>Feature sequence001 2167 749 gene locus_tag LOCUS_00010 2167 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00010 5322 2506 gene locus_tag LOCUS_00020 5322 2506 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285985.1 protein_id gnl|my_center|LOCUS_00020 5427 6413 gene locus_tag LOCUS_00030 5427 6413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 6430 7998 gene locus_tag LOCUS_00040 6430 7998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 8076 9533 gene locus_tag LOCUS_00050 8076 9533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 12070 10109 gene locus_tag LOCUS_00060 12070 10109 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122594.1 protein_id gnl|my_center|LOCUS_00060 14234 12243 gene locus_tag LOCUS_00070 14234 12243 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108596.1 protein_id gnl|my_center|LOCUS_00070 15502 14318 gene locus_tag LOCUS_00080 15502 14318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 16910 15639 gene locus_tag LOCUS_00090 16910 15639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 17201 18775 gene locus_tag LOCUS_00100 17201 18775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 18812 19921 gene locus_tag LOCUS_00110 18812 19921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00110 19903 20214 gene locus_tag LOCUS_00120 19903 20214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00120 20396 21433 gene locus_tag LOCUS_00130 20396 21433 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963682.1 protein_id gnl|my_center|LOCUS_00130 25977 21745 gene locus_tag LOCUS_00140 25977 21745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 26883 26233 gene locus_tag LOCUS_00150 26883 26233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 28500 26965 gene locus_tag LOCUS_00160 28500 26965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 28600 28824 gene locus_tag LOCUS_00170 28600 28824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 29011 32832 gene locus_tag LOCUS_00180 29011 32832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 32856 33566 gene locus_tag LOCUS_00190 32856 33566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 35937 33550 gene locus_tag LOCUS_00200 35937 33550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 37030 37797 gene locus_tag LOCUS_00210 37030 37797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 38092 40359 gene locus_tag LOCUS_00220 38092 40359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 41835 40435 gene locus_tag LOCUS_00230 41835 40435 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118376.1 protein_id gnl|my_center|LOCUS_00230 43292 42126 gene locus_tag LOCUS_00240 43292 42126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 43747 43310 gene locus_tag LOCUS_00250 43747 43310 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770645.1 protein_id gnl|my_center|LOCUS_00250 44161 43754 gene locus_tag LOCUS_00260 44161 43754 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119077.1 protein_id gnl|my_center|LOCUS_00260 44968 44174 gene locus_tag LOCUS_00270 44968 44174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 46095 44977 gene locus_tag LOCUS_00280 46095 44977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 49075 46088 gene locus_tag LOCUS_00290 49075 46088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 49529 53521 gene locus_tag LOCUS_00300 49529 53521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 53721 55031 gene locus_tag LOCUS_00310 53721 55031 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117863.1 protein_id gnl|my_center|LOCUS_00310 55960 55232 gene locus_tag LOCUS_00320 55960 55232 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405245.1 protein_id gnl|my_center|LOCUS_00320 57314 55965 gene locus_tag LOCUS_00330 57314 55965 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118427.1 protein_id gnl|my_center|LOCUS_00330 57747 58586 gene locus_tag LOCUS_00340 57747 58586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 58618 60156 gene locus_tag LOCUS_00350 58618 60156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 60267 60962 gene locus_tag LOCUS_00360 60267 60962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 61220 62038 gene locus_tag LOCUS_00370 gene ugpQ 61220 62038 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119041.1 protein_id gnl|my_center|LOCUS_00370 62534 63961 gene locus_tag LOCUS_00380 62534 63961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 63993 66701 gene locus_tag LOCUS_00390 63993 66701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 66855 67112 gene locus_tag LOCUS_00400 66855 67112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 68498 67263 gene locus_tag LOCUS_00410 gene galK 68498 67263 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A3CML9 protein_id gnl|my_center|LOCUS_00410 69505 68525 gene locus_tag LOCUS_00420 69505 68525 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255969.1 protein_id gnl|my_center|LOCUS_00420 69782 69516 gene locus_tag LOCUS_00430 69782 69516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 69996 69787 gene locus_tag LOCUS_00440 69996 69787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 70286 71293 gene locus_tag LOCUS_00450 70286 71293 CDS product XylR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120976.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00450 72058 72432 gene locus_tag LOCUS_00460 72058 72432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 72777 74600 gene locus_tag LOCUS_00470 gene yidC 72777 74600 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KGG2 protein_id gnl|my_center|LOCUS_00470 74688 75437 gene locus_tag LOCUS_00480 74688 75437 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F839 protein_id gnl|my_center|LOCUS_00480 75529 75783 gene locus_tag LOCUS_00490 75529 75783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 >Feature sequence002 1326 676 gene locus_tag LOCUS_00500 1326 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 1946 1611 gene locus_tag LOCUS_00510 1946 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 2208 2456 gene locus_tag LOCUS_00520 2208 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 3627 2767 gene locus_tag LOCUS_00530 gene tatC 3627 2767 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD48 protein_id gnl|my_center|LOCUS_00530 4361 4969 gene locus_tag LOCUS_00540 4361 4969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 4988 6469 gene locus_tag LOCUS_00550 4988 6469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 6574 8244 gene locus_tag LOCUS_00560 6574 8244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 9209 8433 gene locus_tag LOCUS_00570 gene lpxA 9209 8433 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63T24 protein_id gnl|my_center|LOCUS_00570 10561 9224 gene locus_tag LOCUS_00580 gene lpxC/fabZ 10561 9224 CDS product bifunctional enzyme LpxC/FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBX0 protein_id gnl|my_center|LOCUS_00580 10809 12167 gene locus_tag LOCUS_00590 gene ffh 10809 12167 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BB4 protein_id gnl|my_center|LOCUS_00590 12203 12769 gene locus_tag LOCUS_00600 gene hprT 12203 12769 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37472 protein_id gnl|my_center|LOCUS_00600 12830 13891 gene locus_tag LOCUS_00610 gene aroG 12830 13891 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E0I2 protein_id gnl|my_center|LOCUS_00610 15116 14022 gene locus_tag LOCUS_00620 gene rlmN 15116 14022 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK16 protein_id gnl|my_center|LOCUS_00620 15334 15495 gene locus_tag LOCUS_00630 15334 15495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 16973 16326 gene locus_tag LOCUS_00640 gene ubiE 16973 16326 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122034.1 protein_id gnl|my_center|LOCUS_00640 19038 17200 gene locus_tag LOCUS_00650 gene cysI 19038 17200 CDS product sulfite reductase [NADPH] hemoprotein beta-component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32213 protein_id gnl|my_center|LOCUS_00650 19158 20960 gene locus_tag LOCUS_00660 gene cysJ 19158 20960 CDS product sulfite reductase [NADPH] flavoprotein alpha-component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32214 protein_id gnl|my_center|LOCUS_00660 21079 21972 gene locus_tag LOCUS_00670 21079 21972 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089091.1 protein_id gnl|my_center|LOCUS_00670 22242 25055 gene locus_tag LOCUS_00680 22242 25055 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796991.1 protein_id gnl|my_center|LOCUS_00680 25314 25099 gene locus_tag LOCUS_00690 25314 25099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 25957 27156 gene locus_tag LOCUS_00700 gene rimK 25957 27156 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNW8 protein_id gnl|my_center|LOCUS_00700 27153 28229 gene locus_tag LOCUS_00710 27153 28229 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120210.1 protein_id gnl|my_center|LOCUS_00710 28226 28669 gene locus_tag LOCUS_00720 28226 28669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 29747 28746 gene locus_tag LOCUS_00730 29747 28746 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWC5 protein_id gnl|my_center|LOCUS_00730 30902 29790 gene locus_tag LOCUS_00740 30902 29790 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654729.1 protein_id gnl|my_center|LOCUS_00740 31468 31268 gene locus_tag LOCUS_00750 31468 31268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 32877 31465 gene locus_tag LOCUS_00760 32877 31465 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118019.1 protein_id gnl|my_center|LOCUS_00760 34332 33091 gene locus_tag LOCUS_00770 gene rhaA 34332 33091 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58507 protein_id gnl|my_center|LOCUS_00770 34444 35325 gene locus_tag LOCUS_00780 34444 35325 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762705.1 protein_id gnl|my_center|LOCUS_00780 36053 35808 gene locus_tag LOCUS_00790 36053 35808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 36687 38753 gene locus_tag LOCUS_00800 36687 38753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970584.1 protein_id gnl|my_center|LOCUS_00800 38796 38984 gene locus_tag LOCUS_00810 38796 38984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 41916 39358 gene locus_tag LOCUS_00820 41916 39358 CDS product alpha-1,4 glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKZ5 protein_id gnl|my_center|LOCUS_00820 43745 42309 gene locus_tag LOCUS_00830 43745 42309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 44847 43738 gene locus_tag LOCUS_00840 gene prfB 44847 43738 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y4D8 protein_id gnl|my_center|LOCUS_00840 45240 44962 gene locus_tag LOCUS_00850 45240 44962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707213.1 protein_id gnl|my_center|LOCUS_00850 45539 46444 gene locus_tag LOCUS_00860 45539 46444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 46605 47546 gene locus_tag LOCUS_00870 46605 47546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 49977 47968 gene locus_tag LOCUS_00880 49977 47968 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257128.1 protein_id gnl|my_center|LOCUS_00880 50137 51957 gene locus_tag LOCUS_00890 gene mutL 50137 51957 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJ86 protein_id gnl|my_center|LOCUS_00890 52971 52174 gene locus_tag LOCUS_00900 gene deoD 52971 52174 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HE80 protein_id gnl|my_center|LOCUS_00900 53253 52984 gene locus_tag LOCUS_00910 53253 52984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 53343 54041 gene locus_tag LOCUS_00920 53343 54041 CDS product 2-deoxyribose-5-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251054.1 protein_id gnl|my_center|LOCUS_00920 55822 54374 gene locus_tag LOCUS_00930 55822 54374 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258343.1 protein_id gnl|my_center|LOCUS_00930 57785 56730 gene locus_tag LOCUS_00940 57785 56730 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947748.1 protein_id gnl|my_center|LOCUS_00940 61910 58245 gene locus_tag LOCUS_00950 61910 58245 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_00950 63819 61903 gene locus_tag LOCUS_00960 63819 61903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 >Feature sequence003 800 4138 gene locus_tag LOCUS_00970 800 4138 CDS product acyl-[ACP]--phospholipid O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943656.1 protein_id gnl|my_center|LOCUS_00970 5449 4217 gene locus_tag LOCUS_00980 gene xylR 5449 4217 CDS product xylose repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94490 protein_id gnl|my_center|LOCUS_00980 5561 6994 gene locus_tag LOCUS_00990 5561 6994 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767658.1 protein_id gnl|my_center|LOCUS_00990 7024 8289 gene locus_tag LOCUS_01000 7024 8289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767657.1 protein_id gnl|my_center|LOCUS_01000 8378 9697 gene locus_tag LOCUS_01010 gene phoD 8378 9697 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120624.1 protein_id gnl|my_center|LOCUS_01010 9711 11339 gene locus_tag LOCUS_01020 9711 11339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119625.1 protein_id gnl|my_center|LOCUS_01020 11375 12394 gene locus_tag LOCUS_01030 11375 12394 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120800.1 protein_id gnl|my_center|LOCUS_01030 12532 13416 gene locus_tag LOCUS_01040 12532 13416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 13519 14025 gene locus_tag LOCUS_01050 13519 14025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01050 14027 14890 gene locus_tag LOCUS_01060 14027 14890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01060 15714 14896 gene locus_tag LOCUS_01070 15714 14896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 15790 16575 gene locus_tag LOCUS_01080 15790 16575 CDS product D-mannonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332279.1 protein_id gnl|my_center|LOCUS_01080 16666 18075 gene locus_tag LOCUS_01090 gene uxaC 16666 18075 CDS product uronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9J2 protein_id gnl|my_center|LOCUS_01090 18082 19059 gene locus_tag LOCUS_01100 18082 19059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 19093 20181 gene locus_tag LOCUS_01110 19093 20181 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229212.1 protein_id gnl|my_center|LOCUS_01110 21458 20544 gene locus_tag LOCUS_01120 gene thrB 21458 20544 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RRU5 protein_id gnl|my_center|LOCUS_01120 21936 21460 gene locus_tag LOCUS_01130 gene smpB 21936 21460 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CG4 protein_id gnl|my_center|LOCUS_01130 22225 22007 gene locus_tag LOCUS_01140 22225 22007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 22380 22805 gene locus_tag LOCUS_01150 gene rplM 22380 22805 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMK8 protein_id gnl|my_center|LOCUS_01150 22824 23216 gene locus_tag LOCUS_01160 gene rpsI 22824 23216 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88XU7 protein_id gnl|my_center|LOCUS_01160 23399 24421 gene locus_tag LOCUS_01170 gene argC 23399 24421 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Z3 protein_id gnl|my_center|LOCUS_01170 24489 25712 gene locus_tag LOCUS_01180 gene argJ 24489 25712 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGC2 protein_id gnl|my_center|LOCUS_01180 25796 26686 gene locus_tag LOCUS_01190 25796 26686 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496896.1 protein_id gnl|my_center|LOCUS_01190 26772 27953 gene locus_tag LOCUS_01200 gene argD 26772 27953 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP73 protein_id gnl|my_center|LOCUS_01200 28027 28968 gene locus_tag LOCUS_01210 gene argF 28027 28968 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023243.1 protein_id gnl|my_center|LOCUS_01210 30201 32054 gene locus_tag LOCUS_01220 gene parE 30201 32054 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC8 protein_id gnl|my_center|LOCUS_01220 32268 32044 gene locus_tag LOCUS_01230 32268 32044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 34892 33243 gene locus_tag LOCUS_01240 gene groL 34892 33243 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AL6 protein_id gnl|my_center|LOCUS_01240 35231 34944 gene locus_tag LOCUS_01250 gene groS 35231 34944 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747C8 protein_id gnl|my_center|LOCUS_01250 37211 35322 gene locus_tag LOCUS_01260 gene dnaK 37211 35322 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YH59 protein_id gnl|my_center|LOCUS_01260 37501 37785 gene locus_tag LOCUS_01270 37501 37785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 37820 38500 gene locus_tag LOCUS_01280 37820 38500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 39144 38614 gene locus_tag LOCUS_01290 39144 38614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 39459 40715 gene locus_tag LOCUS_01300 gene ybdG 39459 40715 CDS product small conductance mechanosensitive ion channel protein YbdG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070528.1 protein_id gnl|my_center|LOCUS_01300 43667 40815 gene locus_tag LOCUS_01310 gene uvrA 43667 40815 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLU9 protein_id gnl|my_center|LOCUS_01310 44549 43740 gene locus_tag LOCUS_01320 44549 43740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 46631 44706 gene locus_tag LOCUS_01330 gene speA 46631 44706 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NE10 protein_id gnl|my_center|LOCUS_01330 47153 46773 gene locus_tag LOCUS_01340 gene gcvH 47153 46773 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FJE8 protein_id gnl|my_center|LOCUS_01340 47728 47195 gene locus_tag LOCUS_01350 47728 47195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 47879 48961 gene locus_tag LOCUS_01360 47879 48961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_01360 50055 49084 gene locus_tag LOCUS_01370 gene hemB 50055 49084 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WGF5 protein_id gnl|my_center|LOCUS_01370 50361 51797 gene locus_tag LOCUS_01380 gene cysS 50361 51797 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MGC2 protein_id gnl|my_center|LOCUS_01380 51885 52421 gene locus_tag LOCUS_01390 51885 52421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 52897 53769 gene locus_tag LOCUS_01400 52897 53769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492432.1 protein_id gnl|my_center|LOCUS_01400 54235 56823 gene locus_tag LOCUS_01410 54235 56823 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933627.1 protein_id gnl|my_center|LOCUS_01410 >Feature sequence004 1374 1916 gene locus_tag LOCUS_01420 1374 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 2910 2008 gene locus_tag LOCUS_01430 2910 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 3756 2914 gene locus_tag LOCUS_01440 3756 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142866.1 protein_id gnl|my_center|LOCUS_01440 4643 3753 gene locus_tag LOCUS_01450 4643 3753 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120812.1 protein_id gnl|my_center|LOCUS_01450 4962 4645 gene locus_tag LOCUS_01460 4962 4645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 5100 5792 gene locus_tag LOCUS_01470 5100 5792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 5813 6634 gene locus_tag LOCUS_01480 5813 6634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 6642 7979 gene locus_tag LOCUS_01490 6642 7979 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671775.1 protein_id gnl|my_center|LOCUS_01490 8102 8785 gene locus_tag LOCUS_01500 gene lipB 8102 8785 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW1 protein_id gnl|my_center|LOCUS_01500 8772 9695 gene locus_tag LOCUS_01510 gene lipA 8772 9695 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32129 protein_id gnl|my_center|LOCUS_01510 9791 10102 gene locus_tag LOCUS_01520 9791 10102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 10611 11072 gene locus_tag LOCUS_01530 10611 11072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 11133 11759 gene locus_tag LOCUS_01540 11133 11759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 12891 11767 gene locus_tag LOCUS_01550 12891 11767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 14342 13425 gene locus_tag LOCUS_01560 gene purC 14342 13425 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BF0 protein_id gnl|my_center|LOCUS_01560 14472 14549 gene locus_tag LOCUS_t00010 14472 14549 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 16288 14861 gene locus_tag LOCUS_01570 16288 14861 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259490.1 protein_id gnl|my_center|LOCUS_01570 16654 18651 gene locus_tag LOCUS_01580 16654 18651 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X0W5 protein_id gnl|my_center|LOCUS_01580 20669 19092 gene locus_tag LOCUS_01590 20669 19092 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583555.1 protein_id gnl|my_center|LOCUS_01590 21589 23679 gene locus_tag LOCUS_01600 gene fusA2 21589 23679 CDS product elongation factor G 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPM5 protein_id gnl|my_center|LOCUS_01600 24022 23946 gene locus_tag LOCUS_t00020 24022 23946 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 24556 25218 gene locus_tag LOCUS_01610 gene gph 24556 25218 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67359 protein_id gnl|my_center|LOCUS_01610 25219 25881 gene locus_tag LOCUS_01620 25219 25881 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393503.1 protein_id gnl|my_center|LOCUS_01620 26581 25898 gene locus_tag LOCUS_01630 26581 25898 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_01630 26729 27997 gene locus_tag LOCUS_01640 gene hflX 26729 27997 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDT2 protein_id gnl|my_center|LOCUS_01640 28356 28916 gene locus_tag LOCUS_01650 28356 28916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 29010 29918 gene locus_tag LOCUS_01660 29010 29918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 32472 29983 gene locus_tag LOCUS_01670 gene clpC 32472 29983 CDS product ATP-dependent Clp protease ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121080.1 protein_id gnl|my_center|LOCUS_01670 33582 32494 gene locus_tag LOCUS_01680 gene yacI 33582 32494 CDS product protein-arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMV3 protein_id gnl|my_center|LOCUS_01680 34088 33579 gene locus_tag LOCUS_01690 34088 33579 CDS product excinuclease Uvr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357604.1 protein_id gnl|my_center|LOCUS_01690 35136 34270 gene locus_tag LOCUS_01700 gene ilvE 35136 34270 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005489.1 protein_id gnl|my_center|LOCUS_01700 36916 35582 gene locus_tag LOCUS_01710 36916 35582 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583823.1 protein_id gnl|my_center|LOCUS_01710 37140 38918 gene locus_tag LOCUS_01720 gene argS 37140 38918 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RD6 protein_id gnl|my_center|LOCUS_01720 39878 38985 gene locus_tag LOCUS_01730 39878 38985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 40882 39875 gene locus_tag LOCUS_01740 40882 39875 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261760.1 protein_id gnl|my_center|LOCUS_01740 41988 41086 gene locus_tag LOCUS_01750 41988 41086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01750 42491 42132 gene locus_tag LOCUS_01760 42491 42132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01760 43175 42546 gene locus_tag LOCUS_01770 43175 42546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 43865 43533 gene locus_tag LOCUS_01780 43865 43533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 45025 43892 gene locus_tag LOCUS_01790 45025 43892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 45392 46465 gene locus_tag LOCUS_01800 45392 46465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 46556 47029 gene locus_tag LOCUS_01810 46556 47029 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03AV9 protein_id gnl|my_center|LOCUS_01810 47106 47849 gene locus_tag LOCUS_01820 47106 47849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 >Feature sequence005 2863 1769 gene locus_tag LOCUS_01830 gene aroB 2863 1769 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNV2 protein_id gnl|my_center|LOCUS_01830 3878 2952 gene locus_tag LOCUS_01840 3878 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 4352 3894 gene locus_tag LOCUS_01850 gene nusB 4352 3894 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHQ2 protein_id gnl|my_center|LOCUS_01850 4807 4331 gene locus_tag LOCUS_01860 gene ribH 4807 4331 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCM7 protein_id gnl|my_center|LOCUS_01860 4948 6063 gene locus_tag LOCUS_01870 gene tgt 4948 6063 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RDN0 protein_id gnl|my_center|LOCUS_01870 6839 6078 gene locus_tag LOCUS_01880 6839 6078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 7611 6979 gene locus_tag LOCUS_01890 7611 6979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 8339 7608 gene locus_tag LOCUS_01900 8339 7608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392134.1 protein_id gnl|my_center|LOCUS_01900 8367 8984 gene locus_tag LOCUS_01910 8367 8984 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117887.1 protein_id gnl|my_center|LOCUS_01910 9398 9039 gene locus_tag LOCUS_01920 9398 9039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 10549 9998 gene locus_tag LOCUS_01930 10549 9998 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770997.1 protein_id gnl|my_center|LOCUS_01930 11938 10643 gene locus_tag LOCUS_01940 11938 10643 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173864.1 protein_id gnl|my_center|LOCUS_01940 13433 12009 gene locus_tag LOCUS_01950 13433 12009 CDS product putative FeS assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703482.1 protein_id gnl|my_center|LOCUS_01950 14228 13467 gene locus_tag LOCUS_01960 14228 13467 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888738.1 protein_id gnl|my_center|LOCUS_01960 14690 14259 gene locus_tag LOCUS_01970 14690 14259 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143722.1 protein_id gnl|my_center|LOCUS_01970 15869 15678 gene locus_tag LOCUS_01980 15869 15678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01980 16132 15947 gene locus_tag LOCUS_01990 16132 15947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 16467 16159 gene locus_tag LOCUS_02000 16467 16159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 16627 16457 gene locus_tag LOCUS_02010 16627 16457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 18688 17666 gene locus_tag LOCUS_02020 18688 17666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 21761 18681 gene locus_tag LOCUS_02030 21761 18681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 22408 23136 gene locus_tag LOCUS_02040 22408 23136 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I694 protein_id gnl|my_center|LOCUS_02040 24358 23144 gene locus_tag LOCUS_02050 24358 23144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 24508 24963 gene locus_tag LOCUS_02060 gene dtd 24508 24963 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2P0 protein_id gnl|my_center|LOCUS_02060 24963 25493 gene locus_tag LOCUS_02070 24963 25493 CDS product putative 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN92 protein_id gnl|my_center|LOCUS_02070 27304 25505 gene locus_tag LOCUS_02080 gene glmS 27304 25505 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIA9 protein_id gnl|my_center|LOCUS_02080 27427 28722 gene locus_tag LOCUS_02090 gene glgC 27427 28722 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674820.1 protein_id gnl|my_center|LOCUS_02090 28947 29711 gene locus_tag LOCUS_02100 gene usp 28947 29711 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836249.1 protein_id gnl|my_center|LOCUS_02100 30553 29708 gene locus_tag LOCUS_02110 30553 29708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 30665 31273 gene locus_tag LOCUS_02120 30665 31273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 31276 32238 gene locus_tag LOCUS_02130 31276 32238 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393992.1 protein_id gnl|my_center|LOCUS_02130 33871 32663 gene locus_tag LOCUS_02140 33871 32663 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461405.1 protein_id gnl|my_center|LOCUS_02140 34078 34743 gene locus_tag LOCUS_02150 gene rplY 34078 34743 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG55 protein_id gnl|my_center|LOCUS_02150 34790 35371 gene locus_tag LOCUS_02160 gene pth 34790 35371 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WHN7 protein_id gnl|my_center|LOCUS_02160 35373 35672 gene locus_tag LOCUS_02170 35373 35672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 35718 36197 gene locus_tag LOCUS_02180 gene ssb 35718 36197 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59932 protein_id gnl|my_center|LOCUS_02180 36242 36745 gene locus_tag LOCUS_02190 gene rplI 36242 36745 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67830 protein_id gnl|my_center|LOCUS_02190 36783 38231 gene locus_tag LOCUS_02200 gene dnaB 36783 38231 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EG4 protein_id gnl|my_center|LOCUS_02200 38262 40640 gene locus_tag LOCUS_02210 38262 40640 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546857.1 protein_id gnl|my_center|LOCUS_02210 40683 41225 gene locus_tag LOCUS_02220 40683 41225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 41297 42355 gene locus_tag LOCUS_02230 gene lpxD1 41297 42355 CDS product UDP-3-O-acylglucosamine N-acyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJG8 protein_id gnl|my_center|LOCUS_02230 42361 43311 gene locus_tag LOCUS_02240 gene prs 42361 43311 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG56 protein_id gnl|my_center|LOCUS_02240 43394 44536 gene locus_tag LOCUS_02250 gene metX 43394 44536 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89UL7 protein_id gnl|my_center|LOCUS_02250 44545 45150 gene locus_tag LOCUS_02260 44545 45150 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188046.1 protein_id gnl|my_center|LOCUS_02260 45313 45397 gene locus_tag LOCUS_t00030 45313 45397 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 45884 45809 gene locus_tag LOCUS_t00040 45884 45809 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 46003 46617 gene locus_tag LOCUS_02270 46003 46617 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_02270 46614 47285 gene locus_tag LOCUS_02280 46614 47285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 >Feature sequence006 875 516 gene locus_tag LOCUS_02290 875 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02290 1361 879 gene locus_tag LOCUS_02300 1361 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02300 1917 1408 gene locus_tag LOCUS_02310 1917 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02310 2202 1978 gene locus_tag LOCUS_02320 2202 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 2519 2334 gene locus_tag LOCUS_02330 2519 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 