 protein_id gnl|my_center|LOCUS_09900 28193 26073 gene locus_tag LOCUS_09910 28193 26073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 28290 29765 gene locus_tag LOCUS_09920 gene atsA 28290 29765 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118387.1 protein_id gnl|my_center|LOCUS_09920 30829 29774 gene locus_tag LOCUS_09930 30829 29774 CDS product syringomycin biosynthesis enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526940.1 protein_id gnl|my_center|LOCUS_09930 30859 32157 gene locus_tag LOCUS_09940 30859 32157 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140914.1 protein_id gnl|my_center|LOCUS_09940 33126 32158 gene locus_tag LOCUS_09950 33126 32158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 34169 33123 gene locus_tag LOCUS_09960 34169 33123 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868853.1 protein_id gnl|my_center|LOCUS_09960 34814 34251 gene locus_tag LOCUS_09970 34814 34251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 35950 34826 gene locus_tag LOCUS_09980 35950 34826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 36084 37220 gene locus_tag LOCUS_09990 36084 37220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120602.1 protein_id gnl|my_center|LOCUS_09990 38285 37233 gene locus_tag LOCUS_10000 38285 37233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 39337 38444 gene locus_tag LOCUS_10010 39337 38444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 40477 39473 gene locus_tag LOCUS_10020 40477 39473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 41382 40537 gene locus_tag LOCUS_10030 41382 40537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 41954 41445 gene locus_tag LOCUS_10040 41954 41445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 43177 41951 gene locus_tag LOCUS_10050 43177 41951 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400343.1 protein_id gnl|my_center|LOCUS_10050 43867 43181 gene locus_tag LOCUS_10060 43867 43181 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120140.1 protein_id gnl|my_center|LOCUS_10060 44049 44423 gene locus_tag LOCUS_10070 44049 44423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 46273 44453 gene locus_tag LOCUS_10080 46273 44453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765170.1 protein_id gnl|my_center|LOCUS_10080 47658 46300 gene locus_tag LOCUS_10090 47658 46300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 48605 47751 gene locus_tag LOCUS_10100 48605 47751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 49316 48618 gene locus_tag LOCUS_10110 49316 48618 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965007.1 protein_id gnl|my_center|LOCUS_10110 50059 49415 gene locus_tag LOCUS_10120 50059 49415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 51327 50056 gene locus_tag LOCUS_10130 51327 50056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 52883 51324 gene locus_tag LOCUS_10140 52883 51324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 54580 53030 gene locus_tag LOCUS_10150 54580 53030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 55323 54577 gene locus_tag LOCUS_10160 55323 54577 CDS product adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545472.1 protein_id gnl|my_center|LOCUS_10160 55610 55332 gene locus_tag LOCUS_10170 55610 55332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 56290 55619 gene locus_tag LOCUS_10180 56290 55619 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755963.1 protein_id gnl|my_center|LOCUS_10180 57602 56283 gene locus_tag LOCUS_10190 57602 56283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 58816 57599 gene locus_tag LOCUS_10200 58816 57599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 59575 58955 gene locus_tag LOCUS_10210 59575 58955 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TB07 protein_id gnl|my_center|LOCUS_10210 60135 59572 gene locus_tag LOCUS_10220 60135 59572 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TB07 protein_id gnl|my_center|LOCUS_10220 61200 60220 gene locus_tag LOCUS_10230 61200 60220 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887649.1 protein_id gnl|my_center|LOCUS_10230 62544 61243 gene locus_tag LOCUS_10240 62544 61243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327912.1 protein_id gnl|my_center|LOCUS_10240 >Feature sequence014 450 1169 gene locus_tag LOCUS_10250 450 1169 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546302.1 protein_id gnl|my_center|LOCUS_10250 1173 2108 gene locus_tag LOCUS_10260 1173 2108 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545278.1 protein_id gnl|my_center|LOCUS_10260 2125 3432 gene locus_tag LOCUS_10270 2125 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 3676 4869 gene locus_tag LOCUS_10280 3676 4869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 5177 6349 gene locus_tag LOCUS_10290 5177 6349 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871132.1 protein_id gnl|my_center|LOCUS_10290 6420 7304 gene locus_tag LOCUS_10300 6420 7304 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227567.1 protein_id gnl|my_center|LOCUS_10300 7322 8152 gene locus_tag LOCUS_10310 7322 8152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 9248 10435 gene locus_tag LOCUS_10320 9248 10435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 11744 12040 gene locus_tag LOCUS_10330 11744 12040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 12915 13187 gene locus_tag LOCUS_10340 12915 13187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 13195 14040 gene locus_tag LOCUS_10350 13195 14040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 14224 15687 gene locus_tag LOCUS_10360 14224 15687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 15794 17656 gene locus_tag LOCUS_10370 gene wcaG 15794 17656 CDS product nucleotide sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338776.1 protein_id gnl|my_center|LOCUS_10370 18035 18856 gene locus_tag LOCUS_10380 18035 18856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 18982 20967 gene locus_tag LOCUS_10390 18982 20967 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546064.1 protein_id gnl|my_center|LOCUS_10390 20957 22057 gene locus_tag LOCUS_10400 20957 22057 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202631.1 protein_id gnl|my_center|LOCUS_10400 23691 24932 gene locus_tag LOCUS_10410 23691 24932 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048108.1 protein_id gnl|my_center|LOCUS_10410 25018 26544 gene locus_tag LOCUS_10420 25018 26544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 26700 27665 gene locus_tag LOCUS_10430 26700 27665 CDS product NAD dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807052.1 protein_id gnl|my_center|LOCUS_10430 27819 29489 gene locus_tag LOCUS_10440 27819 29489 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056069.1 protein_id gnl|my_center|LOCUS_10440 29486 30187 gene locus_tag LOCUS_10450 29486 30187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 30202 30846 gene locus_tag LOCUS_10460 30202 30846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 30839 31828 gene locus_tag LOCUS_10470 30839 31828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 31845 33044 gene locus_tag LOCUS_10480 31845 33044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 33047 34996 gene locus_tag LOCUS_10490 gene wbmI 33047 34996 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807086.1 protein_id gnl|my_center|LOCUS_10490 34993 35928 gene locus_tag LOCUS_10500 gene wbmH 34993 35928 CDS product nucleotide sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807090.1 protein_id gnl|my_center|LOCUS_10500 35931 36866 gene locus_tag LOCUS_10510 gene wbmG 35931 36866 CDS product nucleotide sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807092.1 protein_id gnl|my_center|LOCUS_10510 36880 37932 gene locus_tag LOCUS_10520 gene wbmF 36880 37932 CDS product nucleotide sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807093.1 protein_id gnl|my_center|LOCUS_10520 38009 39280 gene locus_tag LOCUS_10530 38009 39280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 39288 40601 gene locus_tag LOCUS_10540 39288 40601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 40617 41795 gene locus_tag LOCUS_10550 gene wbpH 40617 41795 CDS product glycosyltransferase WbpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115615.1 protein_id gnl|my_center|LOCUS_10550 41792 42877 gene locus_tag LOCUS_10560 gene bplD 41792 42877 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929613.1 protein_id gnl|my_center|LOCUS_10560 42878 44038 gene locus_tag LOCUS_10570 42878 44038 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545698.1 protein_id gnl|my_center|LOCUS_10570 44038 45372 gene locus_tag LOCUS_10580 44038 45372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 45380 46411 gene locus_tag LOCUS_10590 gene galE-1 45380 46411 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705040.1 protein_id gnl|my_center|LOCUS_10590 46784 46392 gene locus_tag LOCUS_10600 46784 46392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 47000 47971 gene locus_tag LOCUS_10610 47000 47971 CDS product ADP-heptose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015825.1 protein_id gnl|my_center|LOCUS_10610 47968 48507 gene locus_tag LOCUS_10620 47968 48507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 48504 49070 gene locus_tag LOCUS_10630 48504 49070 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808789.1 protein_id gnl|my_center|LOCUS_10630 49148 49630 gene locus_tag LOCUS_10640 49148 49630 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392703.1 protein_id gnl|my_center|LOCUS_10640 49654 50832 gene locus_tag LOCUS_10650 49654 50832 CDS product aromatic amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064998.1 protein_id gnl|my_center|LOCUS_10650 50842 52236 gene locus_tag LOCUS_10660 gene der 50842 52236 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q834T4 protein_id gnl|my_center|LOCUS_10660 52318 53325 gene locus_tag LOCUS_10670 gene fmt 52318 53325 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4G0 protein_id gnl|my_center|LOCUS_10670 53465 54016 gene locus_tag LOCUS_10680 53465 54016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 54021 54977 gene locus_tag LOCUS_10690 gene spoOJ 54021 54977 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966989.1 protein_id gnl|my_center|LOCUS_10690 55156 55608 gene locus_tag LOCUS_10700 55156 55608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 55796 56539 gene locus_tag LOCUS_10710 55796 56539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 56629 57819 gene locus_tag LOCUS_10720 56629 57819 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHD7 protein_id gnl|my_center|LOCUS_10720 58156 57893 gene locus_tag LOCUS_10730 58156 57893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 <63514 58202 gene locus_tag LOCUS_10740 <63514 58202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943350.1:fibronectin type III >Feature sequence015 719 1906 gene locus_tag LOCUS_10750 719 1906 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525183.1 protein_id gnl|my_center|LOCUS_10750 3450 1903 gene locus_tag LOCUS_10760 3450 1903 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_10760 4886 3447 gene locus_tag LOCUS_10770 4886 3447 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119535.1 protein_id gnl|my_center|LOCUS_10770 6875 4971 gene locus_tag LOCUS_10780 6875 4971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 7687 7289 gene locus_tag LOCUS_10790 7687 7289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 9488 7788 gene locus_tag LOCUS_10800 gene ilvD 9488 7788 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NH32 protein_id gnl|my_center|LOCUS_10800 9799 9641 gene locus_tag LOCUS_10810 9799 9641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 34123 10097 gene locus_tag LOCUS_10820 34123 10097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 35954 35379 gene locus_tag LOCUS_10830 35954 35379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 38955 36148 gene locus_tag LOCUS_10840 gene rapA 38955 36148 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGL5 protein_id gnl|my_center|LOCUS_10840 39946 39011 gene locus_tag LOCUS_10850 39946 39011 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201854.1 protein_id gnl|my_center|LOCUS_10850 41468 40044 gene locus_tag LOCUS_10860 41468 40044 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203533.1 protein_id gnl|my_center|LOCUS_10860 42791 41487 gene locus_tag LOCUS_10870 42791 41487 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118059.1 protein_id gnl|my_center|LOCUS_10870 43554 42889 gene locus_tag LOCUS_10880 43554 42889 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229952.1 protein_id gnl|my_center|LOCUS_10880 43724 43954 gene locus_tag LOCUS_10890 43724 43954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 45521 43944 gene locus_tag LOCUS_10900 45521 43944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 45960 47591 gene locus_tag LOCUS_10910 45960 47591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 48559 47618 gene locus_tag LOCUS_10920 gene xynE 48559 47618 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122022.1 protein_id gnl|my_center|LOCUS_10920 50079 48574 gene locus_tag LOCUS_10930 50079 48574 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203533.1 protein_id gnl|my_center|LOCUS_10930 50266 50087 gene locus_tag LOCUS_10940 50266 50087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 50202 51599 gene locus_tag LOCUS_10950 50202 51599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 51974 53593 gene locus_tag LOCUS_10960 51974 53593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203365.1 protein_id gnl|my_center|LOCUS_10960 53783 54973 gene locus_tag LOCUS_10970 53783 54973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 55746 55060 gene locus_tag LOCUS_10980 55746 55060 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942483.1 protein_id gnl|my_center|LOCUS_10980 57043 55769 gene locus_tag LOCUS_10990 57043 55769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117891.1 protein_id gnl|my_center|LOCUS_10990 59409 57061 gene locus_tag LOCUS_11000 59409 57061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117890.1 protein_id gnl|my_center|LOCUS_11000 61127 59421 gene locus_tag LOCUS_11010 61127 59421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 61916 61173 gene locus_tag LOCUS_11020 61916 61173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 63180 61918 gene locus_tag LOCUS_11030 63180 61918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327912.1 protein_id gnl|my_center|LOCUS_11030 >Feature sequence016 5696 4896 gene locus_tag LOCUS_11040 5696 4896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 7320 5788 gene locus_tag LOCUS_11050 7320 5788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 8313 7411 gene locus_tag LOCUS_11060 8313 7411 CDS product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393022.1 protein_id gnl|my_center|LOCUS_11060 8462 9085 gene locus_tag LOCUS_11070 8462 9085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 9098 9436 gene locus_tag LOCUS_11080 9098 9436 CDS product FmdB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325406.1 protein_id gnl|my_center|LOCUS_11080 9489 11066 gene locus_tag LOCUS_11090 gene mviN 9489 11066 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBG8 protein_id gnl|my_center|LOCUS_11090 11159 14626 gene locus_tag LOCUS_11100 gene pyc 11159 14626 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UES1 protein_id gnl|my_center|LOCUS_11100 15300 14692 gene locus_tag LOCUS_11110 gene sodA 15300 14692 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HDP2 protein_id gnl|my_center|LOCUS_11110 15927 15382 gene locus_tag LOCUS_11120 15927 15382 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815124.1 protein_id gnl|my_center|LOCUS_11120 16010 16318 gene locus_tag LOCUS_11130 16010 16318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 16368 17333 gene locus_tag LOCUS_11140 gene cysK 16368 17333 CDS product O-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A535 protein_id gnl|my_center|LOCUS_11140 17404 17859 gene locus_tag LOCUS_11150 gene dtd 17404 17859 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3H7Q0 protein_id gnl|my_center|LOCUS_11150 17869 18411 gene locus_tag LOCUS_11160 17869 18411 CDS product putative 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN92 protein_id gnl|my_center|LOCUS_11160 18404 19294 gene locus_tag LOCUS_11170 18404 19294 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073864.1 protein_id gnl|my_center|LOCUS_11170 19393 19665 gene locus_tag LOCUS_11180 19393 19665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 19703 20548 gene locus_tag LOCUS_11190 19703 20548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 20586 21443 gene locus_tag LOCUS_11200 20586 21443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 21509 22054 gene locus_tag LOCUS_11210 21509 22054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 22124 22882 gene locus_tag LOCUS_11220 22124 22882 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228266.1 protein_id gnl|my_center|LOCUS_11220 23687 22944 gene locus_tag LOCUS_11230 23687 22944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11230 24427 23792 gene locus_tag LOCUS_11240 24427 23792 CDS product 3'-exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938381.1 protein_id gnl|my_center|LOCUS_11240 25547 24450 gene locus_tag LOCUS_11250 25547 24450 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220497.1 protein_id gnl|my_center|LOCUS_11250 25640 26806 gene locus_tag LOCUS_11260 gene pilT 25640 26806 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880449.1 protein_id gnl|my_center|LOCUS_11260 26891 27856 gene locus_tag LOCUS_11270 gene msrP 26891 27856 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q46 protein_id gnl|my_center|LOCUS_11270 27871 28725 gene locus_tag LOCUS_11280 27871 28725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 28729 29754 gene locus_tag LOCUS_11290 28729 29754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 29751 30482 gene locus_tag LOCUS_11300 29751 30482 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404114.1 protein_id gnl|my_center|LOCUS_11300 30518 31483 gene locus_tag LOCUS_11310 gene hprK 30518 31483 CDS product HPr kinase/phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3J9 protein_id gnl|my_center|LOCUS_11310 31902 33308 gene locus_tag LOCUS_11320 gene dnaA 31902 33308 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HQ03 protein_id gnl|my_center|LOCUS_11320 33350 33949 gene locus_tag LOCUS_11330 33350 33949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 35863 33986 gene locus_tag LOCUS_11340 35863 33986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119977.1 protein_id gnl|my_center|LOCUS_11340 36950 35931 gene locus_tag LOCUS_11350 36950 35931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004566323.1 protein_id gnl|my_center|LOCUS_11350 37666 37085 gene locus_tag LOCUS_11360 37666 37085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 37767 38624 gene locus_tag LOCUS_11370 37767 38624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 38611 39750 gene locus_tag LOCUS_11380 gene pgl 38611 39750 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZGX4 protein_id gnl|my_center|LOCUS_11380 39743 40774 gene locus_tag LOCUS_11390 39743 40774 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086980.1 protein_id gnl|my_center|LOCUS_11390 40788 41867 gene locus_tag LOCUS_11400 40788 41867 CDS product dihydrodipicolinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121662.1 protein_id gnl|my_center|LOCUS_11400 42860 41871 gene locus_tag LOCUS_11410 42860 41871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 44111 42885 gene locus_tag LOCUS_11420 44111 42885 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120415.1 protein_id gnl|my_center|LOCUS_11420 44269 45072 gene locus_tag LOCUS_11430 44269 45072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123954.1 protein_id gnl|my_center|LOCUS_11430 45076 46005 gene locus_tag LOCUS_11440 45076 46005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 46900 46013 gene locus_tag LOCUS_11450 46900 46013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 48299 46914 gene locus_tag LOCUS_11460 gene arsA 48299 46914 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121615.1 protein_id gnl|my_center|LOCUS_11460 48447 49499 gene locus_tag LOCUS_11470 48447 49499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326116.1 protein_id gnl|my_center|LOCUS_11470 49708 51888 gene locus_tag LOCUS_11480 49708 51888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 52353 51910 gene locus_tag LOCUS_11490 52353 51910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 53531 52368 gene locus_tag LOCUS_11500 53531 52368 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957890.1 protein_id gnl|my_center|LOCUS_11500 54602 53649 gene locus_tag LOCUS_11510 54602 53649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 54759 55718 gene locus_tag LOCUS_11520 54759 55718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 56953 55727 gene locus_tag LOCUS_11530 56953 55727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120898.1 protein_id gnl|my_center|LOCUS_11530 58083 56950 gene locus_tag LOCUS_11540 58083 56950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 58222 59550 gene locus_tag LOCUS_11550 58222 59550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117743.1 protein_id gnl|my_center|LOCUS_11550 59547 60443 gene locus_tag LOCUS_11560 gene xynB 59547 60443 CDS product xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038153.1 protein_id gnl|my_center|LOCUS_11560 >Feature sequence017 4448 3642 gene locus_tag LOCUS_11570 gene mutM 4448 3642 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O50606 protein_id gnl|my_center|LOCUS_11570 4514 4996 gene locus_tag LOCUS_11580 4514 4996 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229426.1 protein_id gnl|my_center|LOCUS_11580 5558 4989 gene locus_tag LOCUS_11590 5558 4989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 7289 5586 gene locus_tag LOCUS_11600 gene cysI 7289 5586 CDS product sulfite reductase [NADPH] hemoprotein beta-component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32213 protein_id gnl|my_center|LOCUS_11600 8392 7361 gene locus_tag LOCUS_11610 gene tsaD 8392 7361 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A57 protein_id gnl|my_center|LOCUS_11610 9618 8389 gene locus_tag LOCUS_11620 9618 8389 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545828.1 protein_id gnl|my_center|LOCUS_11620 9520 9774 gene locus_tag LOCUS_11630 9520 9774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 9786 10814 gene locus_tag LOCUS_11640 9786 10814 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941144.1 protein_id gnl|my_center|LOCUS_11640 10811 11110 gene locus_tag LOCUS_11650 10811 11110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 11530 11195 gene locus_tag LOCUS_11660 11530 11195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 12475 13179 gene locus_tag LOCUS_11670 gene ubiE 12475 13179 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122034.1 protein_id gnl|my_center|LOCUS_11670 13315 17928 gene locus_tag LOCUS_11680 13315 17928 CDS product glutamate synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807931.1 protein_id gnl|my_center|LOCUS_11680 17965 19446 gene locus_tag LOCUS_11690 gene gltD 17965 19446 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_11690 19457 20059 gene locus_tag LOCUS_11700 gene thrH 19457 20059 CDS product phosphoserine phosphatase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Y2 protein_id gnl|my_center|LOCUS_11700 20056 20604 gene locus_tag LOCUS_11710 20056 20604 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384995.1 protein_id gnl|my_center|LOCUS_11710 21464 20571 gene locus_tag LOCUS_11720 21464 20571 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230953.1 protein_id gnl|my_center|LOCUS_11720 21503 22705 gene locus_tag LOCUS_11730 21503 22705 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813169.1 protein_id gnl|my_center|LOCUS_11730 22712 23620 gene locus_tag LOCUS_11740 22712 23620 CDS product 2-deoxyribose-5-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403980.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11740 23634 25136 gene locus_tag LOCUS_11750 23634 25136 CDS product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403981.1 protein_id gnl|my_center|LOCUS_11750 25133 26011 gene locus_tag LOCUS_11760 25133 26011 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403982.1 protein_id gnl|my_center|LOCUS_11760 26008 26841 gene locus_tag LOCUS_11770 gene pnp 26008 26841 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y5V2 protein_id gnl|my_center|LOCUS_11770 27796 26846 gene locus_tag LOCUS_11780 gene rbsK 27796 26846 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCH0 protein_id gnl|my_center|LOCUS_11780 29220 27793 gene locus_tag LOCUS_11790 29220 27793 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120982.1 protein_id gnl|my_center|LOCUS_11790 31382 29220 gene locus_tag LOCUS_11800 31382 29220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 33404 31665 gene locus_tag LOCUS_11810 33404 31665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119050.1 protein_id gnl|my_center|LOCUS_11810 33976 33401 gene locus_tag LOCUS_11820 33976 33401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 34708 34073 gene locus_tag LOCUS_11830 34708 34073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 35602 34988 gene locus_tag LOCUS_11840 35602 34988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 36738 35602 gene locus_tag LOCUS_11850 36738 35602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 42792 36823 gene locus_tag LOCUS_11860 42792 36823 CDS product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122194.1 protein_id gnl|my_center|LOCUS_11860 43207 43034 gene locus_tag LOCUS_11870 43207 43034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 43469 46297 gene locus_tag LOCUS_11880 43469 46297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 46297 47583 gene locus_tag LOCUS_11890 46297 47583 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073038.1 protein_id gnl|my_center|LOCUS_11890 48372 47602 gene locus_tag LOCUS_11900 48372 47602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 49541 48399 gene locus_tag LOCUS_11910 49541 48399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 51449 49740 gene locus_tag LOCUS_11920 51449 49740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 55548 51775 gene locus_tag LOCUS_11930 gene gdhP 55548 51775 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118605.1 protein_id gnl|my_center|LOCUS_11930 <56592 55488 gene locus_tag LOCUS_11940 <56592 55488 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122408.1:N-acetylgalactosamine-6-sulfatase >Feature sequence018 1745 1383 gene locus_tag LOCUS_11950 1745 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 3199 1955 gene locus_tag LOCUS_11960 3199 1955 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122959.