2917 2708 gene locus_tag LOCUS_02340 2917 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 3162 2917 gene locus_tag LOCUS_02350 3162 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02350 3362 3207 gene locus_tag LOCUS_02360 3362 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02360 3869 4840 gene locus_tag LOCUS_02370 3869 4840 CDS product magnesium chelatase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_02370 4942 5811 gene locus_tag LOCUS_02380 4942 5811 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330235.1 protein_id gnl|my_center|LOCUS_02380 5811 6683 gene locus_tag LOCUS_02390 5811 6683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 6680 7705 gene locus_tag LOCUS_02400 gene batA 6680 7705 CDS product aerotolerance regulator BatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121996.1 protein_id gnl|my_center|LOCUS_02400 7702 9828 gene locus_tag LOCUS_02410 7702 9828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 9828 12407 gene locus_tag LOCUS_02420 9828 12407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 12751 12918 gene locus_tag LOCUS_02430 12751 12918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 14511 13108 gene locus_tag LOCUS_02440 14511 13108 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDN5 protein_id gnl|my_center|LOCUS_02440 15935 14688 gene locus_tag LOCUS_02450 gene sucB 15935 14688 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X64 protein_id gnl|my_center|LOCUS_02450 18741 16006 gene locus_tag LOCUS_02460 gene sucA 18741 16006 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943088.1 protein_id gnl|my_center|LOCUS_02460 18913 19167 gene locus_tag LOCUS_02470 18913 19167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 19164 19562 gene locus_tag LOCUS_02480 19164 19562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 19833 20042 gene locus_tag LOCUS_02490 19833 20042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 21390 20104 gene locus_tag LOCUS_02500 21390 20104 CDS product carbon dioxide concentrating mechanism protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056989.1 protein_id gnl|my_center|LOCUS_02500 22287 21586 gene locus_tag LOCUS_02510 22287 21586 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941332.1 protein_id gnl|my_center|LOCUS_02510 24416 22515 gene locus_tag LOCUS_02520 gene uup 24416 22515 CDS product heme ABC transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941581.1 protein_id gnl|my_center|LOCUS_02520 25771 24725 gene locus_tag LOCUS_02530 gene galM 25771 24725 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ38 protein_id gnl|my_center|LOCUS_02530 26649 25795 gene locus_tag LOCUS_02540 26649 25795 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140509.1 protein_id gnl|my_center|LOCUS_02540 28178 26694 gene locus_tag LOCUS_02550 28178 26694 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331455.1 protein_id gnl|my_center|LOCUS_02550 28433 31888 gene locus_tag LOCUS_02560 28433 31888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 32774 32520 gene locus_tag LOCUS_02570 gene rpmA 32774 32520 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPR5 protein_id gnl|my_center|LOCUS_02570 33116 32802 gene locus_tag LOCUS_02580 gene rplU 33116 32802 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UBR5 protein_id gnl|my_center|LOCUS_02580 33259 33744 gene locus_tag LOCUS_02590 33259 33744 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405408.1 protein_id gnl|my_center|LOCUS_02590 33745 34122 gene locus_tag LOCUS_02600 33745 34122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 34153 35880 gene locus_tag LOCUS_02610 gene ygaD 34153 35880 CDS product putative multidrug export ATP-binding/permease protein YgaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71082 protein_id gnl|my_center|LOCUS_02610 35867 38131 gene locus_tag LOCUS_02620 gene priA 35867 38131 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94461 protein_id gnl|my_center|LOCUS_02620 39669 38209 gene locus_tag LOCUS_02630 39669 38209 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDD3 protein_id gnl|my_center|LOCUS_02630 <40740 40132 gene locus_tag LOCUS_02640 <40740 40132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268944.1:NAD(FAD)-utilizing dehydrogenase >Feature sequence007 240 1913 gene locus_tag LOCUS_02650 240 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 3324 2020 gene locus_tag LOCUS_02660 3324 2020 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439596.1 protein_id gnl|my_center|LOCUS_02660 4436 3321 gene locus_tag LOCUS_02670 gene hisC2 4436 3321 CDS product histidinol-phosphate aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ68 protein_id gnl|my_center|LOCUS_02670 4504 5418 gene locus_tag LOCUS_02680 4504 5418 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143114.1 protein_id gnl|my_center|LOCUS_02680 5431 6147 gene locus_tag LOCUS_02690 5431 6147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 6763 6296 gene locus_tag LOCUS_02700 6763 6296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 7416 6760 gene locus_tag LOCUS_02710 gene yqjF 7416 6760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54543 protein_id gnl|my_center|LOCUS_02710 7597 11298 gene locus_tag LOCUS_02720 gene dnaE 7597 11298 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I799 protein_id gnl|my_center|LOCUS_02720 11474 11295 gene locus_tag LOCUS_02730 11474 11295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 11443 12312 gene locus_tag LOCUS_02740 11443 12312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 12413 13372 gene locus_tag LOCUS_02750 12413 13372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 13487 14290 gene locus_tag LOCUS_02760 13487 14290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 18062 14334 gene locus_tag LOCUS_02770 gene smc 18062 14334 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S457 protein_id gnl|my_center|LOCUS_02770 18215 19063 gene locus_tag LOCUS_02780 18215 19063 CDS product lysine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974284.1 protein_id gnl|my_center|LOCUS_02780 20529 19072 gene locus_tag LOCUS_02790 20529 19072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 21477 20539 gene locus_tag LOCUS_02800 21477 20539 CDS product arabinose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195206.1 protein_id gnl|my_center|LOCUS_02800 22675 21758 gene locus_tag LOCUS_02810 22675 21758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 22762 23526 gene locus_tag LOCUS_02820 22762 23526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 24400 23855 gene locus_tag LOCUS_02830 24400 23855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 25490 24489 gene locus_tag LOCUS_02840 gene rpoA 25490 24489 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFS6 protein_id gnl|my_center|LOCUS_02840 26171 25563 gene locus_tag LOCUS_02850 gene rpsD 26171 25563 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80373 protein_id gnl|my_center|LOCUS_02850 26743 26234 gene locus_tag LOCUS_02860 26743 26234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 27124 26762 gene locus_tag LOCUS_02870 gene rpsM 27124 26762 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1F7 protein_id gnl|my_center|LOCUS_02870 27966 27199 gene locus_tag LOCUS_02880 gene map 27966 27199 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG27 protein_id gnl|my_center|LOCUS_02880 29577 28063 gene locus_tag LOCUS_02890 gene secY 29577 28063 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAJ1 protein_id gnl|my_center|LOCUS_02890 30091 29618 gene locus_tag LOCUS_02900 gene rplO 30091 29618 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y447 protein_id gnl|my_center|LOCUS_02900 30624 30103 gene locus_tag LOCUS_02910 30624 30103 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810132.1 protein_id gnl|my_center|LOCUS_02910 30987 30634 gene locus_tag LOCUS_02920 gene rplR 30987 30634 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG31 protein_id gnl|my_center|LOCUS_02920 31540 31004 gene locus_tag LOCUS_02930 gene rplF 31540 31004 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89J99 protein_id gnl|my_center|LOCUS_02930 31955 31557 gene locus_tag LOCUS_02940 gene rpsH 31955 31557 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WH80 protein_id gnl|my_center|LOCUS_02940 32306 32001 gene locus_tag LOCUS_02950 gene rpsN 32306 32001 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PB08 protein_id gnl|my_center|LOCUS_02950 32912 32322 gene locus_tag LOCUS_02960 gene rplE 32912 32322 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38517 protein_id gnl|my_center|LOCUS_02960 33263 33021 gene locus_tag LOCUS_02970 33263 33021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 33628 33266 gene locus_tag LOCUS_02980 gene rplN 33628 33266 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615921.1 protein_id gnl|my_center|LOCUS_02980 33950 33672 gene locus_tag LOCUS_02990 gene rpsQ 33950 33672 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ90 protein_id gnl|my_center|LOCUS_02990 34178 33972 gene locus_tag LOCUS_03000 34178 33972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 34628 34212 gene locus_tag LOCUS_03010 gene rplP 34628 34212 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CG4 protein_id gnl|my_center|LOCUS_03010 35308 34676 gene locus_tag LOCUS_03020 gene rpsC 35308 34676 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CH4 protein_id gnl|my_center|LOCUS_03020 35667 35332 gene locus_tag LOCUS_03030 gene rplV 35667 35332 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q839F9 protein_id gnl|my_center|LOCUS_03030 36047 35673 gene locus_tag LOCUS_03040 36047 35673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 36333 36067 gene locus_tag LOCUS_03050 gene rpsS 36333 36067 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PLX5 protein_id gnl|my_center|LOCUS_03050 37194 36346 gene locus_tag LOCUS_03060 gene rplB 37194 36346 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CH7 protein_id gnl|my_center|LOCUS_03060 37506 37216 gene locus_tag LOCUS_03070 37506 37216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 38141 37506 gene locus_tag LOCUS_03080 gene rplD 38141 37506 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NT08 protein_id gnl|my_center|LOCUS_03080 38804 38160 gene locus_tag LOCUS_03090 gene rplC 38804 38160 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CG0 protein_id gnl|my_center|LOCUS_03090 >Feature sequence008 535 110 gene locus_tag LOCUS_03100 535 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329952.1 protein_id gnl|my_center|LOCUS_03100 1624 638 gene locus_tag LOCUS_03110 1624 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 1947 2414 gene locus_tag LOCUS_03120 1947 2414 CDS product HIT family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146469.1 protein_id gnl|my_center|LOCUS_03120 2429 3436 gene locus_tag LOCUS_03130 gene phoH 2429 3436 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840510.1 protein_id gnl|my_center|LOCUS_03130 3526 5958 gene locus_tag LOCUS_03140 3526 5958 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392131.1 protein_id gnl|my_center|LOCUS_03140 5921 6394 gene locus_tag LOCUS_03150 5921 6394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 6396 7460 gene locus_tag LOCUS_03160 6396 7460 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171504.1 protein_id gnl|my_center|LOCUS_03160 7874 7656 gene locus_tag LOCUS_03170 7874 7656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 8542 7850 gene locus_tag LOCUS_03180 8542 7850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 10028 8631 gene locus_tag LOCUS_03190 gene clpX 10028 8631 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YR7 protein_id gnl|my_center|LOCUS_03190 10652 10056 gene locus_tag LOCUS_03200 gene clpP 10652 10056 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YI38 protein_id gnl|my_center|LOCUS_03200 12082 10745 gene locus_tag LOCUS_03210 gene tig 12082 10745 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U2 protein_id gnl|my_center|LOCUS_03210 12952 12419 gene locus_tag LOCUS_03220 12952 12419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 13098 13526 gene locus_tag LOCUS_03230 13098 13526 CDS product acyl-CoA thioester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811622.1 protein_id gnl|my_center|LOCUS_03230 14476 13640 gene locus_tag LOCUS_03240 14476 13640 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057953.1 protein_id gnl|my_center|LOCUS_03240 15911 14538 gene locus_tag LOCUS_03250 15911 14538 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918720.1 protein_id gnl|my_center|LOCUS_03250 16179 16268 gene locus_tag LOCUS_t00050 16179 16268 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 17151 17489 gene locus_tag LOCUS_03260 17151 17489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 18072 17734 gene locus_tag LOCUS_03270 gene glnB 18072 17734 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812004.1 protein_id gnl|my_center|LOCUS_03270 19446 18121 gene locus_tag LOCUS_03280 gene amt-1 19446 18121 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B15 protein_id gnl|my_center|LOCUS_03280 20086 19748 gene locus_tag LOCUS_03290 gene glnB 20086 19748 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66513 protein_id gnl|my_center|LOCUS_03290 21524 20130 gene locus_tag LOCUS_03300 21524 20130 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD2 protein_id gnl|my_center|LOCUS_03300 22247 22062 gene locus_tag LOCUS_03310 22247 22062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 23850 22699 gene locus_tag LOCUS_03320 23850 22699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 24100 23834 gene locus_tag LOCUS_03330 24100 23834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 24947 24186 gene locus_tag LOCUS_03340 24947 24186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 26326 27300 gene locus_tag LOCUS_03350 26326 27300 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949134.1 protein_id gnl|my_center|LOCUS_03350 28114 27395 gene locus_tag LOCUS_03360 28114 27395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 29688 28108 gene locus_tag LOCUS_03370 29688 28108 CDS product iron(III) ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057549.1 protein_id gnl|my_center|LOCUS_03370 30749 29739 gene locus_tag LOCUS_03380 gene idiA 30749 29739 CDS product iron deficiency-induced protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLH9 protein_id gnl|my_center|LOCUS_03380 31029 31799 gene locus_tag LOCUS_03390 31029 31799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 31805 33187 gene locus_tag LOCUS_03400 31805 33187 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263089.1 protein_id gnl|my_center|LOCUS_03400 33200 33796 gene locus_tag LOCUS_03410 33200 33796 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069550.1 protein_id gnl|my_center|LOCUS_03410 33793 34200 gene locus_tag LOCUS_03420 33793 34200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 34200 34865 gene locus_tag LOCUS_03430 34200 34865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 34890 36242 gene locus_tag LOCUS_03440 34890 36242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 36715 38760 gene locus_tag LOCUS_03450 36715 38760 CDS product iron transport outer membrane receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112850.1 protein_id gnl|my_center|LOCUS_03450 >Feature sequence009 316 1170 gene locus_tag LOCUS_03460 316 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 1705 1618 gene locus_tag LOCUS_t00060 1705 1618 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3367 1820 gene locus_tag LOCUS_03470 gene comM 3367 1820 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_03470 3467 4048 gene locus_tag LOCUS_03480 gene coaE 3467 4048 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIP9 protein_id gnl|my_center|LOCUS_03480 4127 6241 gene locus_tag LOCUS_03490 4127 6241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 6282 8003 gene locus_tag LOCUS_03500 gene pilB 6282 8003 CDS product type IV fimbrial assembly protein PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123899.1 protein_id gnl|my_center|LOCUS_03500 8048 9130 gene locus_tag LOCUS_03510 gene pilT 8048 9130 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329383.1 protein_id gnl|my_center|LOCUS_03510 9163 10851 gene locus_tag LOCUS_03520 gene pilB 9163 10851 CDS product type IV fimbrial assembly protein PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123902.1 protein_id gnl|my_center|LOCUS_03520 10875 12125 gene locus_tag LOCUS_03530 gene pilC 10875 12125 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_03530 12260 13510 gene locus_tag LOCUS_03540 12260 13510 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555861.1 protein_id gnl|my_center|LOCUS_03540 13648 14454 gene locus_tag LOCUS_03550 13648 14454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 14530 15309 gene locus_tag LOCUS_03560 14530 15309 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257270.1 protein_id gnl|my_center|LOCUS_03560 16514 15540 gene locus_tag LOCUS_03570 gene accA 16514 15540 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DB5 protein_id gnl|my_center|LOCUS_03570 16919 16560 gene locus_tag LOCUS_03580 16919 16560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 16975 17679 gene locus_tag LOCUS_03590 16975 17679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 18241 18447 gene locus_tag LOCUS_03600 18241 18447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 20359 18482 gene locus_tag LOCUS_03610 gene fadE10 20359 18482 CDS product putative acyl-CoA dehydrogenase FadE10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WQF7 protein_id gnl|my_center|LOCUS_03610 22434 20431 gene locus_tag LOCUS_03620 gene fadJ 22434 20431 CDS product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MM3 protein_id gnl|my_center|LOCUS_03620 23746 22475 gene locus_tag LOCUS_03630 23746 22475 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957671.1 protein_id gnl|my_center|LOCUS_03630 25074 23743 gene locus_tag LOCUS_03640 gene paaK-3 25074 23743 CDS product phenylacetate-coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q727W9 protein_id gnl|my_center|LOCUS_03640 26119 25157 gene locus_tag LOCUS_03650 26119 25157 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583274.1 protein_id gnl|my_center|LOCUS_03650 26434 29004 gene locus_tag LOCUS_03660 26434 29004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 29035 29685 gene locus_tag LOCUS_03670 29035 29685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 29688 30233 gene locus_tag LOCUS_03680 29688 30233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 30284 31003 gene locus_tag LOCUS_03690 30284 31003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 31067 31573 gene locus_tag LOCUS_03700 gene comEB 31067 31573 CDS product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439693.1 protein_id gnl|my_center|LOCUS_03700 31586 32161 gene locus_tag LOCUS_03710 31586 32161 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S591 protein_id gnl|my_center|LOCUS_03710 32395 32640 gene locus_tag LOCUS_03720 gene rpmE2 32395 32640 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MFN5 protein_id gnl|my_center|LOCUS_03720 34463 33102 gene locus_tag LOCUS_03730 34463 33102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 34873 36225 gene locus_tag LOCUS_03740 34873 36225 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121727.1 protein_id gnl|my_center|LOCUS_03740 36772 37257 gene locus_tag LOCUS_03750 36772 37257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 37460 37281 gene locus_tag LOCUS_03760 37460 37281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 >Feature sequence010 1108 170 gene locus_tag LOCUS_03770 1108 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 1963 1202 gene locus_tag LOCUS_03780 gene hisF 1963 1202 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TBG5 protein_id gnl|my_center|LOCUS_03780 3832 2057 gene locus_tag LOCUS_03790 3832 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 4144 6018 gene locus_tag LOCUS_03800 gene acs 4144 6018 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VBQ1 protein_id gnl|my_center|LOCUS_03800 6571 7800 gene locus_tag LOCUS_03810 gene sufS 6571 7800 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2S3 protein_id gnl|my_center|LOCUS_03810 7851 8282 gene locus_tag LOCUS_03820 7851 8282 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946342.1 protein_id gnl|my_center|LOCUS_03820 9938 8400 gene locus_tag LOCUS_03830 9938 8400 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938035.1 protein_id gnl|my_center|LOCUS_03830 11046 10186 gene locus_tag LOCUS_03840 gene hemC 11046 10186 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TJV6 protein_id gnl|my_center|LOCUS_03840 12185 11157 gene locus_tag LOCUS_03850 gene ilvC 12185 11157 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIS6 protein_id gnl|my_center|LOCUS_03850 12723 12250 gene locus_tag LOCUS_03860 gene ilvH 12723 12250 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938672.1 protein_id gnl|my_center|LOCUS_03860 12833 12757 gene locus_tag LOCUS_t00070 12833 12757 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 13353 14144 gene locus_tag LOCUS_03870 13353 14144 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940707.1 protein_id gnl|my_center|LOCUS_03870 15130 14471 gene locus_tag LOCUS_03880 gene rpe 15130 14471 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A1H8 protein_id gnl|my_center|LOCUS_03880 15231 16217 gene locus_tag LOCUS_03890 15231 16217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031741.1 protein_id gnl|my_center|LOCUS_03890 17168 16350 gene locus_tag LOCUS_03900 17168 16350 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727285.1 protein_id gnl|my_center|LOCUS_03900 18370 17198 gene locus_tag LOCUS_03910 18370 17198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 18424 19158 gene locus_tag LOCUS_03920 18424 19158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 19650 19321 gene locus_tag LOCUS_03930 19650 19321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 20974 19667 gene locus_tag LOCUS_03940 gene argA 20974 19667 CDS product amino-acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPQ0 protein_id gnl|my_center|LOCUS_03940 21173 22105 gene locus_tag LOCUS_03950 gene xerD 21173 22105 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ZAJ2 protein_id gnl|my_center|LOCUS_03950 22278 22784 gene locus_tag LOCUS_03960 22278 22784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 23113 23030 gene locus_tag LOCUS_t00080 23113 23030 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 23569 23712 gene locus_tag LOCUS_03970 23569 23712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 26013 23782 gene locus_tag LOCUS_03980 26013 23782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 26916 26128 gene locus_tag LOCUS_03990 gene cysE 26916 26128 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815280.1 protein_id gnl|my_center|LOCUS_03990 27655 27215 gene locus_tag LOCUS_04000 27655 27215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 29290 27803 gene locus_tag LOCUS_04010 29290 27803 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870743.1 protein_id gnl|my_center|LOCUS_04010 30682 29609 gene locus_tag LOCUS_04020 30682 29609 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGI3 protein_id gnl|my_center|LOCUS_04020 31488 30805 gene locus_tag LOCUS_04030 31488 30805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 31647 31853 gene locus_tag LOCUS_04040 31647 31853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 32897 31944 gene locus_tag LOCUS_04050 32897 31944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 34194 32899 gene locus_tag LOCUS_04060 gene pyrC 34194 32899 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK42 protein_id gnl|my_center|LOCUS_04060 35192 34233 gene locus_tag LOCUS_04070 gene pyrB 35192 34233 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DP5 protein_id gnl|my_center|LOCUS_04070 35465 35541 gene locus_tag LOCUS_t00090 35465 35541 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 35778 36578 gene locus_tag LOCUS_04080 35778 36578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 36711 37115 gene locus_tag LOCUS_04090 gene ndk 36711 37115 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJK7 protein_id gnl|my_center|LOCUS_04090 37119 37598 gene locus_tag LOCUS_04100 gene ispF 37119 37598 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z805 protein_id gnl|my_center|LOCUS_04100 >Feature sequence011 524 1225 gene locus_tag LOCUS_04110 gene phoB 524 1225 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938382.1 protein_id gnl|my_center|LOCUS_04110 1225 2514 gene locus_tag LOCUS_04120 1225 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 2849 3445 gene locus_tag LOCUS_04130 2849 3445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 3969 3640 gene locus_tag LOCUS_04140 3969 3640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 4125 4925 gene locus_tag LOCUS_04150 gene atpB 4125 4925 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFX3 protein_id gnl|my_center|LOCUS_04150 5014 5220 gene locus_tag LOCUS_04160 5014 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 5238 6014 gene locus_tag LOCUS_04170 5238 6014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 6034 6429 gene locus_tag LOCUS_04180 6034 6429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 6496 8040 gene locus_tag LOCUS_04190 gene atpA 6496 8040 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9S3 protein_id gnl|my_center|LOCUS_04190 8082 8975 gene locus_tag LOCUS_04200 gene atpG 8082 8975 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JTC7 protein_id gnl|my_center|LOCUS_04200 9029 10450 gene locus_tag LOCUS_04210 gene atpD 9029 10450 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MB60 protein_id gnl|my_center|LOCUS_04210 10554 10964 gene locus_tag LOCUS_04220 10554 10964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 12703 11576 gene locus_tag LOCUS_04230 12703 11576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 12978 13403 gene locus_tag LOCUS_04240 12978 13403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 15928 13526 gene locus_tag LOCUS_04250 gene prc 15928 13526 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329904.1 protein_id gnl|my_center|LOCUS_04250 17021 16116 gene locus_tag LOCUS_04260 gene glpG 17021 16116 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145885.1 protein_id gnl|my_center|LOCUS_04260 17209 17451 gene locus_tag LOCUS_04270 17209 17451 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764038.1 protein_id gnl|my_center|LOCUS_04270 19176 17704 gene locus_tag LOCUS_04280 19176 17704 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769710.1 protein_id gnl|my_center|LOCUS_04280 20529 19180 gene locus_tag LOCUS_04290 gene trkA 20529 19180 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327001.1 protein_id gnl|my_center|LOCUS_04290 21699 20779 gene locus_tag LOCUS_04300 21699 20779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526695.1 protein_id gnl|my_center|LOCUS_04300 22077 23477 gene locus_tag LOCUS_04310 gene yqeZ 22077 23477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54465 protein_id gnl|my_center|LOCUS_04310 23474 23938 gene locus_tag LOCUS_04320 23474 23938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 23935 24972 gene locus_tag LOCUS_04330 gene yqfA 23935 24972 CDS product UPF0365 protein YqfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54466 protein_id gnl|my_center|LOCUS_04330 25035 25664 gene locus_tag LOCUS_04340 25035 25664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 26780 25962 gene locus_tag LOCUS_04350 26780 25962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 27757 26861 gene locus_tag LOCUS_04360 27757 26861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 27902 28903 gene locus_tag LOCUS_04370 gene yjgB 27902 28903 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123109.1 protein_id gnl|my_center|LOCUS_04370 29714 29121 gene locus_tag LOCUS_04380 gene purN 29714 29121 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q833Z2 protein_id gnl|my_center|LOCUS_04380 30952 29801 gene locus_tag LOCUS_04390 gene dnaJ 30952 29801 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34242 protein_id gnl|my_center|LOCUS_04390 31544 30969 gene locus_tag LOCUS_04400 31544 30969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 32626 31679 gene locus_tag LOCUS_04410 gene manA 32626 31679 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174418.1 protein_id gnl|my_center|LOCUS_04410 32826 35255 gene locus_tag LOCUS_04420 32826 35255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 36690 35449 gene locus_tag LOCUS_04430 gene dinB 36690 35449 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CQ6 protein_id gnl|my_center|LOCUS_04430 >Feature sequence012 2168 1185 gene locus_tag LOCUS_04440 gene fmt 2168 1185 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GW4 protein_id gnl|my_center|LOCUS_04440 2813 2175 gene locus_tag LOCUS_04450 2813 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 3059 3847 gene locus_tag LOCUS_04460 3059 3847 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090456.1 protein_id gnl|my_center|LOCUS_04460 3898 5718 gene locus_tag LOCUS_04470 3898 5718 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459981.1 protein_id gnl|my_center|LOCUS_04470 7643 6309 gene locus_tag LOCUS_04480 7643 6309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 8380 7643 gene locus_tag LOCUS_04490 gene rnhB 8380 7643 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RDX3 protein_id gnl|my_center|LOCUS_04490 9293 8400 gene locus_tag LOCUS_04500 gene oxyR 9293 8400 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036068.1 protein_id gnl|my_center|LOCUS_04500 9444 11618 gene locus_tag LOCUS_04510 9444 11618 CDS product catalase peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814129.1 protein_id gnl|my_center|LOCUS_04510 12720 11716 gene locus_tag LOCUS_04520 gene rnhC 12720 11716 CDS product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B0B9B5 protein_id gnl|my_center|LOCUS_04520 13581 12805 gene locus_tag LOCUS_04530 13581 12805 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202801.1 protein_id gnl|my_center|LOCUS_04530 14590 13595 gene locus_tag LOCUS_04540 14590 13595 CDS product molybdenum cofactor biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_04540 15938 14784 gene locus_tag LOCUS_04550 gene thiH 15938 14784 CDS product thiamine biosynthesis protein ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008477.1 protein_id gnl|my_center|LOCUS_04550 16740 15964 gene locus_tag LOCUS_04560 gene thiG 16740 15964 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KF4 protein_id gnl|my_center|LOCUS_04560 17351 16737 gene locus_tag LOCUS_04570 gene thiE 17351 16737 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TA1 protein_id gnl|my_center|LOCUS_04570 17956 17348 gene locus_tag LOCUS_04580 17956 17348 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788060.1 protein_id gnl|my_center|LOCUS_04580 18164 17961 gene locus_tag