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11960 4463 3231 gene locus_tag LOCUS_11970 4463 3231 CDS product polyvinyl alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122626.1 protein_id gnl|my_center|LOCUS_11970 5119 4589 gene locus_tag LOCUS_11980 5119 4589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 5219 5950 gene locus_tag LOCUS_11990 5219 5950 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557316.1 protein_id gnl|my_center|LOCUS_11990 6618 5959 gene locus_tag LOCUS_12000 gene glgC 6618 5959 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037912.1 protein_id gnl|my_center|LOCUS_12000 7612 6635 gene locus_tag LOCUS_12010 7612 6635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113208.1 protein_id gnl|my_center|LOCUS_12010 8663 7677 gene locus_tag LOCUS_12020 8663 7677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118659.1 protein_id gnl|my_center|LOCUS_12020 10157 8712 gene locus_tag LOCUS_12030 10157 8712 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122596.1 protein_id gnl|my_center|LOCUS_12030 13315 10181 gene locus_tag LOCUS_12040 13315 10181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 protein_id gnl|my_center|LOCUS_12040 13612 14241 gene locus_tag LOCUS_12050 13612 14241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 15383 14259 gene locus_tag LOCUS_12060 15383 14259 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGI3 protein_id gnl|my_center|LOCUS_12060 16045 15380 gene locus_tag LOCUS_12070 16045 15380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 17616 16072 gene locus_tag LOCUS_12080 gene rpoN 17616 16072 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546561.1 protein_id gnl|my_center|LOCUS_12080 18660 17632 gene locus_tag LOCUS_12090 18660 17632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 18733 19119 gene locus_tag LOCUS_12100 gene erpA 18733 19119 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMM4 protein_id gnl|my_center|LOCUS_12100 19813 19166 gene locus_tag LOCUS_12110 19813 19166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 21597 19858 gene locus_tag LOCUS_12120 gene argS 21597 19858 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JYM8 protein_id gnl|my_center|LOCUS_12120 21765 23102 gene locus_tag LOCUS_12130 21765 23102 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583823.1 protein_id gnl|my_center|LOCUS_12130 23722 23156 gene locus_tag LOCUS_12140 gene efp 23722 23156 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HDW8 protein_id gnl|my_center|LOCUS_12140 23819 24604 gene locus_tag LOCUS_12150 23819 24604 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462044.1 protein_id gnl|my_center|LOCUS_12150 24694 25713 gene locus_tag LOCUS_12160 24694 25713 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK07 protein_id gnl|my_center|LOCUS_12160 25710 26312 gene locus_tag LOCUS_12170 25710 26312 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C80 protein_id gnl|my_center|LOCUS_12170 28155 26317 gene locus_tag LOCUS_12180 28155 26317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118540.1 protein_id gnl|my_center|LOCUS_12180 29031 28252 gene locus_tag LOCUS_12190 29031 28252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 30735 29116 gene locus_tag LOCUS_12200 30735 29116 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12200 30886 30962 gene locus_tag LOCUS_t00160 30886 30962 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 31332 31141 gene locus_tag LOCUS_12210 31332 31141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 31377 31598 gene locus_tag LOCUS_12220 31377 31598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12220 31805 32419 gene locus_tag LOCUS_12230 31805 32419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 32499 33440 gene locus_tag LOCUS_12240 32499 33440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 33577 35238 gene locus_tag LOCUS_12250 33577 35238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 35270 36742 gene locus_tag LOCUS_12260 35270 36742 CDS product aryl-sulfate sulfohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120414.1 protein_id gnl|my_center|LOCUS_12260 36759 37628 gene locus_tag LOCUS_12270 36759 37628 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099029.1 protein_id gnl|my_center|LOCUS_12270 38502 37609 gene locus_tag LOCUS_12280 38502 37609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 38619 41252 gene locus_tag LOCUS_12290 38619 41252 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142782.1 protein_id gnl|my_center|LOCUS_12290 41297 42016 gene locus_tag LOCUS_12300 41297 42016 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582974.1 protein_id gnl|my_center|LOCUS_12300 42013 42492 gene locus_tag LOCUS_12310 42013 42492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 42518 43990 gene locus_tag LOCUS_12320 gene glcD-1 42518 43990 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_12320 43969 45495 gene locus_tag LOCUS_12330 43969 45495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 45538 46443 gene locus_tag LOCUS_12340 45538 46443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 47367 46459 gene locus_tag LOCUS_12350 47367 46459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 47542 48567 gene locus_tag LOCUS_12360 47542 48567 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_12360 48713 50629 gene locus_tag LOCUS_12370 gene parE 48713 50629 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC8 protein_id gnl|my_center|LOCUS_12370 50662 53160 gene locus_tag LOCUS_12380 50662 53160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 53179 53823 gene locus_tag LOCUS_12390 53179 53823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 55097 53865 gene locus_tag LOCUS_12400 55097 53865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 >Feature sequence019 655 1134 gene locus_tag LOCUS_12410 655 1134 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269266.1 protein_id gnl|my_center|LOCUS_12410 2650 1187 gene locus_tag LOCUS_12420 2650 1187 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121006.1 protein_id gnl|my_center|LOCUS_12420 4165 2675 gene locus_tag LOCUS_12430 4165 2675 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118059.1 protein_id gnl|my_center|LOCUS_12430 4291 5514 gene locus_tag LOCUS_12440 4291 5514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 7568 5511 gene locus_tag LOCUS_12450 7568 5511 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140331.1 protein_id gnl|my_center|LOCUS_12450 10053 7720 gene locus_tag LOCUS_12460 10053 7720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 10416 10078 gene locus_tag LOCUS_12470 10416 10078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 10583 12718 gene locus_tag LOCUS_12480 10583 12718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121107.1 protein_id gnl|my_center|LOCUS_12480 12755 14032 gene locus_tag LOCUS_12490 12755 14032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331975.1 protein_id gnl|my_center|LOCUS_12490 14160 16502 gene locus_tag LOCUS_12500 14160 16502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 16560 24089 gene locus_tag LOCUS_12510 16560 24089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 24117 24992 gene locus_tag LOCUS_12520 24117 24992 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404426.1 protein_id gnl|my_center|LOCUS_12520 24989 25405 gene locus_tag LOCUS_12530 24989 25405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 25413 25841 gene locus_tag LOCUS_12540 25413 25841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 25893 26321 gene locus_tag LOCUS_12550 25893 26321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 26318 27784 gene locus_tag LOCUS_12560 26318 27784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 27754 29481 gene locus_tag LOCUS_12570 27754 29481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 30237 29539 gene locus_tag LOCUS_12580 gene nanE 30237 29539 CDS product putative N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CP01 protein_id gnl|my_center|LOCUS_12580 30305 31219 gene locus_tag LOCUS_12590 30305 31219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 31939 31238 gene locus_tag LOCUS_12600 31939 31238 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122175.1 protein_id gnl|my_center|LOCUS_12600 33330 32017 gene locus_tag LOCUS_12610 gene GALNS 33330 32017 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121570.1 protein_id gnl|my_center|LOCUS_12610 34816 33344 gene locus_tag LOCUS_12620 34816 33344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 36100 34841 gene locus_tag LOCUS_12630 gene aslA 36100 34841 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_12630 39234 36211 gene locus_tag LOCUS_12640 39234 36211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 40496 39231 gene locus_tag LOCUS_12650 40496 39231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122571.1 protein_id gnl|my_center|LOCUS_12650 43386 40615 gene locus_tag LOCUS_12660 43386 40615 CDS product large multi-functional protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119677.1 protein_id gnl|my_center|LOCUS_12660 44771 43389 gene locus_tag LOCUS_12670 44771 43389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142441.1 protein_id gnl|my_center|LOCUS_12670 45004 45960 gene locus_tag LOCUS_12680 45004 45960 CDS product 4-hydroxyproline 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I476 protein_id gnl|my_center|LOCUS_12680 45957 47204 gene locus_tag LOCUS_12690 gene dadA 45957 47204 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120365.1 protein_id gnl|my_center|LOCUS_12690 49224 47218 gene locus_tag LOCUS_12700 49224 47218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 51065 49221 gene locus_tag LOCUS_12710 51065 49221 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118947.1 protein_id gnl|my_center|LOCUS_12710 52369 51110 gene locus_tag LOCUS_12720 52369 51110 CDS product quinohemoprotein ethanol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117995.1 protein_id gnl|my_center|LOCUS_12720 53871 52381 gene locus_tag LOCUS_12730 53871 52381 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122518.1 protein_id gnl|my_center|LOCUS_12730 <55585 53906 gene locus_tag LOCUS_12740 <55585 53906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122595.1:cytochrome c >Feature sequence020 2408 912 gene locus_tag LOCUS_12750 2408 912 CDS product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_12750 4079 2415 gene locus_tag LOCUS_12760 4079 2415 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118263.1 protein_id gnl|my_center|LOCUS_12760 5049 4177 gene locus_tag LOCUS_12770 5049 4177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492432.1 protein_id gnl|my_center|LOCUS_12770 5860 5111 gene locus_tag LOCUS_12780 5860 5111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 7225 5876 gene locus_tag LOCUS_12790 gene arsA 7225 5876 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122622.1 protein_id gnl|my_center|LOCUS_12790 8484 7321 gene locus_tag LOCUS_12800 8484 7321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 10191 8560 gene locus_tag LOCUS_12810 10191 8560 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120439.1 protein_id gnl|my_center|LOCUS_12810 10397 11635 gene locus_tag LOCUS_12820 10397 11635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 13165 11660 gene locus_tag LOCUS_12830 13165 11660 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333818.1 protein_id gnl|my_center|LOCUS_12830 15942 13162 gene locus_tag LOCUS_12840 15942 13162 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120440.1 protein_id gnl|my_center|LOCUS_12840 16645 15965 gene locus_tag LOCUS_12850 16645 15965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119681.1 protein_id gnl|my_center|LOCUS_12850 18016 16700 gene locus_tag LOCUS_12860 18016 16700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 18430 18047 gene locus_tag LOCUS_12870 18430 18047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 18927 18445 gene locus_tag LOCUS_12880 18927 18445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 20296 18962 gene locus_tag LOCUS_12890 20296 18962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225440.1 protein_id gnl|my_center|LOCUS_12890 21852 20305 gene locus_tag LOCUS_12900 21852 20305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205128.1 protein_id gnl|my_center|LOCUS_12900 22345 21857 gene locus_tag LOCUS_12910 22345 21857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 23077 22814 gene locus_tag LOCUS_12920 23077 22814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12920 23507 23124 gene locus_tag LOCUS_12930 23507 23124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12930 24485 23535 gene locus_tag LOCUS_12940 24485 23535 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118357.1 protein_id gnl|my_center|LOCUS_12940 25287 24532 gene locus_tag LOCUS_12950 25287 24532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 27037 25679 gene locus_tag LOCUS_12960 27037 25679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327912.1 protein_id gnl|my_center|LOCUS_12960 29052 26995 gene locus_tag LOCUS_12970 29052 26995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121107.1 protein_id gnl|my_center|LOCUS_12970 30803 29199 gene locus_tag LOCUS_12980 gene yidJ 30803 29199 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122680.1 protein_id gnl|my_center|LOCUS_12980 32365 30800 gene locus_tag LOCUS_12990 32365 30800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 33636 32470 gene locus_tag LOCUS_13000 33636 32470 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877095.1 protein_id gnl|my_center|LOCUS_13000 35276 33723 gene locus_tag LOCUS_13010 35276 33723 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123733.1 protein_id gnl|my_center|LOCUS_13010 38455 35288 gene locus_tag LOCUS_13020 38455 35288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 40154 38556 gene locus_tag LOCUS_13030 40154 38556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 42378 40231 gene locus_tag LOCUS_13040 42378 40231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 42530 42925 gene locus_tag LOCUS_13050 42530 42925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 42922 43746 gene locus_tag LOCUS_13060 42922 43746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 43850 44788 gene locus_tag LOCUS_13070 43850 44788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118058.1 protein_id gnl|my_center|LOCUS_13070 44953 47019 gene locus_tag LOCUS_13080 44953 47019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 47335 47619 gene locus_tag LOCUS_13090 47335 47619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 47612 48196 gene locus_tag LOCUS_13100 47612 48196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 49774 48230 gene locus_tag LOCUS_13110 49774 48230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637181.2 protein_id gnl|my_center|LOCUS_13110 51212 49788 gene locus_tag LOCUS_13120 51212 49788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120913.1 protein_id gnl|my_center|LOCUS_13120 54022 51209 gene locus_tag LOCUS_13130 54022 51209 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120914.1 protein_id gnl|my_center|LOCUS_13130 >Feature sequence021 1567 2589 gene locus_tag LOCUS_13140 gene tdh 1567 2589 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8J1 protein_id gnl|my_center|LOCUS_13140 2583 3779 gene locus_tag LOCUS_13150 gene kbl 2583 3779 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KL61 protein_id gnl|my_center|LOCUS_13150 3776 4765 gene locus_tag LOCUS_13160 gene cysM 3776 4765 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454499.1 protein_id gnl|my_center|LOCUS_13160 6261 4792 gene locus_tag LOCUS_13170 6261 4792 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120799.1 protein_id gnl|my_center|LOCUS_13170 6479 6751 gene locus_tag LOCUS_13180 6479 6751 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_13180 7625 6846 gene locus_tag LOCUS_13190 7625 6846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 9313 7730 gene locus_tag LOCUS_13200 9313 7730 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120298.1 protein_id gnl|my_center|LOCUS_13200 9411 10826 gene locus_tag LOCUS_13210 9411 10826 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0W2 protein_id gnl|my_center|LOCUS_13210 10841 12256 gene locus_tag LOCUS_13220 10841 12256 CDS product 2,5-dioxovalerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731065.1 protein_id gnl|my_center|LOCUS_13220 12507 13133 gene locus_tag LOCUS_13230 12507 13133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 13141 14079 gene locus_tag LOCUS_13240 13141 14079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603461.1 protein_id gnl|my_center|LOCUS_13240 15271 14135 gene locus_tag LOCUS_13250 15271 14135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782250.1 protein_id gnl|my_center|LOCUS_13250 16066 15332 gene locus_tag LOCUS_13260 16066 15332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 17259 16090 gene locus_tag LOCUS_13270 17259 16090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 17794 17273 gene locus_tag LOCUS_13280 17794 17273 CDS product RNA polymerase subunit sigma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813613.1 protein_id gnl|my_center|LOCUS_13280 19449 17983 gene locus_tag LOCUS_13290 19449 17983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_13290 25412 19524 gene locus_tag LOCUS_13300 25412 19524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 25818 27101 gene locus_tag LOCUS_13310 gene yflS 25818 27101 CDS product putative malate transporter YflS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34726 protein_id gnl|my_center|LOCUS_13310 27906 27112 gene locus_tag LOCUS_13320 27906 27112 CDS product putative isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I073 protein_id gnl|my_center|LOCUS_13320 28026 29021 gene locus_tag LOCUS_13330 28026 29021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 29844 29035 gene locus_tag LOCUS_13340 29844 29035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 30586 29876 gene locus_tag LOCUS_13350 30586 29876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086626.1 protein_id gnl|my_center|LOCUS_13350 32062 30662 gene locus_tag LOCUS_13360 32062 30662 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118427.1 protein_id gnl|my_center|LOCUS_13360 32470 32174 gene locus_tag LOCUS_13370 32470 32174 CDS product UPF0213 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KLK4 protein_id gnl|my_center|LOCUS_13370 34065 32488 gene locus_tag LOCUS_13380 34065 32488 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122594.1 protein_id gnl|my_center|LOCUS_13380 34279 35745 gene locus_tag LOCUS_13390 gene pepA 34279 35745 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GB4 protein_id gnl|my_center|LOCUS_13390 38008 35747 gene locus_tag LOCUS_13400 38008 35747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 39096 38005 gene locus_tag LOCUS_13410 39096 38005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 40510 39365 gene locus_tag LOCUS_13420 40510 39365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 40660 41367 gene locus_tag LOCUS_13430 40660 41367 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122354.1 protein_id gnl|my_center|LOCUS_13430 41569 42636 gene locus_tag LOCUS_13440 41569 42636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 42737 46060 gene locus_tag LOCUS_13450 42737 46060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 46214 46441 gene locus_tag LOCUS_13460 46214 46441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 47295 46456 gene locus_tag LOCUS_13470 47295 46456 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684417.1 protein_id gnl|my_center|LOCUS_13470 47431 47643 gene locus_tag LOCUS_13480 47431 47643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 48425 47712 gene locus_tag LOCUS_13490 48425 47712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 >Feature sequence022 3917 3402 gene locus_tag LOCUS_13500 3917 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 5966 3966 gene locus_tag LOCUS_13510 5966 3966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 6552 5983 gene locus_tag LOCUS_13520 6552 5983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 7204 6641 gene locus_tag LOCUS_13530 7204 6641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 7307 8500 gene locus_tag LOCUS_13540 7307 8500 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869432.1 protein_id gnl|my_center|LOCUS_13540 8512 9099 gene locus_tag LOCUS_13550 8512 9099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 9089 10072 gene locus_tag LOCUS_13560 9089 10072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 11134 10088 gene locus_tag LOCUS_13570 11134 10088 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920708.1 protein_id gnl|my_center|LOCUS_13570 12158 11160 gene locus_tag LOCUS_13580 12158 11160 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869431.1 protein_id gnl|my_center|LOCUS_13580 12267 13832 gene locus_tag LOCUS_13590 12267 13832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 15031 13829 gene locus_tag LOCUS_13600 15031 13829 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086334.1 protein_id gnl|my_center|LOCUS_13600 15752 15063 gene locus_tag LOCUS_13610 15752 15063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 16882 15749 gene locus_tag LOCUS_13620 16882 15749 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426064.1 protein_id gnl|my_center|LOCUS_13620 18165 16915 gene locus_tag LOCUS_13630 18165 16915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763485.1 protein_id gnl|my_center|LOCUS_13630 19955 18318 gene locus_tag LOCUS_13640 gene groL 19955 18318 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747C7 protein_id gnl|my_center|LOCUS_13640 20303 20007 gene locus_tag LOCUS_13650 gene groES 20303 20007 CDS product co-chaperonin GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001314660.1 protein_id gnl|my_center|LOCUS_13650 22360 20396 gene locus_tag LOCUS_13660 gene dnaK2 22360 20396 CDS product chaperone protein dnaK2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI58 protein_id gnl|my_center|LOCUS_13660 22919 22533 gene locus_tag LOCUS_13670 gene rbfA 22919 22533 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NE48 protein_id gnl|my_center|LOCUS_13670 25290 22960 gene locus_tag LOCUS_13680 gene infB 25290 22960 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHT8 protein_id gnl|my_center|LOCUS_13680 26683 25340 gene locus_tag LOCUS_13690 gene nusA 26683 25340 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MC64 protein_id gnl|my_center|LOCUS_13690 27919 26717 gene locus_tag LOCUS_13700 27919 26717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 28265 27921 gene locus_tag LOCUS_13710 28265 27921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 28316 29116 gene locus_tag LOCUS_13720 gene pksC 28316 29116 CDS product polyketide biosynthesis malonyl CoA-acyl carrier protein transacylase PksC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34825 protein_id gnl|my_center|LOCUS_13720 >Feature sequence023 3653 1812 gene locus_tag LOCUS_13730 3653 1812 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183842.1 protein_id gnl|my_center|LOCUS_13730 3771 4454 gene locus_tag LOCUS_13740 3771 4454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 4451 5011 gene locus_tag LOCUS_13750 4451 5011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 5028 5681 gene locus_tag LOCUS_13760 5028 5681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 5930 6214 gene locus_tag LOCUS_13770 5930 6214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 6722 6225 gene locus_tag LOCUS_13780 6722 6225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 6810 7943 gene locus_tag LOCUS_13790 gene dprA 6810 7943 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_13790 8083 12957 gene locus_tag LOCUS_13800 8083 12957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 13016 13978 gene locus_tag LOCUS_13810 13016 13978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 14131 14787 gene locus_tag LOCUS_13820 14131 14787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 14882 15871 gene locus_tag LOCUS_13830 14882 15871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 16026 16547 gene locus_tag LOCUS_13840 gene gspG 16026 16547 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308483.1 protein_id gnl|my_center|LOCUS_13840 16627 17166 gene locus_tag LOCUS_13850 16627 17166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 17187 17855 gene locus_tag LOCUS_13860 17187 17855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 17845 18363 gene locus_tag LOCUS_13870 17845 18363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 18367 19248 gene locus_tag LOCUS_13880 18367 19248 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902772.1 protein_id gnl|my_center|LOCUS_13880 19603 19283 gene locus_tag LOCUS_13890 19603 19283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 20453 19623 gene locus_tag LOCUS_13900 20453 19623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 20738 20496 gene locus_tag LOCUS_13910 20738 20496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 23005 20864 gene locus_tag LOCUS_13920 23005 20864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 23036 25282 gene locus_tag LOCUS_13930 gene glgB 23036 25282 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D0G8 protein_id gnl|my_center|LOCUS_13930 25388 26677 gene locus_tag LOCUS_13940 25388 26677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 29156 26694 gene locus_tag LOCUS_13950 29156 26694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 31837 29153 gene locus_tag LOCUS_13960 gene alaS 31837 29153 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG04 protein_id gnl|my_center|LOCUS_13960 32981 31860 gene locus_tag LOCUS_13970 gene leuB 32981 31860 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N7U8 protein_id gnl|my_center|LOCUS_13970 33651 34904 gene locus_tag LOCUS_13980 gene lysA 33651 34904 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190627.1 protein_id gnl|my_center|LOCUS_13980 34901 36427 gene locus_tag LOCUS_13990 gene metC 34901 36427 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910561.1 protein_id gnl|my_center|LOCUS_13990 37700 36435 gene locus_tag LOCUS_14000 gene pfp 37700 36435 CDS product pyrophosphate--fructose 6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJ41 protein_id gnl|my_center|LOCUS_14000 39259 37832 gene locus_tag LOCUS_14010 gene purB 39259 37832 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DJA2 protein_id gnl|my_center|LOCUS_14010 39358 40518 gene locus_tag LOCUS_14020 39358 40518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 40580 41224 gene locus_tag LOCUS_14030 gene pdxH 40580 41224 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MC56 protein_id gnl|my_center|LOCUS_14030 41163 41438 gene locus_tag LOCUS_14040 41163 41438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 41974 41435 gene locus_tag LOCUS_14050 41974 41435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 42833 42012 gene locus_tag LOCUS_14060 42833 42012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 43084 43815 gene locus_tag LOCUS_14070 43084 43815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 43818 44375 gene locus_tag LOCUS_14080 43818 44375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 <45705 44653 gene locus_tag LOCUS_14090 <45705 44653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390203.1:peptidase M48 >Feature sequence024 1393 998 gene locus_tag LOCUS_14100 1393 998 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975605.1 protein_id gnl|my_center|LOCUS_14100 1881 1423 gene locus_tag LOCUS_14110 