LOCUS_04590 18164 17961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 20098 18161 gene locus_tag LOCUS_04600 gene thiC 20098 18161 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUJ2 protein_id gnl|my_center|LOCUS_04600 20463 21563 gene locus_tag LOCUS_04610 gene mutY 20463 21563 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404847.1 protein_id gnl|my_center|LOCUS_04610 21831 21968 gene locus_tag LOCUS_04620 21831 21968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 22031 22213 gene locus_tag LOCUS_04630 22031 22213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 22478 22254 gene locus_tag LOCUS_04640 22478 22254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 24167 22821 gene locus_tag LOCUS_04650 24167 22821 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903476.1 protein_id gnl|my_center|LOCUS_04650 24521 24213 gene locus_tag LOCUS_04660 24521 24213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 24616 26220 gene locus_tag LOCUS_04670 24616 26220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 26343 27041 gene locus_tag LOCUS_04680 gene menG 26343 27041 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SH76 protein_id gnl|my_center|LOCUS_04680 27601 27152 gene locus_tag LOCUS_04690 27601 27152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 29134 27707 gene locus_tag LOCUS_04700 gene dnaA 29134 27707 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HQ03 protein_id gnl|my_center|LOCUS_04700 30597 29626 gene locus_tag LOCUS_04710 gene hprK 30597 29626 CDS product HPr kinase/phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61323 protein_id gnl|my_center|LOCUS_04710 31356 30616 gene locus_tag LOCUS_04720 gene yhbG 31356 30616 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369327.1 protein_id gnl|my_center|LOCUS_04720 33332 31413 gene locus_tag LOCUS_04730 33332 31413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 35204 33405 gene locus_tag LOCUS_04740 gene aspS 35204 33405 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHW1 protein_id gnl|my_center|LOCUS_04740 35486 35560 gene locus_tag LOCUS_t00100 35486 35560 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 35856 35674 gene locus_tag LOCUS_04750 35856 35674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 36629 36554 gene locus_tag LOCUS_t00110 36629 36554 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence013 <1 777 gene locus_tag LOCUS_04760 <1 777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010884013.1:1-phosphofructokinase 2097 952 gene locus_tag LOCUS_04770 gene rho 2097 952 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7C5 protein_id gnl|my_center|LOCUS_04770 3942 2617 gene locus_tag LOCUS_04780 gene gdhA 3942 2617 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFF0 protein_id gnl|my_center|LOCUS_04780 4164 4709 gene locus_tag LOCUS_04790 gene nuoB 4164 4709 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CYI7 protein_id gnl|my_center|LOCUS_04790 4713 5330 gene locus_tag LOCUS_04800 4713 5330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 5343 6581 gene locus_tag LOCUS_04810 gene nuoD 5343 6581 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GA5 protein_id gnl|my_center|LOCUS_04810 6655 7137 gene locus_tag LOCUS_04820 6655 7137 CDS product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969256.1 protein_id gnl|my_center|LOCUS_04820 7208 8575 gene locus_tag LOCUS_04830 gene nuoF 7208 8575 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829484.1 protein_id gnl|my_center|LOCUS_04830 8580 10301 gene locus_tag LOCUS_04840 gene nuoG 8580 10301 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403178.1 protein_id gnl|my_center|LOCUS_04840 10317 11429 gene locus_tag LOCUS_04850 gene nuoH1 10317 11429 CDS product NADH-quinone oxidoreductase subunit H 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GA1 protein_id gnl|my_center|LOCUS_04850 11442 11990 gene locus_tag LOCUS_04860 gene nuoI 11442 11990 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1Q5 protein_id gnl|my_center|LOCUS_04860 12105 12650 gene locus_tag LOCUS_04870 gene nuoJ 12105 12650 CDS product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087674.1 protein_id gnl|my_center|LOCUS_04870 12682 12987 gene locus_tag LOCUS_04880 gene nuoK1 12682 12987 CDS product NADH-quinone oxidoreductase subunit K 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G98 protein_id gnl|my_center|LOCUS_04880 12992 14845 gene locus_tag LOCUS_04890 12992 14845 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460436.1 protein_id gnl|my_center|LOCUS_04890 14879 16474 gene locus_tag LOCUS_04900 14879 16474 CDS product NADH dehydrogenase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813230.1 protein_id gnl|my_center|LOCUS_04900 16474 17976 gene locus_tag LOCUS_04910 16474 17976 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460435.1 protein_id gnl|my_center|LOCUS_04910 19606 18299 gene locus_tag LOCUS_04920 gene met17 19606 18299 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137848.1 protein_id gnl|my_center|LOCUS_04920 21347 19725 gene locus_tag LOCUS_04930 21347 19725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 21868 21350 gene locus_tag LOCUS_04940 21868 21350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278813.1 protein_id gnl|my_center|LOCUS_04940 21942 23087 gene locus_tag LOCUS_04950 21942 23087 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902891.1 protein_id gnl|my_center|LOCUS_04950 23877 23362 gene locus_tag LOCUS_04960 23877 23362 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329717.1 protein_id gnl|my_center|LOCUS_04960 24120 25667 gene locus_tag LOCUS_04970 gene purH 24120 25667 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFK6 protein_id gnl|my_center|LOCUS_04970 25721 25957 gene locus_tag LOCUS_04980 25721 25957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 25905 26561 gene locus_tag LOCUS_04990 25905 26561 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455384.1 protein_id gnl|my_center|LOCUS_04990 26951 28315 gene locus_tag LOCUS_05000 gene gltX 26951 28315 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0A6 protein_id gnl|my_center|LOCUS_05000 28378 30048 gene locus_tag LOCUS_05010 gene glnS 28378 30048 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UX42 protein_id gnl|my_center|LOCUS_05010 30473 30264 gene locus_tag LOCUS_05020 30473 30264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 31270 30365 gene locus_tag LOCUS_05030 31270 30365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 31357 32415 gene locus_tag LOCUS_05040 gene trpS 31357 32415 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182U4 protein_id gnl|my_center|LOCUS_05040 32489 34066 gene locus_tag LOCUS_05050 32489 34066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 34257 34176 gene locus_tag LOCUS_t00120 34257 34176 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence014 2741 1245 gene locus_tag LOCUS_05060 2741 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 3255 2911 gene locus_tag LOCUS_05070 3255 2911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 5175 3301 gene locus_tag LOCUS_05080 5175 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 6542 5253 gene locus_tag LOCUS_05090 6542 5253 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120406.1 protein_id gnl|my_center|LOCUS_05090 7605 6571 gene locus_tag LOCUS_05100 7605 6571 CDS product AP endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_05100 8289 7633 gene locus_tag LOCUS_05110 8289 7633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 9486 8299 gene locus_tag LOCUS_05120 9486 8299 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122159.1 protein_id gnl|my_center|LOCUS_05120 10980 9514 gene locus_tag LOCUS_05130 10980 9514 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119516.1 protein_id gnl|my_center|LOCUS_05130 11864 11106 gene locus_tag LOCUS_05140 11864 11106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 12833 14338 gene locus_tag LOCUS_05150 12833 14338 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122845.1 protein_id gnl|my_center|LOCUS_05150 14619 15137 gene locus_tag LOCUS_05160 14619 15137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 15157 16536 gene locus_tag LOCUS_05170 15157 16536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 16615 17313 gene locus_tag LOCUS_05180 16615 17313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 17724 17437 gene locus_tag LOCUS_05190 17724 17437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05190 18231 17968 gene locus_tag LOCUS_05200 18231 17968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 18999 18244 gene locus_tag LOCUS_05210 18999 18244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05210 19575 19063 gene locus_tag LOCUS_05220 19575 19063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05220 21005 20091 gene locus_tag LOCUS_05230 21005 20091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 21886 21011 gene locus_tag LOCUS_05240 21886 21011 CDS product tagatose 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974400.1 protein_id gnl|my_center|LOCUS_05240 21993 22772 gene locus_tag LOCUS_05250 21993 22772 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122515.1 protein_id gnl|my_center|LOCUS_05250 22806 23192 gene locus_tag LOCUS_05260 gene gloA 22806 23192 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947599.1 protein_id gnl|my_center|LOCUS_05260 24389 23490 gene locus_tag LOCUS_05270 24389 23490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 24460 26370 gene locus_tag LOCUS_05280 gene gpi2 24460 26370 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330748.1 protein_id gnl|my_center|LOCUS_05280 26375 26860 gene locus_tag LOCUS_05290 26375 26860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 26880 27404 gene locus_tag LOCUS_05300 26880 27404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 28208 27540 gene locus_tag LOCUS_05310 28208 27540 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403103.1 protein_id gnl|my_center|LOCUS_05310 28861 28208 gene locus_tag LOCUS_05320 28861 28208 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403102.1 protein_id gnl|my_center|LOCUS_05320 30330 28861 gene locus_tag LOCUS_05330 30330 28861 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403101.1 protein_id gnl|my_center|LOCUS_05330 30642 30352 gene locus_tag LOCUS_05340 30642 30352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 31923 30649 gene locus_tag LOCUS_05350 31923 30649 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453372.1 protein_id gnl|my_center|LOCUS_05350 32581 31928 gene locus_tag LOCUS_05360 32581 31928 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404831.1 protein_id gnl|my_center|LOCUS_05360 33127 32591 gene locus_tag LOCUS_05370 33127 32591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404832.1 protein_id gnl|my_center|LOCUS_05370 <34130 33127 gene locus_tag LOCUS_05380 <34130 33127 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404833.1:polysulfide reductase chain C >Feature sequence015 1242 3821 gene locus_tag LOCUS_05390 gene leuS 1242 3821 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108730.1 protein_id gnl|my_center|LOCUS_05390 3821 4639 gene locus_tag LOCUS_05400 3821 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 4649 5530 gene locus_tag LOCUS_05410 4649 5530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880814.1 protein_id gnl|my_center|LOCUS_05410 6298 6101 gene locus_tag LOCUS_05420 6298 6101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 6624 7514 gene locus_tag LOCUS_05430 6624 7514 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLG6 protein_id gnl|my_center|LOCUS_05430 7593 7904 gene locus_tag LOCUS_05440 7593 7904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 8107 8787 gene locus_tag LOCUS_05450 8107 8787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 9360 8791 gene locus_tag LOCUS_05460 9360 8791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 10390 9548 gene locus_tag LOCUS_05470 10390 9548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 11474 10440 gene locus_tag LOCUS_05480 11474 10440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 12182 11577 gene locus_tag LOCUS_05490 12182 11577 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBN4 protein_id gnl|my_center|LOCUS_05490 13724 12225 gene locus_tag LOCUS_05500 13724 12225 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931801.1 protein_id gnl|my_center|LOCUS_05500 13704 15350 gene locus_tag LOCUS_05510 13704 15350 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403181.1 protein_id gnl|my_center|LOCUS_05510 15399 16706 gene locus_tag LOCUS_05520 gene hemL 15399 16706 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FRE3 protein_id gnl|my_center|LOCUS_05520 17528 17058 gene locus_tag LOCUS_05530 17528 17058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 19557 17878 gene locus_tag LOCUS_05540 gene fumB 19557 17878 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MSG7 protein_id gnl|my_center|LOCUS_05540 21477 19723 gene locus_tag LOCUS_05550 gene menD 21477 19723 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y6K9 protein_id gnl|my_center|LOCUS_05550 21797 23962 gene locus_tag LOCUS_05560 21797 23962 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932948.1 protein_id gnl|my_center|LOCUS_05560 25270 24620 gene locus_tag LOCUS_05570 25270 24620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 26923 25763 gene locus_tag LOCUS_05580 26923 25763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 27627 26923 gene locus_tag LOCUS_05590 27627 26923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 28244 27648 gene locus_tag LOCUS_05600 28244 27648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 28228 29154 gene locus_tag LOCUS_05610 28228 29154 CDS product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393022.1 protein_id gnl|my_center|LOCUS_05610 29811 29341 gene locus_tag LOCUS_05620 29811 29341 CDS product transcription elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261386.1 protein_id gnl|my_center|LOCUS_05620 30050 31033 gene locus_tag LOCUS_05630 30050 31033 CDS product cytochrome aa3 oxidase assembly protein CtaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405086.1 protein_id gnl|my_center|LOCUS_05630 31141 32004 gene locus_tag LOCUS_05640 gene ctaB 31141 32004 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S012 protein_id gnl|my_center|LOCUS_05640 32039 32464 gene locus_tag LOCUS_05650 32039 32464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 >Feature sequence016 156 1370 gene locus_tag LOCUS_05660 gene lpxB 156 1370 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AT9 protein_id gnl|my_center|LOCUS_05660 1526 1882 gene locus_tag LOCUS_05670 1526 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 1986 2501 gene locus_tag LOCUS_05680 1986 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 3224 2799 gene locus_tag LOCUS_05690 3224 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 4819 3440 gene locus_tag LOCUS_05700 gene cca 4819 3440 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5D4 protein_id gnl|my_center|LOCUS_05700 5892 5059 gene locus_tag LOCUS_05710 gene nadK 5892 5059 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIC1 protein_id gnl|my_center|LOCUS_05710 6128 6628 gene locus_tag LOCUS_05720 6128 6628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003394990.1 protein_id gnl|my_center|LOCUS_05720 6844 8079 gene locus_tag LOCUS_05730 6844 8079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 8771 8256 gene locus_tag LOCUS_05740 8771 8256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 9135 9734 gene locus_tag LOCUS_05750 9135 9734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 9798 10592 gene locus_tag LOCUS_05760 gene lpxA 9798 10592 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAZ0 protein_id gnl|my_center|LOCUS_05760 10612 11550 gene locus_tag LOCUS_05770 gene pdxA 10612 11550 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VV96 protein_id gnl|my_center|LOCUS_05770 11601 11978 gene locus_tag LOCUS_05780 11601 11978 CDS product HesB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550200.1 protein_id gnl|my_center|LOCUS_05780 12190 12888 gene locus_tag LOCUS_05790 12190 12888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 12894 13922 gene locus_tag LOCUS_05800 12894 13922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 13926 15587 gene locus_tag LOCUS_05810 13926 15587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 15768 16385 gene locus_tag LOCUS_05820 gene cysC 15768 16385 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAQ1 protein_id gnl|my_center|LOCUS_05820 16423 17331 gene locus_tag LOCUS_05830 gene cysD 16423 17331 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S508 protein_id gnl|my_center|LOCUS_05830 17429 18709 gene locus_tag LOCUS_05840 gene cysN 17429 18709 CDS product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYJ5 protein_id gnl|my_center|LOCUS_05840 18985 18773 gene locus_tag LOCUS_05850 18985 18773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 20402 19203 gene locus_tag LOCUS_05860 gene lys1 20402 19203 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937725.1 protein_id gnl|my_center|LOCUS_05860 21825 20524 gene locus_tag LOCUS_05870 21825 20524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 22004 22570 gene locus_tag LOCUS_05880 22004 22570 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036085.1 protein_id gnl|my_center|LOCUS_05880 24324 22921 gene locus_tag LOCUS_05890 gene pntB 24324 22921 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIW3 protein_id gnl|my_center|LOCUS_05890 24644 24363 gene locus_tag LOCUS_05900 24644 24363 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325302.1 protein_id gnl|my_center|LOCUS_05900 25866 24727 gene locus_tag LOCUS_05910 gene pntA 25866 24727 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123663.1 protein_id gnl|my_center|LOCUS_05910 27287 26289 gene locus_tag LOCUS_05920 gene fba 27287 26289 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WQA3 protein_id gnl|my_center|LOCUS_05920 28818 27469 gene locus_tag LOCUS_05930 28818 27469 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651487.1 protein_id gnl|my_center|LOCUS_05930 29305 28820 gene locus_tag LOCUS_05940 gene coaD 29305 28820 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NET8 protein_id gnl|my_center|LOCUS_05940 29383 30075 gene locus_tag LOCUS_05950 29383 30075 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869392.1 protein_id gnl|my_center|LOCUS_05950 30068 30589 gene locus_tag LOCUS_05960 30068 30589 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNG4 protein_id gnl|my_center|LOCUS_05960 30810 31610 gene locus_tag LOCUS_05970 30810 31610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 32300 31725 gene locus_tag LOCUS_05980 32300 31725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 >Feature sequence017 1351 20 gene locus_tag LOCUS_05990 1351 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 2540 1569 gene locus_tag LOCUS_06000 2540 1569 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461587.1 protein_id gnl|my_center|LOCUS_06000 2785 3900 gene locus_tag LOCUS_06010 2785 3900 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811750.1 protein_id gnl|my_center|LOCUS_06010 3955 4620 gene locus_tag LOCUS_06020 3955 4620 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTU9 protein_id gnl|my_center|LOCUS_06020 4734 4913 gene locus_tag LOCUS_06030 4734 4913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 4955 6022 gene locus_tag LOCUS_06040 4955 6022 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_06040 6146 7069 gene locus_tag LOCUS_06050 gene fabH 6146 7069 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJX8 protein_id gnl|my_center|LOCUS_06050 7075 8091 gene locus_tag LOCUS_06060 7075 8091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 8118 8699 gene locus_tag LOCUS_06070 8118 8699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 11782 8795 gene locus_tag LOCUS_06080 11782 8795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 12699 11854 gene locus_tag LOCUS_06090 12699 11854 CDS product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124881.1 protein_id gnl|my_center|LOCUS_06090 13623 13198 gene locus_tag LOCUS_06100 13623 13198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 13807 15810 gene locus_tag LOCUS_06110 13807 15810 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81A99 protein_id gnl|my_center|LOCUS_06110 16298 16223 gene locus_tag LOCUS_t00130 16298 16223 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 17230 16364 gene locus_tag LOCUS_06120 17230 16364 CDS product phosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269390.1 protein_id gnl|my_center|LOCUS_06120 18758 17391 gene locus_tag LOCUS_06130 18758 17391 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_06130 18880 19881 gene locus_tag LOCUS_06140 18880 19881 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330234.1 protein_id gnl|my_center|LOCUS_06140 19994 20881 gene locus_tag LOCUS_06150 19994 20881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_06150 20931 21503 gene locus_tag LOCUS_06160 20931 21503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 21500 22537 gene locus_tag LOCUS_06170 gene batA 21500 22537 CDS product aerotolerance regulator BatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121996.1 protein_id gnl|my_center|LOCUS_06170 22534 24531 gene locus_tag LOCUS_06180 22534 24531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 24551 26344 gene locus_tag LOCUS_06190 24551 26344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 26522 27262 gene locus_tag LOCUS_06200 26522 27262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 27719 28579 gene locus_tag LOCUS_06210 27719 28579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 29619 28597 gene locus_tag LOCUS_06220 gene tsaD 29619 28597 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z3M6 protein_id gnl|my_center|LOCUS_06220 30830 29820 gene locus_tag LOCUS_06230 30830 29820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 >Feature sequence018 586 1218 gene locus_tag LOCUS_06240 gene ureG 586 1218 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q09066 protein_id gnl|my_center|LOCUS_06240 1218 2078 gene locus_tag LOCUS_06250 1218 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 2303 2602 gene locus_tag LOCUS_06260 2303 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06260 3166 2585 gene locus_tag LOCUS_06270 gene def 3166 2585 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SH6 protein_id gnl|my_center|LOCUS_06270 3255 3503 gene locus_tag LOCUS_06280 3255 3503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 3554 3829 gene locus_tag LOCUS_06290 3554 3829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 3807 4013 gene locus_tag LOCUS_06300 3807 4013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 4524 4021 gene locus_tag LOCUS_06310 4524 4021 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144323.1 protein_id gnl|my_center|LOCUS_06310 5152 6462 gene locus_tag LOCUS_06320 5152 6462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051537.1 protein_id gnl|my_center|LOCUS_06320 6737 7291 gene locus_tag LOCUS_06330 6737 7291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 7454 7627 gene locus_tag LOCUS_06340 7454 7627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 7925 8893 gene locus_tag LOCUS_06350 7925 8893 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769896.1 protein_id gnl|my_center|LOCUS_06350 8890 9168 gene locus_tag LOCUS_06360 8890 9168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 9393 12410 gene locus_tag LOCUS_06370 gene secA 9393 12410 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD18 protein_id gnl|my_center|LOCUS_06370 12986 12510 gene locus_tag LOCUS_06380 12986 12510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 13149 14774 gene locus_tag LOCUS_06390 gene lnt 13149 14774 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_06390 15921 14956 gene locus_tag LOCUS_06400 15921 14956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 17606 16116 gene locus_tag LOCUS_06410 gene trpE 17606 16116 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_06410 18988 17792 gene locus_tag LOCUS_06420 gene purK 18988 17792 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J672 protein_id gnl|my_center|LOCUS_06420 19548 19045 gene locus_tag LOCUS_06430 gene purE 19548 19045 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72157 protein_id gnl|my_center|LOCUS_06430 20566 19685 gene locus_tag LOCUS_06440 20566 19685 CDS product ADP-ribosylglycohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940539.1 protein_id gnl|my_center|LOCUS_06440 21668 20571 gene locus_tag LOCUS_06450 21668 20571 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330337.1 protein_id gnl|my_center|LOCUS_06450 22756 21707 gene locus_tag LOCUS_06460 22756 21707 CDS product periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072052.1 protein_id gnl|my_center|LOCUS_06460 23817 22972 gene locus_tag LOCUS_06470 23817 22972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 24918 23944 gene locus_tag LOCUS_06480 24918 23944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 26196 25102 gene locus_tag LOCUS_06490 26196 25102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117866.1 protein_id gnl|my_center|LOCUS_06490 26850 26563 gene locus_tag LOCUS_06500 26850 26563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 28210 27014 gene locus_tag LOCUS_06510 28210 27014 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764417.1 protein_id gnl|my_center|LOCUS_06510 28493 28269 gene locus_tag LOCUS_06520 28493 28269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 >Feature sequence019 792 484 gene locus_tag LOCUS_06530 792 484 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810163.1 protein_id gnl|my_center|LOCUS_06530 3004 899 gene locus_tag LOCUS_06540 gene fusA 3004 899 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFP4 protein_id gnl|my_center|LOCUS_06540 3564 3091 gene locus_tag LOCUS_06550 gene rpsG 3564 3091 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38526 protein_id gnl|my_center|LOCUS_06550 3972 3592 gene locus_tag LOCUS_06560 gene rpsL 3972 3592 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG52 protein_id gnl|my_center|LOCUS_06560 8394 4156 gene locus_tag LOCUS_06570 gene rpoC 8394 4156 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z999 protein_id gnl|my_center|LOCUS_06570 12224 8436 gene locus_tag LOCUS_06580 gene rpoB 12224 8436 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z9A0 protein_id gnl|my_center|LOCUS_06580 12766 12389 gene locus_tag LOCUS_06590 gene rplL 12766 12389 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV2 protein_id gnl|my_center|LOCUS_06590 13416 12901 gene locus_tag LOCUS_06600 gene rplJ 13416 12901 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q727C9 protein_id gnl|my_center|LOCUS_06600 14137 13433 gene locus_tag LOCUS_06610 gene rplA 14137 13433 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MH85 protein_id gnl|my_center|LOCUS_06610 14589 14164 gene locus_tag LOCUS_06620 gene rplK 14589 14164 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EG5 protein_id gnl|my_center|LOCUS_06620 15168 14596 gene locus_tag LOCUS_06630 gene nusG 15168 14596 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y1 protein_id gnl|my_center|LOCUS_06630 15433 15230 gene locus_tag LOCUS_06640 15433 15230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 15521 15446 gene locus_tag LOCUS_t00140 15521 15446 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 16803 15613 gene locus_tag LOCUS_06650 gene tuf 16803 15613 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMZ0 protein_id gnl|my_center|LOCUS_06650 16922 16848 gene locus_tag LOCUS_t00150 16922 16848 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 17917 17060 gene locus_tag LOCUS_06660 17917 17060 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020084.1 protein_id gnl|my_center|LOCUS_06660 18782 17976 gene locus_tag LOCUS_06670 18782 17976 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933759.1 protein_id gnl|my_center|LOCUS_06670 19675 18779 gene locus_tag LOCUS_06680 19675 18779 CDS product cation ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938638.1 protein_id gnl|my_center|LOCUS_06680 21133 19919 gene locus_tag LOCUS_06690 21133 19919 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGC1 protein_id gnl|my_center|LOCUS_06690 22838 21510 gene locus_tag LOCUS_06700 22838 21510 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIE4 protein_id gnl|my_center|LOCUS_06700 23884 23030 gene locus_tag LOCUS_06710 23884 23030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 24633 24034 gene locus_tag LOCUS_06720 gene plsY 24633 24034 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66905 protein_id gnl|my_center|LOCUS_06720 26470 24884 gene locus_tag LOCUS_06730 gene serA 26470 24884 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKK8 protein_id gnl|my_center|LOCUS_06730 27910 26711 gene locus_tag LOCUS_06740 27910 26711 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 protein_id gnl|my_center|LOCUS_06740 >Feature sequence020 1318 326 gene locus_tag LOCUS_06750 1318 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 2122 2295 gene locus_tag LOCUS_06760 2122 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 3116 2442 gene locus_tag LOCUS_06770 gene rsmG 3116 2442 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ2 protein_id gnl|my_center|LOCUS_06770 3942 3358 gene locus_tag LOCUS_06780 3942 3358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 4309 4674 gene locus_tag LOCUS_06790 4309 4674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 7334 4818 gene locus_tag LOCUS_06800 7334 4818 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403467.1 protein_id gnl|my_center|LOCUS_06800 8038 7331 gene locus_tag LOCUS_06810 8038 7331 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 protein_id gnl|my_center|LOCUS_06810 8069 8725 gene locus_tag LOCUS_06820 8069 8725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 8973 9212 gene locus_tag LOCUS_06830 8973 9212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 9425 10402 gene locus_tag LOCUS_06840 9425 10402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 10493 14365 gene locus_tag LOCUS_06850 gene metH 10493 14365 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071290.1 protein_id gnl|my_center|LOCUS_06850 15146 14577 gene locus_tag LOCUS_06860 gene slyD 15146 14577 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase SlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNX6 protein_id gnl|my_center|LOCUS_06860 15375 18173 gene locus_tag LOCUS_06870 gene glnD 15375 18173 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG2 protein_id gnl|my_center|LOCUS_06870 18204 19895 gene locus_tag LOCUS_06880 18204 19895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 19897 20301 gene locus_tag LOCUS_06890 19897 20301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 20897 20298 gene locus_tag LOCUS_06900 20897 20298 