1881 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 2325 1912 gene locus_tag LOCUS_14120 2325 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 3184 2354 gene locus_tag LOCUS_14130 3184 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 4813 3311 gene locus_tag LOCUS_14140 4813 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 7020 4813 gene locus_tag LOCUS_14150 7020 4813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 8915 7017 gene locus_tag LOCUS_14160 8915 7017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 10443 9007 gene locus_tag LOCUS_14170 10443 9007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 11475 10507 gene locus_tag LOCUS_14180 11475 10507 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261418.1 protein_id gnl|my_center|LOCUS_14180 13564 11468 gene locus_tag LOCUS_14190 13564 11468 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706661.1 protein_id gnl|my_center|LOCUS_14190 15167 13569 gene locus_tag LOCUS_14200 15167 13569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 16521 15175 gene locus_tag LOCUS_14210 16521 15175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 16643 18328 gene locus_tag LOCUS_14220 16643 18328 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008920793.1 protein_id gnl|my_center|LOCUS_14220 18332 19255 gene locus_tag LOCUS_14230 gene oppB 18332 19255 CDS product oligopeptide transport system permease protein OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24138 protein_id gnl|my_center|LOCUS_14230 19252 20205 gene locus_tag LOCUS_14240 19252 20205 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144110.1 protein_id gnl|my_center|LOCUS_14240 20208 21971 gene locus_tag LOCUS_14250 20208 21971 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056770.1 protein_id gnl|my_center|LOCUS_14250 22864 21968 gene locus_tag LOCUS_14260 22864 21968 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435007.1 protein_id gnl|my_center|LOCUS_14260 23353 22880 gene locus_tag LOCUS_14270 23353 22880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 24135 23362 gene locus_tag LOCUS_14280 24135 23362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 25153 24254 gene locus_tag LOCUS_14290 25153 24254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117866.1 protein_id gnl|my_center|LOCUS_14290 25798 25406 gene locus_tag LOCUS_14300 25798 25406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 26918 25926 gene locus_tag LOCUS_14310 26918 25926 CDS product zinc ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256103.1 protein_id gnl|my_center|LOCUS_14310 28454 26925 gene locus_tag LOCUS_14320 gene mntB 28454 26925 CDS product manganese ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123736.1 protein_id gnl|my_center|LOCUS_14320 29244 28444 gene locus_tag LOCUS_14330 gene mntB 29244 28444 CDS product manganese transport system ATP-binding protein MntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34338 protein_id gnl|my_center|LOCUS_14330 30187 29249 gene locus_tag LOCUS_14340 gene mtsA 30187 29249 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123738.1 protein_id gnl|my_center|LOCUS_14340 30281 30943 gene locus_tag LOCUS_14350 30281 30943 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404773.1 protein_id gnl|my_center|LOCUS_14350 31114 32157 gene locus_tag LOCUS_14360 31114 32157 CDS product AP endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_14360 32183 33343 gene locus_tag LOCUS_14370 32183 33343 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405244.1 protein_id gnl|my_center|LOCUS_14370 33348 34433 gene locus_tag LOCUS_14380 33348 34433 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_14380 34526 36079 gene locus_tag LOCUS_14390 34526 36079 CDS product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118678.1 protein_id gnl|my_center|LOCUS_14390 36423 38777 gene locus_tag LOCUS_14400 36423 38777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 39156 38881 gene locus_tag LOCUS_14410 39156 38881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 40020 41861 gene locus_tag LOCUS_14420 40020 41861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 41988 44315 gene locus_tag LOCUS_14430 41988 44315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 >Feature sequence025 412 1950 gene locus_tag LOCUS_14440 gene guaA 412 1950 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHY9 protein_id gnl|my_center|LOCUS_14440 1991 3298 gene locus_tag LOCUS_14450 gene hisD 1991 3298 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P6L4 protein_id gnl|my_center|LOCUS_14450 3307 4410 gene locus_tag LOCUS_14460 gene hisC 3307 4410 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61000 protein_id gnl|my_center|LOCUS_14460 4383 4985 gene locus_tag LOCUS_14470 gene hisB 4383 4985 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60885 protein_id gnl|my_center|LOCUS_14470 5009 5635 gene locus_tag LOCUS_14480 gene hisH 5009 5635 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66943 protein_id gnl|my_center|LOCUS_14480 5707 6993 gene locus_tag LOCUS_14490 gene gltA 5707 6993 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPW5 protein_id gnl|my_center|LOCUS_14490 7757 6990 gene locus_tag LOCUS_14500 7757 6990 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841479.1 protein_id gnl|my_center|LOCUS_14500 7828 8493 gene locus_tag LOCUS_14510 7828 8493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 8490 9665 gene locus_tag LOCUS_14520 8490 9665 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679701.1 protein_id gnl|my_center|LOCUS_14520 9705 11084 gene locus_tag LOCUS_14530 9705 11084 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_14530 11177 11103 gene locus_tag LOCUS_t00170 11177 11103 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 11335 12033 gene locus_tag LOCUS_14540 gene rplY 11335 12033 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FE7 protein_id gnl|my_center|LOCUS_14540 12109 12696 gene locus_tag LOCUS_14550 gene pth 12109 12696 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1W1 protein_id gnl|my_center|LOCUS_14550 12689 12985 gene locus_tag LOCUS_14560 12689 12985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 12988 13479 gene locus_tag LOCUS_14570 gene ssb 12988 13479 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59932 protein_id gnl|my_center|LOCUS_14570 13524 13991 gene locus_tag LOCUS_14580 gene rplI 13524 13991 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67830 protein_id gnl|my_center|LOCUS_14580 14026 15459 gene locus_tag LOCUS_14590 gene dnaC 14026 15459 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97CY1 protein_id gnl|my_center|LOCUS_14590 15644 17854 gene locus_tag LOCUS_14600 15644 17854 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546857.1 protein_id gnl|my_center|LOCUS_14600 17876 18430 gene locus_tag LOCUS_14610 17876 18430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 18472 19497 gene locus_tag LOCUS_14620 gene lpxD 18472 19497 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z8N6 protein_id gnl|my_center|LOCUS_14620 19517 20467 gene locus_tag LOCUS_14630 gene prs 19517 20467 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG56 protein_id gnl|my_center|LOCUS_14630 20550 22037 gene locus_tag LOCUS_14640 20550 22037 CDS product MucD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545685.1 protein_id gnl|my_center|LOCUS_14640 22425 22066 gene locus_tag LOCUS_14650 22425 22066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 23991 23389 gene locus_tag LOCUS_14660 23991 23389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 25133 23988 gene locus_tag LOCUS_14670 gene cioF 25133 23988 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125772.1 protein_id gnl|my_center|LOCUS_14670 25786 25130 gene locus_tag LOCUS_14680 25786 25130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 26798 25794 gene locus_tag LOCUS_14690 gene bioB 26798 25794 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CU5 protein_id gnl|my_center|LOCUS_14690 28177 26795 gene locus_tag LOCUS_14700 gene bioA 28177 26795 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CT9 protein_id gnl|my_center|LOCUS_14700 29120 28236 gene locus_tag LOCUS_14710 gene prmA 29120 28236 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0DJO9 protein_id gnl|my_center|LOCUS_14710 29707 29117 gene locus_tag LOCUS_14720 gene purN 29707 29117 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YK81 protein_id gnl|my_center|LOCUS_14720 30251 29730 gene locus_tag LOCUS_14730 30251 29730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 31399 30248 gene locus_tag LOCUS_14740 gene dnaJ 31399 30248 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H58 protein_id gnl|my_center|LOCUS_14740 32056 31412 gene locus_tag LOCUS_14750 gene grpE 32056 31412 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAL0 protein_id gnl|my_center|LOCUS_14750 33102 32128 gene locus_tag LOCUS_14760 gene pmi 33102 32128 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122560.1 protein_id gnl|my_center|LOCUS_14760 33184 35742 gene locus_tag LOCUS_14770 33184 35742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 35832 36566 gene locus_tag LOCUS_14780 35832 36566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 37079 36567 gene locus_tag LOCUS_14790 37079 36567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 38107 37109 gene locus_tag LOCUS_14800 gene yqfA 38107 37109 CDS product UPF0365 protein YqfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54466 protein_id gnl|my_center|LOCUS_14800 38644 38177 gene locus_tag LOCUS_14810 38644 38177 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812221.1 protein_id gnl|my_center|LOCUS_14810 40050 38641 gene locus_tag LOCUS_14820 40050 38641 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228400.1 protein_id gnl|my_center|LOCUS_14820 40304 41128 gene locus_tag LOCUS_14830 40304 41128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526695.1 protein_id gnl|my_center|LOCUS_14830 42265 41135 gene locus_tag LOCUS_14840 42265 41135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 <44315 42267 gene locus_tag LOCUS_14850 <44315 42267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005454529.1:membrane protein >Feature sequence026 1274 1519 gene locus_tag LOCUS_14860 1274 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 2145 1855 gene locus_tag LOCUS_14870 2145 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 2241 3005 gene locus_tag LOCUS_14880 gene uppS 2241 3005 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1E0 protein_id gnl|my_center|LOCUS_14880 2999 3856 gene locus_tag LOCUS_14890 2999 3856 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAG4 protein_id gnl|my_center|LOCUS_14890 3853 5022 gene locus_tag LOCUS_14900 gene dxr 3853 5022 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1H0 protein_id gnl|my_center|LOCUS_14900 5019 6479 gene locus_tag LOCUS_14910 5019 6479 CDS product putative zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67776 protein_id gnl|my_center|LOCUS_14910 6490 8484 gene locus_tag LOCUS_14920 gene ispG 6490 8484 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F1H5 protein_id gnl|my_center|LOCUS_14920 8469 9308 gene locus_tag LOCUS_14930 8469 9308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 10130 9327 gene locus_tag LOCUS_14940 10130 9327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 10282 11952 gene locus_tag LOCUS_14950 10282 11952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 14268 11971 gene locus_tag LOCUS_14960 14268 11971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 15986 14265 gene locus_tag LOCUS_14970 15986 14265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 16989 16069 gene locus_tag LOCUS_14980 16989 16069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 18218 17085 gene locus_tag LOCUS_14990 18218 17085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 18412 19851 gene locus_tag LOCUS_15000 18412 19851 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_15000 21266 19914 gene locus_tag LOCUS_15010 21266 19914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 21805 21266 gene locus_tag LOCUS_15020 gene rpoE 21805 21266 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224545.1 protein_id gnl|my_center|LOCUS_15020 24020 21966 gene locus_tag LOCUS_15030 24020 21966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085445.1 protein_id gnl|my_center|LOCUS_15030 24199 24483 gene locus_tag LOCUS_15040 24199 24483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 25211 24447 gene locus_tag LOCUS_15050 25211 24447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 25617 25234 gene locus_tag LOCUS_15060 25617 25234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 26606 25614 gene locus_tag LOCUS_15070 26606 25614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 28171 26603 gene locus_tag LOCUS_15080 28171 26603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 30373 28184 gene locus_tag LOCUS_15090 30373 28184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 33540 30376 gene locus_tag LOCUS_15100 33540 30376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 35536 33533 gene locus_tag LOCUS_15110 35536 33533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 36435 35536 gene locus_tag LOCUS_15120 36435 35536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121742.1 protein_id gnl|my_center|LOCUS_15120 37485 36460 gene locus_tag LOCUS_15130 gene moxR 37485 36460 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_15130 39139 37664 gene locus_tag LOCUS_15140 39139 37664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 42444 39136 gene locus_tag LOCUS_15150 42444 39136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 43494 42553 gene locus_tag LOCUS_15160 43494 42553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 >Feature sequence027 287 778 gene locus_tag LOCUS_15170 287 778 CDS product azurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYW1 protein_id gnl|my_center|LOCUS_15170 876 2738 gene locus_tag LOCUS_15180 876 2738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119625.1 protein_id gnl|my_center|LOCUS_15180 2638 3387 gene locus_tag LOCUS_15190 2638 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 3412 5448 gene locus_tag LOCUS_15200 3412 5448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 5441 6931 gene locus_tag LOCUS_15210 5441 6931 CDS product large multi-functional protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119646.1 protein_id gnl|my_center|LOCUS_15210 7294 6956 gene locus_tag LOCUS_15220 7294 6956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 7453 8433 gene locus_tag LOCUS_15230 7453 8433 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584122.1 protein_id gnl|my_center|LOCUS_15230 8453 9547 gene locus_tag LOCUS_15240 8453 9547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 9588 10688 gene locus_tag LOCUS_15250 9588 10688 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919370.1 protein_id gnl|my_center|LOCUS_15250 10717 11496 gene locus_tag LOCUS_15260 10717 11496 CDS product D-mannonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332279.1 protein_id gnl|my_center|LOCUS_15260 11542 12423 gene locus_tag LOCUS_15270 11542 12423 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941571.1 protein_id gnl|my_center|LOCUS_15270 12696 12493 gene locus_tag LOCUS_15280 12696 12493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 12869 13945 gene locus_tag LOCUS_15290 gene moxR 12869 13945 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122095.1 protein_id gnl|my_center|LOCUS_15290 13929 14840 gene locus_tag LOCUS_15300 13929 14840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324190.1 protein_id gnl|my_center|LOCUS_15300 14863 16845 gene locus_tag LOCUS_15310 14863 16845 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122098.1 protein_id gnl|my_center|LOCUS_15310 16842 19136 gene locus_tag LOCUS_15320 16842 19136 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122099.1 protein_id gnl|my_center|LOCUS_15320 19272 22388 gene locus_tag LOCUS_15330 19272 22388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 22400 23437 gene locus_tag LOCUS_15340 22400 23437 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122104.1 protein_id gnl|my_center|LOCUS_15340 23427 27299 gene locus_tag LOCUS_15350 23427 27299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 27374 27700 gene locus_tag LOCUS_15360 27374 27700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 27954 28397 gene locus_tag LOCUS_15370 27954 28397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 29180 28860 gene locus_tag LOCUS_15380 29180 28860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 29517 29425 gene locus_tag LOCUS_t00180 29517 29425 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 30946 29609 gene locus_tag LOCUS_15390 30946 29609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749215.1 protein_id gnl|my_center|LOCUS_15390 31111 31569 gene locus_tag LOCUS_15400 31111 31569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 32868 31588 gene locus_tag LOCUS_15410 32868 31588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201992.1 protein_id gnl|my_center|LOCUS_15410 33479 32871 gene locus_tag LOCUS_15420 33479 32871 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263295.1 protein_id gnl|my_center|LOCUS_15420 34663 33485 gene locus_tag LOCUS_15430 gene glxK 34663 33485 CDS product glycerate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554710.1 protein_id gnl|my_center|LOCUS_15430 36456 34702 gene locus_tag LOCUS_15440 gene cafA 36456 34702 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_15440 37793 36531 gene locus_tag LOCUS_15450 gene rodA 37793 36531 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931982.1 protein_id gnl|my_center|LOCUS_15450 38149 37847 gene locus_tag LOCUS_15460 38149 37847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087848.1 protein_id gnl|my_center|LOCUS_15460 38945 38193 gene locus_tag LOCUS_15470 38945 38193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 40484 38949 gene locus_tag LOCUS_15480 40484 38949 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_15480 40771 40920 gene locus_tag LOCUS_15490 40771 40920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 41893 41015 gene locus_tag LOCUS_15500 41893 41015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 41839 42084 gene locus_tag LOCUS_15510 41839 42084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 43210 42086 gene locus_tag LOCUS_15520 43210 42086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 >Feature sequence028 1126 4839 gene locus_tag LOCUS_15530 1126 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 4948 6117 gene locus_tag LOCUS_15540 gene fabV 4948 6117 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z9U1 protein_id gnl|my_center|LOCUS_15540 6180 6794 gene locus_tag LOCUS_15550 6180 6794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 6901 8100 gene locus_tag LOCUS_15560 6901 8100 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706898.1 protein_id gnl|my_center|LOCUS_15560 8123 10138 gene locus_tag LOCUS_15570 gene ligA 8123 10138 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5Q8 protein_id gnl|my_center|LOCUS_15570 11151 10159 gene locus_tag LOCUS_15580 11151 10159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 11271 12392 gene locus_tag LOCUS_15590 gene ribBA 11271 12392 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK05 protein_id gnl|my_center|LOCUS_15590 12405 12887 gene locus_tag LOCUS_15600 gene ribH 12405 12887 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CCP3 protein_id gnl|my_center|LOCUS_15600 12884 13660 gene locus_tag LOCUS_15610 12884 13660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 15024 13699 gene locus_tag LOCUS_15620 15024 13699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 15955 15071 gene locus_tag LOCUS_15630 gene purU 15955 15071 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67681 protein_id gnl|my_center|LOCUS_15630 19196 15969 gene locus_tag LOCUS_15640 gene carB 19196 15969 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DP0 protein_id gnl|my_center|LOCUS_15640 19619 19284 gene locus_tag LOCUS_15650 19619 19284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 20402 19737 gene locus_tag LOCUS_15660 20402 19737 CDS product NAD dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733273.1 protein_id gnl|my_center|LOCUS_15660 21963 20410 gene locus_tag LOCUS_15670 21963 20410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 23447 21990 gene locus_tag LOCUS_15680 23447 21990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332558.1 protein_id gnl|my_center|LOCUS_15680 23337 25364 gene locus_tag LOCUS_15690 23337 25364 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 protein_id gnl|my_center|LOCUS_15690 25404 25961 gene locus_tag LOCUS_15700 25404 25961 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036085.1 protein_id gnl|my_center|LOCUS_15700 25973 26434 gene locus_tag LOCUS_15710 25973 26434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 29373 26449 gene locus_tag LOCUS_15720 gene secA 29373 26449 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD18 protein_id gnl|my_center|LOCUS_15720 30407 29472 gene locus_tag LOCUS_15730 30407 29472 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119523.1 protein_id gnl|my_center|LOCUS_15730 31827 30532 gene locus_tag LOCUS_15740 31827 30532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 32970 31888 gene locus_tag LOCUS_15750 32970 31888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 34020 33007 gene locus_tag LOCUS_15760 34020 33007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 35204 34071 gene locus_tag LOCUS_15770 35204 34071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 35273 35743 gene locus_tag LOCUS_15780 35273 35743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 36784 35855 gene locus_tag LOCUS_15790 36784 35855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 37219 36785 gene locus_tag LOCUS_15800 37219 36785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 37405 38391 gene locus_tag LOCUS_15810 37405 38391 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403126.1 protein_id gnl|my_center|LOCUS_15810 39778 38405 gene locus_tag LOCUS_15820 39778 38405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 41289 39775 gene locus_tag LOCUS_15830 gene rbsA2 41289 39775 CDS product ribose import ATP-binding protein RbsA 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RDI1 protein_id gnl|my_center|LOCUS_15830 42311 41292 gene locus_tag LOCUS_15840 42311 41292 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392149.1 protein_id gnl|my_center|LOCUS_15840 <43237 42458 gene locus_tag LOCUS_15850 <43237 42458 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119052.1:sulfatase >Feature sequence029 1 1185 gene locus_tag LOCUS_15860 1 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 1204 2631 gene locus_tag LOCUS_15870 1204 2631 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326676.1 protein_id gnl|my_center|LOCUS_15870 2707 3657 gene locus_tag LOCUS_15880 2707 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15880 3584 5863 gene locus_tag LOCUS_15890 3584 5863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15890 5919 8795 gene locus_tag LOCUS_15900 5919 8795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 10158 8827 gene locus_tag LOCUS_15910 10158 8827 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119046.1 protein_id gnl|my_center|LOCUS_15910 12775 10259 gene locus_tag LOCUS_15920 12775 10259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 14035 13028 gene locus_tag LOCUS_15930 14035 13028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 16724 14070 gene locus_tag LOCUS_15940 16724 14070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 18423 16915 gene locus_tag LOCUS_15950 18423 16915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122305.1 protein_id gnl|my_center|LOCUS_15950 20002 18407 gene locus_tag LOCUS_15960 20002 18407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 21407 20076 gene locus_tag LOCUS_15970 21407 20076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119116.1 protein_id gnl|my_center|LOCUS_15970 21680 22633 gene locus_tag LOCUS_15980 21680 22633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 22731 23651 gene locus_tag LOCUS_15990 22731 23651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 23804 24286 gene locus_tag LOCUS_16000 gene rpsH 23804 24286 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UW29 protein_id gnl|my_center|LOCUS_16000 24283 24966 gene locus_tag LOCUS_16010 24283 24966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 25026 25949 gene locus_tag LOCUS_16020 25026 25949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 26621 25953 gene locus_tag LOCUS_16030 26621 25953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 26667 28343 gene locus_tag LOCUS_16040 gene leuA 26667 28343 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97MC5 protein_id gnl|my_center|LOCUS_16040 28650 31331 gene locus_tag LOCUS_16050 28650 31331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 31849 31328 gene locus_tag LOCUS_16060 31849 31328 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67613 protein_id gnl|my_center|LOCUS_16060 31981 33609 gene locus_tag LOCUS_16070 31981 33609 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403181.1 protein_id gnl|my_center|LOCUS_16070 33690 34967 gene locus_tag LOCUS_16080 gene hemL 33690 34967 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNA0 protein_id gnl|my_center|LOCUS_16080 35109 35768 gene locus_tag LOCUS_16090 35109 35768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 37039 35813 gene locus_tag LOCUS_16100 gene lpxK 37039 35813 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AU2 protein_id gnl|my_center|LOCUS_16100 37195 37557 gene locus_tag LOCUS_16110 gene panD 37195 37557 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFS0 protein_id gnl|my_center|LOCUS_16110 37595 38689 gene locus_tag LOCUS_16120 37595 38689 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943872.1 protein_id gnl|my_center|LOCUS_16120 38754 41231 gene locus_tag LOCUS_16130 gene topB 38754 41231 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200734.1 protein_id gnl|my_center|LOCUS_16130 >Feature sequence030 2386 1268 gene locus_tag LOCUS_16140 2386 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 3329 2526 gene locus_tag LOCUS_16150 3329 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 3892 3326 gene locus_tag LOCUS_16160 3892 3326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 4368 3913 gene locus_tag LOCUS_16170 4368 3913 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_16170 5596 4373 gene locus_tag LOCUS_16180 gene sufS 5596 4373 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2S3 protein_id gnl|my_center|LOCUS_16180 6854 5610 gene locus_tag LOCUS_16190 6854 5610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 8179 6887 gene locus_tag LOCUS_16200 8179 6887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327912.1 protein_id gnl|my_center|LOCUS_16200 10636 8213 gene locus_tag LOCUS_16210 10636 8213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 12832 10889 gene locus_tag LOCUS_16220 12832 10889 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640158.1 protein_id gnl|my_center|LOCUS_16220 13135 12908 gene locus_tag LOCUS_16230 13135 