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143952.1 protein_id gnl|my_center|LOCUS_06900 21150 20944 gene locus_tag LOCUS_06910 21150 20944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 23006 21558 gene locus_tag LOCUS_06920 23006 21558 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MQ0 protein_id gnl|my_center|LOCUS_06920 25301 23151 gene locus_tag LOCUS_06930 25301 23151 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143951.1 protein_id gnl|my_center|LOCUS_06930 25318 25950 gene locus_tag LOCUS_06940 25318 25950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 26014 26493 gene locus_tag LOCUS_06950 26014 26493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 <27953 27093 gene locus_tag LOCUS_06960 <27953 27093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918103.1:TonB-dependent receptor >Feature sequence021 1 762 gene locus_tag LOCUS_06970 1 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 1055 1882 gene locus_tag LOCUS_06980 1055 1882 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGZ8 protein_id gnl|my_center|LOCUS_06980 1993 2715 gene locus_tag LOCUS_06990 1993 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 2868 3449 gene locus_tag LOCUS_07000 2868 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 4306 3812 gene locus_tag LOCUS_07010 4306 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 4718 5362 gene locus_tag LOCUS_07020 gene trpF 4718 5362 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNU7 protein_id gnl|my_center|LOCUS_07020 8828 5379 gene locus_tag LOCUS_07030 8828 5379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121009.1 protein_id gnl|my_center|LOCUS_07030 10841 9276 gene locus_tag LOCUS_07040 10841 9276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 12220 11042 gene locus_tag LOCUS_07050 12220 11042 CDS product DUF4432 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403753.1 protein_id gnl|my_center|LOCUS_07050 14070 12571 gene locus_tag LOCUS_07060 gene mqo 14070 12571 CDS product putative malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887Z4 protein_id gnl|my_center|LOCUS_07060 15569 14091 gene locus_tag LOCUS_07070 15569 14091 CDS product L-fuculose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582815.1 protein_id gnl|my_center|LOCUS_07070 16381 15620 gene locus_tag LOCUS_07080 gene agaR 16381 15620 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072195.1 protein_id gnl|my_center|LOCUS_07080 16434 17168 gene locus_tag LOCUS_07090 16434 17168 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVJ7 protein_id gnl|my_center|LOCUS_07090 17215 17484 gene locus_tag LOCUS_07100 17215 17484 CDS product microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324357.1 protein_id gnl|my_center|LOCUS_07100 17505 17783 gene locus_tag LOCUS_07110 gene eutM 17505 17783 CDS product ethanolamine utilization protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324356.1 protein_id gnl|my_center|LOCUS_07110 17845 19029 gene locus_tag LOCUS_07120 gene ackA 17845 19029 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVK1 protein_id gnl|my_center|LOCUS_07120 19078 19383 gene locus_tag LOCUS_07130 19078 19383 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004146125.1 protein_id gnl|my_center|LOCUS_07130 19389 19703 gene locus_tag LOCUS_07140 19389 19703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 19728 21170 gene locus_tag LOCUS_07150 gene eutE 19728 21170 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333579.1 protein_id gnl|my_center|LOCUS_07150 21235 21489 gene locus_tag LOCUS_07160 21235 21489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 21492 21797 gene locus_tag LOCUS_07170 21492 21797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 21931 23013 gene locus_tag LOCUS_07180 21931 23013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 23069 23443 gene locus_tag LOCUS_07190 23069 23443 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870231.1 protein_id gnl|my_center|LOCUS_07190 23511 24506 gene locus_tag LOCUS_07200 gene mdh 23511 24506 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4A2 protein_id gnl|my_center|LOCUS_07200 24732 25958 gene locus_tag LOCUS_07210 24732 25958 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119383.1 protein_id gnl|my_center|LOCUS_07210 >Feature sequence022 2300 6 gene locus_tag LOCUS_07220 2300 6 CDS product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939521.1 protein_id gnl|my_center|LOCUS_07220 3318 2422 gene locus_tag LOCUS_07230 3318 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226805.1 protein_id gnl|my_center|LOCUS_07230 3715 3323 gene locus_tag LOCUS_07240 3715 3323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 4106 5221 gene locus_tag LOCUS_07250 4106 5221 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963093.1 protein_id gnl|my_center|LOCUS_07250 6424 5459 gene locus_tag LOCUS_07260 gene pilC 6424 5459 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262624.1 protein_id gnl|my_center|LOCUS_07260 7008 6499 gene locus_tag LOCUS_07270 7008 6499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 8056 7406 gene locus_tag LOCUS_07280 gene engB 8056 7406 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UN4 protein_id gnl|my_center|LOCUS_07280 8235 9209 gene locus_tag LOCUS_07290 8235 9209 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931134.1 protein_id gnl|my_center|LOCUS_07290 9721 9377 gene locus_tag LOCUS_07300 9721 9377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 10473 9805 gene locus_tag LOCUS_07310 10473 9805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 11441 10764 gene locus_tag LOCUS_07320 11441 10764 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404334.1 protein_id gnl|my_center|LOCUS_07320 12588 11635 gene locus_tag LOCUS_07330 12588 11635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 15365 12585 gene locus_tag LOCUS_07340 15365 12585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 15564 15641 gene locus_tag LOCUS_t00160 15564 15641 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 17100 15976 gene locus_tag LOCUS_07350 gene nos 17100 15976 CDS product nitric oxide synthase oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34453 protein_id gnl|my_center|LOCUS_07350 17819 17664 gene locus_tag LOCUS_07360 17819 17664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 18100 18567 gene locus_tag LOCUS_07370 18100 18567 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009543.1 protein_id gnl|my_center|LOCUS_07370 18847 19125 gene locus_tag LOCUS_07380 18847 19125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 19482 19114 gene locus_tag LOCUS_07390 19482 19114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 19865 19608 gene locus_tag LOCUS_07400 19865 19608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 20003 20587 gene locus_tag LOCUS_07410 20003 20587 CDS product CIA30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123297.1 protein_id gnl|my_center|LOCUS_07410 22163 20652 gene locus_tag LOCUS_07420 22163 20652 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020815.1 protein_id gnl|my_center|LOCUS_07420 23716 22181 gene locus_tag LOCUS_07430 23716 22181 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020819.1 protein_id gnl|my_center|LOCUS_07430 23955 25016 gene locus_tag LOCUS_07440 gene rsmH 23955 25016 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG80 protein_id gnl|my_center|LOCUS_07440 >Feature sequence023 2805 136 gene locus_tag LOCUS_07450 2805 136 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDE6 protein_id gnl|my_center|LOCUS_07450 3559 3044 gene locus_tag LOCUS_07460 3559 3044 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929825.1 protein_id gnl|my_center|LOCUS_07460 4594 3596 gene locus_tag LOCUS_07470 gene gpsA 4594 3596 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RND0 protein_id gnl|my_center|LOCUS_07470 5505 4729 gene locus_tag LOCUS_07480 gene panB 5505 4729 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM79 protein_id gnl|my_center|LOCUS_07480 5647 5916 gene locus_tag LOCUS_07490 5647 5916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 7196 6354 gene locus_tag LOCUS_07500 7196 6354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 7533 7276 gene locus_tag LOCUS_07510 gene rpsT 7533 7276 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97JK0 protein_id gnl|my_center|LOCUS_07510 8489 9004 gene locus_tag LOCUS_07520 8489 9004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07520 9055 9957 gene locus_tag LOCUS_07530 9055 9957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07530 10584 10270 gene locus_tag LOCUS_07540 10584 10270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 10791 10597 gene locus_tag LOCUS_07550 10791 10597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 11155 10772 gene locus_tag LOCUS_07560 11155 10772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 12191 11589 gene locus_tag LOCUS_07570 12191 11589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07570 13505 12681 gene locus_tag LOCUS_07580 13505 12681 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326598.1 protein_id gnl|my_center|LOCUS_07580 13740 13510 gene locus_tag LOCUS_07590 13740 13510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 14711 15472 gene locus_tag LOCUS_07600 14711 15472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 15493 16899 gene locus_tag LOCUS_07610 15493 16899 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459000.1 protein_id gnl|my_center|LOCUS_07610 16926 17531 gene locus_tag LOCUS_07620 16926 17531 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267143.1 protein_id gnl|my_center|LOCUS_07620 17580 17978 gene locus_tag LOCUS_07630 gene exbD2 17580 17978 CDS product biopolymer transport protein exbD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZHV9 protein_id gnl|my_center|LOCUS_07630 18000 18653 gene locus_tag LOCUS_07640 18000 18653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 18666 20063 gene locus_tag LOCUS_07650 18666 20063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 20074 20970 gene locus_tag LOCUS_07660 20074 20970 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524222.1 protein_id gnl|my_center|LOCUS_07660 21118 21909 gene locus_tag LOCUS_07670 21118 21909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 22238 22969 gene locus_tag LOCUS_07680 22238 22969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 22947 23711 gene locus_tag LOCUS_07690 22947 23711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 25383 24754 gene locus_tag LOCUS_07700 25383 24754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 >Feature sequence024 <1 3219 gene locus_tag LOCUS_07710 <1 3219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UJ58:carbamoyl-phosphate synthase large chain 3334 4185 gene locus_tag LOCUS_07720 gene purU 3334 4185 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67681 protein_id gnl|my_center|LOCUS_07720 4323 4970 gene locus_tag LOCUS_07730 4323 4970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 5247 6533 gene locus_tag LOCUS_07740 gene eno 5247 6533 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121760.1 protein_id gnl|my_center|LOCUS_07740 6774 7193 gene locus_tag LOCUS_07750 6774 7193 CDS product cysteine desulfuration protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391222.1 protein_id gnl|my_center|LOCUS_07750 7327 8130 gene locus_tag LOCUS_07760 7327 8130 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943898.1 protein_id gnl|my_center|LOCUS_07760 8147 8599 gene locus_tag LOCUS_07770 8147 8599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 9383 8613 gene locus_tag LOCUS_07780 9383 8613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 9972 9361 gene locus_tag LOCUS_07790 9972 9361 CDS product toluene tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546348.1 protein_id gnl|my_center|LOCUS_07790 10446 9988 gene locus_tag LOCUS_07800 10446 9988 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938540.1 protein_id gnl|my_center|LOCUS_07800 11226 10462 gene locus_tag LOCUS_07810 11226 10462 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_07810 12002 11226 gene locus_tag LOCUS_07820 12002 11226 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938542.1 protein_id gnl|my_center|LOCUS_07820 14024 12153 gene locus_tag LOCUS_07830 14024 12153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 14077 15372 gene locus_tag LOCUS_07840 14077 15372 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q819U2 protein_id gnl|my_center|LOCUS_07840 16959 15559 gene locus_tag LOCUS_07850 16959 15559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 18352 17000 gene locus_tag LOCUS_07860 gene glmM 18352 17000 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DP16 protein_id gnl|my_center|LOCUS_07860 19476 18370 gene locus_tag LOCUS_07870 gene trpD 19476 18370 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT49 protein_id gnl|my_center|LOCUS_07870 19564 20580 gene locus_tag LOCUS_07880 gene uppP3 19564 20580 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KML1 protein_id gnl|my_center|LOCUS_07880 23266 20711 gene locus_tag LOCUS_07890 gene hrpB 23266 20711 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942482.1 protein_id gnl|my_center|LOCUS_07890 24286 23369 gene locus_tag LOCUS_07900 24286 23369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 >Feature sequence025 2384 243 gene locus_tag LOCUS_07910 2384 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 2973 2413 gene locus_tag LOCUS_07920 2973 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 4211 2973 gene locus_tag LOCUS_07930 4211 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 5469 4249 gene locus_tag LOCUS_07940 5469 4249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 6318 5554 gene locus_tag LOCUS_07950 6318 5554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 6851 6387 gene locus_tag LOCUS_07960 6851 6387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 7381 6848 gene locus_tag LOCUS_07970 7381 6848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 7850 7362 gene locus_tag LOCUS_07980 7850 7362 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087289.1 protein_id gnl|my_center|LOCUS_07980 8628 8179 gene locus_tag LOCUS_07990 8628 8179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 9602 8625 gene locus_tag LOCUS_08000 9602 8625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 10396 9611 gene locus_tag LOCUS_08010 10396 9611 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462044.1 protein_id gnl|my_center|LOCUS_08010 11915 10845 gene locus_tag LOCUS_08020 gene mnmA 11915 10845 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRK0 protein_id gnl|my_center|LOCUS_08020 12065 14542 gene locus_tag LOCUS_08030 12065 14542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 15901 14801 gene locus_tag LOCUS_08040 gene olE1 15901 14801 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116208.1 protein_id gnl|my_center|LOCUS_08040 16291 17316 gene locus_tag LOCUS_08050 gene gapA 16291 17316 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FXX2 protein_id gnl|my_center|LOCUS_08050 17506 18699 gene locus_tag LOCUS_08060 gene pgk 17506 18699 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HYC0 protein_id gnl|my_center|LOCUS_08060 18809 19588 gene locus_tag LOCUS_08070 gene tpiA 18809 19588 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP89 protein_id gnl|my_center|LOCUS_08070 20552 21457 gene locus_tag LOCUS_08080 20552 21457 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64U24 protein_id gnl|my_center|LOCUS_08080 >Feature sequence026 243 1235 gene locus_tag LOCUS_08090 243 1235 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123535.1 protein_id gnl|my_center|LOCUS_08090 2316 1354 gene locus_tag LOCUS_08100 gene hemE 2316 1354 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95458 protein_id gnl|my_center|LOCUS_08100 3469 2543 gene locus_tag LOCUS_08110 gene hemF 3469 2543 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43898 protein_id gnl|my_center|LOCUS_08110 3521 4450 gene locus_tag LOCUS_08120 3521 4450 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266255.1 protein_id gnl|my_center|LOCUS_08120 4513 4965 gene locus_tag LOCUS_08130 4513 4965 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121094.1 protein_id gnl|my_center|LOCUS_08130 5980 6288 gene locus_tag LOCUS_08140 5980 6288 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN25 protein_id gnl|my_center|LOCUS_08140 6301 6897 gene locus_tag LOCUS_08150 gene recR 6301 6897 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAI4 protein_id gnl|my_center|LOCUS_08150 8251 7040 gene locus_tag LOCUS_08160 8251 7040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 9314 8328 gene locus_tag LOCUS_08170 gene nadA 9314 8328 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM90 protein_id gnl|my_center|LOCUS_08170 10209 9574 gene locus_tag LOCUS_08180 10209 9574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 10660 10896 gene locus_tag LOCUS_08190 10660 10896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 10992 11360 gene locus_tag LOCUS_08200 gene rplT 10992 11360 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKP6 protein_id gnl|my_center|LOCUS_08200 12421 11843 gene locus_tag LOCUS_08210 gene clpP 12421 11843 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4T6 protein_id gnl|my_center|LOCUS_08210 12918 12475 gene locus_tag LOCUS_08220 12918 12475 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721856.1 protein_id gnl|my_center|LOCUS_08220 13391 13561 gene locus_tag LOCUS_08230 gene rpmG 13391 13561 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67756 protein_id gnl|my_center|LOCUS_08230 14077 13838 gene locus_tag LOCUS_08240 14077 13838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 15250 14180 gene locus_tag LOCUS_08250 15250 14180 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKJ7 protein_id gnl|my_center|LOCUS_08250 15443 16687 gene locus_tag LOCUS_08260 15443 16687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 16899 17732 gene locus_tag LOCUS_08270 gene menB 16899 17732 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG66 protein_id gnl|my_center|LOCUS_08270 18966 17824 gene locus_tag LOCUS_08280 gene purT 18966 17824 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXP3 protein_id gnl|my_center|LOCUS_08280 19179 19778 gene locus_tag LOCUS_08290 19179 19778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106328.1 protein_id gnl|my_center|LOCUS_08290 19800 21725 gene locus_tag LOCUS_08300 19800 21725 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489375.1 protein_id gnl|my_center|LOCUS_08300 21987 22661 gene locus_tag LOCUS_08310 21987 22661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 22576 23037 gene locus_tag LOCUS_08320 22576 23037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 >Feature sequence027 510 1076 gene locus_tag LOCUS_08330 510 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 2538 1165 gene locus_tag LOCUS_08340 2538 1165 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933237.1 protein_id gnl|my_center|LOCUS_08340 2685 3770 gene locus_tag LOCUS_08350 2685 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 3831 5012 gene locus_tag LOCUS_08360 gene tyrS 3831 5012 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43836 protein_id gnl|my_center|LOCUS_08360 5166 5639 gene locus_tag LOCUS_08370 5166 5639 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080908.1 protein_id gnl|my_center|LOCUS_08370 5935 6321 gene locus_tag LOCUS_08380 5935 6321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 6370 7803 gene locus_tag LOCUS_08390 6370 7803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 11001 8233 gene locus_tag LOCUS_08400 gene acnB 11001 8233 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974111.1 protein_id gnl|my_center|LOCUS_08400 11416 12435 gene locus_tag LOCUS_08410 gene mreB-1 11416 12435 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_08410 12445 13305 gene locus_tag LOCUS_08420 12445 13305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 13295 13825 gene locus_tag LOCUS_08430 13295 13825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 13822 15774 gene locus_tag LOCUS_08440 13822 15774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 16964 16254 gene locus_tag LOCUS_08450 gene adh2 16964 16254 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880787.1 protein_id gnl|my_center|LOCUS_08450 17688 17107 gene locus_tag LOCUS_08460 17688 17107 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_08460 18614 17865 gene locus_tag LOCUS_08470 18614 17865 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KZC0 protein_id gnl|my_center|LOCUS_08470 19149 18958 gene locus_tag LOCUS_08480 19149 18958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 19060 19725 gene locus_tag LOCUS_08490 gene truA 19060 19725 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MTA1 protein_id gnl|my_center|LOCUS_08490 19795 20517 gene locus_tag LOCUS_08500 19795 20517 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_08500 20670 21533 gene locus_tag LOCUS_08510 gene accD 20670 21533 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AI4 protein_id gnl|my_center|LOCUS_08510 21546 22844 gene locus_tag LOCUS_08520 gene folC 21546 22844 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723235.1 protein_id gnl|my_center|LOCUS_08520 >Feature sequence028 602 2929 gene locus_tag LOCUS_08530 602 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 3509 2943 gene locus_tag LOCUS_08540 3509 2943 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101350.1 protein_id gnl|my_center|LOCUS_08540 4593 3496 gene locus_tag LOCUS_08550 4593 3496 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002661162.1 protein_id gnl|my_center|LOCUS_08550 5165 6721 gene locus_tag LOCUS_08560 gene zwf 5165 6721 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WE89 protein_id gnl|my_center|LOCUS_08560 6767 7750 gene locus_tag LOCUS_08570 6767 7750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 8276 7782 gene locus_tag LOCUS_08580 8276 7782 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142371.1 protein_id gnl|my_center|LOCUS_08580 8364 8675 gene locus_tag LOCUS_08590 8364 8675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 8965 8813 gene locus_tag LOCUS_08600 8965 8813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 9297 9124 gene locus_tag LOCUS_08610 9297 9124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 10750 9323 gene locus_tag LOCUS_08620 gene pykA 10750 9323 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UF82 protein_id gnl|my_center|LOCUS_08620 11582 10776 gene locus_tag LOCUS_08630 gene yycJ 11582 10776 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883514.1 protein_id gnl|my_center|LOCUS_08630 11767 12747 gene locus_tag LOCUS_08640 gene folE2 11767 12747 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5D3 protein_id gnl|my_center|LOCUS_08640 12842 13396 gene locus_tag LOCUS_08650 12842 13396 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546029.1 protein_id gnl|my_center|LOCUS_08650 14104 13406 gene locus_tag LOCUS_08660 14104 13406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 17124 14101 gene locus_tag LOCUS_08670 17124 14101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 16955 17043 gene locus_tag LOCUS_t00170 16955 17043 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 17422 18954 gene locus_tag LOCUS_08680 17422 18954 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937421.1 protein_id gnl|my_center|LOCUS_08680 19832 19155 gene locus_tag LOCUS_08690 19832 19155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 20339 19887 gene locus_tag LOCUS_08700 20339 19887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 20740 20327 gene locus_tag LOCUS_08710 20740 20327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 21684 22337 gene locus_tag LOCUS_08720 gene nth 21684 22337 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGP4 protein_id gnl|my_center|LOCUS_08720 >Feature sequence029 2197 257 gene locus_tag LOCUS_08730 gene mnmG 2197 257 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WVH6 protein_id gnl|my_center|LOCUS_08730 3555 2194 gene locus_tag LOCUS_08740 gene mnmE 3555 2194 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67030 protein_id gnl|my_center|LOCUS_08740 5959 4892 gene locus_tag LOCUS_08750 gene recA 5959 4892 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4H9 protein_id gnl|my_center|LOCUS_08750 6548 6961 gene locus_tag LOCUS_08760 6548 6961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 6962 7615 gene locus_tag LOCUS_08770 6962 7615 CDS product putative phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705604.1 protein_id gnl|my_center|LOCUS_08770 7851 9539 gene locus_tag LOCUS_08780 7851 9539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 10189 9557 gene locus_tag LOCUS_08790 10189 9557 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288769.1 protein_id gnl|my_center|LOCUS_08790 10699 10229 gene locus_tag LOCUS_08800 10699 10229 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056985.1 protein_id gnl|my_center|LOCUS_08800 11258 10734 gene locus_tag LOCUS_08810 gene ahpD 11258 10734 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BM5 protein_id gnl|my_center|LOCUS_08810 11791 11264 gene locus_tag LOCUS_08820 11791 11264 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948056.1 protein_id gnl|my_center|LOCUS_08820 11999 13393 gene locus_tag LOCUS_08830 gene miaB 11999 13393 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P2L3 protein_id gnl|my_center|LOCUS_08830 13752 13429 gene locus_tag LOCUS_08840 13752 13429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 15570 13783 gene locus_tag LOCUS_08850 15570 13783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 15968 15561 gene locus_tag LOCUS_08860 15968 15561 CDS product redox protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405004.1 protein_id gnl|my_center|LOCUS_08860 16109 16477 gene locus_tag LOCUS_08870 16109 16477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 16492 17361 gene locus_tag LOCUS_08880 gene pssA-1 16492 17361 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770492.1 protein_id gnl|my_center|LOCUS_08880 17604 18731 gene locus_tag LOCUS_08890 gene dnaN 17604 18731 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H91 protein_id gnl|my_center|LOCUS_08890 18893 19783 gene locus_tag LOCUS_08900 18893 19783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 19917 20225 gene locus_tag LOCUS_08910 19917 20225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 21938 20433 gene locus_tag LOCUS_08920 gene gndA 21938 20433 CDS product 6-phosphogluconate dehydrogenase, NADP(+)-dependent, decarboxylating inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80859 protein_id gnl|my_center|LOCUS_08920 >Feature sequence030 <1 1629 gene locus_tag LOCUS_08930 <1 1629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869365.1:carbon starvation protein A 3053 1755 gene locus_tag LOCUS_08940 3053 1755 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEA2 protein_id gnl|my_center|LOCUS_08940 3162 3755 gene locus_tag LOCUS_08950 3162 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 3888 5345 gene locus_tag LOCUS_08960 3888 5345 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118315.1 protein_id gnl|my_center|LOCUS_08960 6130 6573 gene locus_tag LOCUS_08970 gene fabZ 6130 6573 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A714 protein_id gnl|my_center|LOCUS_08970 6570 7382 gene locus_tag LOCUS_08980 gene fabI 6570 7382 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UG49 protein_id gnl|my_center|LOCUS_08980 7461 8504 gene locus_tag LOCUS_08990 gene fabH 7461 8504 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123917.1 protein_id gnl|my_center|LOCUS_08990 8497 9408 gene locus_tag LOCUS_09000 8497 9408 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259370.1 protein_id gnl|my_center|LOCUS_09000 11126 9630 gene locus_tag LOCUS_09010 gene glyQS 11126 9630 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UEU9 protein_id gnl|my_center|LOCUS_09010 11384 12097 gene locus_tag LOCUS_09020 11384 12097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918193.1 protein_id gnl|my_center|LOCUS_09020 12909 12310 gene locus_tag LOCUS_09030 12909 12310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 13778 13089 gene locus_tag LOCUS_09040 gene phoU 13778 13089 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S080 protein_id gnl|my_center|LOCUS_09040 14586 13771 gene locus_tag LOCUS_09050 gene pstB2 14586 13771 CDS product phosphate import ATP-binding protein PstB 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLA7 protein_id gnl|my_center|LOCUS_09050 15823 14618 gene locus_tag LOCUS_09060 15823 14618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 17623 15851 gene locus_tag LOCUS_09070 17623 15851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 18597 17770 gene locus_tag LOCUS_09080 18597 17770 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538556.1 protein_id gnl|my_center|LOCUS_09080 19824 18694 gene locus_tag LOCUS_09090 19824 18694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 20499 20678 gene locus_tag LOCUS_09100 20499 20678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 >Feature sequence031 1657 155 gene locus_tag LOCUS_09110 1657 155 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262844.1 protein_id gnl|my_center|LOCUS_09110 2318 1875 gene locus_tag LOCUS_09120 2318 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 2880 2359 gene locus_tag LOCUS_09130 2880 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 4536 2908 gene locus_tag LOCUS_09140 4536 2908 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09140 5281 4838 gene locus_tag LOCUS_09150 5281 4838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 6110 5349 gene locus_tag LOCUS_09160 gene rph 6110 5349 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P28619 protein_id gnl|my_center|LOCUS_09160 7444 6257 gene locus_tag LOCUS_09170 gene yueF 7444 6257 CDS product UPF0118 membrane protein YueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32095 protein_id gnl|my_center|LOCUS_09170 8701 7517 gene locus_tag LOCUS_09180 8701 7517 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114990.1 protein_id gnl|my_center|LOCUS_09180 8790 9164 gene locus_tag LOCUS_09190 gene queF 8790 9164 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMA3 protein_id gnl|my_center|LOCUS_09190 9688 9230 gene locus_tag LOCUS_09200 9688 9230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087890.1 protein_id gnl|my_center|LOCUS_09200 11060 9750 gene locus_tag LOCUS_09210 gene gltP 11060 9750 CDS product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_09210 11912 11079 gene locus_tag LOCUS_09220 gene rsmA 11912 11079 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FMG3 protein_id gnl|my_center|LOCUS_09220 12858 12061 gene locus_tag LOCUS_09230 gene trpC 12858 12061 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCF2 protein_id gnl|my_center|LOCUS_09230 13563 13039 gene locus_tag LOCUS_09240 13563 13039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 14188 13568 gene locus_tag LOCUS_09250 14188 13568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 15786 14191 gene locus_tag LOCUS_09260 gene pyrG 15786 14191 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJ86 protein_id gnl|my_center|LOCUS_09260 16197 16931 gene locus_tag LOCUS_09270 16197 16931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345920.1 protein_id gnl|my_center|LOCUS_09270 16947 18890 gene locus_tag LOCUS_09280 gene sdhA 16947 18890 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_09280 18918 19679 gene locus_tag LOCUS_09290 18918 19679 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_09290 20373 20786 gene locus_tag LOCUS_09300 20373 20786 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760582.1 protein_id gnl|my_center|LOCUS_09300 20802 21245 gene locus_tag LOCUS_09310 20802 21245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 21587 21661 gene locus_tag LOCUS_t00180 21587 21661 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence032 4092 670 gene locus_tag LOCUS_09320 4092 670 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258002.1 protein_id gnl|my_center|LOCUS_09320 4763 4110 gene locus_tag LOCUS_09330 4763 4110 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404835.1 protein_id gnl|my_center|LOCUS_09330 5356 5841 gene locus_tag LOCUS_09340 5356 5841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 6094 6957 gene locus_tag LOCUS_09350 6094 6957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 7676 8557 gene locus_tag LOCUS_09360 7676 8557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625866.1 protein_id gnl|my_center|LOCUS_09360 9708 8644 gene locus_tag LOCUS_09370 gene pyrD 9708 8644 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDI1 protein_id gnl|my_center|LOCUS_09370 9918 10664 gene locus_tag LOCUS_09380 9918 10664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 12793 11300 gene locus_tag LOCUS_09390 12793 11300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 13172 12825 gene locus_tag LOCUS_09400 13172 12825 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258905.1 protein_id gnl|my_center|LOCUS_09400 13610 13251 gene locus_tag LOCUS_09410 13610 13251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 14109 14780 gene locus_tag LOCUS_09420 14109 14780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121005.1 protein_id gnl|my_center|LOCUS_09420 14899 15699 gene locus_tag LOCUS_09430 14899 15699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 15696 16241 gene locus_tag LOCUS_09440 15696 16241 CDS product 4-methyl-5(B-hydroxyethyl)-thiazole monophosphate biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143742.1 protein_id gnl|my_center|LOCUS_09440 16273 17730 gene locus_tag LOCUS_09450 16273 17730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 17744 19126 gene locus_tag LOCUS_09460 17744 19126 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_444230.2 protein_id gnl|my_center|LOCUS_09460 19224 20213 gene locus_tag LOCUS_09470 19224 20213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 20378 20728 gene locus_tag LOCUS_09480 20378 20728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 20991 21599 gene locus_tag LOCUS_09490 20991 21599 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946962.1 protein_id gnl|my_center|LOCUS_09490 >Feature sequence033 2653 719 gene locus_tag LOCUS_09500 2653 719 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_09500 2843 3352 gene locus_tag LOCUS_09510 2843 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 3363 5027 gene locus_tag LOCUS_09520 3363 5027 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIC3 protein_id gnl|my_center|LOCUS_09520 5159 6295 gene locus_tag LOCUS_09530 gene epsN 5159 6295 CDS product putative pyridoxal phosphate-dependent aminotransferase EpsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q795J3 protein_id gnl|my_center|LOCUS_09530 6311 8179 gene locus_tag LOCUS_09540 6311 8179 CDS product nucleoside-diphosphate sugar oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185930.1 protein_id gnl|my_center|LOCUS_09540 8673 8197 gene locus_tag LOCUS_09550 8673 8197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 9621 8734 gene locus_tag LOCUS_09560 9621 8734 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388348.1 protein_id gnl|my_center|LOCUS_09560 10531 9614 gene locus_tag LOCUS_09570 gene oppB 10531 9614 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706429.1 protein_id gnl|my_center|LOCUS_09570 12239 10614 gene locus_tag LOCUS_09580 12239 10614 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277613.1 protein_id gnl|my_center|LOCUS_09580 13770 12301 gene locus_tag LOCUS_09590 gene ybhO 13770 12301 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016286.1 protein_id gnl|my_center|LOCUS_09590 13920 14690 gene locus_tag LOCUS_09600 13920 14690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 14708 15502 gene locus_tag LOCUS_09610 14708 15502 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266288.1 protein_id gnl|my_center|LOCUS_09610 15552 15995 gene locus_tag LOCUS_09620 gene rlmH 15552 15995 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VCH9 protein_id gnl|my_center|LOCUS_09620 16174 16371 gene locus_tag LOCUS_09630 16174 16371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09630 17287 16871 gene locus_tag LOCUS_09640 17287 16871 CDS product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404728.1 protein_id gnl|my_center|LOCUS_09640 17299 19452 gene locus_tag LOCUS_09650 gene uvrB 17299 19452 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180R0 protein_id gnl|my_center|LOCUS_09650 >Feature sequence034 378 1568 gene locus_tag LOCUS_09660 gene aspC 378 1568 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67781 protein_id gnl|my_center|LOCUS_09660 1658 3883 gene locus_tag LOCUS_09670 1658 3883 CDS product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262307.1 protein_id gnl|my_center|LOCUS_09670 5065 4103 gene locus_tag LOCUS_09680 5065 4103 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763623.1 protein_id gnl|my_center|LOCUS_09680 5233 5718 gene locus_tag LOCUS_09690 5233 5718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 5742 6353 gene locus_tag LOCUS_09700 5742 6353 CDS product PhnA domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071746.1 protein_id gnl|my_center|LOCUS_09700 7157 6471 gene locus_tag LOCUS_09710 7157 6471 CDS product amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022907.1 protein_id gnl|my_center|LOCUS_09710 7245 8831 gene locus_tag LOCUS_09720 7245 8831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 9829 8852 gene locus_tag LOCUS_09730 9829 8852 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404958.1 protein_id gnl|my_center|LOCUS_09730 10037 10705 gene locus_tag LOCUS_09740 10037 10705 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230112.1 protein_id gnl|my_center|LOCUS_09740 10806 11561 gene locus_tag LOCUS_09750 10806 11561 CDS product urea amidolyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249287.1 protein_id gnl|my_center|LOCUS_09750 11979 11686 gene locus_tag LOCUS_09760 gene rbpD 11979 11686 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115113.1 protein_id gnl|my_center|LOCUS_09760 12741 12271 gene locus_tag LOCUS_09770 12741 12271 CDS product DUF1456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073612.1 protein_id gnl|my_center|LOCUS_09770 14874 13138 gene locus_tag LOCUS_09780 14874 13138 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578076.1 protein_id gnl|my_center|LOCUS_09780 15193 15906 gene locus_tag LOCUS_09790 15193 15906 CDS product UPF0271 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62EU9 protein_id gnl|my_center|LOCUS_09790 17595 15979 gene locus_tag LOCUS_09800 17595 15979 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UH36 protein_id gnl|my_center|LOCUS_09800 19651 17654 gene locus_tag LOCUS_09810 gene ligA 19651 17654 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180F3 protein_id gnl|my_center|LOCUS_09810 >Feature sequence035 236 1777 gene locus_tag LOCUS_09820 236 1777 CDS product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883980.1 protein_id gnl|my_center|LOCUS_09820 2906 1758 gene locus_tag LOCUS_09830 2906 1758 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082213.1 protein_id gnl|my_center|LOCUS_09830 3995 2919 gene locus_tag LOCUS_09840 3995 2919 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870030.1 protein_id gnl|my_center|LOCUS_09840 4662 4138 gene locus_tag LOCUS_09850 4662 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 6614 5643 gene locus_tag LOCUS_09860 6614 5643 CDS product glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938705.1 protein_id gnl|my_center|LOCUS_09860 8447 6690 gene locus_tag LOCUS_09870 gene ptsI 8447 6690 CDS product phosphoenolpyruvate-protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31149 protein_id gnl|my_center|LOCUS_09870 9343 8507 gene locus_tag LOCUS_09880 9343 8507 CDS product 4-diphosphocytidyl-2C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458917.1 protein_id gnl|my_center|LOCUS_09880 9502 10209 gene locus_tag LOCUS_09890 gene pyrF 9502 10209 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ97 protein_id gnl|my_center|LOCUS_09890 10332 11066 gene locus_tag LOCUS_09900 gene ispD 10332 11066 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CD1 protein_id gnl|my_center|LOCUS_09900 11083 13152 gene locus_tag LOCUS_09910 gene yoaA 11083 13152 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121692.1 protein_id gnl|my_center|LOCUS_09910 13396 13205 gene locus_tag LOCUS_09920 13396 13205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 13416 13721 gene locus_tag LOCUS_09930 13416 13721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 13998 14213 gene locus_tag LOCUS_09940 13998 14213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09940 14300 14677 gene locus_tag LOCUS_09950 14300 14677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 14835 17633 gene locus_tag LOCUS_09960 14835 17633 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120395.1 protein_id gnl|my_center|LOCUS_09960 17991 19457 gene locus_tag LOCUS_09970 gene dbpA 17991 19457 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071179.1 protein_id gnl|my_center|LOCUS_09970 >Feature sequence036 1292 318 gene locus_tag LOCUS_09980 1292 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 1874 1356 gene locus_tag LOCUS_09990 1874 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 2387 1890 gene locus_tag LOCUS_10000 2387 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 2869 3423 gene locus_tag LOCUS_10010 2869 3423 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706500.1 protein_id gnl|my_center|LOCUS_10010 3661 4761 gene locus_tag LOCUS_10020 gene aroC 3661 4761 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLM1 protein_id gnl|my_center|LOCUS_10020 4831 5565 gene locus_tag LOCUS_10030 4831 5565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 6821 5793 gene locus_tag LOCUS_10040 6821 5793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478452.1 protein_id gnl|my_center|LOCUS_10040 7689 7036 gene locus_tag LOCUS_10050 gene rsmJ 7689 7036 CDS product ribosomal RNA small subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXW0 protein_id gnl|my_center|LOCUS_10050 8340 9614 gene locus_tag LOCUS_10060 8340 9614 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967826.1 protein_id gnl|my_center|LOCUS_10060 9649 10404 gene locus_tag LOCUS_10070 9649 10404 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_10070 11612 10557 gene locus_tag LOCUS_10080 11612 10557 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259146.1 protein_id gnl|my_center|LOCUS_10080 12568 11678 gene locus_tag LOCUS_10090 12568 11678 CDS product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259145.1 protein_id gnl|my_center|LOCUS_10090 13438 12578 gene locus_tag LOCUS_10100 gene hisG 13438 12578 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KB10 protein_id gnl|my_center|LOCUS_10100 13597 14073 gene locus_tag LOCUS_10110 gene bcp-1 13597 14073 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932346.1 protein_id gnl|my_center|LOCUS_10110 14135 14821 gene locus_tag LOCUS_10120 gene phoP_pnpR 14135 14821 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166475.1 protein_id gnl|my_center|LOCUS_10120 15725 15513 gene locus_tag LOCUS_10130 15725 15513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 15857 16882 gene locus_tag LOCUS_10140 gene dusB 15857 16882 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181F5 protein_id gnl|my_center|LOCUS_10140 16882 17352 gene locus_tag LOCUS_10150 16882 17352 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057647.1 protein_id gnl|my_center|LOCUS_10150 17445 18002 gene locus_tag LOCUS_10160 gene efp 17445 18002 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q812U1 protein_id gnl|my_center|LOCUS_10160 19154 18156 gene locus_tag LOCUS_10170 19154 18156 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WK73 protein_id gnl|my_center|LOCUS_10170 >Feature sequence037 1742 1371 gene locus_tag LOCUS_10180 gene rplS 1742 1371 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJV3 protein_id gnl|my_center|LOCUS_10180 2431 1739 gene locus_tag LOCUS_10190 gene trmD 2431 1739 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2G4 protein_id gnl|my_center|LOCUS_10190 2865 2476 gene locus_tag LOCUS_10200 2865 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 3226 2996 gene locus_tag LOCUS_10210 3226 2996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 3381 3650 gene locus_tag LOCUS_10220 3381 3650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 5122 4337 gene locus_tag LOCUS_10230 5122 4337 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221095.1 protein_id gnl|my_center|LOCUS_10230 5264 7042 gene locus_tag LOCUS_10240 5264 7042 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UHW9 protein_id gnl|my_center|LOCUS_10240 8394 7294 gene locus_tag LOCUS_10250 gene mraY 8394 7294 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748D3 protein_id gnl|my_center|LOCUS_10250 9850 8450 gene locus_tag LOCUS_10260 gene murF 9850 8450 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4M9 protein_id gnl|my_center|LOCUS_10260 11345 9852 gene locus_tag LOCUS_10270 gene murE 11345 9852 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK84 protein_id gnl|my_center|LOCUS_10270 13245 11431 gene locus_tag LOCUS_10280 13245 11431 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545621.1 protein_id gnl|my_center|LOCUS_10280 13848 13471 gene locus_tag LOCUS_10290 13848 13471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 14827 13862 gene locus_tag LOCUS_10300 gene rsmH 14827 13862 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG80 protein_id gnl|my_center|LOCUS_10300 15584 15060 gene locus_tag LOCUS_10310 15584 15060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 18684 16099 gene locus_tag LOCUS_10320 18684 16099 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055906.1 protein_id gnl|my_center|LOCUS_10320 >Feature sequence038 1598 765 gene locus_tag LOCUS_10330 1598 765 CDS product 2-keto-4-methylthiobutyrate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388886.1 protein_id gnl|my_center|LOCUS_10330 3028 1583 gene locus_tag LOCUS_10340 3028 1583 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393598.1 protein_id gnl|my_center|LOCUS_10340 4244 3072 gene locus_tag LOCUS_10350 4244 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 4371 4940 gene locus_tag LOCUS_10360 4371 4940 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460653.1 protein_id gnl|my_center|LOCUS_10360 5054 5359 gene locus_tag LOCUS_10370 5054 5359 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953389.1 protein_id gnl|my_center|LOCUS_10370 6301 5555 gene locus_tag LOCUS_10380 6301 5555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 9458 6312 gene locus_tag LOCUS_10390 gene mexF 9458 6312 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122351.1 protein_id gnl|my_center|LOCUS_10390 10525 9479 gene locus_tag LOCUS_10400 10525 9479 CDS product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066863.1 protein_id gnl|my_center|LOCUS_10400 12161 10716 gene locus_tag LOCUS_10410 12161 10716 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887698.1 protein_id gnl|my_center|LOCUS_10410 13545 12385 gene locus_tag LOCUS_10420 13545 12385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 13692 14270 gene locus_tag LOCUS_10430 13692 14270 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481406.1 protein_id gnl|my_center|LOCUS_10430 15435 14377 gene locus_tag LOCUS_10440 gene flgL 15435 14377 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392268.1 protein_id gnl|my_center|LOCUS_10440 16954 15455 gene locus_tag LOCUS_10450 gene flgK 16954 15455 CDS product flagellar hook-associated protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKH5 protein_id gnl|my_center|LOCUS_10450 17503 17006 gene locus_tag LOCUS_10460 17503 17006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 17840 17508 gene locus_tag LOCUS_10470 17840 17508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 18891 17845 gene locus_tag LOCUS_10480 gene flgI 18891 17845 CDS product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748F5 protein_id gnl|my_center|LOCUS_10480 >Feature sequence039 488 1729 gene locus_tag LOCUS_10490 488 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201992.1 protein_id gnl|my_center|LOCUS_10490 4089 1870 gene locus_tag LOCUS_10500 4089 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 6011 4221 gene locus_tag LOCUS_10510 6011 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 7049 6027 gene locus_tag LOCUS_10520 7049 6027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 8040 7219 gene locus_tag LOCUS_10530 8040 7219 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227864.1 protein_id gnl|my_center|LOCUS_10530 8704 8063 gene locus_tag LOCUS_10540 gene pdxH 8704 8063 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AFI8 protein_id gnl|my_center|LOCUS_10540 9721 8795 gene locus_tag LOCUS_10550 gene trxB 9721 8795 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R7I9 protein_id gnl|my_center|LOCUS_10550 10007 10804 gene locus_tag LOCUS_10560 10007 10804 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705042.1 protein_id gnl|my_center|LOCUS_10560 10813 12072 gene locus_tag LOCUS_10570 10813 12072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 12738 12223 gene locus_tag LOCUS_10580 12738 12223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405403.1 protein_id gnl|my_center|LOCUS_10580 12877 13668 gene locus_tag LOCUS_10590 gene kdsA 12877 13668 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66496 protein_id gnl|my_center|LOCUS_10590 13741 14298 gene locus_tag LOCUS_10600 13741 14298 CDS product methyltransferase small inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392453.1 protein_id gnl|my_center|LOCUS_10600 14756 14340 gene locus_tag LOCUS_10610 14756 14340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 15331 14966 gene locus_tag LOCUS_10620 15331 14966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 15544 16209 gene locus_tag LOCUS_10630 15544 16209 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932468.1 protein_id gnl|my_center|LOCUS_10630 16506 17711 gene locus_tag LOCUS_10640 16506 17711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 17764 17840 gene locus_tag LOCUS_t00190 17764 17840 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence040 1061 15 gene locus_tag LOCUS_10650 gene hemA 1061 15 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72C23 protein_id gnl|my_center|LOCUS_10650 1918 1058 gene locus_tag LOCUS_10660 1918 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 3016 1949 gene locus_tag LOCUS_10670 gene hemH 3016 1949 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP3 protein_id gnl|my_center|LOCUS_10670 4239 3121 gene locus_tag LOCUS_10680 gene xylR 4239 3121 CDS product XylR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124078.1 protein_id gnl|my_center|LOCUS_10680 4338 5354 gene locus_tag LOCUS_10690 gene gmd 4338 5354 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL63 protein_id gnl|my_center|LOCUS_10690 5527 6432 gene locus_tag LOCUS_10700 gene fcl 5527 6432 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVN0 protein_id gnl|my_center|LOCUS_10700 7028 7258 gene locus_tag LOCUS_10710 7028 7258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 7251 8147 gene locus_tag LOCUS_10720 gene miaA 7251 8147 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BP1 protein_id gnl|my_center|LOCUS_10720 9458 8391 gene locus_tag LOCUS_10730 9458 8391 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AE7 protein_id gnl|my_center|LOCUS_10730 10481 9912 gene locus_tag LOCUS_10740 10481 9912 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896521.1 protein_id gnl|my_center|LOCUS_10740 11375 10491 gene locus_tag LOCUS_10750 11375 10491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 11903 11379 gene locus_tag LOCUS_10760 gene sigM 11903 11379 CDS product ECF RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401930.1 protein_id gnl|my_center|LOCUS_10760 13059 11971 gene locus_tag LOCUS_10770 gene queA 13059 11971 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZ44 protein_id gnl|my_center|LOCUS_10770 13394 16000 gene locus_tag LOCUS_10780 13394 16000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 16494 16165 gene locus_tag LOCUS_10790 16494 16165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 16984 16550 gene locus_tag LOCUS_10800 gene aroQ 16984 16550 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RW91 protein_id gnl|my_center|LOCUS_10800 17800 17042 gene locus_tag LOCUS_10810 17800 17042 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RY41 protein_id gnl|my_center|LOCUS_10810 >Feature sequence041 1109 477 gene locus_tag LOCUS_10820 1109 477 CDS product transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382700.1 protein_id gnl|my_center|LOCUS_10820 1391 1116 gene locus_tag LOCUS_10830 1391 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 2480 1398 gene locus_tag LOCUS_10840 2480 1398 CDS product putative 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PMZ6 protein_id gnl|my_center|LOCUS_10840 2675 2983 gene locus_tag LOCUS_10850 2675 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 2980 3678 gene locus_tag LOCUS_10860 2980 3678 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339011.1 protein_id gnl|my_center|LOCUS_10860 3687 5060 gene locus_tag LOCUS_10870 3687 5060 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259605.1 protein_id gnl|my_center|LOCUS_10870 5231 5674 gene locus_tag LOCUS_10880 5231 5674 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732266.1 protein_id gnl|my_center|LOCUS_10880 5680 7044 gene locus_tag LOCUS_10890 gene accC 5680 7044 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966833.1 protein_id gnl|my_center|LOCUS_10890 7072 7518 gene locus_tag LOCUS_10900 7072 7518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 7565 8110 gene locus_tag LOCUS_10910 7565 8110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 8184 8648 gene locus_tag LOCUS_10920 8184 8648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 8721 9056 gene locus_tag LOCUS_10930 8721 9056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 9319 13965 gene locus_tag LOCUS_10940 9319 13965 CDS product glutamate synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807931.1 protein_id gnl|my_center|LOCUS_10940 14124 15611 gene locus_tag LOCUS_10950 gene gltD 14124 15611 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_10950 15948 16499 gene locus_tag LOCUS_10960 15948 16499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 16552 17151 gene locus_tag LOCUS_10970 gene thrH 16552 17151 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267421.1 protein_id gnl|my_center|LOCUS_10970 17193 17492 gene locus_tag LOCUS_10980 17193 17492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 17524 18132 gene locus_tag LOCUS_10990 17524 18132 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108279.1 protein_id gnl|my_center|LOCUS_10990 >Feature sequence042 567 142 gene locus_tag LOCUS_11000 567 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11000 1138 809 gene locus_tag LOCUS_11010 1138 809 CDS product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062160.1 protein_id gnl|my_center|LOCUS_11010 1416 1126 gene locus_tag LOCUS_11020 1416 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 1750 1406 gene locus_tag LOCUS_11030 1750 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 3248 1722 gene locus_tag LOCUS_11040 gene mrpD 3248 1722 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942977.1 protein_id gnl|my_center|LOCUS_11040 3598 3245 gene locus_tag LOCUS_11050 3598 3245 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258078.1 protein_id gnl|my_center|LOCUS_11050 4037 3606 gene locus_tag LOCUS_11060 gene shaB 4037 3606 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958317.1 protein_id gnl|my_center|LOCUS_11060 6349 4040 gene locus_tag LOCUS_11070 gene mrpA 6349 4040 CDS product Na(+)/H(+) antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942980.1 protein_id gnl|my_center|LOCUS_11070 6879 6385 gene locus_tag LOCUS_11080 6879 6385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 6990 7274 gene locus_tag LOCUS_11090 6990 7274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 7842 9002 gene locus_tag LOCUS_11100 gene gtrB 7842 9002 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036173.1 protein_id gnl|my_center|LOCUS_11100 8999 9823 gene locus_tag LOCUS_11110 8999 9823 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203172.1 protein_id gnl|my_center|LOCUS_11110 11921 9825 gene locus_tag LOCUS_11120 gene ispG 11921 9825 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F1H5 protein_id gnl|my_center|LOCUS_11120 13490 12039 gene locus_tag LOCUS_11130 gene rseP 13490 12039 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3E6 protein_id gnl|my_center|LOCUS_11130 14789 13608 gene locus_tag LOCUS_11140 gene dxr 14789 13608 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK30 protein_id gnl|my_center|LOCUS_11140 15620 14790 gene locus_tag LOCUS_11150 gene cdsA 15620 14790 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VBI1 protein_id gnl|my_center|LOCUS_11150 16464 15775 gene locus_tag LOCUS_11160 gene uppS 16464 15775 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D3 protein_id gnl|my_center|LOCUS_11160 17673 16948 gene locus_tag LOCUS_11170 gene cysH 17673 16948 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L92 protein_id gnl|my_center|LOCUS_11170 >Feature sequence043 368 682 gene locus_tag LOCUS_11180 368 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 2184 769 gene locus_tag LOCUS_11190 gene mpl 2184 769 CDS product UDP-N-acetylmuramate--L-alanyl-gamma-D-glutamyl-meso-2,6-diaminoheptandioate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5P6 protein_id gnl|my_center|LOCUS_11190 2574 3860 gene locus_tag LOCUS_11200 gene purD 2574 3860 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JIJ6 protein_id gnl|my_center|LOCUS_11200 3876 4775 gene locus_tag LOCUS_11210 3876 4775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 4913 6061 gene locus_tag LOCUS_11220 4913 6061 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257745.1 protein_id gnl|my_center|LOCUS_11220 6054 6722 gene locus_tag LOCUS_11230 6054 6722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 6786 7268 gene locus_tag LOCUS_11240 6786 7268 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437844.1 protein_id gnl|my_center|LOCUS_11240 7502 7293 gene locus_tag LOCUS_11250 7502 7293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 8572 7412 gene locus_tag LOCUS_11260 8572 7412 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403679.1 protein_id gnl|my_center|LOCUS_11260 9266 9466 gene locus_tag LOCUS_11270 9266 9466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 9642 9917 gene locus_tag LOCUS_11280 9642 9917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 11244 10114 gene locus_tag LOCUS_11290 11244 10114 CDS product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257568.1 protein_id gnl|my_center|LOCUS_11290 13280 11835 gene locus_tag LOCUS_11300 gene ahcY 13280 11835 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCH5 protein_id gnl|my_center|LOCUS_11300 14595 13408 gene locus_tag LOCUS_11310 gene metK 14595 13408 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPS4 protein_id gnl|my_center|LOCUS_11310 14724 16646 gene locus_tag LOCUS_11320 14724 16646 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488980.1 protein_id gnl|my_center|LOCUS_11320 <17571 16918 gene locus_tag LOCUS_11330 <17571 16918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011172559.1:ABC transporter ATP-binding protein >Feature sequence044 946 1440 gene locus_tag LOCUS_11340 946 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 2531 1497 gene locus_tag LOCUS_11350 2531 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 3666 2563 gene locus_tag LOCUS_11360 gene wbyK 3666 2563 CDS product mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208591.1 protein_id gnl|my_center|LOCUS_11360 4637 3687 gene locus_tag LOCUS_11370 4637 3687 CDS product hemolytic protein HlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058218.1 protein_id gnl|my_center|LOCUS_11370 4824 5612 gene locus_tag LOCUS_11380 4824 5612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 6461 5664 gene locus_tag LOCUS_11390 6461 5664 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657976.1 protein_id gnl|my_center|LOCUS_11390 7628 6642 gene locus_tag LOCUS_11400 7628 6642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 8289 7918 gene locus_tag LOCUS_11410 8289 7918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 9127 8297 gene locus_tag LOCUS_11420 9127 8297 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122210.1 protein_id gnl|my_center|LOCUS_11420 9843 9448 gene locus_tag LOCUS_11430 9843 9448 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972683.1 protein_id gnl|my_center|LOCUS_11430 10083 9847 gene locus_tag LOCUS_11440 10083 9847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 10932 10141 gene locus_tag LOCUS_11450 10932 10141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095770.1 protein_id gnl|my_center|LOCUS_11450 11622 10951 gene locus_tag LOCUS_11460 11622 10951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114545.1 protein_id gnl|my_center|LOCUS_11460 12445 11603 gene locus_tag LOCUS_11470 12445 11603 CDS product LPS kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266463.1 protein_id gnl|my_center|LOCUS_11470 12821 14665 gene locus_tag LOCUS_11480 12821 14665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 14662 16116 gene locus_tag LOCUS_11490 14662 16116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 16118 17077 gene locus_tag LOCUS_11500 gene rfaF 16118 17077 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_11500 >Feature sequence045 1461 169 gene locus_tag LOCUS_11510 gene pheA 1461 