12908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 13740 13147 gene locus_tag LOCUS_16240 gene ctaE 13740 13147 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057844.1 protein_id gnl|my_center|LOCUS_16240 14133 13765 gene locus_tag LOCUS_16250 14133 13765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 14786 14154 gene locus_tag LOCUS_16260 14786 14154 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404826.1 protein_id gnl|my_center|LOCUS_16260 16531 14816 gene locus_tag LOCUS_16270 gene coxN 16531 14816 CDS product alternative cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P98000 protein_id gnl|my_center|LOCUS_16270 17297 16563 gene locus_tag LOCUS_16280 gene coxM 17297 16563 CDS product alternative cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P98053 protein_id gnl|my_center|LOCUS_16280 17949 17338 gene locus_tag LOCUS_16290 17949 17338 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833353.1 protein_id gnl|my_center|LOCUS_16290 18712 17942 gene locus_tag LOCUS_16300 18712 17942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 20441 18879 gene locus_tag LOCUS_16310 20441 18879 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976195.1 protein_id gnl|my_center|LOCUS_16310 20880 20485 gene locus_tag LOCUS_16320 gene cdd 20880 20485 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086294.1 protein_id gnl|my_center|LOCUS_16320 22193 20883 gene locus_tag LOCUS_16330 22193 20883 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082160.1 protein_id gnl|my_center|LOCUS_16330 22570 23208 gene locus_tag LOCUS_16340 gene gpmB 22570 23208 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809593.1 protein_id gnl|my_center|LOCUS_16340 24468 23212 gene locus_tag LOCUS_16350 24468 23212 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 protein_id gnl|my_center|LOCUS_16350 25532 24492 gene locus_tag LOCUS_16360 25532 24492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 26668 25559 gene locus_tag LOCUS_16370 26668 25559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 26849 27106 gene locus_tag LOCUS_16380 26849 27106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 28064 27126 gene locus_tag LOCUS_16390 gene apaH 28064 27126 CDS product diadenosine tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124047.1 protein_id gnl|my_center|LOCUS_16390 28604 28128 gene locus_tag LOCUS_16400 28604 28128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 29158 28691 gene locus_tag LOCUS_16410 29158 28691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 29644 29171 gene locus_tag LOCUS_16420 29644 29171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 31106 29619 gene locus_tag LOCUS_16430 31106 29619 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121859.1 protein_id gnl|my_center|LOCUS_16430 34138 31049 gene locus_tag LOCUS_16440 gene cti 34138 31049 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121858.1 protein_id gnl|my_center|LOCUS_16440 35731 34217 gene locus_tag LOCUS_16450 35731 34217 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963148.1 protein_id gnl|my_center|LOCUS_16450 36135 35728 gene locus_tag LOCUS_16460 36135 35728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 36802 36365 gene locus_tag LOCUS_16470 36802 36365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 40774 36872 gene locus_tag LOCUS_16480 40774 36872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 <41850 40813 gene locus_tag LOCUS_16490 <41850 40813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121095.1:choline-sulfatase >Feature sequence031 115 1569 gene locus_tag LOCUS_16500 115 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 1739 1900 gene locus_tag LOCUS_16510 1739 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 2054 2833 gene locus_tag LOCUS_16520 2054 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 5480 2886 gene locus_tag LOCUS_16530 5480 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 5492 6070 gene locus_tag LOCUS_16540 5492 6070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 6975 6085 gene locus_tag LOCUS_16550 6975 6085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 7143 7724 gene locus_tag LOCUS_16560 7143 7724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 8472 7759 gene locus_tag LOCUS_16570 8472 7759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 9292 8513 gene locus_tag LOCUS_16580 9292 8513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269372.1 protein_id gnl|my_center|LOCUS_16580 9433 10809 gene locus_tag LOCUS_16590 9433 10809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 11401 10820 gene locus_tag LOCUS_16600 11401 10820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 11528 12253 gene locus_tag LOCUS_16610 11528 12253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 12532 12260 gene locus_tag LOCUS_16620 12532 12260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 13295 12615 gene locus_tag LOCUS_16630 13295 12615 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080583.1 protein_id gnl|my_center|LOCUS_16630 13725 13288 gene locus_tag LOCUS_16640 13725 13288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 13851 14480 gene locus_tag LOCUS_16650 13851 14480 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085667.1 protein_id gnl|my_center|LOCUS_16650 14537 15169 gene locus_tag LOCUS_16660 14537 15169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 15225 15638 gene locus_tag LOCUS_16670 15225 15638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 16199 15774 gene locus_tag LOCUS_16680 16199 15774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 17422 16337 gene locus_tag LOCUS_16690 17422 16337 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119138.1 protein_id gnl|my_center|LOCUS_16690 18100 17486 gene locus_tag LOCUS_16700 18100 17486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 19659 18262 gene locus_tag LOCUS_16710 19659 18262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 21288 19954 gene locus_tag LOCUS_16720 21288 19954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124058.1 protein_id gnl|my_center|LOCUS_16720 23216 21315 gene locus_tag LOCUS_16730 23216 21315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124057.1 protein_id gnl|my_center|LOCUS_16730 23325 25202 gene locus_tag LOCUS_16740 23325 25202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 25796 25233 gene locus_tag LOCUS_16750 25796 25233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 27214 25901 gene locus_tag LOCUS_16760 27214 25901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 28736 27273 gene locus_tag LOCUS_16770 28736 27273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 30914 28839 gene locus_tag LOCUS_16780 gene macB 30914 28839 CDS product macrolide export ATP-binding/permease protein MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFE9 protein_id gnl|my_center|LOCUS_16780 32446 30983 gene locus_tag LOCUS_16790 32446 30983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 34839 32500 gene locus_tag LOCUS_16800 34839 32500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121404.1 protein_id gnl|my_center|LOCUS_16800 35481 34954 gene locus_tag LOCUS_16810 35481 34954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 35453 35680 gene locus_tag LOCUS_16820 35453 35680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 36903 35623 gene locus_tag LOCUS_16830 36903 35623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002347434.1 protein_id gnl|my_center|LOCUS_16830 37101 39299 gene locus_tag LOCUS_16840 37101 39299 CDS product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481838.1 protein_id gnl|my_center|LOCUS_16840 41324 39720 gene locus_tag LOCUS_16850 gene arsB 41324 39720 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122841.1 protein_id gnl|my_center|LOCUS_16850 >Feature sequence032 8264 10276 gene locus_tag LOCUS_16860 8264 10276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 10341 11750 gene locus_tag LOCUS_16870 gene leuC 10341 11750 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZND5 protein_id gnl|my_center|LOCUS_16870 11760 12356 gene locus_tag LOCUS_16880 gene leuD 11760 12356 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZND4 protein_id gnl|my_center|LOCUS_16880 12353 13069 gene locus_tag LOCUS_16890 12353 13069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 13072 13524 gene locus_tag LOCUS_16900 gene exbD2 13072 13524 CDS product transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085366.1 protein_id gnl|my_center|LOCUS_16900 14363 13545 gene locus_tag LOCUS_16910 14363 13545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 15243 14368 gene locus_tag LOCUS_16920 15243 14368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 15636 15313 gene locus_tag LOCUS_16930 15636 15313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 17339 15633 gene locus_tag LOCUS_16940 gene glnS 17339 15633 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q727A5 protein_id gnl|my_center|LOCUS_16940 18893 17370 gene locus_tag LOCUS_16950 gene gltX 18893 17370 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZV02 protein_id gnl|my_center|LOCUS_16950 20732 18945 gene locus_tag LOCUS_16960 gene msbA 20732 18945 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_16960 21534 20773 gene locus_tag LOCUS_16970 21534 20773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 21988 22977 gene locus_tag LOCUS_16980 21988 22977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 23951 22932 gene locus_tag LOCUS_16990 23951 22932 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865945.1 protein_id gnl|my_center|LOCUS_16990 25057 23948 gene locus_tag LOCUS_17000 gene lpsB 25057 23948 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208294.1 protein_id gnl|my_center|LOCUS_17000 25177 26250 gene locus_tag LOCUS_17010 25177 26250 CDS product heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942161.1 protein_id gnl|my_center|LOCUS_17010 27082 26264 gene locus_tag LOCUS_17020 27082 26264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 27333 27118 gene locus_tag LOCUS_17030 27333 27118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 27439 28704 gene locus_tag LOCUS_17040 gene serS 27439 28704 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1G4 protein_id gnl|my_center|LOCUS_17040 28763 30217 gene locus_tag LOCUS_17050 gene tilS 28763 30217 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C65 protein_id gnl|my_center|LOCUS_17050 30217 32220 gene locus_tag LOCUS_17060 gene ftsH 30217 32220 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H444 protein_id gnl|my_center|LOCUS_17060 32469 32314 gene locus_tag LOCUS_17070 32469 32314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 32888 32526 gene locus_tag LOCUS_17080 gene cutA 32888 32526 CDS product cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122616.1 protein_id gnl|my_center|LOCUS_17080 32999 33208 gene locus_tag LOCUS_17090 32999 33208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 33290 33739 gene locus_tag LOCUS_17100 gene smpB 33290 33739 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CG4 protein_id gnl|my_center|LOCUS_17100 33736 34191 gene locus_tag LOCUS_17110 gene trmL 33736 34191 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLR4 protein_id gnl|my_center|LOCUS_17110 34222 35250 gene locus_tag LOCUS_17120 34222 35250 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937445.1 protein_id gnl|my_center|LOCUS_17120 35344 36654 gene locus_tag LOCUS_17130 35344 36654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119642.1 protein_id gnl|my_center|LOCUS_17130 36651 39368 gene locus_tag LOCUS_17140 36651 39368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 39362 40888 gene locus_tag LOCUS_17150 39362 40888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122305.1 protein_id gnl|my_center|LOCUS_17150 41257 41435 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggcaagaagccaagtggcgaccatcgcg >Feature sequence033 245 844 gene locus_tag LOCUS_17160 245 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 940 2895 gene locus_tag LOCUS_17170 940 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 2927 3262 gene locus_tag LOCUS_17180 2927 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 3343 3891 gene locus_tag LOCUS_17190 3343 3891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 3967 4389 gene locus_tag LOCUS_17200 3967 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 4386 5006 gene locus_tag LOCUS_17210 gene coaE 4386 5006 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q817G7 protein_id gnl|my_center|LOCUS_17210 5044 6771 gene locus_tag LOCUS_17220 5044 6771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 6813 8519 gene locus_tag LOCUS_17230 6813 8519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 8523 10214 gene locus_tag LOCUS_17240 gene pilB 8523 10214 CDS product type IV fimbrial assembly protein PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123902.1 protein_id gnl|my_center|LOCUS_17240 10237 11484 gene locus_tag LOCUS_17250 gene pilC 10237 11484 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_17250 12119 11535 gene locus_tag LOCUS_17260 12119 11535 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706500.1 protein_id gnl|my_center|LOCUS_17260 12191 12637 gene locus_tag LOCUS_17270 12191 12637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 12724 13668 gene locus_tag LOCUS_17280 12724 13668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 13799 14776 gene locus_tag LOCUS_17290 13799 14776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 14773 15867 gene locus_tag LOCUS_17300 14773 15867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 16705 15875 gene locus_tag LOCUS_17310 16705 15875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 17541 16702 gene locus_tag LOCUS_17320 17541 16702 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124073.1 protein_id gnl|my_center|LOCUS_17320 19850 17643 gene locus_tag LOCUS_17330 19850 17643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 20408 19929 gene locus_tag LOCUS_17340 20408 19929 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142372.1 protein_id gnl|my_center|LOCUS_17340 20512 20904 gene locus_tag LOCUS_17350 20512 20904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 25475 20901 gene locus_tag LOCUS_17360 25475 20901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 27023 25527 gene locus_tag LOCUS_17370 27023 25527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 28171 27020 gene locus_tag LOCUS_17380 28171 27020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 29505 28402 gene locus_tag LOCUS_17390 29505 28402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 30838 29576 gene locus_tag LOCUS_17400 30838 29576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 31087 31542 gene locus_tag LOCUS_17410 31087 31542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 33916 31562 gene locus_tag LOCUS_17420 33916 31562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 34158 34757 gene locus_tag LOCUS_17430 gene ribB 34158 34757 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130990.1 protein_id gnl|my_center|LOCUS_17430 34754 35632 gene locus_tag LOCUS_17440 34754 35632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 35651 36271 gene locus_tag LOCUS_17450 35651 36271 CDS product thiamine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338181.1 protein_id gnl|my_center|LOCUS_17450 36836 36273 gene locus_tag LOCUS_17460 36836 36273 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404273.1 protein_id gnl|my_center|LOCUS_17460 37882 36833 gene locus_tag LOCUS_17470 37882 36833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 38110 39759 gene locus_tag LOCUS_17480 38110 39759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 40280 39765 gene locus_tag LOCUS_17490 gene folK 40280 39765 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943608.1 protein_id gnl|my_center|LOCUS_17490 40620 40270 gene locus_tag LOCUS_17500 40620 40270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 >Feature sequence034 <1 1210 gene locus_tag LOCUS_17510 <1 1210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120681.1:sulfatase 1855 1235 gene locus_tag LOCUS_17520 1855 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 3546 1852 gene locus_tag LOCUS_17530 3546 1852 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117793.1 protein_id gnl|my_center|LOCUS_17530 3759 5330 gene locus_tag LOCUS_17540 3759 5330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 5388 6512 gene locus_tag LOCUS_17550 5388 6512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 7266 6571 gene locus_tag LOCUS_17560 7266 6571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 7553 8788 gene locus_tag LOCUS_17570 gene pepP 7553 8788 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_17570 10174 8855 gene locus_tag LOCUS_17580 10174 8855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 10325 11194 gene locus_tag LOCUS_17590 10325 11194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 11191 12786 gene locus_tag LOCUS_17600 gene arsA 11191 12786 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121409.1 protein_id gnl|my_center|LOCUS_17600 13015 13629 gene locus_tag LOCUS_17610 13015 13629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 14944 13667 gene locus_tag LOCUS_17620 14944 13667 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118005.1 protein_id gnl|my_center|LOCUS_17620 16116 14941 gene locus_tag LOCUS_17630 16116 14941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123797.1 protein_id gnl|my_center|LOCUS_17630 16278 18539 gene locus_tag LOCUS_17640 16278 18539 CDS product NADH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121573.1 protein_id gnl|my_center|LOCUS_17640 18546 20372 gene locus_tag LOCUS_17650 gene nosR 18546 20372 CDS product NosR regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121575.1 protein_id gnl|my_center|LOCUS_17650 20374 21393 gene locus_tag LOCUS_17660 20374 21393 CDS product thiamin biosynthesis lipoprotein ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_231920.2 protein_id gnl|my_center|LOCUS_17660 21461 23530 gene locus_tag LOCUS_17670 21461 23530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 23553 25007 gene locus_tag LOCUS_17680 gene arsA 23553 25007 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_17680 25021 25572 gene locus_tag LOCUS_17690 25021 25572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 25751 27115 gene locus_tag LOCUS_17700 25751 27115 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123571.1 protein_id gnl|my_center|LOCUS_17700 27228 27722 gene locus_tag LOCUS_17710 27228 27722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 27771 29234 gene locus_tag LOCUS_17720 27771 29234 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123571.1 protein_id gnl|my_center|LOCUS_17720 29272 30549 gene locus_tag LOCUS_17730 29272 30549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 32959 30566 gene locus_tag LOCUS_17740 32959 30566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 32959 33159 gene locus_tag LOCUS_17750 32959 33159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 33164 35260 gene locus_tag LOCUS_17760 33164 35260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 35257 35838 gene locus_tag LOCUS_17770 35257 35838 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140820.1 protein_id gnl|my_center|LOCUS_17770 35945 38257 gene locus_tag LOCUS_17780 35945 38257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122548.1 protein_id gnl|my_center|LOCUS_17780 38254 39570 gene locus_tag LOCUS_17790 38254 39570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122547.1 protein_id gnl|my_center|LOCUS_17790 39598 40227 gene locus_tag LOCUS_17800 39598 40227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 >Feature sequence035 1114 200 gene locus_tag LOCUS_17810 1114 200 CDS product putative 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WJ7 protein_id gnl|my_center|LOCUS_17810 2428 1124 gene locus_tag LOCUS_17820 2428 1124 CDS product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267913.1 protein_id gnl|my_center|LOCUS_17820 3880 2432 gene locus_tag LOCUS_17830 gene gntP 3880 2432 CDS product gluconate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122824.1 protein_id gnl|my_center|LOCUS_17830 4799 3915 gene locus_tag LOCUS_17840 4799 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 9406 4844 gene locus_tag LOCUS_17850 9406 4844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 14127 9583 gene locus_tag LOCUS_17860 14127 9583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 15953 14220 gene locus_tag LOCUS_17870 15953 14220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 16086 17072 gene locus_tag LOCUS_17880 16086 17072 CDS product thiamine biosynthesis lipoprotein ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461458.1 protein_id gnl|my_center|LOCUS_17880 17056 17337 gene locus_tag LOCUS_17890 17056 17337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 17469 17888 gene locus_tag LOCUS_17900 17469 17888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582775.1 protein_id gnl|my_center|LOCUS_17900 17963 19342 gene locus_tag LOCUS_17910 17963 19342 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789261.1 protein_id gnl|my_center|LOCUS_17910 19366 20862 gene locus_tag LOCUS_17920 gene arsA 19366 20862 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119603.1 protein_id gnl|my_center|LOCUS_17920 20884 21930 gene locus_tag LOCUS_17930 gene sgbU 20884 21930 CDS product hexulose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332337.1 protein_id gnl|my_center|LOCUS_17930 21938 22939 gene locus_tag LOCUS_17940 21938 22939 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121299.1 protein_id gnl|my_center|LOCUS_17940 22936 25599 gene locus_tag LOCUS_17950 22936 25599 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120962.1 protein_id gnl|my_center|LOCUS_17950 25610 27052 gene locus_tag LOCUS_17960 25610 27052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120961.1 protein_id gnl|my_center|LOCUS_17960 27103 28041 gene locus_tag LOCUS_17970 27103 28041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 28046 30946 gene locus_tag LOCUS_17980 28046 30946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 30950 32371 gene locus_tag LOCUS_17990 30950 32371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120393.1 protein_id gnl|my_center|LOCUS_17990 34150 32417 gene locus_tag LOCUS_18000 34150 32417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 35445 34291 gene locus_tag LOCUS_18010 35445 34291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118495.1 protein_id gnl|my_center|LOCUS_18010 35713 36198 gene locus_tag LOCUS_18020 35713 36198 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461289.1 protein_id gnl|my_center|LOCUS_18020 36756 36283 gene locus_tag LOCUS_18030 36756 36283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 37712 36849 gene locus_tag LOCUS_18040 37712 36849 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085765.1 protein_id gnl|my_center|LOCUS_18040 38717 37773 gene locus_tag LOCUS_18050 38717 37773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 >Feature sequence036 1 777 gene locus_tag LOCUS_18060 1 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 770 1543 gene locus_tag LOCUS_18070 770 1543 CDS product fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726931.1 protein_id gnl|my_center|LOCUS_18070 1634 3040 gene locus_tag LOCUS_18080 gene argH 1634 3040 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9L6 protein_id gnl|my_center|LOCUS_18080 3037 4095 gene locus_tag LOCUS_18090 3037 4095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 4102 4929 gene locus_tag LOCUS_18100 4102 4929 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122505.1 protein_id gnl|my_center|LOCUS_18100 6040 4946 gene locus_tag LOCUS_18110 6040 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120927.1 protein_id gnl|my_center|LOCUS_18110 12707 6108 gene locus_tag LOCUS_18120 12707 6108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 15579 12727 gene locus_tag LOCUS_18130 15579 12727 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120925.1 protein_id gnl|my_center|LOCUS_18130 18011 15576 gene locus_tag LOCUS_18140 18011 15576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117947.1 protein_id gnl|my_center|LOCUS_18140 18928 18008 gene locus_tag LOCUS_18150 18928 18008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120923.1 protein_id gnl|my_center|LOCUS_18150 20033 18975 gene locus_tag LOCUS_18160 gene moxR 20033 18975 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122148.1 protein_id gnl|my_center|LOCUS_18160 21837 20425 gene locus_tag LOCUS_18170 21837 20425 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031019.1 protein_id gnl|my_center|LOCUS_18170 23062 21842 gene locus_tag LOCUS_18180 gene aroB 23062 21842 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368549.1 protein_id gnl|my_center|LOCUS_18180 23985 23059 gene locus_tag LOCUS_18190 23985 23059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 25164 23989 gene locus_tag LOCUS_18200 25164 23989 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368548.1 protein_id gnl|my_center|LOCUS_18200 25427 25945 gene locus_tag LOCUS_18210 25427 25945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 25942 26523 gene locus_tag LOCUS_18220 25942 26523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 26569 27735 gene locus_tag LOCUS_18230 26569 27735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 27762 29081 gene locus_tag LOCUS_18240 27762 29081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 29224 30693 gene locus_tag LOCUS_18250 29224 30693 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869086.1 protein_id gnl|my_center|LOCUS_18250 30690 31880 gene locus_tag LOCUS_18260 30690 31880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 32153 31896 gene locus_tag LOCUS_18270 32153 31896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 32391 33431 gene locus_tag LOCUS_18280 32391 33431 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_313095.1 protein_id gnl|my_center|LOCUS_18280 33475 34791 gene locus_tag LOCUS_18290 33475 34791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 34804 35070 gene locus_tag LOCUS_18300 34804 35070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 35081 36289 gene locus_tag LOCUS_18310 gene mtlD 35081 36289 CDS product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7M9L9 protein_id gnl|my_center|LOCUS_18310 36858 37589 gene locus_tag LOCUS_18320 36858 37589 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392145.1 protein_id gnl|my_center|LOCUS_18320 >Feature sequence037 25 1218 gene locus_tag LOCUS_18330 25 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 1484 1858 gene locus_tag LOCUS_18340 1484 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 1926 2906 gene locus_tag LOCUS_18350 1926 2906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680154.1 protein_id gnl|my_center|LOCUS_18350 2906 3157 gene locus_tag LOCUS_18360 2906 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 4163 3342 gene locus_tag LOCUS_18370 4163 3342 CDS product sorbitol-6-phosphate 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379285.1 protein_id gnl|my_center|LOCUS_18370 6003 4186 gene locus_tag LOCUS_18380 6003 4186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 6756 6022 gene locus_tag LOCUS_18390 6756 