169 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943245.1 protein_id gnl|my_center|LOCUS_11510 2254 1454 gene locus_tag LOCUS_11520 2254 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 2399 4111 gene locus_tag LOCUS_11530 gene ilvD 2399 4111 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF68 protein_id gnl|my_center|LOCUS_11530 4204 5778 gene locus_tag LOCUS_11540 gene pgi 4204 5778 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DK5 protein_id gnl|my_center|LOCUS_11540 5814 6638 gene locus_tag LOCUS_11550 5814 6638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 6913 7611 gene locus_tag LOCUS_11560 gene rsmI 6913 7611 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SH3 protein_id gnl|my_center|LOCUS_11560 8870 7908 gene locus_tag LOCUS_11570 gene cysK 8870 7908 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324150.1 protein_id gnl|my_center|LOCUS_11570 9409 9128 gene locus_tag LOCUS_11580 gene infA 9409 9128 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM07 protein_id gnl|my_center|LOCUS_11580 10084 10992 gene locus_tag LOCUS_11590 10084 10992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 11137 11700 gene locus_tag LOCUS_11600 gene tadA 11137 11700 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2VEQ5 protein_id gnl|my_center|LOCUS_11600 11875 12501 gene locus_tag LOCUS_11610 gene sodA 11875 12501 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HDP2 protein_id gnl|my_center|LOCUS_11610 13599 12661 gene locus_tag LOCUS_11620 gene rlmF 13599 12661 CDS product ribosomal RNA large subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHV5 protein_id gnl|my_center|LOCUS_11620 13864 15237 gene locus_tag LOCUS_11630 13864 15237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 15269 16312 gene locus_tag LOCUS_11640 15269 16312 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546105.1 protein_id gnl|my_center|LOCUS_11640 16352 16720 gene locus_tag LOCUS_11650 16352 16720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 <17333 16736 gene locus_tag LOCUS_11660 <17333 16736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004406281.1:tRNA threonylcarbamoyladenosine dehydratase >Feature sequence046 2361 622 gene locus_tag LOCUS_11670 gene cafA 2361 622 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_11670 3657 2449 gene locus_tag LOCUS_11680 3657 2449 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392081.1 protein_id gnl|my_center|LOCUS_11680 4290 3829 gene locus_tag LOCUS_11690 4290 3829 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804034.1 protein_id gnl|my_center|LOCUS_11690 4427 4768 gene locus_tag LOCUS_11700 4427 4768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 4827 6176 gene locus_tag LOCUS_11710 4827 6176 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBV0 protein_id gnl|my_center|LOCUS_11710 7064 6345 gene locus_tag LOCUS_11720 7064 6345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 7836 7129 gene locus_tag LOCUS_11730 7836 7129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 8328 7870 gene locus_tag LOCUS_11740 8328 7870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 8635 9072 gene locus_tag LOCUS_11750 8635 9072 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007449657.1 protein_id gnl|my_center|LOCUS_11750 9846 10211 gene locus_tag LOCUS_11760 9846 10211 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942008.1 protein_id gnl|my_center|LOCUS_11760 10814 10542 gene locus_tag LOCUS_11770 10814 10542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 13014 11044 gene locus_tag LOCUS_11780 gene glgE 13014 11044 CDS product alpha-1,4-glucan:maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAR6 protein_id gnl|my_center|LOCUS_11780 14272 13064 gene locus_tag LOCUS_11790 14272 13064 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258925.1 protein_id gnl|my_center|LOCUS_11790 14599 14345 gene locus_tag LOCUS_11800 14599 14345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 15018 14731 gene locus_tag LOCUS_11810 15018 14731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 16212 15328 gene locus_tag LOCUS_11820 16212 15328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11820 16464 16237 gene locus_tag LOCUS_11830 16464 16237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 >Feature sequence047 221 763 gene locus_tag LOCUS_11840 221 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 902 2203 gene locus_tag LOCUS_11850 gene kdtA 902 2203 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105256.1 protein_id gnl|my_center|LOCUS_11850 2423 2244 gene locus_tag LOCUS_11860 2423 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 4335 3079 gene locus_tag LOCUS_11870 gene fabF 4335 3079 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97DA7 protein_id gnl|my_center|LOCUS_11870 4652 4398 gene locus_tag LOCUS_11880 gene acpP 4652 4398 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67611 protein_id gnl|my_center|LOCUS_11880 5433 4687 gene locus_tag LOCUS_11890 gene fabG 5433 4687 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072711.1 protein_id gnl|my_center|LOCUS_11890 5563 6297 gene locus_tag LOCUS_11900 5563 6297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 6329 7261 gene locus_tag LOCUS_11910 6329 7261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 7312 8184 gene locus_tag LOCUS_11920 gene folD 7312 8184 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RB7 protein_id gnl|my_center|LOCUS_11920 8181 8831 gene locus_tag LOCUS_11930 8181 8831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 8929 10041 gene locus_tag LOCUS_11940 8929 10041 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546841.1 protein_id gnl|my_center|LOCUS_11940 10042 10848 gene locus_tag LOCUS_11950 gene proC 10042 10848 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG91 protein_id gnl|my_center|LOCUS_11950 11137 10919 gene locus_tag LOCUS_11960 11137 10919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 13507 11396 gene locus_tag LOCUS_11970 gene glgB 13507 11396 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJB4 protein_id gnl|my_center|LOCUS_11970 13758 15929 gene locus_tag LOCUS_11980 13758 15929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 15942 16721 gene locus_tag LOCUS_11990 gene scpA 15942 16721 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C43 protein_id gnl|my_center|LOCUS_11990 >Feature sequence048 1323 370 gene locus_tag LOCUS_12000 1323 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 3058 1532 gene locus_tag LOCUS_12010 gene rny 3058 1532 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZZ6 protein_id gnl|my_center|LOCUS_12010 5010 3217 gene locus_tag LOCUS_12020 5010 3217 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957611.1 protein_id gnl|my_center|LOCUS_12020 6438 5059 gene locus_tag LOCUS_12030 gene menE 6438 5059 CDS product O-succinylbenzoic acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057063.1 protein_id gnl|my_center|LOCUS_12030 7412 6411 gene locus_tag LOCUS_12040 gene menC 7412 6411 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJP8 protein_id gnl|my_center|LOCUS_12040 7470 9053 gene locus_tag LOCUS_12050 gene guaB 7470 9053 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X168 protein_id gnl|my_center|LOCUS_12050 9203 10750 gene locus_tag LOCUS_12060 gene purA 9203 10750 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q725K9 protein_id gnl|my_center|LOCUS_12060 10760 11098 gene locus_tag LOCUS_12070 10760 11098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 11551 11126 gene locus_tag LOCUS_12080 11551 11126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523721.1 protein_id gnl|my_center|LOCUS_12080 13265 11682 gene locus_tag LOCUS_12090 gene nadB 13265 11682 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C48 protein_id gnl|my_center|LOCUS_12090 14209 13361 gene locus_tag LOCUS_12100 gene panC 14209 13361 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM60 protein_id gnl|my_center|LOCUS_12100 14335 15579 gene locus_tag LOCUS_12110 14335 15579 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870908.1 protein_id gnl|my_center|LOCUS_12110 15652 16020 gene locus_tag LOCUS_12120 15652 16020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 16606 16244 gene locus_tag LOCUS_12130 16606 16244 CDS product UPF0345 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DI8 protein_id gnl|my_center|LOCUS_12130 >Feature sequence049 348 1448 gene locus_tag LOCUS_12140 gene leuB 348 1448 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CFL3 protein_id gnl|my_center|LOCUS_12140 1480 1869 gene locus_tag LOCUS_12150 1480 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963175.1 protein_id gnl|my_center|LOCUS_12150 1953 4760 gene locus_tag LOCUS_12160 gene alaS 1953 4760 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG04 protein_id gnl|my_center|LOCUS_12160 5384 4818 gene locus_tag LOCUS_12170 5384 4818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 5986 5384 gene locus_tag LOCUS_12180 5986 5384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 6077 6760 gene locus_tag LOCUS_12190 6077 6760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 6750 8168 gene locus_tag LOCUS_12200 gene xseA 6750 8168 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXL8 protein_id gnl|my_center|LOCUS_12200 8500 8892 gene locus_tag LOCUS_12210 8500 8892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 8996 9982 gene locus_tag LOCUS_12220 8996 9982 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797481.1 protein_id gnl|my_center|LOCUS_12220 10063 11334 gene locus_tag LOCUS_12230 gene proA 10063 11334 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKZ6 protein_id gnl|my_center|LOCUS_12230 12628 11480 gene locus_tag LOCUS_12240 gene rlmN 12628 11480 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0X3 protein_id gnl|my_center|LOCUS_12240 12730 13449 gene locus_tag LOCUS_12250 12730 13449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816793.1 protein_id gnl|my_center|LOCUS_12250 14192 13446 gene locus_tag LOCUS_12260 14192 13446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 14328 15983 gene locus_tag LOCUS_12270 14328 15983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 >Feature sequence050 1000 107 gene locus_tag LOCUS_12280 1000 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 1031 2206 gene locus_tag LOCUS_12290 1031 2206 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_12290 3763 2315 gene locus_tag LOCUS_12300 gene rpoN 3763 2315 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BZ1 protein_id gnl|my_center|LOCUS_12300 4194 3787 gene locus_tag LOCUS_12310 4194 3787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 4325 4642 gene locus_tag LOCUS_12320 gene erpA 4325 4642 CDS product putative iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VUW2 protein_id gnl|my_center|LOCUS_12320 6315 4723 gene locus_tag LOCUS_12330 6315 4723 CDS product NAD-utilizing dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202072.1 protein_id gnl|my_center|LOCUS_12330 7286 6441 gene locus_tag LOCUS_12340 7286 6441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 8803 7283 gene locus_tag LOCUS_12350 8803 7283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 8974 9645 gene locus_tag LOCUS_12360 8974 9645 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_12360 10668 9994 gene locus_tag LOCUS_12370 gene lexA 10668 9994 CDS product lexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33927 protein_id gnl|my_center|LOCUS_12370 10768 12624 gene locus_tag LOCUS_12380 gene oppA 10768 12624 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880932.1 protein_id gnl|my_center|LOCUS_12380 12621 13595 gene locus_tag LOCUS_12390 12621 13595 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081376.1 protein_id gnl|my_center|LOCUS_12390 13597 14655 gene locus_tag LOCUS_12400 gene oppC 13597 14655 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880981.1 protein_id gnl|my_center|LOCUS_12400 14682 15542 gene locus_tag LOCUS_12410 14682 15542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 15869 15681 gene locus_tag LOCUS_12420 15869 15681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705982.1 protein_id gnl|my_center|LOCUS_12420 >Feature sequence051 1447 563 gene locus_tag LOCUS_12430 1447 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404936.1 protein_id gnl|my_center|LOCUS_12430 2595 1444 gene locus_tag LOCUS_12440 2595 1444 CDS product lycopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026915.1 protein_id gnl|my_center|LOCUS_12440 3526 2585 gene locus_tag LOCUS_12450 gene crtB 3526 2585 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54905 protein_id gnl|my_center|LOCUS_12450 4998 3523 gene locus_tag LOCUS_12460 gene crtI 4998 3523 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404788.1 protein_id gnl|my_center|LOCUS_12460 5899 5000 gene locus_tag LOCUS_12470 5899 5000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 6826 5948 gene locus_tag LOCUS_12480 6826 5948 CDS product xanthorhodopsin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140202.1 protein_id gnl|my_center|LOCUS_12480 8118 7741 gene locus_tag LOCUS_12490 8118 7741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 9179 8850 gene locus_tag LOCUS_12500 9179 8850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 10831 9842 gene locus_tag LOCUS_12510 10831 9842 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258797.1 protein_id gnl|my_center|LOCUS_12510 10916 11080 gene locus_tag LOCUS_12520 10916 11080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 12984 11341 gene locus_tag LOCUS_12530 12984 11341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 15701 14229 gene locus_tag LOCUS_12540 15701 14229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 >Feature sequence052 101 1474 gene locus_tag LOCUS_12550 101 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 1993 5556 gene locus_tag LOCUS_12560 1993 5556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 6458 6153 gene locus_tag LOCUS_12570 6458 6153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 10086 6826 gene locus_tag LOCUS_12580 gene nrdA 10086 6826 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MK29 protein_id gnl|my_center|LOCUS_12580 11294 10212 gene locus_tag LOCUS_12590 gene nrdB 11294 10212 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MK81 protein_id gnl|my_center|LOCUS_12590 11754 12395 gene locus_tag LOCUS_12600 11754 12395 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFP4 protein_id gnl|my_center|LOCUS_12600 12677 13069 gene locus_tag LOCUS_12610 12677 13069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 13066 13623 gene locus_tag LOCUS_12620 13066 13623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 13707 13781 gene locus_tag LOCUS_t00200 13707 13781 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 13786 13861 gene locus_tag LOCUS_t00210 13786 13861 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 14205 13906 gene locus_tag LOCUS_12630 14205 13906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 14889 15578 gene locus_tag LOCUS_12640 14889 15578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016479.1 protein_id gnl|my_center|LOCUS_12640 >Feature sequence053 440 844 gene locus_tag LOCUS_12650 440 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 880 2043 gene locus_tag LOCUS_12660 880 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 2116 2736 gene locus_tag LOCUS_12670 2116 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 2882 3802 gene locus_tag LOCUS_12680 2882 3802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 3857 4162 gene locus_tag LOCUS_12690 3857 4162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 4221 4493 gene locus_tag LOCUS_12700 4221 4493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 4527 5066 gene locus_tag LOCUS_12710 4527 5066 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119583.1 protein_id gnl|my_center|LOCUS_12710 5615 6712 gene locus_tag LOCUS_12720 5615 6712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969423.1 protein_id gnl|my_center|LOCUS_12720 8453 7017 gene locus_tag LOCUS_12730 8453 7017 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898767.1 protein_id gnl|my_center|LOCUS_12730 9831 8998 gene locus_tag LOCUS_12740 9831 8998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 10267 9833 gene locus_tag LOCUS_12750 10267 9833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 10485 11510 gene locus_tag LOCUS_12760 gene glnII 10485 11510 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KM78 protein_id gnl|my_center|LOCUS_12760 12500 11718 gene locus_tag LOCUS_12770 12500 11718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478233.1 protein_id gnl|my_center|LOCUS_12770 12709 13227 gene locus_tag LOCUS_12780 12709 13227 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524578.1 protein_id gnl|my_center|LOCUS_12780 13224 13886 gene locus_tag LOCUS_12790 13224 13886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 15271 13907 gene locus_tag LOCUS_12800 15271 13907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 >Feature sequence054 <1 766 gene locus_tag LOCUS_12810 <1 766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545949.1:sensor histidine kinase 747 1160 gene locus_tag LOCUS_12820 747 1160 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259628.1 protein_id gnl|my_center|LOCUS_12820 2945 1497 gene locus_tag LOCUS_12830 2945 1497 CDS product MucD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545685.1 protein_id gnl|my_center|LOCUS_12830 4961 3612 gene locus_tag LOCUS_12840 gene thrC 4961 3612 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942338.1 protein_id gnl|my_center|LOCUS_12840 6619 5246 gene locus_tag LOCUS_12850 6619 5246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227990.1 protein_id gnl|my_center|LOCUS_12850 7086 6766 gene locus_tag LOCUS_12860 gene cutA 7086 6766 CDS product divalent cation tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226991.1 protein_id gnl|my_center|LOCUS_12860 8591 7119 gene locus_tag LOCUS_12870 gene glcD-1 8591 7119 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_12870 9327 9127 gene locus_tag LOCUS_12880 9327 9127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 9579 10682 gene locus_tag LOCUS_12890 gene ychF 9579 10682 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3XYK0 protein_id gnl|my_center|LOCUS_12890 10808 11455 gene locus_tag LOCUS_12900 10808 11455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 11522 12640 gene locus_tag LOCUS_12910 11522 12640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 12640 14553 gene locus_tag LOCUS_12920 12640 14553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 >Feature sequence055 1198 479 gene locus_tag LOCUS_12930 1198 479 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338637.1 protein_id gnl|my_center|LOCUS_12930 1999 1328 gene locus_tag LOCUS_12940 gene mazG 1999 1328 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44723 protein_id gnl|my_center|LOCUS_12940 3733 2264 gene locus_tag LOCUS_12950 gene rhlE 3733 2264 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CPJ8 protein_id gnl|my_center|LOCUS_12950 5203 4817 gene locus_tag LOCUS_12960 5203 4817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 5487 5969 gene locus_tag LOCUS_12970 5487 5969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 6925 5981 gene locus_tag LOCUS_12980 gene psd 6925 5981 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFM0 protein_id gnl|my_center|LOCUS_12980 8171 6900 gene locus_tag LOCUS_12990 8171 6900 CDS product voltage-gated chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416818.1 protein_id gnl|my_center|LOCUS_12990 8770 8931 gene locus_tag LOCUS_13000 8770 8931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 10911 9334 gene locus_tag LOCUS_13010 gene gpmI 10911 9334 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFG7 protein_id gnl|my_center|LOCUS_13010 11956 10946 gene locus_tag LOCUS_13020 11956 10946 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_13020 12109 14937 gene locus_tag LOCUS_13030 gene ileS 12109 14937 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46213 protein_id gnl|my_center|LOCUS_13030 >Feature sequence056 1482 445 gene locus_tag LOCUS_13040 1482 445 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038316.1 protein_id gnl|my_center|LOCUS_13040 3677 1542 gene locus_tag LOCUS_13050 gene ppk 3677 1542 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGU8 protein_id gnl|my_center|LOCUS_13050 3903 4145 gene locus_tag LOCUS_13060 3903 4145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 6316 4433 gene locus_tag LOCUS_13070 6316 4433 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460040.1 protein_id gnl|my_center|LOCUS_13070 7318 6461 gene locus_tag LOCUS_13080 gene dapF 7318 6461 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZX7 protein_id gnl|my_center|LOCUS_13080 7408 7710 gene locus_tag LOCUS_13090 7408 7710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 9666 7969 gene locus_tag LOCUS_13100 gene leuA-2 9666 7969 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAP9 protein_id gnl|my_center|LOCUS_13100 10152 10589 gene locus_tag LOCUS_13110 10152 10589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 11692 10880 gene locus_tag LOCUS_13120 11692 10880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 11815 11890 gene locus_tag LOCUS_t00220 11815 11890 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 12113 12289 gene locus_tag LOCUS_13130 12113 12289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 13080 12310 gene locus_tag LOCUS_13140 13080 12310 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104424.1 protein_id gnl|my_center|LOCUS_13140 13194 14870 gene locus_tag LOCUS_13150 13194 14870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 >Feature sequence057 2139 226 gene locus_tag LOCUS_13160 gene purF 2139 226 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_13160 3190 2252 gene locus_tag LOCUS_13170 3190 2252 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020666.1 protein_id gnl|my_center|LOCUS_13170 3596 4015 gene locus_tag LOCUS_13180 3596 4015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 4021 5379 gene locus_tag LOCUS_13190 4021 5379 CDS product Ysh1p: subunit of polyadenylation factor I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404676.1 protein_id gnl|my_center|LOCUS_13190 5846 7681 gene locus_tag LOCUS_13200 gene typA 5846 7681 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941168.1 protein_id gnl|my_center|LOCUS_13200 8243 8590 gene locus_tag LOCUS_13210 8243 8590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 8753 9664 gene locus_tag LOCUS_13220 8753 9664 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108322.1 protein_id gnl|my_center|LOCUS_13220 9801 10442 gene locus_tag LOCUS_13230 9801 10442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 12145 10751 gene locus_tag LOCUS_13240 gene argH 12145 10751 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UCI6 protein_id gnl|my_center|LOCUS_13240 13774 12212 gene locus_tag LOCUS_13250 gene mviN 13774 12212 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8U3 protein_id gnl|my_center|LOCUS_13250 >Feature sequence058 616 161 gene locus_tag LOCUS_13260 616 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 protein_id gnl|my_center|LOCUS_13260 710 1627 gene locus_tag LOCUS_13270 gene desC 710 1627 CDS product delta 9 acyl-lipid fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036524.1 protein_id gnl|my_center|LOCUS_13270 1620 2423 gene locus_tag LOCUS_13280 1620 2423 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036519.1 protein_id gnl|my_center|LOCUS_13280 2378 3619 gene locus_tag LOCUS_13290 gene cfaS 2378 3619 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073246.1 protein_id gnl|my_center|LOCUS_13290 4626 4000 gene locus_tag LOCUS_13300 4626 4000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 5541 4789 gene locus_tag LOCUS_13310 5541 4789 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338709.1 protein_id gnl|my_center|LOCUS_13310 6887 5586 gene locus_tag LOCUS_13320 6887 5586 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266740.1 protein_id gnl|my_center|LOCUS_13320 7038 7589 gene locus_tag LOCUS_13330 7038 7589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 9342 8080 gene locus_tag LOCUS_13340 gene pfp 9342 8080 CDS product pyrophosphate--fructose 6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJ41 protein_id gnl|my_center|LOCUS_13340 10836 9412 gene locus_tag LOCUS_13350 10836 9412 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CK34 protein_id gnl|my_center|LOCUS_13350 11326 10976 gene locus_tag LOCUS_13360 11326 10976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 12546 11449 gene locus_tag LOCUS_13370 12546 11449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 13951 12668 gene locus_tag LOCUS_13380 13951 12668 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812916.1 protein_id gnl|my_center|LOCUS_13380 >Feature sequence059 683 132 gene locus_tag LOCUS_13390 gene plsC 683 132 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873822.1 protein_id gnl|my_center|LOCUS_13390 1492 917 gene locus_tag LOCUS_13400 gene cmk 1492 917 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WTS4 protein_id gnl|my_center|LOCUS_13400 1469 1840 gene locus_tag LOCUS_13410 1469 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 2825 1986 gene locus_tag LOCUS_13420 2825 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895674.1 protein_id gnl|my_center|LOCUS_13420 3791 2925 gene locus_tag LOCUS_13430 gene gluQ 3791 2925 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BE3 protein_id gnl|my_center|LOCUS_13430 5531 3906 gene locus_tag LOCUS_13440 5531 3906 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889552.1 protein_id gnl|my_center|LOCUS_13440 5907 7121 gene locus_tag LOCUS_13450 gene rhlE-2 5907 7121 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941582.1 protein_id gnl|my_center|LOCUS_13450 7268 8005 gene locus_tag LOCUS_13460 7268 8005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 9446 8088 gene locus_tag LOCUS_13470 gene aroA 9446 8088 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3Z0 protein_id gnl|my_center|LOCUS_13470 10417 9572 gene locus_tag LOCUS_13480 10417 9572 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545810.1 protein_id gnl|my_center|LOCUS_13480 10668 12335 gene locus_tag LOCUS_13490 10668 12335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 12966 13325 gene locus_tag LOCUS_13500 12966 13325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 <14068 13512 gene locus_tag LOCUS_13510 <14068 13512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KBI0:UvrABC system protein C >Feature sequence060 2018 621 gene locus_tag LOCUS_13520 2018 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332558.1 protein_id gnl|my_center|LOCUS_13520 3175 2120 gene locus_tag LOCUS_13530 3175 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 3892 3197 gene locus_tag LOCUS_13540 3892 3197 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063877.1 protein_id gnl|my_center|LOCUS_13540 5105 3873 gene locus_tag LOCUS_13550 5105 3873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091170.1 protein_id gnl|my_center|LOCUS_13550 5373 5449 gene locus_tag LOCUS_t00230 5373 5449 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5722 6861 gene locus_tag LOCUS_13560 5722 6861 CDS product transposase for insertion sequence element ISRM5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q52873 protein_id gnl|my_center|LOCUS_13560 7160 8086 gene locus_tag LOCUS_13570 7160 8086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 8126 9505 gene locus_tag LOCUS_13580 8126 9505 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123785.1 protein_id gnl|my_center|LOCUS_13580 9915 9637 gene locus_tag LOCUS_13590 9915 9637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 9835 10146 gene locus_tag LOCUS_13600 9835 10146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 10708 10211 gene locus_tag LOCUS_13610 10708 10211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13610 10882 11094 gene locus_tag LOCUS_13620 10882 11094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 12787 11087 gene locus_tag LOCUS_13630 12787 11087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 >Feature sequence061 3171 1384 gene locus_tag LOCUS_13640 3171 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 4865 3276 gene locus_tag LOCUS_13650 4865 3276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 5035 6108 gene locus_tag LOCUS_13660 5035 6108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 6132 6542 gene locus_tag LOCUS_13670 gene nuoA 6132 6542 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S5J3 protein_id gnl|my_center|LOCUS_13670 6681 8039 gene locus_tag LOCUS_13680 6681 8039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 8141 8953 gene locus_tag LOCUS_13690 gene trpA 8141 8953 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X4E8 protein_id gnl|my_center|LOCUS_13690 9065 9688 gene locus_tag LOCUS_13700 9065 9688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13700 9880 10299 gene locus_tag LOCUS_13710 9880 10299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13710 10292 11908 gene locus_tag LOCUS_13720 10292 11908 CDS product paraquat-inducible protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881538.1 protein_id gnl|my_center|LOCUS_13720 12013 12465 gene locus_tag LOCUS_13730 12013 12465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 >Feature sequence062 725 5719 gene locus_tag LOCUS_13740 725 5719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 5724 7277 gene locus_tag LOCUS_13750 5724 7277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920272.1 protein_id gnl|my_center|LOCUS_13750 7299 7856 gene locus_tag LOCUS_13760 7299 7856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 8473 8153 gene locus_tag LOCUS_13770 8473 8153 CDS product UPF0345 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DI8 protein_id gnl|my_center|LOCUS_13770 9581 9075 gene locus_tag LOCUS_13780 9581 9075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 12764 9660 gene locus_tag LOCUS_13790 12764 9660 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108104.1 protein_id gnl|my_center|LOCUS_13790 >Feature sequence063 2505 3263 gene locus_tag LOCUS_13800 2505 3263 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333296.1 protein_id gnl|my_center|LOCUS_13800 3374 3808 gene locus_tag LOCUS_13810 3374 3808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 3982 5022 gene locus_tag LOCUS_13820 gene pdhA 3982 5022 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y472 protein_id gnl|my_center|LOCUS_13820 5098 6075 gene locus_tag LOCUS_13830 5098 6075 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257842.1 protein_id gnl|my_center|LOCUS_13830 6199 7482 gene locus_tag LOCUS_13840 6199 7482 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBK4 protein_id gnl|my_center|LOCUS_13840 7844 8179 gene locus_tag LOCUS_13850 7844 8179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 8316 9053 gene locus_tag LOCUS_13860 