6022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 7313 6861 gene locus_tag LOCUS_18400 gene fucU 7313 6861 CDS product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z427 protein_id gnl|my_center|LOCUS_18400 8699 7752 gene locus_tag LOCUS_18410 8699 7752 CDS product acetoin utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968890.1 protein_id gnl|my_center|LOCUS_18410 9873 8716 gene locus_tag LOCUS_18420 gene carA 9873 8716 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGJ6 protein_id gnl|my_center|LOCUS_18420 10036 11829 gene locus_tag LOCUS_18430 gene pckG 10036 11829 CDS product phosphoenolpyruvate carboxykinase [GTP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Y3 protein_id gnl|my_center|LOCUS_18430 12853 11897 gene locus_tag LOCUS_18440 gene ctaB 12853 11897 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S012 protein_id gnl|my_center|LOCUS_18440 13130 13918 gene locus_tag LOCUS_18450 13130 13918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 14093 14695 gene locus_tag LOCUS_18460 gene yozB 14093 14695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964211.1 protein_id gnl|my_center|LOCUS_18460 15269 14796 gene locus_tag LOCUS_18470 gene folA 15269 14796 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB86 protein_id gnl|my_center|LOCUS_18470 16063 15269 gene locus_tag LOCUS_18480 gene thyA 16063 15269 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JY72 protein_id gnl|my_center|LOCUS_18480 16205 17020 gene locus_tag LOCUS_18490 16205 17020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 17087 17163 gene locus_tag LOCUS_t00190 17087 17163 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 17182 17658 gene locus_tag LOCUS_18500 gene ilvN 17182 17658 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545180.1 protein_id gnl|my_center|LOCUS_18500 17711 18739 gene locus_tag LOCUS_18510 gene ilvC 17711 18739 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67289 protein_id gnl|my_center|LOCUS_18510 18810 19667 gene locus_tag LOCUS_18520 gene hemC 18810 19667 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KI9 protein_id gnl|my_center|LOCUS_18520 19664 21202 gene locus_tag LOCUS_18530 19664 21202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460180.1 protein_id gnl|my_center|LOCUS_18530 21199 21846 gene locus_tag LOCUS_18540 gene trpF 21199 21846 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67853 protein_id gnl|my_center|LOCUS_18540 23224 21839 gene locus_tag LOCUS_18550 gene ffh 23224 21839 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DT9 protein_id gnl|my_center|LOCUS_18550 23362 24960 gene locus_tag LOCUS_18560 gene serA 23362 24960 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKK8 protein_id gnl|my_center|LOCUS_18560 25000 25686 gene locus_tag LOCUS_18570 gene plsY 25000 25686 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66905 protein_id gnl|my_center|LOCUS_18570 25679 26998 gene locus_tag LOCUS_18580 25679 26998 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VVA1 protein_id gnl|my_center|LOCUS_18580 26995 28263 gene locus_tag LOCUS_18590 26995 28263 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGC1 protein_id gnl|my_center|LOCUS_18590 28308 29669 gene locus_tag LOCUS_18600 gene thrC 28308 29669 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942338.1 protein_id gnl|my_center|LOCUS_18600 29686 30525 gene locus_tag LOCUS_18610 29686 30525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545817.1 protein_id gnl|my_center|LOCUS_18610 32110 30518 gene locus_tag LOCUS_18620 gene cimA 32110 30518 CDS product (R)-citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66682 protein_id gnl|my_center|LOCUS_18620 33659 32475 gene locus_tag LOCUS_18630 33659 32475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 34080 35699 gene locus_tag LOCUS_18640 34080 35699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 >Feature sequence038 4 2454 gene locus_tag LOCUS_18650 4 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 2736 3926 gene locus_tag LOCUS_18660 2736 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 4005 6332 gene locus_tag LOCUS_18670 4005 6332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119051.1 protein_id gnl|my_center|LOCUS_18670 6338 7726 gene locus_tag LOCUS_18680 6338 7726 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121859.1 protein_id gnl|my_center|LOCUS_18680 7832 10078 gene locus_tag LOCUS_18690 7832 10078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 10080 11480 gene locus_tag LOCUS_18700 10080 11480 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121859.1 protein_id gnl|my_center|LOCUS_18700 11509 12564 gene locus_tag LOCUS_18710 11509 12564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 12601 13791 gene locus_tag LOCUS_18720 12601 13791 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72F23 protein_id gnl|my_center|LOCUS_18720 13838 14623 gene locus_tag LOCUS_18730 13838 14623 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069020.1 protein_id gnl|my_center|LOCUS_18730 15681 14638 gene locus_tag LOCUS_18740 15681 14638 CDS product glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529545.1 protein_id gnl|my_center|LOCUS_18740 15824 16924 gene locus_tag LOCUS_18750 15824 16924 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085740.1 protein_id gnl|my_center|LOCUS_18750 16971 19733 gene locus_tag LOCUS_18760 16971 19733 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119311.1 protein_id gnl|my_center|LOCUS_18760 19839 20906 gene locus_tag LOCUS_18770 19839 20906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 20925 22442 gene locus_tag LOCUS_18780 20925 22442 CDS product large multi-functional protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119646.1 protein_id gnl|my_center|LOCUS_18780 22565 24814 gene locus_tag LOCUS_18790 22565 24814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 24950 27223 gene locus_tag LOCUS_18800 24950 27223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 27271 28347 gene locus_tag LOCUS_18810 27271 28347 CDS product calcium sensor EFh inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119349.1 protein_id gnl|my_center|LOCUS_18810 28800 28357 gene locus_tag LOCUS_18820 28800 28357 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061191.1 protein_id gnl|my_center|LOCUS_18820 28803 29303 gene locus_tag LOCUS_18830 gene yuxK 28803 29303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40761 protein_id gnl|my_center|LOCUS_18830 29352 31010 gene locus_tag LOCUS_18840 29352 31010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 31160 32143 gene locus_tag LOCUS_18850 31160 32143 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222236.1 protein_id gnl|my_center|LOCUS_18850 32153 32386 gene locus_tag LOCUS_18860 32153 32386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 32383 34212 gene locus_tag LOCUS_18870 32383 34212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 34223 35227 gene locus_tag LOCUS_18880 34223 35227 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978349.1 protein_id gnl|my_center|LOCUS_18880 35224 36690 gene locus_tag LOCUS_18890 35224 36690 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067535.1 protein_id gnl|my_center|LOCUS_18890 >Feature sequence039 1580 2596 gene locus_tag LOCUS_18900 1580 2596 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_18900 2655 3593 gene locus_tag LOCUS_18910 2655 3593 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330235.1 protein_id gnl|my_center|LOCUS_18910 3590 4264 gene locus_tag LOCUS_18920 3590 4264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 4261 5673 gene locus_tag LOCUS_18930 4261 5673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 5670 8051 gene locus_tag LOCUS_18940 5670 8051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 8048 9868 gene locus_tag LOCUS_18950 8048 9868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 9865 10719 gene locus_tag LOCUS_18960 9865 10719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 10716 12218 gene locus_tag LOCUS_18970 10716 12218 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_18970 13686 12220 gene locus_tag LOCUS_18980 13686 12220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 13977 15092 gene locus_tag LOCUS_18990 gene aroC 13977 15092 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLM1 protein_id gnl|my_center|LOCUS_18990 15094 15828 gene locus_tag LOCUS_19000 15094 15828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 15895 15981 gene locus_tag LOCUS_t00200 15895 15981 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 15998 16870 gene locus_tag LOCUS_19010 15998 16870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 18184 17153 gene locus_tag LOCUS_19020 gene korB 18184 17153 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121170.1 protein_id gnl|my_center|LOCUS_19020 20039 18198 gene locus_tag LOCUS_19030 20039 18198 CDS product putative ferredoxin oxidoreductase, alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702333.1 protein_id gnl|my_center|LOCUS_19030 20790 20221 gene locus_tag LOCUS_19040 20790 20221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 21313 20873 gene locus_tag LOCUS_19050 21313 20873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 21863 21462 gene locus_tag LOCUS_19060 21863 21462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 22443 21967 gene locus_tag LOCUS_19070 22443 21967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 22527 22452 gene locus_tag LOCUS_t00210 22527 22452 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 22608 23207 gene locus_tag LOCUS_19080 22608 23207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 23298 27008 gene locus_tag LOCUS_19090 gene metH 23298 27008 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262613.1 protein_id gnl|my_center|LOCUS_19090 27563 27033 gene locus_tag LOCUS_19100 27563 27033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 28137 29987 gene locus_tag LOCUS_19110 gene thrS 28137 29987 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCU0 protein_id gnl|my_center|LOCUS_19110 29980 30300 gene locus_tag LOCUS_19120 gene yidD 29980 30300 CDS product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y865 protein_id gnl|my_center|LOCUS_19120 31435 30314 gene locus_tag LOCUS_19130 31435 30314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 32699 31455 gene locus_tag LOCUS_19140 32699 31455 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584016.1 protein_id gnl|my_center|LOCUS_19140 >Feature sequence040 1691 231 gene locus_tag LOCUS_19150 1691 231 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120737.1 protein_id gnl|my_center|LOCUS_19150 5661 1708 gene locus_tag LOCUS_19160 5661 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 6000 5809 gene locus_tag LOCUS_19170 6000 5809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 6236 5997 gene locus_tag LOCUS_19180 6236 5997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 7002 6259 gene locus_tag LOCUS_19190 7002 6259 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086142.1 protein_id gnl|my_center|LOCUS_19190 8879 7002 gene locus_tag LOCUS_19200 8879 7002 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453777.1 protein_id gnl|my_center|LOCUS_19200 9167 10609 gene locus_tag LOCUS_19210 9167 10609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 12486 10606 gene locus_tag LOCUS_19220 12486 10606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 14674 12575 gene locus_tag LOCUS_19230 14674 12575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 16216 14699 gene locus_tag LOCUS_19240 16216 14699 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085058.1 protein_id gnl|my_center|LOCUS_19240 17449 16265 gene locus_tag LOCUS_19250 17449 16265 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085057.1 protein_id gnl|my_center|LOCUS_19250 18224 17469 gene locus_tag LOCUS_19260 gene fabG1 18224 17469 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706496.1 protein_id gnl|my_center|LOCUS_19260 19111 18323 gene locus_tag LOCUS_19270 19111 18323 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082969.1 protein_id gnl|my_center|LOCUS_19270 19472 19119 gene locus_tag LOCUS_19280 gene arsC 19472 19119 CDS product ArsC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001971937.1 protein_id gnl|my_center|LOCUS_19280 19568 22492 gene locus_tag LOCUS_19290 19568 22492 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933213.1 protein_id gnl|my_center|LOCUS_19290 22489 22968 gene locus_tag LOCUS_19300 22489 22968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 23104 24237 gene locus_tag LOCUS_19310 gene pntA 23104 24237 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123663.1 protein_id gnl|my_center|LOCUS_19310 24240 24536 gene locus_tag LOCUS_19320 24240 24536 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325302.1 protein_id gnl|my_center|LOCUS_19320 24533 25978 gene locus_tag LOCUS_19330 gene pntB 24533 25978 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIW3 protein_id gnl|my_center|LOCUS_19330 26164 26430 gene locus_tag LOCUS_19340 26164 26430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 27538 26423 gene locus_tag LOCUS_19350 gene ald 27538 26423 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEW0 protein_id gnl|my_center|LOCUS_19350 27658 29178 gene locus_tag LOCUS_19360 27658 29178 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767669.1 protein_id gnl|my_center|LOCUS_19360 29213 29971 gene locus_tag LOCUS_19370 29213 29971 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529371.1 protein_id gnl|my_center|LOCUS_19370 29974 30672 gene locus_tag LOCUS_19380 29974 30672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 31346 31421 gene locus_tag LOCUS_t00220 31346 31421 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence041 476 2260 gene locus_tag LOCUS_19390 476 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 2268 5855 gene locus_tag LOCUS_19400 2268 5855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19400 6358 5861 gene locus_tag LOCUS_19410 6358 5861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 7852 6389 gene locus_tag LOCUS_19420 gene lysS 7852 6389 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q839A8 protein_id gnl|my_center|LOCUS_19420 9859 7871 gene locus_tag LOCUS_19430 9859 7871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 10160 9921 gene locus_tag LOCUS_19440 10160 9921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 13793 10212 gene locus_tag LOCUS_19450 13793 10212 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHB7 protein_id gnl|my_center|LOCUS_19450 15162 13909 gene locus_tag LOCUS_19460 15162 13909 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942641.1 protein_id gnl|my_center|LOCUS_19460 15384 17366 gene locus_tag LOCUS_19470 15384 17366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 17371 18156 gene locus_tag LOCUS_19480 17371 18156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 18197 19522 gene locus_tag LOCUS_19490 18197 19522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 20467 19523 gene locus_tag LOCUS_19500 20467 19523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 22711 20504 gene locus_tag LOCUS_19510 22711 20504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 25207 22766 gene locus_tag LOCUS_19520 25207 22766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 25421 25158 gene locus_tag LOCUS_19530 25421 25158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 26561 25617 gene locus_tag LOCUS_19540 26561 25617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 27541 26567 gene locus_tag LOCUS_19550 27541 26567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 28521 27583 gene locus_tag LOCUS_19560 28521 27583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 29730 28573 gene locus_tag LOCUS_19570 29730 28573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 33519 29737 gene locus_tag LOCUS_19580 33519 29737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 >Feature sequence042 <1 1128 gene locus_tag LOCUS_19590 <1 1128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013368537.1:dehydrogenase 3222 1147 gene locus_tag LOCUS_19600 3222 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101985.1 protein_id gnl|my_center|LOCUS_19600 3683 3357 gene locus_tag LOCUS_19610 3683 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 3884 4801 gene locus_tag LOCUS_19620 3884 4801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 4854 6236 gene locus_tag LOCUS_19630 4854 6236 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_19630 6237 7316 gene locus_tag LOCUS_19640 6237 7316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 7357 10230 gene locus_tag LOCUS_19650 7357 10230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 10227 11846 gene locus_tag LOCUS_19660 10227 11846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 11861 13030 gene locus_tag LOCUS_19670 11861 13030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 13187 14077 gene locus_tag LOCUS_19680 13187 14077 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967104.1 protein_id gnl|my_center|LOCUS_19680 14169 16745 gene locus_tag LOCUS_19690 14169 16745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 17842 16775 gene locus_tag LOCUS_19700 gene adh 17842 16775 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324237.1 protein_id gnl|my_center|LOCUS_19700 17905 18051 gene locus_tag LOCUS_19710 17905 18051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 19118 18087 gene locus_tag LOCUS_19720 19118 18087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121407.1 protein_id gnl|my_center|LOCUS_19720 20568 19273 gene locus_tag LOCUS_19730 20568 19273 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324174.1 protein_id gnl|my_center|LOCUS_19730 21891 20590 gene locus_tag LOCUS_19740 21891 20590 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324174.1 protein_id gnl|my_center|LOCUS_19740 22614 21907 gene locus_tag LOCUS_19750 22614 21907 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121188.1 protein_id gnl|my_center|LOCUS_19750 24459 22681 gene locus_tag LOCUS_19760 24459 22681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 26132 24456 gene locus_tag LOCUS_19770 26132 24456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 27288 26203 gene locus_tag LOCUS_19780 27288 26203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 29956 27335 gene locus_tag LOCUS_19790 29956 27335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 31365 30001 gene locus_tag LOCUS_19800 gene arsA 31365 30001 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122622.1 protein_id gnl|my_center|LOCUS_19800 32800 31382 gene locus_tag LOCUS_19810 32800 31382 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120094.1 protein_id gnl|my_center|LOCUS_19810 >Feature sequence043 1673 90 gene locus_tag LOCUS_19820 gene aceF 1673 90 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2S2 protein_id gnl|my_center|LOCUS_19820 4340 1686 gene locus_tag LOCUS_19830 4340 1686 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LU2 protein_id gnl|my_center|LOCUS_19830 4450 4689 gene locus_tag LOCUS_19840 4450 4689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 6154 4661 gene locus_tag LOCUS_19850 gene nuoN 6154 4661 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEC9 protein_id gnl|my_center|LOCUS_19850 7647 6142 gene locus_tag LOCUS_19860 7647 6142 CDS product NADH dehydrogenase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257846.1 protein_id gnl|my_center|LOCUS_19860 9153 7654 gene locus_tag LOCUS_19870 9153 7654 CDS product NADH dehydrogenase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392501.1 protein_id gnl|my_center|LOCUS_19870 11116 9155 gene locus_tag LOCUS_19880 11116 9155 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460436.1 protein_id gnl|my_center|LOCUS_19880 11433 11122 gene locus_tag LOCUS_19890 gene nuoK 11433 11122 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WED3 protein_id gnl|my_center|LOCUS_19890 11953 11435 gene locus_tag LOCUS_19900 11953 11435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 13197 11950 gene locus_tag LOCUS_19910 gene nuoH 13197 11950 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WED5 protein_id gnl|my_center|LOCUS_19910 14090 13194 gene locus_tag LOCUS_19920 14090 13194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 15280 14102 gene locus_tag LOCUS_19930 gene nuoD1 15280 14102 CDS product NADH-quinone oxidoreductase subunit D 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WED7 protein_id gnl|my_center|LOCUS_19930 15885 15277 gene locus_tag LOCUS_19940 gene nuoC 15885 15277 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKI4 protein_id gnl|my_center|LOCUS_19940 16568 15876 gene locus_tag LOCUS_19950 16568 15876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 16965 16570 gene locus_tag LOCUS_19960 gene nuoA 16965 16570 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEE0 protein_id gnl|my_center|LOCUS_19960 18374 17148 gene locus_tag LOCUS_19970 gene argG 18374 17148 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59846 protein_id gnl|my_center|LOCUS_19970 19356 18409 gene locus_tag LOCUS_19980 gene argF 19356 18409 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG66 protein_id gnl|my_center|LOCUS_19980 20582 19380 gene locus_tag LOCUS_19990 gene argD 20582 19380 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG65 protein_id gnl|my_center|LOCUS_19990 21500 20613 gene locus_tag LOCUS_20000 gene argB 21500 20613 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59303 protein_id gnl|my_center|LOCUS_20000 22747 21497 gene locus_tag LOCUS_20010 gene argJ 22747 21497 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGC2 protein_id gnl|my_center|LOCUS_20010 23791 22766 gene locus_tag LOCUS_20020 gene argC 23791 22766 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG62 protein_id gnl|my_center|LOCUS_20020 24309 23908 gene locus_tag LOCUS_20030 gene rpsI 24309 23908 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FM58 protein_id gnl|my_center|LOCUS_20030 24796 24314 gene locus_tag LOCUS_20040 gene rplM 24796 24314 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1G6 protein_id gnl|my_center|LOCUS_20040 24869 25861 gene locus_tag LOCUS_20050 24869 25861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 25867 26376 gene locus_tag LOCUS_20060 25867 26376 CDS product phosphinothricin acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887825.1 protein_id gnl|my_center|LOCUS_20060 27374 26382 gene locus_tag LOCUS_20070 gene mdh 27374 26382 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4A2 protein_id gnl|my_center|LOCUS_20070 28480 27425 gene locus_tag LOCUS_20080 28480 27425 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KU34 protein_id gnl|my_center|LOCUS_20080 28548 29489 gene locus_tag LOCUS_20090 28548 29489 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887003.1 protein_id gnl|my_center|LOCUS_20090 29651 29917 gene locus_tag LOCUS_20100 29651 29917 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481749.1 protein_id gnl|my_center|LOCUS_20100 29973 31169 gene locus_tag LOCUS_20110 gene galK 29973 31169 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39574 protein_id gnl|my_center|LOCUS_20110 31166 32866 gene locus_tag LOCUS_20120 31166 32866 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976195.1 protein_id gnl|my_center|LOCUS_20120 >Feature sequence044 1033 50 gene locus_tag LOCUS_20130 gene hag 1033 50 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P02968 protein_id gnl|my_center|LOCUS_20130 1959 1156 gene locus_tag LOCUS_20140 1959 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 2288 2001 gene locus_tag LOCUS_20150 2288 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 3069 2872 gene locus_tag LOCUS_20160 3069 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 6550 4544 gene locus_tag LOCUS_20170 6550 4544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 6872 7492 gene locus_tag LOCUS_20180 6872 7492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 7489 9312 gene locus_tag LOCUS_20190 7489 9312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 9438 13247 gene locus_tag LOCUS_20200 9438 13247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 13259 13948 gene locus_tag LOCUS_20210 13259 13948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 14019 14315 gene locus_tag LOCUS_20220 14019 14315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 14338 14778 gene locus_tag LOCUS_20230 14338 14778 CDS product flagellar protein FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKF5 protein_id gnl|my_center|LOCUS_20230 14781 15152 gene locus_tag LOCUS_20240 14781 15152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 15192 15422 gene locus_tag LOCUS_20250 15192 15422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 15811 15425 gene locus_tag LOCUS_20260 gene rsfS 15811 15425 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MTE0 protein_id gnl|my_center|LOCUS_20260 16263 15811 gene locus_tag LOCUS_20270 16263 15811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 17792 16428 gene locus_tag LOCUS_20280 17792 16428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 18207 17833 gene locus_tag LOCUS_20290 gene nuoA 18207 17833 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K1C3 protein_id gnl|my_center|LOCUS_20290 18423 18839 gene locus_tag LOCUS_20300 18423 18839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 18934 19401 gene locus_tag LOCUS_20310 18934 19401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 19401 19883 gene locus_tag LOCUS_20320 19401 19883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 19910 20593 gene locus_tag LOCUS_20330 19910 20593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 20574 21728 gene locus_tag LOCUS_20340 20574 21728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 21896 23209 gene locus_tag LOCUS_20350 21896 23209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 23206 23781 gene locus_tag LOCUS_20360 23206 23781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 23818 26091 gene locus_tag LOCUS_20370 23818 26091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 26178 26684 gene locus_tag LOCUS_20380 26178 26684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 26695 28623 gene locus_tag LOCUS_20390 gene pilB2 26695 28623 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546881.1 protein_id gnl|my_center|LOCUS_20390 28643 29917 gene locus_tag LOCUS_20400 28643 29917 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266635.1 protein_id gnl|my_center|LOCUS_20400 29914 30882 gene locus_tag LOCUS_20410 29914 30882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 >Feature sequence045 863 654 gene locus_tag LOCUS_20420 863 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 1286 3484 gene locus_tag LOCUS_20430 gene hppA1 1286 3484 CDS product putative K(+)-stimulated pyrophosphate-energized sodium pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIS7 protein_id gnl|my_center|LOCUS_20430 4214 3510 gene locus_tag LOCUS_20440 4214 3510 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK08 protein_id gnl|my_center|LOCUS_20440 4738 4208 gene locus_tag LOCUS_20450 4738 4208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 5799 4735 gene locus_tag LOCUS_20460 5799 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 6836 5835 gene locus_tag LOCUS_20470 gene fabH-2 6836 5835 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CS1 protein_id gnl|my_center|LOCUS_20470 7930 6833 gene locus_tag LOCUS_20480 gene plsX 7930 6833 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CS2 protein_id gnl|my_center|LOCUS_20480 8127 7951 gene locus_tag LOCUS_20490 8127 7951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 9290 8274 gene locus_tag LOCUS_20500 gene uppP2 9290 8274 CDS product undecaprenyl-diphosphatase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTE2 protein_id gnl|my_center|LOCUS_20500 9343 10407 gene locus_tag LOCUS_20510 9343 10407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 10397 11734 gene locus_tag LOCUS_20520 gene glmM 10397 11734 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXK7 protein_id gnl|my_center|LOCUS_20520 11818 13230 gene locus_tag LOCUS_20530 11818 13230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 13342 13255 gene locus_tag LOCUS_t00230 13342 13255 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 13485 14408 gene locus_tag LOCUS_20540 13485 14408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 16778 14499 gene locus_tag LOCUS_20550 16778 14499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 16964 19972 gene locus_tag LOCUS_20560 gene gcvP 16964 19972 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MEH6 protein_id gnl|my_center|LOCUS_20560 20222 20674 gene locus_tag LOCUS_20570 20222 20674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 20880 24014 gene locus_tag LOCUS_20580 20880 24014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 24018 24419 gene locus_tag LOCUS_20590 24018 24419 CDS product heat-shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785756.1 protein_id gnl|my_center|LOCUS_20590 24971 24435 gene locus_tag LOCUS_20600 gene dcd 24971 24435 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97N13 protein_id gnl|my_center|LOCUS_20600 27103 25019 gene locus_tag LOCUS_20610 gene uvrd 27103 25019 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S575 protein_id gnl|my_center|LOCUS_20610 28265 27147 gene locus_tag LOCUS_20620 gene proB 28265 27147 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKZ7 protein_id gnl|my_center|LOCUS_20620 28891 28334 gene locus_tag LOCUS_20630 gene frr 28891 28334 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2X9 protein_id gnl|my_center|LOCUS_20630 29657 28968 gene locus_tag LOCUS_20640 gene pyrH 29657 28968 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97I64 protein_id gnl|my_center|LOCUS_20640 29853 29926 gene locus_tag LOCUS_t00240 29853 29926 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence046 1641 313 gene locus_tag LOCUS_20650 1641 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 3011 1644 gene locus_tag LOCUS_20660 gene GALNS 3011 1644 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121664.1 protein_id gnl|my_center|LOCUS_20660 3143 3448 gene locus_tag LOCUS_20670 3143 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 3465 4043 gene locus_tag LOCUS_20680 3465 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 5490 4075 gene locus_tag LOCUS_20690 5490 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 7009 5621 gene locus_tag LOCUS_20700 7009 5621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 7590 7129 gene locus_tag LOCUS_20710 7590 7129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117967.1 protein_id gnl|my_center|LOCUS_20710 7714 8019 gene locus_tag LOCUS_20720 7714 8019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 16652 8046 gene locus_tag LOCUS_20730 16652 8046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 18082 16649 gene locus_tag LOCUS_20740 18082 16649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 18583 18113 gene locus_tag LOCUS_20750 18583 18113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 20796 18586 gene locus_tag LOCUS_20760 20796 18586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 22192 20789 gene locus_tag LOCUS_20770 22192 20789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 22259 22444 gene locus_tag LOCUS_20780 22259 22444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 23732 22449 gene locus_tag LOCUS_20790 23732 22449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 24666 23725 gene locus_tag LOCUS_20800 24666 23725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 27317 24663 gene locus_tag LOCUS_20810 27317 24663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 29029 27308 gene locus_tag LOCUS_20820 29029 27308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 >Feature sequence047 197 1015 gene locus_tag LOCUS_20830 197 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 988 1311 gene locus_tag LOCUS_20840 988 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 1576 2349 gene locus_tag LOCUS_20850 1576 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 3036 2515 gene locus_tag LOCUS_20860 3036 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 3592 4260 gene locus_tag LOCUS_20870 3592 4260 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932468.1 protein_id gnl|my_center|LOCUS_20870 5056 4277 gene locus_tag LOCUS_20880 5056 4277 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_20880 5867 5124 gene locus_tag LOCUS_20890 gene thiD 5867 5124 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972916.1 protein_id gnl|my_center|LOCUS_20890 7070 5904 gene locus_tag LOCUS_20900 7070 5904 CDS product molybdenum cofactor biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404770.1 protein_id gnl|my_center|LOCUS_20900 8233 7064 gene locus_tag LOCUS_20910 gene thiH 8233 7064 CDS product thiamine biosynthesis protein ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008477.1 protein_id gnl|my_center|LOCUS_20910 9014 8238 gene locus_tag LOCUS_20920 gene thiG 9014 8238 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TA0 protein_id gnl|my_center|LOCUS_20920 9649 9011 gene locus_tag LOCUS_20930 gene thiE 9649 9011 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TA1 protein_id gnl|my_center|LOCUS_20930 10300 9665 gene locus_tag LOCUS_20940 10300 9665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 10503 10300 gene locus_tag LOCUS_20950 10503 10300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 12509 10500 gene locus_tag LOCUS_20960 gene thiC 12509 10500 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62FE9 protein_id gnl|my_center|LOCUS_20960 12872 15160 gene locus_tag LOCUS_20970 12872 15160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 15157 15831 gene locus_tag LOCUS_20980 15157 15831 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056165.1 protein_id gnl|my_center|LOCUS_20980 15828 17186 gene locus_tag LOCUS_20990 gene gltP 15828 17186 CDS product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_20990 17197 19227 gene locus_tag LOCUS_21000 gene uvrB 17197 19227 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLV3 protein_id gnl|my_center|LOCUS_21000 19208 20089 gene locus_tag LOCUS_21010 19208 20089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 20946 20104 gene locus_tag LOCUS_21020 20946 20104 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057816.1 protein_id gnl|my_center|LOCUS_21020 21080 21343 gene locus_tag LOCUS_21030 21080 21343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 21451 21375 gene locus_tag LOCUS_t00250 21451 21375 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 21577 22767 gene locus_tag LOCUS_21040 gene sucC 21577 22767 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ84 protein_id gnl|my_center|LOCUS_21040 22794 23669 gene locus_tag LOCUS_21050 gene sucD 22794 23669 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKI2 protein_id gnl|my_center|LOCUS_21050 23738 24175 gene locus_tag LOCUS_21060 23738 24175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 24234 25820 gene locus_tag LOCUS_21070 24234 25820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 26481 25834 gene locus_tag LOCUS_21080 gene rsmG 26481 25834 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ2 protein_id gnl|my_center|LOCUS_21080 27352 26507 gene locus_tag LOCUS_21090 gene kdsA 27352 26507 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWQ9 protein_id gnl|my_center|LOCUS_21090 27765 27349 gene locus_tag LOCUS_21100 27765 27349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 29180 27762 gene locus_tag LOCUS_21110 29180 27762 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THA6 protein_id gnl|my_center|LOCUS_21110 >Feature sequence048 1018 314 gene locus_tag LOCUS_21120 1018 314 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389698.1 protein_id gnl|my_center|LOCUS_21120 1047 2123 gene locus_tag LOCUS_21130 1047 2123 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141616.1 protein_id gnl|my_center|LOCUS_21130 2116 3192 gene locus_tag LOCUS_21140 2116 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 3189 4193 gene locus_tag LOCUS_21150 gene gpsA 3189 4193 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63XU3 protein_id gnl|my_center|LOCUS_21150 4234 4926 gene locus_tag LOCUS_21160 4234 4926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810571.1 protein_id gnl|my_center|LOCUS_21160 4923 5732 gene locus_tag LOCUS_21170 gene cysE 4923 5732 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704210.1 protein_id gnl|my_center|LOCUS_21170 7226 5742 gene locus_tag LOCUS_21180 7226 5742 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123599.1 protein_id gnl|my_center|LOCUS_21180 10245 7234 gene locus_tag LOCUS_21190 10245 7234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123598.1 protein_id gnl|my_center|LOCUS_21190 10808 10287 gene locus_tag LOCUS_21200 10808 10287 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDH6 protein_id gnl|my_center|LOCUS_21200 12289 10859 gene locus_tag LOCUS_21210 gene yidJ 12289 10859 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122680.1 protein_id gnl|my_center|LOCUS_21210 12310 13050 gene locus_tag LOCUS_21220 gene pcxB 12310 13050 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121516.1 protein_id gnl|my_center|LOCUS_21220 <29034 14304 gene locus_tag LOCUS_21230 <29034 14304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229107.1:SGNH hydrolase >Feature sequence049 1309 2367 gene locus_tag LOCUS_21240 1309 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 3632 2403 gene locus_tag LOCUS_21250 gene hflX 3632 2403 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69972 protein_id gnl|my_center|LOCUS_21250 6533 3789 gene locus_tag LOCUS_21260 gene ppd 6533 3789 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933346.1 protein_id gnl|my_center|LOCUS_21260 6807 7841 gene locus_tag LOCUS_21270 6807 7841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 8130 7894 gene locus_tag LOCUS_21280 8130 7894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 9603 8272 gene locus_tag LOCUS_21290 9603 8272 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118593.1 protein_id gnl|my_center|LOCUS_21290 10501 9647 gene locus_tag LOCUS_21300 10501 9647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 11307 10621 gene locus_tag LOCUS_21310 11307 10621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21310 11622 11317 gene locus_tag LOCUS_21320 11622 11317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 12718 11651 gene locus_tag LOCUS_21330 12718 11651 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228754.1 protein_id gnl|my_center|LOCUS_21330 13631 12723 gene locus_tag LOCUS_21340 gene nagA 13631 12723 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118333.1 protein_id gnl|my_center|LOCUS_21340 14359 13628 gene locus_tag LOCUS_21350 gene nagB 14359 13628 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_864370.2 protein_id gnl|my_center|LOCUS_21350 15218 14364 gene locus_tag LOCUS_21360 15218 14364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 16438 15257 gene locus_tag LOCUS_21370 16438 15257 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095330.1 protein_id gnl|my_center|LOCUS_21370 16564 18489 gene locus_tag LOCUS_21380 16564 18489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 18493 19611 gene locus_tag LOCUS_21390 18493 19611 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120946.1 protein_id gnl|my_center|LOCUS_21390 19595 19891 gene locus_tag LOCUS_21400 19595 19891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 19896 21785 gene locus_tag LOCUS_21410 19896 21785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 21899 22690 gene locus_tag LOCUS_21420 21899 22690 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085944.1 protein_id gnl|my_center|LOCUS_21420 22751 25744 gene locus_tag LOCUS_21430 22751 25744 CDS product xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121568.1 protein_id gnl|my_center|LOCUS_21430 25772 27238 gene locus_tag LOCUS_21440 25772 27238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333131.1 protein_id gnl|my_center|LOCUS_21440 >Feature sequence050 <1 1860 gene locus_tag LOCUS_21450 <1 1860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121854.1:sulfatase 1953 3047 gene locus_tag LOCUS_21460 1953 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 4026 3019 gene locus_tag LOCUS_21470 4026 3019 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73N23 protein_id gnl|my_center|LOCUS_21470 4994 4023 gene locus_tag LOCUS_21480 4994 4023 CDS product HflK protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_21480 5200 7056 gene locus_tag LOCUS_21490 gene phoD 5200 7056 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117733.1 protein_id gnl|my_center|LOCUS_21490 8348 7065 gene locus_tag LOCUS_21500 8348 7065 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_21500 8519 9496 gene locus_tag LOCUS_21510 gene pknB 8519 9496 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328819.1 protein_id gnl|my_center|LOCUS_21510 9609 10577 gene locus_tag LOCUS_21520 9609 10577 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121134.1 protein_id gnl|my_center|LOCUS_21520 10574 11212 gene locus_tag LOCUS_21530 10574 11212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 11228 12319 gene locus_tag LOCUS_21540 11228 12319 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801668.1 protein_id gnl|my_center|LOCUS_21540 12412 13785 gene locus_tag LOCUS_21550 gene arsA 12412 13785 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_21550 13802 14116 gene locus_tag LOCUS_21560 13802 14116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 14570 14130 gene locus_tag LOCUS_21570 14570 14130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 15907 14891 gene locus_tag LOCUS_21580 gene glnII 15907 14891 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNZ8 protein_id gnl|my_center|LOCUS_21580 16682 16119 gene locus_tag LOCUS_21590 16682 16119 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L1U6 protein_id gnl|my_center|LOCUS_21590 17192 16785 gene locus_tag LOCUS_21600 17192 16785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 17629 17288 gene locus_tag LOCUS_21610 17629 17288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 17924 17697 gene locus_tag LOCUS_21620 17924 17697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 18890 17937 gene locus_tag LOCUS_21630 18890 17937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 18973 19929 gene locus_tag LOCUS_21640 18973 19929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 20054 21400 gene locus_tag LOCUS_21650 gene tig 20054 21400 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NMZ9 protein_id gnl|my_center|LOCUS_21650 21431 22027 gene locus_tag LOCUS_21660 gene clpP 21431 22027 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZF9 protein_id gnl|my_center|LOCUS_21660 22063 23355 gene locus_tag LOCUS_21670 gene clpX 22063 23355 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NN26 protein_id gnl|my_center|LOCUS_21670 24432 23368 gene locus_tag LOCUS_21680 24432 23368 CDS product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257568.1 protein_id gnl|my_center|LOCUS_21680 24525 25247 gene locus_tag LOCUS_21690 gene hisA 24525 25247 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIB4 protein_id gnl|my_center|LOCUS_21690 >Feature sequence051 <1 2368 gene locus_tag LOCUS_21700 <1 2368 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119791.1:cytochrome c 2368 3750 gene locus_tag LOCUS_21710 2368 3750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119690.1 protein_id gnl|my_center|LOCUS_21710 3767 4642 gene locus_tag LOCUS_21720 3767 4642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 4639 6147 gene locus_tag LOCUS_21730 4639 6147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 6226 8112 gene locus_tag LOCUS_21740 6226 8112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 8512 8126 gene locus_tag LOCUS_21750 8512 8126 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143544.1 protein_id gnl|my_center|LOCUS_21750 8750 8514 gene locus_tag LOCUS_21760 8750 8514 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SL05 protein_id gnl|my_center|LOCUS_21760 8941 9984 gene locus_tag LOCUS_21770 8941 9984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118659.1 protein_id gnl|my_center|LOCUS_21770 10013 11266 gene locus_tag LOCUS_21780 10013 11266 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_21780 11300 12133 gene locus_tag LOCUS_21790 11300 12133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 12154 12858 gene locus_tag LOCUS_21800 12154 12858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 12907 14412 gene locus_tag LOCUS_21810 12907 14412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 14505 15659 gene locus_tag LOCUS_21820 14505 15659 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405503.1 protein_id gnl|my_center|LOCUS_21820 15838 15677 gene locus_tag LOCUS_21830 15838 15677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 16120 17304 gene locus_tag LOCUS_21840 16120 17304 CDS product lipoprotein precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963596.1 protein_id gnl|my_center|LOCUS_21840 17306 18697 gene locus_tag LOCUS_21850 17306 18697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895673.1 protein_id gnl|my_center|LOCUS_21850 18817 19503 gene locus_tag LOCUS_21860 18817 19503 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120554.1 protein_id gnl|my_center|LOCUS_21860 19537 20763 gene locus_tag LOCUS_21870 19537 20763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 20953 22335 gene locus_tag LOCUS_21880 20953 22335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_21880 >Feature sequence052 55 1428 gene locus_tag LOCUS_21890 55 1428 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120368.1 protein_id gnl|my_center|LOCUS_21890 1683 2780 gene locus_tag LOCUS_21900 gene moxR 1683 2780 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_21900 2849 3748 gene locus_tag LOCUS_21910 2849 3748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118532.1 protein_id gnl|my_center|LOCUS_21910 3745 5394 gene locus_tag LOCUS_21920 3745 5394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 5391 7607 gene locus_tag LOCUS_21930 5391 7607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405130.1 protein_id gnl|my_center|LOCUS_21930 7641 10061 gene locus_tag LOCUS_21940 7641 10061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 10077 12107 gene locus_tag LOCUS_21950 10077 12107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 12112 13830 gene locus_tag LOCUS_21960 12112 13830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 13847 14905 gene locus_tag LOCUS_21970 13847 14905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120927.1 protein_id gnl|my_center|LOCUS_21970 14991 16946 gene locus_tag LOCUS_21980 14991 16946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 16985 20884 gene locus_tag LOCUS_21990 16985 20884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 >Feature sequence053 231 1085 gene locus_tag LOCUS_22000 231 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 1647 2396 gene locus_tag LOCUS_22010 1647 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 2568 4424 gene locus_tag LOCUS_22020 2568 4424 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460040.1 protein_id gnl|my_center|LOCUS_22020 4577 6688 gene locus_tag LOCUS_22030 gene ppk 4577 6688 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S646 protein_id gnl|my_center|LOCUS_22030 7666 6902 gene locus_tag LOCUS_22040 7666 6902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 8219 7806 gene locus_tag LOCUS_22050 8219 7806 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705855.1 protein_id gnl|my_center|LOCUS_22050 8949 8242 gene locus_tag LOCUS_22060 8949 8242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 9111 10220 gene locus_tag LOCUS_22070 9111 10220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 10226 10882 gene locus_tag LOCUS_22080 gene tmk 10226 10882 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AX0 protein_id gnl|my_center|LOCUS_22080 10866 11798 gene locus_tag LOCUS_22090 10866 11798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 14379 11815 gene locus_tag LOCUS_22100 gene mutS 14379 11815 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61667 protein_id gnl|my_center|LOCUS_22100 14579 15058 gene locus_tag LOCUS_22110 14579 15058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 15065 16882 gene locus_tag LOCUS_22120 15065 16882 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338330.1 protein_id gnl|my_center|LOCUS_22120 17102 17410 gene locus_tag LOCUS_22130 17102 17410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 17536 18195 gene locus_tag LOCUS_22140 17536 18195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123567.1 protein_id gnl|my_center|LOCUS_22140 18240 19643 gene locus_tag LOCUS_22150 18240 19643 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_22150 20284 19772 gene locus_tag LOCUS_22160 20284 19772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 >Feature sequence054 1659 703 gene locus_tag LOCUS_22170 1659 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 2050 1721 gene locus_tag LOCUS_22180 2050 1721 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331456.1 protein_id gnl|my_center|LOCUS_22180 2301 2897 gene locus_tag LOCUS_22190 2301 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 3045 6635 gene locus_tag LOCUS_22200 3045 6635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 6991 6602 gene locus_tag LOCUS_22210 6991 6602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 7989 7066 gene locus_tag LOCUS_22220 7989 7066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 9098 8085 gene locus_tag LOCUS_22230 9098 8085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 10548 9115 gene locus_tag LOCUS_22240 10548 9115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122305.1 protein_id gnl|my_center|LOCUS_22240 13301 10545 gene locus_tag LOCUS_22250 13301 10545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 14206 13298 gene locus_tag LOCUS_22260 14206 13298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 16163 14208 gene locus_tag LOCUS_22270 16163 14208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 18368 16167 gene locus_tag LOCUS_22280 18368 16167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797477.1 protein_id gnl|my_center|LOCUS_22280 18464 18691 gene locus_tag LOCUS_22290 18464 18691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 20289 18604 gene locus_tag LOCUS_22300 20289 18604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 >Feature sequence055 3621 1984 gene locus_tag LOCUS_22310 3621 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 3844 4638 gene locus_tag LOCUS_22320 3844 4638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 5614 4646 gene locus_tag LOCUS_22330 5614 4646 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816316.1 protein_id gnl|my_center|LOCUS_22330 5752 7122 gene locus_tag LOCUS_22340 5752 7122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_22340 7218 9770 gene locus_tag LOCUS_22350 7218 9770 CDS product L-sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117697.1 protein_id gnl|my_center|LOCUS_22350 9795 12398 gene locus_tag LOCUS_22360 9795 12398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 13689 12430 gene locus_tag LOCUS_22370 13689 12430 CDS product carbon dioxide concentrating mechanism protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056989.1 protein_id gnl|my_center|LOCUS_22370 13813 15216 gene locus_tag LOCUS_22380 gene GALNS 13813 15216 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121570.1 protein_id gnl|my_center|LOCUS_22380 15226 16263 gene locus_tag LOCUS_22390 15226 16263 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764019.1 protein_id gnl|my_center|LOCUS_22390 16276 17631 gene locus_tag LOCUS_22400 16276 17631 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943292.1 protein_id gnl|my_center|LOCUS_22400 17712 18692 gene locus_tag LOCUS_22410 17712 18692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 18744 19352 gene locus_tag LOCUS_22420 18744 19352 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729516.1 protein_id gnl|my_center|LOCUS_22420 >Feature sequence056 138 470 gene locus_tag LOCUS_22430 138 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 743 486 gene locus_tag LOCUS_22440 743 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 1385 750 gene locus_tag LOCUS_22450 1385 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 2974 1463 gene locus_tag LOCUS_22460 2974 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 3081 3824 gene locus_tag LOCUS_22470 3081 3824 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340751.1 protein_id gnl|my_center|LOCUS_22470 5070 3847 gene locus_tag LOCUS_22480 gene dapL 5070 3847 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GT3 protein_id gnl|my_center|LOCUS_22480 5674 5153 gene locus_tag LOCUS_22490 5674 5153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 6502 5693 gene locus_tag LOCUS_22500 6502 5693 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VY8 protein_id gnl|my_center|LOCUS_22500 7236 6499 gene locus_tag LOCUS_22510 7236 6499 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387887.1 protein_id gnl|my_center|LOCUS_22510 11269 7340 gene locus_tag LOCUS_22520 11269 7340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 11737 11279 gene locus_tag LOCUS_22530 11737 11279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 12592 11765 gene locus_tag LOCUS_22540 12592 11765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 15771 12649 gene locus_tag LOCUS_22550 15771 12649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123552.1 protein_id gnl|my_center|LOCUS_22550 16255 15941 gene locus_tag LOCUS_22560 16255 15941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 16716 16249 gene locus_tag LOCUS_22570 gene fliW 16716 16249 CDS product flagellar assembly factor FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKH2 protein_id gnl|my_center|LOCUS_22570 >Feature sequence057 <1 1073 gene locus_tag LOCUS_22580 <1 1073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UIW3:NAD(P) transhydrogenase subunit beta 1974 1096 gene locus_tag LOCUS_22590 1974 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117736.1 protein_id gnl|my_center|LOCUS_22590 2149 3633 gene locus_tag LOCUS_22600 2149 3633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 4671 3643 gene locus_tag LOCUS_22610 gene yjjN 4671 3643 CDS product zinc-type alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119735.1 protein_id gnl|my_center|LOCUS_22610 5480 4713 gene locus_tag LOCUS_22620 5480 4713 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288769.1 