8316 9053 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038753.1 protein_id gnl|my_center|LOCUS_13860 9335 10225 gene locus_tag LOCUS_13870 9335 10225 CDS product GumN protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482258.1 protein_id gnl|my_center|LOCUS_13870 11164 10499 gene locus_tag LOCUS_13880 11164 10499 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937645.1 protein_id gnl|my_center|LOCUS_13880 11291 11827 gene locus_tag LOCUS_13890 11291 11827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 11833 12438 gene locus_tag LOCUS_13900 gene gmk 11833 12438 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJ36 protein_id gnl|my_center|LOCUS_13900 >Feature sequence064 283 909 gene locus_tag LOCUS_13910 283 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 984 1598 gene locus_tag LOCUS_13920 984 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 2602 1763 gene locus_tag LOCUS_13930 2602 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 4146 2959 gene locus_tag LOCUS_13940 gene rsmB 4146 2959 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962856.1 protein_id gnl|my_center|LOCUS_13940 4539 5312 gene locus_tag LOCUS_13950 4539 5312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 6202 5543 gene locus_tag LOCUS_13960 gene bvgA 6202 5543 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039982.1 protein_id gnl|my_center|LOCUS_13960 7119 6244 gene locus_tag LOCUS_13970 7119 6244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 8048 11887 gene locus_tag LOCUS_13980 8048 11887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 >Feature sequence065 3926 1389 gene locus_tag LOCUS_13990 gene secD 3926 1389 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971714.1 protein_id gnl|my_center|LOCUS_13990 4310 3954 gene locus_tag LOCUS_14000 4310 3954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 5367 4480 gene locus_tag LOCUS_14010 gene menA 5367 4480 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2V4 protein_id gnl|my_center|LOCUS_14010 5947 6288 gene locus_tag LOCUS_14020 5947 6288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 6365 7336 gene locus_tag LOCUS_14030 6365 7336 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_14030 8031 7423 gene locus_tag LOCUS_14040 8031 7423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208071.1 protein_id gnl|my_center|LOCUS_14040 11332 8339 gene locus_tag LOCUS_14050 gene gcvP 11332 8339 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DII3 protein_id gnl|my_center|LOCUS_14050 >Feature sequence066 533 348 gene locus_tag LOCUS_14060 533 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 554 2401 gene locus_tag LOCUS_14070 gene infB 554 2401 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043635.1 protein_id gnl|my_center|LOCUS_14070 2474 2827 gene locus_tag LOCUS_14080 2474 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 2814 3821 gene locus_tag LOCUS_14090 2814 3821 CDS product phosphoesterase RecJ-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392566.1 protein_id gnl|my_center|LOCUS_14090 4011 4739 gene locus_tag LOCUS_14100 4011 4739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 4932 5885 gene locus_tag LOCUS_14110 gene ribF 4932 5885 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XG31 protein_id gnl|my_center|LOCUS_14110 6035 6967 gene locus_tag LOCUS_14120 6035 6967 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVD3 protein_id gnl|my_center|LOCUS_14120 7132 8283 gene locus_tag LOCUS_14130 7132 8283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 8824 8405 gene locus_tag LOCUS_14140 8824 8405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 9864 9088 gene locus_tag LOCUS_14150 9864 9088 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPC2 protein_id gnl|my_center|LOCUS_14150 10002 11267 gene locus_tag LOCUS_14160 gene lysA 10002 11267 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190627.1 protein_id gnl|my_center|LOCUS_14160 >Feature sequence067 1061 237 gene locus_tag LOCUS_14170 1061 237 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764311.1 protein_id gnl|my_center|LOCUS_14170 2387 1278 gene locus_tag LOCUS_14180 2387 1278 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCJ0 protein_id gnl|my_center|LOCUS_14180 3488 2391 gene locus_tag LOCUS_14190 3488 2391 CDS product oxidoreductase FAD/NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530417.1 protein_id gnl|my_center|LOCUS_14190 4961 3513 gene locus_tag LOCUS_14200 4961 3513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 5099 5974 gene locus_tag LOCUS_14210 5099 5974 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775503.1 protein_id gnl|my_center|LOCUS_14210 7320 6067 gene locus_tag LOCUS_14220 gene rhaA 7320 6067 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z2V3 protein_id gnl|my_center|LOCUS_14220 8844 7342 gene locus_tag LOCUS_14230 8844 7342 CDS product L-fuculose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582815.1 protein_id gnl|my_center|LOCUS_14230 9951 8845 gene locus_tag LOCUS_14240 9951 8845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 11186 10113 gene locus_tag LOCUS_14250 11186 10113 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728808.1 protein_id gnl|my_center|LOCUS_14250 >Feature sequence068 1262 873 gene locus_tag LOCUS_14260 1262 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 1728 4052 gene locus_tag LOCUS_14270 gene recD2 1728 4052 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGW5 protein_id gnl|my_center|LOCUS_14270 4218 9887 gene locus_tag LOCUS_14280 4218 9887 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749I5 protein_id gnl|my_center|LOCUS_14280 10090 10422 gene locus_tag LOCUS_14290 10090 10422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 10567 10657 gene locus_tag LOCUS_t00240 10567 10657 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence069 3 1550 gene locus_tag LOCUS_14300 gene guaA 3 1550 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHY9 protein_id gnl|my_center|LOCUS_14300 1620 2354 gene locus_tag LOCUS_14310 1620 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 2403 3698 gene locus_tag LOCUS_14320 gene hisD1 2403 3698 CDS product histidinol dehydrogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92S26 protein_id gnl|my_center|LOCUS_14320 4214 4059 gene locus_tag LOCUS_14330 4214 4059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 4768 5859 gene locus_tag LOCUS_14340 gene hisC 4768 5859 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97ES6 protein_id gnl|my_center|LOCUS_14340 5841 6443 gene locus_tag LOCUS_14350 gene hisB 5841 6443 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60885 protein_id gnl|my_center|LOCUS_14350 6654 7292 gene locus_tag LOCUS_14360 gene hisH 6654 7292 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0ML54 protein_id gnl|my_center|LOCUS_14360 7321 8655 gene locus_tag LOCUS_14370 gene gltA 7321 8655 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPW5 protein_id gnl|my_center|LOCUS_14370 9669 8869 gene locus_tag LOCUS_14380 9669 8869 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841479.1 protein_id gnl|my_center|LOCUS_14380 9695 10345 gene locus_tag LOCUS_14390 9695 10345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 >Feature sequence070 925 620 gene locus_tag LOCUS_14400 925 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 1160 2347 gene locus_tag LOCUS_14410 gene kamA 1160 2347 CDS product L-lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RHX4 protein_id gnl|my_center|LOCUS_14410 2467 4125 gene locus_tag LOCUS_14420 2467 4125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765170.1 protein_id gnl|my_center|LOCUS_14420 4345 4833 gene locus_tag LOCUS_14430 4345 4833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 8825 5922 gene locus_tag LOCUS_14440 gene rapA 8825 5922 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGL5 protein_id gnl|my_center|LOCUS_14440 10342 9302 gene locus_tag LOCUS_14450 gene galE 10342 9302 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120830.1 protein_id gnl|my_center|LOCUS_14450 10723 10382 gene locus_tag LOCUS_14460 10723 10382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 >Feature sequence071 639 184 gene locus_tag LOCUS_14470 639 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 2088 664 gene locus_tag LOCUS_14480 gene metC 2088 664 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910561.1 protein_id gnl|my_center|LOCUS_14480 3260 4165 gene locus_tag LOCUS_14490 3260 4165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 4482 4778 gene locus_tag LOCUS_14500 4482 4778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 5136 5744 gene locus_tag LOCUS_14510 5136 5744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 6346 5837 gene locus_tag LOCUS_14520 6346 5837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084789.1 protein_id gnl|my_center|LOCUS_14520 6796 7641 gene locus_tag LOCUS_14530 6796 7641 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_14530 9507 7687 gene locus_tag LOCUS_14540 9507 7687 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933466.1 protein_id gnl|my_center|LOCUS_14540 9787 9521 gene locus_tag LOCUS_14550 9787 9521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458022.1 protein_id gnl|my_center|LOCUS_14550 10290 10505 gene locus_tag LOCUS_14560 10290 10505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 >Feature sequence072 899 450 gene locus_tag LOCUS_14570 899 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 2998 902 gene locus_tag LOCUS_14580 gene ureC 2998 902 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VP0 protein_id gnl|my_center|LOCUS_14580 3297 2995 gene locus_tag LOCUS_14590 gene ureA 3297 2995 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RHM6 protein_id gnl|my_center|LOCUS_14590 4042 3311 gene locus_tag LOCUS_14600 4042 3311 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084269.1 protein_id gnl|my_center|LOCUS_14600 4867 4058 gene locus_tag LOCUS_14610 4867 4058 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972305.1 protein_id gnl|my_center|LOCUS_14610 5979 4873 gene locus_tag LOCUS_14620 5979 4873 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888238.1 protein_id gnl|my_center|LOCUS_14620 7583 6000 gene locus_tag LOCUS_14630 7583 6000 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269026.1 protein_id gnl|my_center|LOCUS_14630 9044 7782 gene locus_tag LOCUS_14640 9044 7782 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112321.1 protein_id gnl|my_center|LOCUS_14640 9902 9390 gene locus_tag LOCUS_14650 9902 9390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 >Feature sequence073 451 53 gene locus_tag LOCUS_14660 451 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 1121 483 gene locus_tag LOCUS_14670 1121 483 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812889.1 protein_id gnl|my_center|LOCUS_14670 1752 1147 gene locus_tag LOCUS_14680 gene leuD 1752 1147 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZND4 protein_id gnl|my_center|LOCUS_14680 3304 1889 gene locus_tag LOCUS_14690 gene leuC 3304 1889 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZND5 protein_id gnl|my_center|LOCUS_14690 3869 3594 gene locus_tag LOCUS_14700 gene hupA 3869 3594 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421291.1 protein_id gnl|my_center|LOCUS_14700 4222 4025 gene locus_tag LOCUS_14710 4222 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 5154 4222 gene locus_tag LOCUS_14720 5154 4222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 5268 6323 gene locus_tag LOCUS_14730 5268 6323 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KU34 protein_id gnl|my_center|LOCUS_14730 6439 7422 gene locus_tag LOCUS_14740 gene mdh 6439 7422 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4A2 protein_id gnl|my_center|LOCUS_14740 7929 8273 gene locus_tag LOCUS_tm00010 7929 8273 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 9015 9245 gene locus_tag LOCUS_14750 9015 9245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 >Feature sequence074 154 375 gene locus_tag LOCUS_14760 154 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 468 704 gene locus_tag LOCUS_14770 468 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 3739 1280 gene locus_tag LOCUS_14780 gene pheT 3739 1280 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CZ9 protein_id gnl|my_center|LOCUS_14780 4908 3868 gene locus_tag LOCUS_14790 gene pheS 4908 3868 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189P4 protein_id gnl|my_center|LOCUS_14790 5229 5918 gene locus_tag LOCUS_14800 gene truC 5229 5918 CDS product tRNA pseudouridine synthase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTL4 protein_id gnl|my_center|LOCUS_14800 6421 6056 gene locus_tag LOCUS_14810 6421 6056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 7047 6430 gene locus_tag LOCUS_14820 gene nadD 7047 6430 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725167.1 protein_id gnl|my_center|LOCUS_14820 7108 7782 gene locus_tag LOCUS_14830 7108 7782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057912.1 protein_id gnl|my_center|LOCUS_14830 7895 7822 gene locus_tag LOCUS_t00250 7895 7822 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 8078 8818 gene locus_tag LOCUS_14840 gene pyrH 8078 8818 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4L0 protein_id gnl|my_center|LOCUS_14840 8856 9413 gene locus_tag LOCUS_14850 gene frr 8856 9413 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2X9 protein_id gnl|my_center|LOCUS_14850 9496 10602 gene locus_tag LOCUS_14860 gene proB 9496 10602 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKZ7 protein_id gnl|my_center|LOCUS_14860 >Feature sequence075 1974 1018 gene locus_tag LOCUS_14870 1974 1018 CDS product abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525237.1 protein_id gnl|my_center|LOCUS_14870 2362 2619 gene locus_tag LOCUS_14880 2362 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 2707 2997 gene locus_tag LOCUS_14890 2707 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 3409 3080 gene locus_tag LOCUS_14900 3409 3080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 3914 3555 gene locus_tag LOCUS_14910 3914 3555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 4185 3916 gene locus_tag LOCUS_14920 4185 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 5013 4288 gene locus_tag LOCUS_14930 5013 4288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485360.1 protein_id gnl|my_center|LOCUS_14930 5573 5370 gene locus_tag LOCUS_14940 5573 5370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 6682 5690 gene locus_tag LOCUS_14950 6682 5690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 10183 6770 gene locus_tag LOCUS_14960 10183 6770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 >Feature sequence076 476 1252 gene locus_tag LOCUS_14970 476 1252 CDS product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582622.1 protein_id gnl|my_center|LOCUS_14970 1587 2381 gene locus_tag LOCUS_14980 gene xerC 1587 2381 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQY6 protein_id gnl|my_center|LOCUS_14980 2978 4099 gene locus_tag LOCUS_14990 gene queG 2978 4099 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CD15 protein_id gnl|my_center|LOCUS_14990 4270 5064 gene locus_tag LOCUS_15000 4270 5064 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 protein_id gnl|my_center|LOCUS_15000 5256 5771 gene locus_tag LOCUS_15010 5256 5771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 5780 7291 gene locus_tag LOCUS_15020 5780 7291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 7372 8910 gene locus_tag LOCUS_15030 gene metG 7372 8910 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AE2 protein_id gnl|my_center|LOCUS_15030 >Feature sequence077 653 165 gene locus_tag LOCUS_15040 653 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 4370 1365 gene locus_tag LOCUS_15050 4370 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 4986 4504 gene locus_tag LOCUS_15060 4986 4504 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001885245.1 protein_id gnl|my_center|LOCUS_15060 5452 5009 gene locus_tag LOCUS_15070 gene mhqR 5452 5009 CDS product HTH-type transcriptional regulator MhqR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31672 protein_id gnl|my_center|LOCUS_15070 6628 5846 gene locus_tag LOCUS_15080 6628 5846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 7018 6635 gene locus_tag LOCUS_15090 7018 6635 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546534.1 protein_id gnl|my_center|LOCUS_15090 7851 7117 gene locus_tag LOCUS_15100 gene tolQ-2 7851 7117 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940358.1 protein_id gnl|my_center|LOCUS_15100 8031 9140 gene locus_tag LOCUS_15110 8031 9140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 >Feature sequence078 4025 2055 gene locus_tag LOCUS_15120 4025 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 5512 4031 gene locus_tag LOCUS_15130 5512 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 6276 5512 gene locus_tag LOCUS_15140 6276 5512 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404002.1 protein_id gnl|my_center|LOCUS_15140 7305 6295 gene locus_tag LOCUS_15150 7305 6295 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404003.1 protein_id gnl|my_center|LOCUS_15150 7488 8651 gene locus_tag LOCUS_15160 gene rnd 7488 8651 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QV7 protein_id gnl|my_center|LOCUS_15160 >Feature sequence079 1183 836 gene locus_tag LOCUS_15170 1183 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 2924 1272 gene locus_tag LOCUS_15180 2924 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 3082 3669 gene locus_tag LOCUS_15190 3082 3669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 5648 4005 gene locus_tag LOCUS_15200 5648 4005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 6709 5666 gene locus_tag LOCUS_15210 6709 5666 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460894.1 protein_id gnl|my_center|LOCUS_15210 7500 7114 gene locus_tag LOCUS_15220 7500 7114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 7832 8770 gene locus_tag LOCUS_15230 7832 8770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 >Feature sequence080 566 2518 gene locus_tag LOCUS_15240 566 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 2515 3429 gene locus_tag LOCUS_15250 2515 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 4570 3875 gene locus_tag LOCUS_15260 4570 3875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 4952 4632 gene locus_tag LOCUS_15270 4952 4632 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224094.1 protein_id gnl|my_center|LOCUS_15270 4965 5732 gene locus_tag LOCUS_15280 gene kdsB 4965 5732 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WL5 protein_id gnl|my_center|LOCUS_15280 5765 6991 gene locus_tag LOCUS_15290 gene trpB1 5765 6991 CDS product tryptophan synthase beta chain 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66923 protein_id gnl|my_center|LOCUS_15290 7009 7572 gene locus_tag LOCUS_15300 gene trpG 7009 7572 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943018.1 protein_id gnl|my_center|LOCUS_15300 7635 8105 gene locus_tag LOCUS_15310 gene nrdR 7635 8105 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X233 protein_id gnl|my_center|LOCUS_15310 8092 8568 gene locus_tag LOCUS_15320 8092 8568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 >Feature sequence081 <1 560 gene locus_tag LOCUS_15330 <1 560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888294.1:oligopeptidase A 1295 825 gene locus_tag LOCUS_15340 gene dnaQ 1295 825 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963327.1 protein_id gnl|my_center|LOCUS_15340 1412 1684 gene locus_tag LOCUS_15350 1412 1684 CDS product antitoxin VapB33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406302.1 protein_id gnl|my_center|LOCUS_15350 1681 2112 gene locus_tag LOCUS_15360 gene vapc33 1681 2112 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3P3B5 protein_id gnl|my_center|LOCUS_15360 3002 3658 gene locus_tag LOCUS_15370 gene salX 3002 3658 CDS product lipoprotein ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184524.1 protein_id gnl|my_center|LOCUS_15370 3674 6259 gene locus_tag LOCUS_15380 3674 6259 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404082.1 protein_id gnl|my_center|LOCUS_15380 6259 7407 gene locus_tag LOCUS_15390 6259 7407 CDS product carotenoid 1,2-hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942826.1 protein_id gnl|my_center|LOCUS_15390 8012 7404 gene locus_tag LOCUS_15400 8012 7404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 8489 8118 gene locus_tag LOCUS_15410 8489 8118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 >Feature sequence082 210 503 gene locus_tag LOCUS_15420 210 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 1556 2557 gene locus_tag LOCUS_15430 gene yhaM 1556 2557 CDS product 3'-5' exoribonuclease YhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y556 protein_id gnl|my_center|LOCUS_15430 3498 2686 gene locus_tag LOCUS_15440 gene mutM 3498 2686 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZM34 protein_id gnl|my_center|LOCUS_15440 5226 3736 gene locus_tag LOCUS_15450 gene lysS 5226 3736 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HPU0 protein_id gnl|my_center|LOCUS_15450 5865 6359 gene locus_tag LOCUS_15460 5865 6359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459677.1 protein_id gnl|my_center|LOCUS_15460 8608 6356 gene locus_tag LOCUS_15470 8608 6356 CDS product heavy metal-(Cd/Co/Hg/Pb/Zn)-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003507.1 protein_id gnl|my_center|LOCUS_15470 >Feature sequence083 3422 2277 gene locus_tag LOCUS_15480 3422 2277 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529158.1 protein_id gnl|my_center|LOCUS_15480 6072 3523 gene locus_tag LOCUS_15490 gene topB 6072 3523 CDS product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MBN9 protein_id gnl|my_center|LOCUS_15490 6454 7686 gene locus_tag LOCUS_15500 gene lpxK 6454 7686 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AU2 protein_id gnl|my_center|LOCUS_15500 >Feature sequence084 805 1146 gene locus_tag LOCUS_15510 805 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 1115 2026 gene locus_tag LOCUS_15520 1115 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 2246 2560 gene locus_tag LOCUS_15530 2246 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 2630 3112 gene locus_tag LOCUS_15540 2630 3112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 5355 3307 gene locus_tag LOCUS_15550 gene ftsH 5355 3307 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHM2 protein_id gnl|my_center|LOCUS_15550 6818 5364 gene locus_tag LOCUS_15560 6818 5364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 7818 7327 gene locus_tag LOCUS_15570 7818 7327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15570 8208 7825 gene locus_tag LOCUS_15580 8208 7825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15580 >Feature sequence085 669 1664 gene locus_tag LOCUS_15590 669 1664 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525152.1 protein_id gnl|my_center|LOCUS_15590 1744 1974 gene locus_tag LOCUS_15600 1744 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 2282 2506 gene locus_tag LOCUS_15610 2282 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 2545 6564 gene locus_tag LOCUS_15620 2545 6564 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105494.1 protein_id gnl|my_center|LOCUS_15620 6856 8127 gene locus_tag LOCUS_15630 6856 8127 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962682.1 protein_id gnl|my_center|LOCUS_15630 >Feature sequence086 1027 482 gene locus_tag LOCUS_15640 1027 482 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_15640 1021 2043 gene locus_tag LOCUS_15650 gene asd 1021 2043 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q726Q8 protein_id gnl|my_center|LOCUS_15650 2784 2272 gene locus_tag LOCUS_15660 2784 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721508.1 protein_id gnl|my_center|LOCUS_15660 3270 2800 gene locus_tag LOCUS_15670 3270 2800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 4819 3278 gene locus_tag LOCUS_15680 4819 3278 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122594.1 protein_id gnl|my_center|LOCUS_15680 6766 4880 gene locus_tag LOCUS_15690 gene dxs1 6766 4880 CDS product 1-deoxy-D-xylulose-5-phosphate synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FC3 protein_id gnl|my_center|LOCUS_15690 7053 6814 gene locus_tag LOCUS_15700 7053 6814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 <8280 7154 gene locus_tag LOCUS_15710 <8280 7154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942324.1:cobyrinic acid a,c-diamide synthase >Feature sequence087 <1 609 gene locus_tag LOCUS_15720 <1 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140045.1:single-stranded-DNA-specific exonuclease RecJ 913 1671 gene locus_tag LOCUS_15730 gene pdxJ 913 1671 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKM1 protein_id gnl|my_center|LOCUS_15730 2179 3690 gene locus_tag LOCUS_15740 gene nnr 2179 3690 CDS product bifunctional NAD(P)H-hydrate repair enzyme Nnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGI2 protein_id gnl|my_center|LOCUS_15740 3891 5021 gene locus_tag LOCUS_15750 gene dprA 3891 5021 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_15750 5104 5547 gene locus_tag LOCUS_15760 5104 5547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 5639 6943 gene locus_tag LOCUS_15770 5639 6943 CDS product cellobiose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947847.1 protein_id gnl|my_center|LOCUS_15770 >Feature sequence088 1550 2437 gene locus_tag LOCUS_15780 1550 2437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15780 2706 3005 gene locus_tag LOCUS_15790 2706 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 2980 3519 gene locus_tag LOCUS_15800 2980 3519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 3722 4864 gene locus_tag LOCUS_15810 3722 4864 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073021.1 protein_id gnl|my_center|LOCUS_15810 5931 4993 gene locus_tag LOCUS_15820 5931 4993 CDS product NADH pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090845.1 protein_id gnl|my_center|LOCUS_15820 6610 6104 gene locus_tag LOCUS_15830 gene lspA 6610 6104 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBI5 protein_id gnl|my_center|LOCUS_15830 <7690 6838 gene locus_tag LOCUS_15840 <7690 6838 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P80872:general stress protein 16O >Feature sequence089 384 1049 gene locus_tag LOCUS_15850 384 1049 CDS product DtxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728504.1 protein_id gnl|my_center|LOCUS_15850 2537 1164 gene locus_tag LOCUS_15860 2537 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 3024 2560 gene locus_tag LOCUS_15870 3024 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328395.1 protein_id gnl|my_center|LOCUS_15870 3653 3204 gene locus_tag LOCUS_15880 3653 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 6839 3750 gene locus_tag LOCUS_15890 6839 3750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 >Feature sequence090 2 180 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq agttgaggctgcacctgaagttg 1205 597 gene locus_tag LOCUS_15900 1205 597 CDS product 3'-exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938381.1 protein_id gnl|my_center|LOCUS_15900 2288 1557 gene locus_tag LOCUS_15910 2288 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 4831 2720 gene locus_tag LOCUS_15920 gene parC 4831 2720 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962810.1 protein_id gnl|my_center|LOCUS_15920 5208 6953 gene locus_tag LOCUS_15930 gene pckG 5208 6953 CDS product phosphoenolpyruvate carboxykinase [GTP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Y3 protein_id gnl|my_center|LOCUS_15930 >Feature sequence091 77 1 gene locus_tag LOCUS_t00260 77 1 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 408 1382 gene locus_tag LOCUS_15940 408 1382 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080613.1 protein_id gnl|my_center|LOCUS_15940 1739 2434 gene locus_tag LOCUS_15950 gene rsuA 1739 2434 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PW18 protein_id gnl|my_center|LOCUS_15950 2746 3039 gene locus_tag LOCUS_15960 gene gatC 2746 3039 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2U4 protein_id gnl|my_center|LOCUS_15960 3208 4674 gene locus_tag LOCUS_15970 gene gatA 3208 4674 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Y7 protein_id gnl|my_center|LOCUS_15970 4853 6319 gene locus_tag LOCUS_15980 gene gatB 4853 6319 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66766 protein_id gnl|my_center|LOCUS_15980 >Feature sequence092 1181 465 gene locus_tag LOCUS_15990 1181 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 2764 1484 gene locus_tag LOCUS_16000 gene glyA 2764 1484 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFW7 protein_id gnl|my_center|LOCUS_16000 4387 2852 gene locus_tag LOCUS_16010 4387 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 5257 4478 gene locus_tag LOCUS_16020 5257 4478 CDS product stationary phase survival protein SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020163.1 protein_id gnl|my_center|LOCUS_16020 5789 5310 gene locus_tag LOCUS_16030 5789 5310 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121867.1 protein_id gnl|my_center|LOCUS_16030 <6894 5966 gene locus_tag LOCUS_16040 <6894 5966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63W00:transaldolase >Feature sequence093 1274 393 gene locus_tag LOCUS_16050 1274 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 1639 1439 gene locus_tag LOCUS_16060 1639 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 2988 1705 gene locus_tag LOCUS_16070 gene rumA 2988 1705 CDS product 23S rRNA (uracil-5-)-methyltransferase RumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546143.1 protein_id gnl|my_center|LOCUS_16070 3085 3897 gene locus_tag LOCUS_16080 3085 3897 CDS product 23S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227823.1 protein_id gnl|my_center|LOCUS_16080 5079 4087 gene locus_tag LOCUS_16090 gene cdh 5079 4087 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035475.1 protein_id gnl|my_center|LOCUS_16090 6711 5092 gene locus_tag LOCUS_16100 6711 5092 CDS product peptide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259368.1 protein_id gnl|my_center|LOCUS_16100 >Feature sequence094 2407 1376 gene locus_tag LOCUS_16110 2407 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 3441 2599 gene locus_tag LOCUS_16120 3441 2599 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403707.1 protein_id gnl|my_center|LOCUS_16120 3605 6178 gene locus_tag LOCUS_16130 gene mutS 3605 6178 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61667 protein_id gnl|my_center|LOCUS_16130 >Feature sequence095 <1 1864 gene locus_tag LOCUS_16140 <1 1864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391892.1:DNA topoisomerase 2669 2082 gene locus_tag LOCUS_16150 2669 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 4465 4058 gene locus_tag LOCUS_16160 4465 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 5024 4605 gene locus_tag