protein_id gnl|my_center|LOCUS_22620 5596 6057 gene locus_tag LOCUS_22630 5596 6057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332434.1 protein_id gnl|my_center|LOCUS_22630 7486 6098 gene locus_tag LOCUS_22640 7486 6098 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120321.1 protein_id gnl|my_center|LOCUS_22640 8834 7551 gene locus_tag LOCUS_22650 8834 7551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327912.1 protein_id gnl|my_center|LOCUS_22650 10821 8845 gene locus_tag LOCUS_22660 10821 8845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121107.1 protein_id gnl|my_center|LOCUS_22660 12462 10930 gene locus_tag LOCUS_22670 12462 10930 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118263.1 protein_id gnl|my_center|LOCUS_22670 13778 12459 gene locus_tag LOCUS_22680 gene arsA 13778 12459 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122187.1 protein_id gnl|my_center|LOCUS_22680 13962 17564 gene locus_tag LOCUS_22690 13962 17564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 >Feature sequence058 <1 947 gene locus_tag LOCUS_22700 <1 947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119680.1:acetylxylan esterase 1063 2901 gene locus_tag LOCUS_22710 1063 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 2898 3935 gene locus_tag LOCUS_22720 2898 3935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 4578 3952 gene locus_tag LOCUS_22730 gene pcm 4578 3952 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJY2 protein_id gnl|my_center|LOCUS_22730 6688 4790 gene locus_tag LOCUS_22740 6688 4790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 6958 8367 gene locus_tag LOCUS_22750 6958 8367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120350.1 protein_id gnl|my_center|LOCUS_22750 9667 8390 gene locus_tag LOCUS_22760 9667 8390 CDS product quinohemoprotein ethanol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117995.1 protein_id gnl|my_center|LOCUS_22760 9774 10877 gene locus_tag LOCUS_22770 9774 10877 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704988.1 protein_id gnl|my_center|LOCUS_22770 12290 10884 gene locus_tag LOCUS_22780 12290 10884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_22780 12443 13144 gene locus_tag LOCUS_22790 12443 13144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 14015 13125 gene locus_tag LOCUS_22800 14015 13125 CDS product myo-inositol catabolism protein IolH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120390.1 protein_id gnl|my_center|LOCUS_22800 14785 14012 gene locus_tag LOCUS_22810 14785 14012 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958120.1 protein_id gnl|my_center|LOCUS_22810 15834 14812 gene locus_tag LOCUS_22820 15834 14812 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120389.1 protein_id gnl|my_center|LOCUS_22820 16550 15840 gene locus_tag LOCUS_22830 16550 15840 CDS product D-arabino 3-hexulose 6-phosphate aldehyde lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120388.1 protein_id gnl|my_center|LOCUS_22830 17236 16547 gene locus_tag LOCUS_22840 17236 16547 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428771.1 protein_id gnl|my_center|LOCUS_22840 >Feature sequence059 5711 4296 gene locus_tag LOCUS_22850 5711 4296 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259490.1 protein_id gnl|my_center|LOCUS_22850 7264 5735 gene locus_tag LOCUS_22860 gene metG 7264 5735 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AE2 protein_id gnl|my_center|LOCUS_22860 7514 8650 gene locus_tag LOCUS_22870 gene rho 7514 8650 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748A7 protein_id gnl|my_center|LOCUS_22870 8705 10465 gene locus_tag LOCUS_22880 8705 10465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 10487 11251 gene locus_tag LOCUS_22890 gene hisF 10487 11251 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60715 protein_id gnl|my_center|LOCUS_22890 11284 12243 gene locus_tag LOCUS_22900 11284 12243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 12253 13515 gene locus_tag LOCUS_22910 12253 13515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 13512 14456 gene locus_tag LOCUS_22920 13512 14456 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQR2 protein_id gnl|my_center|LOCUS_22920 14542 15132 gene locus_tag LOCUS_22930 14542 15132 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101103.1 protein_id gnl|my_center|LOCUS_22930 15129 15662 gene locus_tag LOCUS_22940 15129 15662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 15725 16786 gene locus_tag LOCUS_22950 15725 16786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 17638 16796 gene locus_tag LOCUS_22960 17638 16796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 >Feature sequence060 1363 2622 gene locus_tag LOCUS_22970 1363 2622 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118167.1 protein_id gnl|my_center|LOCUS_22970 2662 4035 gene locus_tag LOCUS_22980 2662 4035 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_22980 5334 4066 gene locus_tag LOCUS_22990 gene adh 5334 4066 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123801.1 protein_id gnl|my_center|LOCUS_22990 5537 6097 gene locus_tag LOCUS_23000 5537 6097 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887W1 protein_id gnl|my_center|LOCUS_23000 6151 7554 gene locus_tag LOCUS_23010 6151 7554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 8160 7963 gene locus_tag LOCUS_23020 gene cspA 8160 7963 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812516.1 protein_id gnl|my_center|LOCUS_23020 8697 8623 gene locus_tag LOCUS_t00260 8697 8623 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 8803 9582 gene locus_tag LOCUS_23030 8803 9582 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528736.1 protein_id gnl|my_center|LOCUS_23030 9584 10384 gene locus_tag LOCUS_23040 gene rnc 9584 10384 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E314 protein_id gnl|my_center|LOCUS_23040 10411 13734 gene locus_tag LOCUS_23050 gene mfd 10411 13734 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQN7 protein_id gnl|my_center|LOCUS_23050 13784 14740 gene locus_tag LOCUS_23060 13784 14740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 14773 15528 gene locus_tag LOCUS_23070 14773 15528 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I683 protein_id gnl|my_center|LOCUS_23070 15618 15703 gene locus_tag LOCUS_t00270 15618 15703 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 17005 16037 gene locus_tag LOCUS_23080 17005 16037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 >Feature sequence061 1492 1199 gene locus_tag LOCUS_23090 gene gatC 1492 1199 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2U4 protein_id gnl|my_center|LOCUS_23090 3946 1511 gene locus_tag LOCUS_23100 gene pheT 3946 1511 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97GL0 protein_id gnl|my_center|LOCUS_23100 4995 3958 gene locus_tag LOCUS_23110 gene pheS 4995 3958 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZS8 protein_id gnl|my_center|LOCUS_23110 5395 5036 gene locus_tag LOCUS_23120 gene rplT 5395 5036 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NGL5 protein_id gnl|my_center|LOCUS_23120 5986 5726 gene locus_tag LOCUS_23130 5986 5726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 6853 6083 gene locus_tag LOCUS_23140 6853 6083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 9560 6897 gene locus_tag LOCUS_23150 gene pnp 9560 6897 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEJ7 protein_id gnl|my_center|LOCUS_23150 10058 9792 gene locus_tag LOCUS_23160 gene rpsO 10058 9792 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJM0 protein_id gnl|my_center|LOCUS_23160 10312 10755 gene locus_tag LOCUS_23170 10312 10755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 10762 14520 gene locus_tag LOCUS_23180 10762 14520 CDS product N-methylhydantoinase HyuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265799.1 protein_id gnl|my_center|LOCUS_23180 15286 14528 gene locus_tag LOCUS_23190 15286 14528 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYR8 protein_id gnl|my_center|LOCUS_23190 15571 15831 gene locus_tag LOCUS_23200 15571 15831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 16384 15833 gene locus_tag LOCUS_23210 16384 15833 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970493.1 protein_id gnl|my_center|LOCUS_23210 16452 16949 gene locus_tag LOCUS_23220 16452 16949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 >Feature sequence062 274 50 gene locus_tag LOCUS_23230 274 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 1658 519 gene locus_tag LOCUS_23240 1658 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 1810 4623 gene locus_tag LOCUS_23250 1810 4623 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120395.1 protein_id gnl|my_center|LOCUS_23250 4620 7823 gene locus_tag LOCUS_23260 gene uvrD 4620 7823 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970609.1 protein_id gnl|my_center|LOCUS_23260 7989 9755 gene locus_tag LOCUS_23270 7989 9755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 9811 10869 gene locus_tag LOCUS_23280 9811 10869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 11226 10873 gene locus_tag LOCUS_23290 11226 10873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 11462 11932 gene locus_tag LOCUS_23300 11462 11932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 12189 13034 gene locus_tag LOCUS_23310 12189 13034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 13031 15424 gene locus_tag LOCUS_23320 13031 15424 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258514.1 protein_id gnl|my_center|LOCUS_23320 16423 15437 gene locus_tag LOCUS_23330 gene nadA 16423 15437 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM90 protein_id gnl|my_center|LOCUS_23330 16853 16431 gene locus_tag LOCUS_23340 gene fur 16853 16431 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078417.1 protein_id gnl|my_center|LOCUS_23340 >Feature sequence063 <1 1025 gene locus_tag LOCUS_23350 <1 1025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121741.1:ATPase AAA 1030 1971 gene locus_tag LOCUS_23360 1030 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121742.1 protein_id gnl|my_center|LOCUS_23360 1968 4067 gene locus_tag LOCUS_23370 1968 4067 CDS product inter-alpha-trypsin inhibitor heavy chain H2 [precursor] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121743.1 protein_id gnl|my_center|LOCUS_23370 4064 7861 gene locus_tag LOCUS_23380 4064 7861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 7885 10221 gene locus_tag LOCUS_23390 7885 10221 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121745.1 protein_id gnl|my_center|LOCUS_23390 10218 11186 gene locus_tag LOCUS_23400 10218 11186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121746.1 protein_id gnl|my_center|LOCUS_23400 11269 12174 gene locus_tag LOCUS_23410 11269 12174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 13018 12182 gene locus_tag LOCUS_23420 13018 12182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 13386 13150 gene locus_tag LOCUS_23430 13386 13150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 14703 13579 gene locus_tag LOCUS_23440 14703 13579 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976168.1 protein_id gnl|my_center|LOCUS_23440 15534 14713 gene locus_tag LOCUS_23450 15534 14713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 16390 15548 gene locus_tag LOCUS_23460 16390 15548 CDS product L-proline 4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121414.1 protein_id gnl|my_center|LOCUS_23460 >Feature sequence064 1136 1936 gene locus_tag LOCUS_23470 1136 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120859.1 protein_id gnl|my_center|LOCUS_23470 3456 1933 gene locus_tag LOCUS_23480 3456 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 4470 3595 gene locus_tag LOCUS_23490 4470 3595 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920217.1 protein_id gnl|my_center|LOCUS_23490 5786 4485 gene locus_tag LOCUS_23500 5786 4485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 6166 5798 gene locus_tag LOCUS_23510 6166 5798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 8187 6184 gene locus_tag LOCUS_23520 gene tkt 8187 6184 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45694 protein_id gnl|my_center|LOCUS_23520 9401 8262 gene locus_tag LOCUS_23530 9401 8262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 9601 10419 gene locus_tag LOCUS_23540 9601 10419 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329136.1 protein_id gnl|my_center|LOCUS_23540 10458 13628 gene locus_tag LOCUS_23550 10458 13628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 >Feature sequence065 408 644 gene locus_tag LOCUS_23560 408 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 641 1099 gene locus_tag LOCUS_23570 641 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 2397 1195 gene locus_tag LOCUS_23580 2397 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 3057 2410 gene locus_tag LOCUS_23590 3057 2410 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096096.1 protein_id gnl|my_center|LOCUS_23590 3140 4615 gene locus_tag LOCUS_23600 3140 4615 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118296.1 protein_id gnl|my_center|LOCUS_23600 5426 4638 gene locus_tag LOCUS_23610 5426 4638 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369923.1 protein_id gnl|my_center|LOCUS_23610 5531 6898 gene locus_tag LOCUS_23620 5531 6898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 8686 6911 gene locus_tag LOCUS_23630 8686 6911 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UHW9 protein_id gnl|my_center|LOCUS_23630 9411 8809 gene locus_tag LOCUS_23640 9411 8809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106328.1 protein_id gnl|my_center|LOCUS_23640 9703 11649 gene locus_tag LOCUS_23650 9703 11649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 11737 12462 gene locus_tag LOCUS_23660 11737 12462 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811803.1 protein_id gnl|my_center|LOCUS_23660 12471 12785 gene locus_tag LOCUS_23670 12471 12785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 14666 12792 gene locus_tag LOCUS_23680 gene cls 14666 12792 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035434.1 protein_id gnl|my_center|LOCUS_23680 >Feature sequence066 490 1659 gene locus_tag LOCUS_23690 490 1659 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 protein_id gnl|my_center|LOCUS_23690 2685 1723 gene locus_tag LOCUS_23700 gene folE2 2685 1723 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5D3 protein_id gnl|my_center|LOCUS_23700 3487 2738 gene locus_tag LOCUS_23710 gene gpmA 3487 2738 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFC8 protein_id gnl|my_center|LOCUS_23710 4185 3553 gene locus_tag LOCUS_23720 4185 3553 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706079.1 protein_id gnl|my_center|LOCUS_23720 5368 4238 gene locus_tag LOCUS_23730 5368 4238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057110.1 protein_id gnl|my_center|LOCUS_23730 5439 9665 gene locus_tag LOCUS_23740 5439 9665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 9681 11576 gene locus_tag LOCUS_23750 9681 11576 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489375.1 protein_id gnl|my_center|LOCUS_23750 11892 11608 gene locus_tag LOCUS_23760 11892 11608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 12589 13932 gene locus_tag LOCUS_23770 12589 13932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 >Feature sequence067 1961 1125 gene locus_tag LOCUS_23780 1961 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030062.1 protein_id gnl|my_center|LOCUS_23780 2461 4083 gene locus_tag LOCUS_23790 gene pyrG 2461 4083 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJ86 protein_id gnl|my_center|LOCUS_23790 4334 5062 gene locus_tag LOCUS_23800 4334 5062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 5193 5828 gene locus_tag LOCUS_23810 5193 5828 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764500.1 protein_id gnl|my_center|LOCUS_23810 5833 7038 gene locus_tag LOCUS_23820 5833 7038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109198.1 protein_id gnl|my_center|LOCUS_23820 9649 7055 gene locus_tag LOCUS_23830 gene clpB 9649 7055 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AW6 protein_id gnl|my_center|LOCUS_23830 9855 10514 gene locus_tag LOCUS_23840 gene nth 9855 10514 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGP4 protein_id gnl|my_center|LOCUS_23840 11741 10536 gene locus_tag LOCUS_23850 11741 10536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 13622 11808 gene locus_tag LOCUS_23860 13622 11808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 14104 13619 gene locus_tag LOCUS_23870 14104 13619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 >Feature sequence068 1525 644 gene locus_tag LOCUS_23880 gene folD 1525 644 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RB7 protein_id gnl|my_center|LOCUS_23880 2297 1542 gene locus_tag LOCUS_23890 2297 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 3121 2294 gene locus_tag LOCUS_23900 3121 2294 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLS4 protein_id gnl|my_center|LOCUS_23900 3155 3907 gene locus_tag LOCUS_23910 3155 3907 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_23910 3941 4195 gene locus_tag LOCUS_23920 gene acpP 3941 4195 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5N7 protein_id gnl|my_center|LOCUS_23920 4248 5483 gene locus_tag LOCUS_23930 4248 5483 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJX3 protein_id gnl|my_center|LOCUS_23930 5840 7081 gene locus_tag LOCUS_23940 5840 7081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 >Feature sequence069 1366 3477 gene locus_tag LOCUS_23950 1366 3477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 4385 3702 gene locus_tag LOCUS_23960 4385 3702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 5520 4441 gene locus_tag LOCUS_23970 gene mnmA 5520 4441 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRK0 protein_id gnl|my_center|LOCUS_23970 5694 8027 gene locus_tag LOCUS_23980 5694 8027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 9328 8039 gene locus_tag LOCUS_23990 9328 8039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 9564 10724 gene locus_tag LOCUS_24000 gene tgt 9564 10724 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183P1 protein_id gnl|my_center|LOCUS_24000 11335 10793 gene locus_tag LOCUS_24010 11335 10793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 11504 11580 gene locus_tag LOCUS_t00280 11504 11580 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 11667 12515 gene locus_tag LOCUS_24020 gene ykwC 11667 12515 CDS product putative oxidoreductase YkwC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34948 protein_id gnl|my_center|LOCUS_24020 12560 13876 gene locus_tag LOCUS_24030 gene araN 12560 13876 CDS product putative arabinose-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94528 protein_id gnl|my_center|LOCUS_24030 >Feature sequence070 2 949 gene locus_tag LOCUS_24040 2 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 4745 957 gene locus_tag LOCUS_24050 4745 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 4639 4872 gene locus_tag LOCUS_24060 4639 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 4927 5868 gene locus_tag LOCUS_24070 4927 5868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 5875 6810 gene locus_tag LOCUS_24080 5875 6810 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330018.1 protein_id gnl|my_center|LOCUS_24080 6807 8558 gene locus_tag LOCUS_24090 6807 8558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 8555 9514 gene locus_tag LOCUS_24100 8555 9514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 9515 9889 gene locus_tag LOCUS_24110 9515 9889 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953389.1 protein_id gnl|my_center|LOCUS_24110 11712 9886 gene locus_tag LOCUS_24120 11712 9886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 12040 11723 gene locus_tag LOCUS_24130 12040 11723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 13356 12157 gene locus_tag LOCUS_24140 13356 12157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 >Feature sequence071 274 1338 gene locus_tag LOCUS_24150 gene ltaE 274 1338 CDS product L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746W0 protein_id gnl|my_center|LOCUS_24150 2444 1341 gene locus_tag LOCUS_24160 2444 1341 CDS product muconate-lactonizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532878.1 protein_id gnl|my_center|LOCUS_24160 2561 3541 gene locus_tag LOCUS_24170 2561 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 3561 4676 gene locus_tag LOCUS_24180 3561 4676 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973578.1 protein_id gnl|my_center|LOCUS_24180 4736 5950 gene locus_tag LOCUS_24190 4736 5950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 5958 6425 gene locus_tag LOCUS_24200 5958 6425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404578.1 protein_id gnl|my_center|LOCUS_24200 6445 6900 gene locus_tag LOCUS_24210 6445 6900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 7149 7619 gene locus_tag LOCUS_24220 7149 7619 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526288.1 protein_id gnl|my_center|LOCUS_24220 7648 8085 gene locus_tag LOCUS_24230 7648 8085 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940109.1 protein_id gnl|my_center|LOCUS_24230 9944 8067 gene locus_tag LOCUS_24240 9944 8067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 10982 10086 gene locus_tag LOCUS_24250 gene hag 10982 10086 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D462 protein_id gnl|my_center|LOCUS_24250 11924 11007 gene locus_tag LOCUS_24260 gene flaA 11924 11007 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89NY8 protein_id gnl|my_center|LOCUS_24260 >Feature sequence072 64 2424 gene locus_tag LOCUS_24270 64 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 2840 2442 gene locus_tag LOCUS_24280 2840 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 3445 2870 gene locus_tag LOCUS_24290 3445 2870 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943377.1 protein_id gnl|my_center|LOCUS_24290 3641 4033 gene locus_tag LOCUS_24300 3641 4033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 5018 4044 gene locus_tag LOCUS_24310 5018 4044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 6390 5140 gene locus_tag LOCUS_24320 6390 5140 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813306.1 protein_id gnl|my_center|LOCUS_24320 6547 6804 gene locus_tag LOCUS_24330 gene xseB 6547 6804 CDS product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F632 protein_id gnl|my_center|LOCUS_24330 6809 8734 gene locus_tag LOCUS_24340 gene dxs2 6809 8734 CDS product 1-deoxy-D-xylulose-5-phosphate synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CB0 protein_id gnl|my_center|LOCUS_24340 <12951 8870 gene locus_tag LOCUS_24350 <12951 8870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070585.1:GlyGly-CTERM sorting domain-containing protein >Feature sequence073 3370 3445 gene locus_tag LOCUS_t00290 3370 3445 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3461 4882 gene locus_tag LOCUS_24360 3461 4882 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804244.1 protein_id gnl|my_center|LOCUS_24360 5090 5899 gene locus_tag LOCUS_24370 5090 5899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 7151 5910 gene locus_tag LOCUS_24380 7151 5910 CDS product DUF4432 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704678.1 protein_id gnl|my_center|LOCUS_24380 8031 7177 gene locus_tag LOCUS_24390 gene aroE 8031 7177 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CUJ9 protein_id gnl|my_center|LOCUS_24390 8203 10989 gene locus_tag LOCUS_24400 8203 10989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120107.1 protein_id gnl|my_center|LOCUS_24400 >Feature sequence074 321 2258 gene locus_tag LOCUS_24410 321 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120253.1 protein_id gnl|my_center|LOCUS_24410 2236 3849 gene locus_tag LOCUS_24420 2236 3849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121211.1 protein_id gnl|my_center|LOCUS_24420 5363 3855 gene locus_tag LOCUS_24430 5363 3855 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121095.1 protein_id gnl|my_center|LOCUS_24430 6562 5378 gene locus_tag LOCUS_24440 6562 5378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 8081 6579 gene locus_tag LOCUS_24450 8081 6579 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122409.1 protein_id gnl|my_center|LOCUS_24450 9100 8198 gene locus_tag LOCUS_24460 9100 8198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 >Feature sequence075 1866 523 gene locus_tag LOCUS_24470 1866 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 2161 3888 gene locus_tag LOCUS_24480 2161 3888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 3878 6154 gene locus_tag LOCUS_24490 3878 6154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 6207 7865 gene locus_tag LOCUS_24500 6207 7865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24500 7894 9252 gene locus_tag LOCUS_24510 7894 9252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 9904 9275 gene locus_tag LOCUS_24520 gene pcm 9904 9275 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG96 protein_id gnl|my_center|LOCUS_24520 11208 9901 gene locus_tag LOCUS_24530 11208 9901 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405033.1 protein_id gnl|my_center|LOCUS_24530 >Feature sequence076 504 1217 gene locus_tag LOCUS_24540 504 1217 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327344.1 protein_id gnl|my_center|LOCUS_24540 2129 1329 gene locus_tag LOCUS_24550 2129 1329 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108741.1 protein_id gnl|my_center|LOCUS_24550 4686 2143 gene locus_tag LOCUS_24560 4686 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 4743 5588 gene locus_tag LOCUS_24570 4743 5588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122998.1 protein_id gnl|my_center|LOCUS_24570 5593 6807 gene locus_tag LOCUS_24580 5593 6807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949085.1 protein_id gnl|my_center|LOCUS_24580 6842 8224 gene locus_tag LOCUS_24590 6842 8224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120350.1 protein_id gnl|my_center|LOCUS_24590 9541 8291 gene locus_tag LOCUS_24600 9541 8291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119116.1 protein_id gnl|my_center|LOCUS_24600 10326 9568 gene locus_tag LOCUS_24610 10326 9568 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122635.1 protein_id gnl|my_center|LOCUS_24610 >Feature sequence077 1018 584 gene locus_tag LOCUS_24620 1018 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 2084 1032 gene locus_tag LOCUS_24630 gene dinB 2084 1032 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZY20 protein_id gnl|my_center|LOCUS_24630 3128 2139 gene locus_tag LOCUS_24640 gene qor 3128 2139 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647231.1 protein_id gnl|my_center|LOCUS_24640 4554 3181 gene locus_tag LOCUS_24650 4554 3181 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_24650 7458 4603 gene locus_tag LOCUS_24660 7458 4603 CDS product xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121568.1 protein_id gnl|my_center|LOCUS_24660 9037 7577 gene locus_tag LOCUS_24670 9037 7577 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118989.1 protein_id gnl|my_center|LOCUS_24670 >Feature sequence078 9585 8110 gene locus_tag LOCUS_24680 9585 8110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 10657 9956 gene locus_tag LOCUS_24690 10657 9956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 >Feature sequence079 958 131 gene locus_tag LOCUS_24700 958 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 3467 939 gene locus_tag LOCUS_24710 3467 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121739.1 protein_id gnl|my_center|LOCUS_24710 4852 3560 gene locus_tag LOCUS_24720 4852 3560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327912.1 protein_id gnl|my_center|LOCUS_24720 6804 4867 gene locus_tag LOCUS_24730 6804 4867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121107.1 protein_id gnl|my_center|LOCUS_24730 7525 7064 gene locus_tag LOCUS_24740 7525 7064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 7648 9339 gene locus_tag LOCUS_24750 7648 9339 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976195.1 protein_id gnl|my_center|LOCUS_24750 9695 10576 gene locus_tag LOCUS_24760 9695 10576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 >Feature sequence080 5 91 gene locus_tag LOCUS_t00300 5 91 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 861 346 gene locus_tag LOCUS_24770 861 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 2023 893 gene locus_tag LOCUS_24780 2023 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 2111 2668 gene locus_tag LOCUS_24790 2111 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 2700 3170 gene locus_tag LOCUS_24800 2700 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 3569 3195 gene locus_tag LOCUS_24810 3569 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 3783 4397 gene locus_tag LOCUS_24820 3783 4397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 4989 4414 gene locus_tag LOCUS_24830 4989 4414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 5332 6039 gene locus_tag LOCUS_24840 5332 6039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 6298 6095 gene locus_tag LOCUS_24850 6298 6095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 6249 7214 gene locus_tag LOCUS_24860 6249 7214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 7224 7901 gene locus_tag LOCUS_24870 7224 7901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 8095 9633 gene locus_tag LOCUS_24880 8095 9633 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546463.1 protein_id gnl|my_center|LOCUS_24880 >Feature sequence081 <1 1607 gene locus_tag LOCUS_24890 <1 1607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118116.1:cellulosome anchoring protein 1687 3981 gene locus_tag LOCUS_24900 1687 3981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 4031 5101 gene locus_tag LOCUS_24910 4031 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 5154 6086 gene locus_tag LOCUS_24920 5154 6086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 6165 6240 gene locus_tag LOCUS_t00310 6165 6240 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6801 6364 gene locus_tag LOCUS_24930 6801 6364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 6920 7555 gene locus_tag LOCUS_24940 6920 7555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 7598 8044 gene locus_tag LOCUS_24950 7598 8044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 8188 8277 gene locus_tag LOCUS_t00320 8188 8277 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence082 952 2373 gene locus_tag LOCUS_24960 952 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24960 2376 2735 gene locus_tag LOCUS_24970 2376 2735 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969399.1 protein_id gnl|my_center|LOCUS_24970 2740 4320 gene locus_tag LOCUS_24980 2740 4320 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969398.1 protein_id gnl|my_center|LOCUS_24980 4846 4397 gene locus_tag LOCUS_24990 4846 4397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 5556 4939 gene locus_tag LOCUS_25000 5556 4939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 6963 5581 gene locus_tag LOCUS_25010 6963 5581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 >Feature sequence083 287 1285 gene locus_tag LOCUS_25020 287 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 1455 1895 gene locus_tag LOCUS_25030 1455 1895 CDS product SOS error prone mutagenesis protein UmuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947431.1 protein_id gnl|my_center|LOCUS_25030 1892 3136 gene locus_tag LOCUS_25040 1892 3136 CDS product SOS mutagenesis and repair protein UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202620.1 protein_id gnl|my_center|LOCUS_25040 3602 4024 gene locus_tag LOCUS_25050 3602 4024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 4046 5548 gene locus_tag LOCUS_25060 4046 5548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 5967 5560 gene locus_tag LOCUS_25070 5967 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 6906 5980 gene locus_tag LOCUS_25080 6906 5980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 7778 7005 gene locus_tag LOCUS_25090 7778 7005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 8801 8046 gene locus_tag LOCUS_25100 8801 8046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 9396 8794 gene locus_tag LOCUS_25110 9396 8794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 9770 9845 gene locus_tag LOCUS_t00330 9770 9845 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence084 2146 5787 gene locus_tag LOCUS_25120 2146 5787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 7206 5815 gene locus_tag LOCUS_25130 7206 5815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120350.1 protein_id gnl|my_center|LOCUS_25130 8215 7343 gene locus_tag LOCUS_25140 8215 7343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 8341 8793 gene locus_tag LOCUS_25150 8341 8793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 8783 9148 gene locus_tag LOCUS_25160 8783 9148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 >Feature sequence085 472 1374 gene locus_tag LOCUS_25170 gene psd 472 1374 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFM0 protein_id gnl|my_center|LOCUS_25170 1501 2469 gene locus_tag LOCUS_25180 1501 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 2751 2572 gene locus_tag LOCUS_25190 2751 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 2871 6137 gene locus_tag LOCUS_25200 2871 6137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 6179 7291 gene locus_tag LOCUS_25210 6179 7291 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_25210 8722 7388 gene locus_tag LOCUS_25220 8722 7388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 >Feature sequence086 <1 2581 gene locus_tag LOCUS_25230 <1 2581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120793.1:L-sorbosone dehydrogenase 2584 2949 gene locus_tag LOCUS_25240 2584 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 3055 3627 gene locus_tag LOCUS_25250 3055 3627 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121244.1 protein_id gnl|my_center|LOCUS_25250 3624 6473 gene locus_tag LOCUS_25260 3624 6473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 6549 7004 gene locus_tag LOCUS_25270 6549 7004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 >Feature sequence087 235 1170 gene locus_tag LOCUS_25280 gene wzz 235 1170 CDS product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073078.1 protein_id gnl|my_center|LOCUS_25280 1243 2526 gene locus_tag LOCUS_25290 1243 2526 CDS product UDP-N-acetyl-D-glucosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118902.1 protein_id gnl|my_center|LOCUS_25290 2622 3539 gene locus_tag LOCUS_25300 2622 3539 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122178.1 protein_id gnl|my_center|LOCUS_25300 3536 4555 gene locus_tag LOCUS_25310 3536 4555 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582950.1 protein_id gnl|my_center|LOCUS_25310 4583 5233 gene locus_tag LOCUS_25320 4583 5233 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_25320 5246 6355 gene locus_tag LOCUS_25330 gene bplC 5246 6355 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929614.1 protein_id gnl|my_center|LOCUS_25330 6373 7332 gene locus_tag LOCUS_25340 gene kpsF 6373 7332 CDS product arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8H2 protein_id gnl|my_center|LOCUS_25340 7382 7573 gene locus_tag LOCUS_25350 7382 7573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 >Feature sequence088 >Feature sequence089 1673 747 gene locus_tag LOCUS_25360 gene fliC 1673 747 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CX7 protein_id gnl|my_center|LOCUS_25360 2457 1768 gene locus_tag LOCUS_25370 2457 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 6437 2925 gene locus_tag LOCUS_25380 6437 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 6804 7040 gene locus_tag LOCUS_25390 6804 7040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 >Feature sequence090 876 2156 gene locus_tag LOCUS_25400 876 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 3357 2170 gene locus_tag LOCUS_25410 gene araC 3357 2170 CDS product XylR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118375.1 protein_id gnl|my_center|LOCUS_25410 3491 5074 gene locus_tag LOCUS_25420 3491 5074 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031534.1 protein_id gnl|my_center|LOCUS_25420 5128 6534 gene locus_tag LOCUS_25430 5128 6534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 >Feature sequence091 372 1271 gene locus_tag LOCUS_25440 372 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 1408 1590 gene locus_tag LOCUS_25450 1408 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 1682 3694 gene locus_tag LOCUS_25460 1682 3694 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096983.1 protein_id gnl|my_center|LOCUS_25460 4715 3756 gene locus_tag LOCUS_25470 4715 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 5880 4741 gene locus_tag LOCUS_25480 5880 4741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 6074 6754 gene locus_tag LOCUS_25490 6074 6754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 >Feature sequence092 2113 1709 gene locus_tag LOCUS_25500 2113 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 2170 4953 gene locus_tag LOCUS_25510 2170 4953 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124071.1 protein_id gnl|my_center|LOCUS_25510 6879 4960 gene locus_tag LOCUS_25520 6879 4960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 >Feature sequence093 192 1070 gene locus_tag LOCUS_25530 192 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 1195 1800 gene locus_tag LOCUS_25540 1195 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 3006 1813 gene locus_tag LOCUS_25550 3006 1813 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121887.1 protein_id gnl|my_center|LOCUS_25550 3699 5015 gene locus_tag LOCUS_25560 3699 5015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074039.1 protein_id gnl|my_center|LOCUS_25560 5773 5159 gene locus_tag LOCUS_25570 5773 5159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263795.1 protein_id gnl|my_center|LOCUS_25570 >Feature sequence094 631 1413 gene locus_tag LOCUS_25580 631 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 1571 1416 gene locus_tag LOCUS_25590 1571 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 2167 1634 gene locus_tag LOCUS_25600 2167 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 2323 3477 gene locus_tag LOCUS_25610 2323 3477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 3746 3570 gene locus_tag LOCUS_25620 3746 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 >Feature sequence095 852 61 gene locus_tag LOCUS_25630 852 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 2359 941 gene locus_tag LOCUS_25640 2359 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 2517 3446 gene locus_tag LOCUS_25650 2517 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 3798 3725 gene locus_tag LOCUS_t00340 3798 3725 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4129 3866 gene locus_tag LOCUS_25660 4129 3866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 4204 5082 gene locus_tag LOCUS_25670 4204 5082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 5129 5713 gene locus_tag LOCUS_25680 5129 5713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 5999 5736 gene locus_tag LOCUS_25690 5999 5736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 >Feature sequence096 654 1397 gene locus_tag LOCUS_25700 gene mip 654 1397 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKI6 protein_id gnl|my_center|LOCUS_25700 2155 1430 gene locus_tag LOCUS_25710 2155 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 3684 2152 gene locus_tag LOCUS_25720 3684 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 5260 3674 gene locus_tag LOCUS_25730 5260 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 6068 5400 gene locus_tag LOCUS_25740 6068 5400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 >Feature sequence097 1012 425 gene locus_tag LOCUS_25750 1012 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 1274 1975 gene locus_tag LOCUS_25760 gene queC 1274 1975 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6W2G5 protein_id gnl|my_center|LOCUS_25760 1992 2423 gene locus_tag LOCUS_25770 gene queD 1992 2423 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31676 protein_id gnl|my_center|LOCUS_25770 2420 3121 gene locus_tag LOCUS_25780 gene queE 2420 3121 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1N2 protein_id gnl|my_center|LOCUS_25780 3291 3956 gene locus_tag LOCUS_25790 3291 3956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 3953 4186 gene locus_tag LOCUS_25800 3953 4186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 4296 5216 gene locus_tag LOCUS_25810 4296 5216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 5213 5650 gene locus_tag LOCUS_25820 5213 5650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 >Feature sequence098 1279 2976 gene locus_tag LOCUS_25830 1279 2976 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804353.1 protein_id gnl|my_center|LOCUS_25830 2983 3606 gene locus_tag LOCUS_25840 2983 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 3923 3636 gene locus_tag LOCUS_25850 3923 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 4985 3942 gene locus_tag LOCUS_25860 4985 3942 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AE7 protein_id gnl|my_center|LOCUS_25860 4869 5396 gene locus_tag LOCUS_25870 gene ymdB 4869 5396 CDS product RNase III inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941194.1 protein_id gnl|my_center|LOCUS_25870 >Feature sequence099 <1 845 gene locus_tag LOCUS_25880 <1 845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257155.1:glycerol-3-phosphate ABC transporter permease 842 1687 gene locus_tag LOCUS_25890 842 1687 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729785.1 protein_id gnl|my_center|LOCUS_25890 1684 2817 gene locus_tag LOCUS_25900 1684 2817 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583259.1 protein_id gnl|my_center|LOCUS_25900 2945 4711 gene locus_tag LOCUS_25910 2945 4711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 4746 5606 gene locus_tag LOCUS_25920 4746 5606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 >Feature sequence100 1926 640 gene locus_tag LOCUS_25930 1926 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_25930 2108 3388 gene locus_tag LOCUS_25940 2108 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123786.1 protein_id gnl|my_center|LOCUS_25940 >Feature sequence101 1252 788 gene locus_tag LOCUS_25950 1252 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 1948 1274 gene locus_tag LOCUS_25960 1948 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 2472 2284 gene locus_tag LOCUS_25970 2472 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 3056 2532 gene locus_tag LOCUS_25980 3056 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 3817 3053 gene locus_tag LOCUS_25990 3817 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 4385 3825 gene locus_tag LOCUS_26000 4385 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 >Feature sequence102 665 198 gene locus_tag LOCUS_26010 665 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 2601 757 gene locus_tag LOCUS_26020 gene glmS 2601 757 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2U4 protein_id gnl|my_center|LOCUS_26020 4573 2678 gene locus_tag LOCUS_26030 gene uup 4573 2678 CDS product heme ABC transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941581.1 protein_id gnl|my_center|LOCUS_26030 >Feature sequence103 1616 480 gene locus_tag LOCUS_26040 1616 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 2495 1656 gene locus_tag LOCUS_26050 2495 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120623.1 protein_id gnl|my_center|LOCUS_26050 2600 3034 gene locus_tag LOCUS_26060 2600 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 4445 3048 gene locus_tag LOCUS_26070 4445 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_26070 4624 4983 gene locus_tag LOCUS_26080 4624 4983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 4980 5390 gene locus_tag LOCUS_26090 4980 5390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 >Feature sequence104 <1 1933 gene locus_tag LOCUS_26100 <1 1933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118116.1:cellulosome anchoring protein >Feature sequence105 16 89 gene locus_tag LOCUS_t00350 16 89 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 233 1726 gene locus_tag LOCUS_26110 233 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 1787 2191 gene locus_tag LOCUS_26120 1787 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 2409 2251 gene locus_tag LOCUS_26130 2409 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 2906 2493 gene locus_tag LOCUS_26140 2906 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 4150 3005 gene locus_tag LOCUS_26150 4150 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 4149 5321 gene locus_tag LOCUS_26160 4149 5321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 >Feature sequence106 339 1295 gene locus_tag LOCUS_26170 339 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 1464 2306 gene locus_tag LOCUS_26180 1464 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 2377 3741 gene locus_tag LOCUS_26190 2377 3741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_26190 3760 4185 gene locus_tag LOCUS_26200 3760 4185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 4642 4235 gene locus_tag LOCUS_26210 4642 4235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 >Feature sequence107 <1 1366 gene locus_tag LOCUS_26220 <1 1366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O50286:dihydrolipoyl dehydrogenase 1493 1407 gene locus_tag LOCUS_t00360 1493 1407 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2025 1648 gene locus_tag LOCUS_26230 2025 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 2169 2396 gene locus_tag LOCUS_26240 2169 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 2393 3337 gene locus_tag LOCUS_26250 gene xerC 2393 3337 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQY6 protein_id gnl|my_center|LOCUS_26250 3516 4820 gene locus_tag LOCUS_26260 3516 4820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 >Feature sequence108 602 817 gene locus_tag LOCUS_26270 602 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 851 2980 gene locus_tag LOCUS_26280 851 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 3161 3943 gene locus_tag LOCUS_26290 3161 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 >Feature sequence109 5 823 gene locus_tag LOCUS_26300 5 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 992 1759 gene locus_tag LOCUS_26310 992 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120623.1 protein_id gnl|my_center|LOCUS_26310 1792 3123 gene locus_tag LOCUS_26320 1792 3123 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704479.1 protein_id gnl|my_center|LOCUS_26320 >Feature sequence110 3386 315 gene locus_tag LOCUS_26330 3386 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 4196 3555 gene locus_tag LOCUS_26340 4196 3555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 >Feature sequence111 346 1746 gene locus_tag LOCUS_26350 346 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120350.1 protein_id gnl|my_center|LOCUS_26350 3014 1782 gene locus_tag LOCUS_26360 3014 1782 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118454.1 protein_id gnl|my_center|LOCUS_26360 >Feature sequence112 737 1828 gene locus_tag LOCUS_26370 737 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 3148 1853 gene locus_tag LOCUS_26380 3148 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 3461 3547 gene locus_tag LOCUS_t00370 3461 3547 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence113 <1 976 gene locus_tag LOCUS_26390 <1 976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583420.1:3-deoxy-7-phosphoheptulonate synthase 1985 984 gene locus_tag LOCUS_26400 gene rfaD 1985 984 CDS product ADP-L-glycero-D-manno-heptose-6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHY3 protein_id gnl|my_center|LOCUS_26400 2805 1978 gene locus_tag LOCUS_26410 gene proC 2805 1978 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M9B7 protein_id gnl|my_center|LOCUS_26410 >Feature sequence114 >Feature sequence115 >Feature sequence116 985 395 gene locus_tag LOCUS_26420 985 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 1934 1062 gene locus_tag LOCUS_26430 1934 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 2208 1993 gene locus_tag LOCUS_26440 2208 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 3066 2254 gene locus_tag LOCUS_26450 3066 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 >Feature sequence117 1392 2168 gene locus_tag LOCUS_26460 gene fliC 1392 2168 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CX7 protein_id gnl|my_center|LOCUS_26460 >Feature sequence118 3 641 gene locus_tag LOCUS_26470 3 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 673 1281 gene locus_tag LOCUS_26480 gene rpsD 673 1281 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y6T6 protein_id gnl|my_center|LOCUS_26480 1336 2334 gene locus_tag LOCUS_26490 gene rpoA 1336 2334 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFS6 protein_id gnl|my_center|LOCUS_26490 >Feature sequence119 1473 937 gene locus_tag LOCUS_26500 1473 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 2636 1884 gene locus_tag LOCUS_26510 2636 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 >Feature sequence120 >Feature sequence121 1378 2490 gene locus_tag LOCUS_26520 1378 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 >Feature sequence122 2010 1075 gene locus_tag LOCUS_26530 gene fliC 2010 1075 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748G4 protein_id gnl|my_center|LOCUS_26530 >Feature sequence123 752 2485 gene locus_tag LOCUS_26540 752 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 >Feature sequence124 >Feature sequence125 >Feature sequence126 >Feature sequence127 981 334 gene locus_tag LOCUS_26550 981 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 1576 1028 gene locus_tag LOCUS_26560 1576 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 >Feature sequence128 284 430 gene locus_tag LOCUS_26570 284 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 444 1784 gene locus_tag LOCUS_26580 444 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 >Feature sequence129 <1 1094 gene locus_tag LOCUS_26590 <1 1094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118163.1:acetylglucosamine-6-sulfatase >Feature sequence130 2089 1142 gene locus_tag LOCUS_26600 2089 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 >Feature sequence131 1175 1588 gene locus_tag LOCUS_26610 1175 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 >Feature sequence132 >Feature sequence133 >Feature sequence134 540 1136 gene locus_tag LOCUS_26620 540 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682064.1 protein_id gnl|my_center|LOCUS_26620 <2013 1426 gene locus_tag LOCUS_26630 <2013 1426 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001102862.1:Xaa-Pro dipeptidase >Feature sequence135 >Feature sequence136 >Feature sequence137 >Feature sequence138 >Feature sequence139 1280 366 gene locus_tag LOCUS_26640 1280 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 >Feature sequence140 >Feature sequence141 >Feature sequence142 76 897 gene locus_tag LOCUS_26650 76 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 >Feature sequence143 >Feature sequence144 <1 1028 gene locus_tag LOCUS_26660 <1 1028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A9J2:uronate isomerase 1773 1174 gene locus_tag LOCUS_26670 1773 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 >Feature sequence145 <1 1029 gene locus_tag LOCUS_26680 <1 1029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DMI6:2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase >Feature sequence146 21 758 gene locus_tag LOCUS_26690 21 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 >Feature sequence147 >Feature sequence148 >Feature sequence149 >Feature sequence150 >Feature sequence151 620 895 gene locus_tag LOCUS_26700 620 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 <1610 994 gene locus_tag LOCUS_26710 <1610 994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902019.1:aminopeptidase >Feature sequence152 117 1124 gene locus_tag LOCUS_26720 117 1124 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403637.1 protein_id gnl|my_center|LOCUS_26720 >Feature sequence153 <1 1377 gene locus_tag LOCUS_26730 <1 1377 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117896.1:arylsulfatase >Feature sequence154 130 858 gene locus_tag LOCUS_26740 130 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 >Feature sequence155 >Feature sequence156 >Feature sequence157 >Feature sequence158 626 1042 gene locus_tag LOCUS_26750 626 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 >Feature sequence159 >Feature sequence160 >Feature sequence161 <1318 144 gene locus_tag LOCUS_26760 <1318 144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119646.1:large multi-functional protein >Feature sequence162 <1 678 gene locus_tag LOCUS_26770 <1 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000584628.1:AAA family ATPase 682 822 gene locus_tag LOCUS_26780 682 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 829 1218 gene locus_tag LOCUS_26790 829 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 >Feature sequence163 569 916 gene locus_tag LOCUS_26800 569 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 >Feature sequence164 >Feature sequence165 684 968 gene locus_tag LOCUS_26810 684 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 >Feature sequence166 >Feature sequence167 >Feature sequence168 <1210 175 gene locus_tag LOCUS_26820 <1210 175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9S2C0:serine/threonine-protein kinase PksC >Feature sequence169 >Feature sequence170 559 266 gene locus_tag LOCUS_26830 559 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 >Feature sequence171 919 677 gene locus_tag LOCUS_26840 919 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 >Feature sequence172 <1 738 gene locus_tag LOCUS_26850 <1 738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7D462:flagellin >Feature sequence173 >Feature sequence174 >Feature sequence175 >Feature sequence176 >Feature sequence177 >Feature sequence178 >Feature sequence179 >Feature sequence180 62 925 gene locus_tag LOCUS_26860 62 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 >Feature sequence181 >Feature sequence182 >Feature sequence183 230 889 gene locus_tag LOCUS_26870 230 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870