LOCUS_16170 5024 4605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 6560 5061 gene locus_tag LOCUS_16180 6560 5061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 >Feature sequence096 27 962 gene locus_tag LOCUS_16190 27 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 1126 2334 gene locus_tag LOCUS_16200 1126 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 3264 2578 gene locus_tag LOCUS_16210 gene queE 3264 2578 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1N2 protein_id gnl|my_center|LOCUS_16210 3841 3410 gene locus_tag LOCUS_16220 3841 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 4592 3891 gene locus_tag LOCUS_16230 4592 3891 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877949.1 protein_id gnl|my_center|LOCUS_16230 4972 6222 gene locus_tag LOCUS_16240 gene nusA 4972 6222 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJM8 protein_id gnl|my_center|LOCUS_16240 >Feature sequence097 131 12 gene locus_tag LOCUS_16250 131 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 651 166 gene locus_tag LOCUS_16260 651 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 760 3312 gene locus_tag LOCUS_16270 gene gyrB 760 3312 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O84193 protein_id gnl|my_center|LOCUS_16270 3429 5993 gene locus_tag LOCUS_16280 3429 5993 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021593.1 protein_id gnl|my_center|LOCUS_16280 >Feature sequence098 1065 58 gene locus_tag LOCUS_16290 1065 58 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89S35 protein_id gnl|my_center|LOCUS_16290 1341 1144 gene locus_tag LOCUS_16300 1341 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 3567 1441 gene locus_tag LOCUS_16310 3567 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 3674 3748 gene locus_tag LOCUS_t00270 3674 3748 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4160 4462 gene locus_tag LOCUS_16320 4160 4462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 4571 6007 gene locus_tag LOCUS_16330 4571 6007 CDS product UDP-N-acetylhexosamine pyrophosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 protein_id gnl|my_center|LOCUS_16330 >Feature sequence099 1427 924 gene locus_tag LOCUS_16340 1427 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 3248 1551 gene locus_tag LOCUS_16350 3248 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 4431 4072 gene locus_tag LOCUS_16360 4431 4072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16360 5025 4438 gene locus_tag LOCUS_16370 5025 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16370 5126 5515 gene locus_tag LOCUS_16380 5126 5515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16380 5482 6123 gene locus_tag LOCUS_16390 5482 6123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16390 6190 6465 gene locus_tag LOCUS_16400 6190 6465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16400 >Feature sequence100 1671 367 gene locus_tag LOCUS_16410 gene xylA 1671 367 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVG2 protein_id gnl|my_center|LOCUS_16410 1803 2963 gene locus_tag LOCUS_16420 1803 2963 CDS product XylR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120976.1 protein_id gnl|my_center|LOCUS_16420 3096 3371 gene locus_tag LOCUS_16430 3096 3371 CDS product DUF493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964112.1 protein_id gnl|my_center|LOCUS_16430 3420 4058 gene locus_tag LOCUS_16440 gene msrA 3420 4058 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3M7 protein_id gnl|my_center|LOCUS_16440 4089 5105 gene locus_tag LOCUS_16450 4089 5105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 5332 5934 gene locus_tag LOCUS_16460 5332 5934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121979.1 protein_id gnl|my_center|LOCUS_16460 >Feature sequence101 1500 985 gene locus_tag LOCUS_16470 gene aroK 1500 985 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FAD3 protein_id gnl|my_center|LOCUS_16470 1790 2233 gene locus_tag LOCUS_16480 1790 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878603.1 protein_id gnl|my_center|LOCUS_16480 2370 3377 gene locus_tag LOCUS_16490 2370 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 3754 4947 gene locus_tag LOCUS_16500 gene sucC 3754 4947 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV33 protein_id gnl|my_center|LOCUS_16500 4982 5866 gene locus_tag LOCUS_16510 gene sucD 4982 5866 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P677 protein_id gnl|my_center|LOCUS_16510 >Feature sequence102 1029 226 gene locus_tag LOCUS_16520 1029 226 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659770.1 protein_id gnl|my_center|LOCUS_16520 1334 1840 gene locus_tag LOCUS_16530 gene spoU 1334 1840 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222738.1 protein_id gnl|my_center|LOCUS_16530 1990 2235 gene locus_tag LOCUS_16540 1990 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 2719 2447 gene locus_tag LOCUS_16550 gene yoaB 2719 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262907.1 protein_id gnl|my_center|LOCUS_16550 3027 3254 gene locus_tag LOCUS_16560 3027 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 4027 4524 gene locus_tag LOCUS_16570 4027 4524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 4545 5471 gene locus_tag LOCUS_16580 4545 5471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 5718 5542 gene locus_tag LOCUS_16590 5718 5542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 6104 5862 gene locus_tag LOCUS_16600 6104 5862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 >Feature sequence103 760 2358 gene locus_tag LOCUS_16610 760 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 2355 3182 gene locus_tag LOCUS_16620 2355 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 3185 3709 gene locus_tag LOCUS_16630 3185 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 3761 4015 gene locus_tag LOCUS_16640 3761 4015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 4118 5215 gene locus_tag LOCUS_16650 gene rsgA 4118 5215 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81EH2 protein_id gnl|my_center|LOCUS_16650 5919 5224 gene locus_tag LOCUS_16660 5919 5224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119745.1 protein_id gnl|my_center|LOCUS_16660 >Feature sequence104 1997 858 gene locus_tag LOCUS_16670 1997 858 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256219.1 protein_id gnl|my_center|LOCUS_16670 2356 2742 gene locus_tag LOCUS_16680 2356 2742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 2749 3591 gene locus_tag LOCUS_16690 2749 3591 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 protein_id gnl|my_center|LOCUS_16690 3607 3843 gene locus_tag LOCUS_16700 3607 3843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 4217 3840 gene locus_tag LOCUS_16710 4217 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962885.1 protein_id gnl|my_center|LOCUS_16710 4531 4944 gene locus_tag LOCUS_16720 4531 4944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 5414 5067 gene locus_tag LOCUS_16730 5414 5067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 >Feature sequence105 1088 534 gene locus_tag LOCUS_16740 1088 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 1747 1115 gene locus_tag LOCUS_16750 gene sigE 1747 1115 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MGI0 protein_id gnl|my_center|LOCUS_16750 1953 3191 gene locus_tag LOCUS_16760 gene fabF 1953 3191 CDS product beta-ketoacyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118441.1 protein_id gnl|my_center|LOCUS_16760 3228 3476 gene locus_tag LOCUS_16770 3228 3476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 3645 5066 gene locus_tag LOCUS_16780 gene crtI 3645 5066 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118443.1 protein_id gnl|my_center|LOCUS_16780 5396 5067 gene locus_tag LOCUS_16790 5396 5067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 6094 5756 gene locus_tag LOCUS_16800 6094 5756 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_16800 >Feature sequence106 <1 839 gene locus_tag LOCUS_16810 <1 839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545308.1:biotin--[acetyl-CoA-carboxylase] ligase 932 1699 gene locus_tag LOCUS_16820 gene coaX 932 1699 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8YAC5 protein_id gnl|my_center|LOCUS_16820 2656 1784 gene locus_tag LOCUS_16830 gene prmC 2656 1784 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748B2 protein_id gnl|my_center|LOCUS_16830 3969 2878 gene locus_tag LOCUS_16840 gene prfA 3969 2878 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B9V1 protein_id gnl|my_center|LOCUS_16840 4566 5024 gene locus_tag LOCUS_16850 4566 5024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 5130 5360 gene locus_tag LOCUS_16860 gene phd 5130 5360 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923260.1 protein_id gnl|my_center|LOCUS_16860 5357 5743 gene locus_tag LOCUS_16870 5357 5743 CDS product death-on-curing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387746.1 protein_id gnl|my_center|LOCUS_16870 >Feature sequence107 756 683 gene locus_tag LOCUS_t00280 756 683 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1392 949 gene locus_tag LOCUS_16880 1392 949 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83A17 protein_id gnl|my_center|LOCUS_16880 2553 1486 gene locus_tag LOCUS_16890 gene manC 2553 1486 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120825.1 protein_id gnl|my_center|LOCUS_16890 2764 3780 gene locus_tag LOCUS_16900 2764 3780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 4617 4024 gene locus_tag LOCUS_16910 gene tsf 4617 4024 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61333 protein_id gnl|my_center|LOCUS_16910 5480 4674 gene locus_tag LOCUS_16920 gene rpsB 5480 4674 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MDF2 protein_id gnl|my_center|LOCUS_16920 >Feature sequence108 725 567 gene locus_tag LOCUS_16930 725 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 959 1183 gene locus_tag LOCUS_16940 959 1183 CDS product iron transporter FeoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545730.1 protein_id gnl|my_center|LOCUS_16940 1185 3371 gene locus_tag LOCUS_16950 gene feoB-2 1185 3371 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747J7 protein_id gnl|my_center|LOCUS_16950 3766 4221 gene locus_tag LOCUS_16960 3766 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 5510 4356 gene locus_tag LOCUS_16970 5510 4356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 >Feature sequence109 129 1142 gene locus_tag LOCUS_16980 gene mtsA 129 1142 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123738.1 protein_id gnl|my_center|LOCUS_16980 1330 2139 gene locus_tag LOCUS_16990 gene mntA 1330 2139 CDS product manganese ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325374.1 protein_id gnl|my_center|LOCUS_16990 2295 3650 gene locus_tag LOCUS_17000 gene mntB 2295 3650 CDS product manganese ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123736.1 protein_id gnl|my_center|LOCUS_17000 3857 4798 gene locus_tag LOCUS_17010 3857 4798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 4861 5553 gene locus_tag LOCUS_17020 4861 5553 CDS product UPF0502 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GL3 protein_id gnl|my_center|LOCUS_17020 >Feature sequence110 1841 939 gene locus_tag LOCUS_17030 1841 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 3253 1838 gene locus_tag LOCUS_17040 3253 1838 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919304.1 protein_id gnl|my_center|LOCUS_17040 3435 3971 gene locus_tag LOCUS_17050 gene drga 3435 3971 CDS product reductase DrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123320.1 protein_id gnl|my_center|LOCUS_17050 <5732 4138 gene locus_tag LOCUS_17060 <5732 4138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001104219.1:phosphoglucomutase >Feature sequence111 552 941 gene locus_tag LOCUS_17070 552 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 1066 1773 gene locus_tag LOCUS_17080 1066 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 1760 3151 gene locus_tag LOCUS_17090 1760 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 4845 3799 gene locus_tag LOCUS_17100 gene ruvB 4845 3799 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3F9 protein_id gnl|my_center|LOCUS_17100 <5513 4985 gene locus_tag LOCUS_17110 <5513 4985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962362.1:NAD metabolism ATPase/kinase >Feature sequence112 693 1619 gene locus_tag LOCUS_17120 693 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 1799 2026 gene locus_tag LOCUS_17130 1799 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 2200 3324 gene locus_tag LOCUS_17140 2200 3324 CDS product putative 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PMZ6 protein_id gnl|my_center|LOCUS_17140 3375 3605 gene locus_tag LOCUS_17150 3375 3605 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775528.1 protein_id gnl|my_center|LOCUS_17150 3608 4345 gene locus_tag LOCUS_17160 3608 4345 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103768.1 protein_id gnl|my_center|LOCUS_17160 4371 5003 gene locus_tag LOCUS_17170 4371 5003 CDS product transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382700.1 protein_id gnl|my_center|LOCUS_17170 >Feature sequence113 398 1036 gene locus_tag LOCUS_17180 398 1036 CDS product phosphatidylethanolamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820605.1 protein_id gnl|my_center|LOCUS_17180 1948 1337 gene locus_tag LOCUS_17190 1948 1337 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140820.1 protein_id gnl|my_center|LOCUS_17190 2203 3726 gene locus_tag LOCUS_17200 gene ilvA 2203 3726 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CL02 protein_id gnl|my_center|LOCUS_17200 3741 4691 gene locus_tag LOCUS_17210 3741 4691 CDS product malate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119988.1 protein_id gnl|my_center|LOCUS_17210 >Feature sequence114 792 1499 gene locus_tag LOCUS_17220 792 1499 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256816.1 protein_id gnl|my_center|LOCUS_17220 1784 2707 gene locus_tag LOCUS_17230 gene aroE 1784 2707 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RI72 protein_id gnl|my_center|LOCUS_17230 2700 3617 gene locus_tag LOCUS_17240 gene pilD 2700 3617 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BJ8 protein_id gnl|my_center|LOCUS_17240 3644 4498 gene locus_tag LOCUS_17250 3644 4498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 >Feature sequence115 <1 2031 gene locus_tag LOCUS_17260 <1 2031 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072436.1:TonB-dependent receptor 2326 2072 gene locus_tag LOCUS_17270 2326 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 2584 2513 gene locus_tag LOCUS_t00290 2584 2513 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3056 2972 gene locus_tag LOCUS_t00300 3056 2972 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence116 169 2406 gene locus_tag LOCUS_17280 169 2406 CDS product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147064.1 protein_id gnl|my_center|LOCUS_17280 2670 2969 gene locus_tag LOCUS_17290 2670 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 3129 3251 gene locus_tag LOCUS_17300 3129 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 3294 4046 gene locus_tag LOCUS_17310 3294 4046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17310 >Feature sequence117 761 162 gene locus_tag LOCUS_17320 gene ruvA 761 162 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XZE4 protein_id gnl|my_center|LOCUS_17320 1517 780 gene locus_tag LOCUS_17330 gene dapB 1517 780 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GT5 protein_id gnl|my_center|LOCUS_17330 2432 1542 gene locus_tag LOCUS_17340 gene dapA 2432 1542 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AX2 protein_id gnl|my_center|LOCUS_17340 2919 4136 gene locus_tag LOCUS_17350 2919 4136 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267685.1 protein_id gnl|my_center|LOCUS_17350 >Feature sequence118 907 233 gene locus_tag LOCUS_17360 907 233 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529371.1 protein_id gnl|my_center|LOCUS_17360 2059 965 gene locus_tag LOCUS_17370 gene rluD 2059 965 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I3U1T3 protein_id gnl|my_center|LOCUS_17370 2413 2231 gene locus_tag LOCUS_17380 2413 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 2611 4011 gene locus_tag LOCUS_17390 2611 4011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 >Feature sequence119 496 711 gene locus_tag LOCUS_17400 496 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 1554 1099 gene locus_tag LOCUS_17410 gene fucU 1554 1099 CDS product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z427 protein_id gnl|my_center|LOCUS_17410 3485 1701 gene locus_tag LOCUS_17420 gene fucI 3485 1701 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RQ13 protein_id gnl|my_center|LOCUS_17420 >Feature sequence120 2232 754 gene locus_tag LOCUS_17430 gene der 2232 754 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4V0 protein_id gnl|my_center|LOCUS_17430 3695 2520 gene locus_tag LOCUS_17440 gene yugH 3695 2520 CDS product putative aminotransferase YugH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q795M6 protein_id gnl|my_center|LOCUS_17440 4177 3695 gene locus_tag LOCUS_17450 4177 3695 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255696.1 protein_id gnl|my_center|LOCUS_17450 >Feature sequence121 106 1524 gene locus_tag LOCUS_17460 106 1524 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142772.1 protein_id gnl|my_center|LOCUS_17460 2739 1822 gene locus_tag LOCUS_17470 2739 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 3426 2764 gene locus_tag LOCUS_17480 3426 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 4182 3499 gene locus_tag LOCUS_17490 4182 3499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 >Feature sequence122 919 1338 gene locus_tag LOCUS_17500 919 1338 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876267.1 protein_id gnl|my_center|LOCUS_17500 2962 1892 gene locus_tag LOCUS_17510 2962 1892 CDS product sugar:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762702.1 protein_id gnl|my_center|LOCUS_17510 3863 3117 gene locus_tag LOCUS_17520 3863 3117 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583927.1 protein_id gnl|my_center|LOCUS_17520 >Feature sequence123 923 123 gene locus_tag LOCUS_17530 gene tolQ 923 123 CDS product biopolymer transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668013.1 protein_id gnl|my_center|LOCUS_17530 2097 982 gene locus_tag LOCUS_17540 2097 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 >Feature sequence124 1513 218 gene locus_tag LOCUS_17550 gene murA 1513 218 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K1Q9 protein_id gnl|my_center|LOCUS_17550 2476 1535 gene locus_tag LOCUS_17560 2476 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 3612 2884 gene locus_tag LOCUS_17570 3612 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 >Feature sequence125 2667 196 gene locus_tag LOCUS_17580 gene rnr 2667 196 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32231 protein_id gnl|my_center|LOCUS_17580 2859 2784 gene locus_tag LOCUS_t00310 2859 2784 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence126 1879 308 gene locus_tag LOCUS_17590 1879 308 CDS product potassium transporter CPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404997.1 protein_id gnl|my_center|LOCUS_17590 3516 1876 gene locus_tag LOCUS_17600 3516 1876 CDS product potassium efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404996.1 protein_id gnl|my_center|LOCUS_17600 >Feature sequence127 1276 899 gene locus_tag LOCUS_17610 1276 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760643.1 protein_id gnl|my_center|LOCUS_17610 2020 1457 gene locus_tag LOCUS_17620 gene gmhA 2020 1457 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCW2 protein_id gnl|my_center|LOCUS_17620 2560 2063 gene locus_tag LOCUS_17630 2560 2063 CDS product ADP-heptose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258042.1 protein_id gnl|my_center|LOCUS_17630 2961 2569 gene locus_tag LOCUS_17640 2961 2569 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143787.1 protein_id gnl|my_center|LOCUS_17640 3191 2958 gene locus_tag LOCUS_17650 3191 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 >Feature sequence128 1133 192 gene locus_tag LOCUS_17660 gene uxs 1133 192 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942460.1 protein_id gnl|my_center|LOCUS_17660 >Feature sequence129 1092 85 gene locus_tag LOCUS_17670 1092 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 1672 1229 gene locus_tag LOCUS_17680 gene yqdE 1672 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882790.1 protein_id gnl|my_center|LOCUS_17680 1963 2463 gene locus_tag LOCUS_17690 gene aroK 1963 2463 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FAD3 protein_id gnl|my_center|LOCUS_17690 >Feature sequence130 1490 480 gene locus_tag LOCUS_17700 1490 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 2456 1527 gene locus_tag LOCUS_17710 2456 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 2749 3171 gene locus_tag LOCUS_17720 2749 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 >Feature sequence131 <1 897 gene locus_tag LOCUS_17730 <1 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222654.1:xylulokinase 1103 1178 gene locus_tag LOCUS_t00320 1103 1178 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2921 1557 gene locus_tag LOCUS_17740 gene avtA 2921 1557 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704054.1 protein_id gnl|my_center|LOCUS_17740 >Feature sequence132 1182 202 gene locus_tag LOCUS_17750 1182 202 CDS product oxidoreductase/dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_602267.1 protein_id gnl|my_center|LOCUS_17750 >Feature sequence133 560 1153 gene locus_tag LOCUS_17760 gene ribB 560 1153 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130990.1 protein_id gnl|my_center|LOCUS_17760 1963 1307 gene locus_tag LOCUS_17770 1963 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 2514 2080 gene locus_tag LOCUS_17780 gene arsC 2514 2080 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933387.1 protein_id gnl|my_center|LOCUS_17780 >Feature sequence134 300 70 gene locus_tag LOCUS_17790 300 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 501 2060 gene locus_tag LOCUS_17800 501 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 <3388 2361 gene locus_tag LOCUS_17810 <3388 2361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764988.1:MFS transporter >Feature sequence135 1920 313 gene locus_tag LOCUS_17820 1920 313 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962990.1 protein_id gnl|my_center|LOCUS_17820 3012 2194 gene locus_tag LOCUS_17830 3012 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 3290 3364 gene locus_tag LOCUS_t00330 3290 3364 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence136 73 303 gene locus_tag LOCUS_17840 73 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 300 620 gene locus_tag LOCUS_17850 300 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 951 1508 gene locus_tag LOCUS_17860 951 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 >Feature sequence137 2048 231 gene locus_tag LOCUS_17870 2048 231 CDS product sodium:sulfate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003705.1 protein_id gnl|my_center|LOCUS_17870 2872 2051 gene locus_tag LOCUS_17880 2872 2051 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525137.1 protein_id gnl|my_center|LOCUS_17880 >Feature sequence138 1038 46 gene locus_tag LOCUS_17890 1038 46 CDS product ADP-L-glycero-D-manno-heptose-6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3S4 protein_id gnl|my_center|LOCUS_17890 1476 1279 gene locus_tag LOCUS_17900 1476 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 2092 1508 gene locus_tag LOCUS_17910 2092 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 2999 2160 gene locus_tag LOCUS_17920 gene rfaP 2999 2160 CDS product lipopolysaccharide core heptose(I) kinase RfaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUF7 protein_id gnl|my_center|LOCUS_17920 >Feature sequence139 1823 1434 gene locus_tag LOCUS_17930 1823 1434 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143544.1 protein_id gnl|my_center|LOCUS_17930 2059 1820 gene locus_tag LOCUS_17940 2059 1820 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KRZ3 protein_id gnl|my_center|LOCUS_17940 <3090 2112 gene locus_tag LOCUS_17950 <3090 2112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583708.1:glutamine--scyllo-inositol aminotransferase >Feature sequence140 116 574 gene locus_tag LOCUS_17960 116 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 667 1950 gene locus_tag LOCUS_17970 gene pfk 667 1950 CDS product pyrophosphate--fructose 6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UES2 protein_id gnl|my_center|LOCUS_17970 >Feature sequence141 1025 216 gene locus_tag LOCUS_17980 1025 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 1178 2461 gene locus_tag LOCUS_17990 1178 2461 CDS product type II secretion system protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465194.1 protein_id gnl|my_center|LOCUS_17990 >Feature sequence142 335 973 gene locus_tag LOCUS_18000 335 973 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393180.1 protein_id gnl|my_center|LOCUS_18000 970 2085 gene locus_tag LOCUS_18010 970 2085 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK07 protein_id gnl|my_center|LOCUS_18010 2112 2711 gene locus_tag LOCUS_18020 gene rdgB 2112 2711 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3D3 protein_id gnl|my_center|LOCUS_18020 >Feature sequence143 2524 380 gene locus_tag LOCUS_18030 2524 380 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072660.1 protein_id gnl|my_center|LOCUS_18030 >Feature sequence144 2353 1130 gene locus_tag LOCUS_18040 2353 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 >Feature sequence145 277 783 gene locus_tag LOCUS_18050 277 783 CDS product putative tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHA9 protein_id gnl|my_center|LOCUS_18050 1242 883 gene locus_tag LOCUS_18060 1242 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 1471 2151 gene locus_tag LOCUS_18070 gene llrD 1471 2151 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131402.1 protein_id gnl|my_center|LOCUS_18070 2505 2431 gene locus_tag LOCUS_t00340 2505 2431 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence146 >Feature sequence147 239 2089 gene locus_tag LOCUS_18080 gene thrS 239 2089 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYT8 protein_id gnl|my_center|LOCUS_18080 >Feature sequence148 1387 2352 gene locus_tag LOCUS_18090 1387 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 >Feature sequence149 55 1335 gene locus_tag LOCUS_18100 55 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327912.1 protein_id gnl|my_center|LOCUS_18100 >Feature sequence150 <1 2316 gene locus_tag LOCUS_18110 <1 2316 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403352.1:tungsten formylmethanofuran dehydrogenase subunit E >Feature sequence151 414 1097 gene locus_tag LOCUS_18120 414 1097 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_18120 >Feature sequence152 1811 1116 gene locus_tag LOCUS_18130 1811 1116 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339011.1 protein_id gnl|my_center|LOCUS_18130 2104 1808 gene locus_tag LOCUS_18140 2104 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 >Feature sequence153 384 1934 gene locus_tag LOCUS_18150 384 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 >Feature sequence154 590 2179 gene locus_tag LOCUS_18160 590 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942511.1 protein_id gnl|my_center|LOCUS_18160 >Feature sequence155 1005 409 gene locus_tag LOCUS_18170 1005 409 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869609.1 protein_id gnl|my_center|LOCUS_18170 1119 1937 gene locus_tag LOCUS_18180 1119 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 2106 2188 gene locus_tag LOCUS_t00350 2106 2188 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence156 <1 1050 gene locus_tag LOCUS_18190 <1 1050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q819N3:cytochrome c oxidase subunit 1 1097 1699 gene locus_tag LOCUS_18200 gene qoxC 1097 1699 CDS product quinol oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P34958 protein_id gnl|my_center|LOCUS_18200 1711 2052 gene locus_tag LOCUS_18210 1711 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 >Feature sequence157 1990 896 gene locus_tag LOCUS_18220 1990 896 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460676.1 protein_id gnl|my_center|LOCUS_18220 >Feature sequence158 68 925 gene locus_tag LOCUS_18230 68 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 959 1843 gene locus_tag LOCUS_18240 gene garR 959 1843 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229027.1 protein_id gnl|my_center|LOCUS_18240 >Feature sequence159 >Feature sequence160 531 770 gene locus_tag LOCUS_18250 531 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 >Feature sequence161 <1 1099 gene locus_tag LOCUS_18260 <1 1099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939521.1:RNA-binding transcriptional accessory protein <2038 1189 gene locus_tag LOCUS_18270 <2038 1189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9A7J2:dihydrolipoyl dehydrogenase >Feature sequence162 371 1669 gene locus_tag LOCUS_18280 371 1669 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RTF6 protein_id gnl|my_center|LOCUS_18280 >Feature sequence163 <1 1118 gene locus_tag LOCUS_18290 <1 1118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389780.1:cysteine desulfurase >Feature sequence164 1251 211 gene locus_tag LOCUS_18300 1251 211 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256222.1 protein_id gnl|my_center|LOCUS_18300 <1855 1248 gene locus_tag LOCUS_18310 <1855 1248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256221.1:iron ABC transporter >Feature sequence165 631 314 gene locus_tag LOCUS_18320 631 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 1843 698 gene locus_tag LOCUS_18330 1843 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 >Feature sequence166 3 320 gene locus_tag LOCUS_18340 3 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 344 1459 gene locus_tag LOCUS_18350 344 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 >Feature sequence167 489 1457 gene locus_tag LOCUS_18360 489 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 >Feature sequence168 623 1144 gene locus_tag LOCUS_18370 623 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 >Feature sequence169 471 833 gene locus_tag LOCUS_18380 471 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 >Feature sequence170 <1604 668 gene locus_tag LOCUS_18390 <1604 668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021862.1:2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinone hydroxylase >Feature sequence171 >Feature sequence172 <1 726 gene locus_tag LOCUS_18400 <1 726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P52329:RNA polymerase sigma factor SigA 767 1171 gene locus_tag LOCUS_18410 767 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 >Feature sequence173