>Feature sequence001 1564 164 gene locus_tag LOCUS_00010 gene rtcB 1564 164 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RX85 protein_id gnl|my_center|LOCUS_00010 2388 1570 gene locus_tag LOCUS_00020 2388 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00020 2836 4437 gene locus_tag LOCUS_00030 gene rtcR 2836 4437 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112813.1 protein_id gnl|my_center|LOCUS_00030 4678 6234 gene locus_tag LOCUS_00040 4678 6234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 6356 6586 gene locus_tag LOCUS_00050 gene phd 6356 6586 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923260.1 protein_id gnl|my_center|LOCUS_00050 6583 6969 gene locus_tag LOCUS_00060 gene doc 6583 6969 CDS product death-on-curing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921192.1 protein_id gnl|my_center|LOCUS_00060 7264 8769 gene locus_tag LOCUS_00070 gene gndA 7264 8769 CDS product 6-phosphogluconate dehydrogenase, NADP(+)-dependent, decarboxylating inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80859 protein_id gnl|my_center|LOCUS_00070 8973 9704 gene locus_tag LOCUS_00080 8973 9704 CDS product glutathione amide-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465158.1 protein_id gnl|my_center|LOCUS_00080 10126 9818 gene locus_tag LOCUS_00090 10126 9818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 11037 10147 gene locus_tag LOCUS_00100 11037 10147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 12348 11221 gene locus_tag LOCUS_00110 gene dnaN 12348 11221 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H91 protein_id gnl|my_center|LOCUS_00110 13462 12593 gene locus_tag LOCUS_00120 gene pssA-1 13462 12593 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770492.1 protein_id gnl|my_center|LOCUS_00120 13844 13476 gene locus_tag LOCUS_00130 13844 13476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 13934 14326 gene locus_tag LOCUS_00140 13934 14326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 14323 16080 gene locus_tag LOCUS_00150 14323 16080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 16110 16472 gene locus_tag LOCUS_00160 16110 16472 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087359.1 protein_id gnl|my_center|LOCUS_00160 17863 16469 gene locus_tag LOCUS_00170 gene miaB 17863 16469 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P2L3 protein_id gnl|my_center|LOCUS_00170 18009 18572 gene locus_tag LOCUS_00180 18009 18572 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893527.1 protein_id gnl|my_center|LOCUS_00180 18771 19298 gene locus_tag LOCUS_00190 18771 19298 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948056.1 protein_id gnl|my_center|LOCUS_00190 19311 19838 gene locus_tag LOCUS_00200 gene ahpD 19311 19838 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ANL0 protein_id gnl|my_center|LOCUS_00200 19981 20391 gene locus_tag LOCUS_00210 19981 20391 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056985.1 protein_id gnl|my_center|LOCUS_00210 21872 20460 gene locus_tag LOCUS_00220 21872 20460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 22165 22001 gene locus_tag LOCUS_00230 22165 22001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 22843 22190 gene locus_tag LOCUS_00240 22843 22190 CDS product putative phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705604.1 protein_id gnl|my_center|LOCUS_00240 23257 22844 gene locus_tag LOCUS_00250 23257 22844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 23800 23261 gene locus_tag LOCUS_00260 23800 23261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 23861 24934 gene locus_tag LOCUS_00270 gene recA 23861 24934 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58254 protein_id gnl|my_center|LOCUS_00270 26161 27363 gene locus_tag LOCUS_00280 gene mnmE 26161 27363 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YLC5 protein_id gnl|my_center|LOCUS_00280 27360 29243 gene locus_tag LOCUS_00290 gene mnmG 27360 29243 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Q4 protein_id gnl|my_center|LOCUS_00290 >Feature sequence002 <1 565 gene locus_tag LOCUS_00300 <1 565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938460.1:MFS transporter 1407 4388 gene locus_tag LOCUS_00310 1407 4388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 5122 4613 gene locus_tag LOCUS_00320 5122 4613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 5259 6101 gene locus_tag LOCUS_00330 5259 6101 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_00330 6153 6878 gene locus_tag LOCUS_00340 6153 6878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 8745 6922 gene locus_tag LOCUS_00350 8745 6922 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933466.1 protein_id gnl|my_center|LOCUS_00350 9025 8759 gene locus_tag LOCUS_00360 9025 8759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458022.1 protein_id gnl|my_center|LOCUS_00360 10342 9071 gene locus_tag LOCUS_00370 gene lysA 10342 9071 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190627.1 protein_id gnl|my_center|LOCUS_00370 10553 11335 gene locus_tag LOCUS_00380 10553 11335 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPC2 protein_id gnl|my_center|LOCUS_00380 11931 11596 gene locus_tag LOCUS_00390 11931 11596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 12751 11999 gene locus_tag LOCUS_00400 12751 11999 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227864.1 protein_id gnl|my_center|LOCUS_00400 13546 12905 gene locus_tag LOCUS_00410 gene pdxH 13546 12905 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KI46 protein_id gnl|my_center|LOCUS_00410 14566 13640 gene locus_tag LOCUS_00420 gene trxB 14566 13640 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R7I9 protein_id gnl|my_center|LOCUS_00420 14919 16130 gene locus_tag LOCUS_00430 14919 16130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 16229 17026 gene locus_tag LOCUS_00440 16229 17026 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705042.1 protein_id gnl|my_center|LOCUS_00440 17033 18292 gene locus_tag LOCUS_00450 17033 18292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 18920 18381 gene locus_tag LOCUS_00460 18920 18381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 19027 19818 gene locus_tag LOCUS_00470 gene kdsA 19027 19818 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66496 protein_id gnl|my_center|LOCUS_00470 19929 20486 gene locus_tag LOCUS_00480 19929 20486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 21114 20638 gene locus_tag LOCUS_00490 gene eco 21114 20638 CDS product ecotin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FYX7 protein_id gnl|my_center|LOCUS_00490 >Feature sequence003 372 446 gene locus_tag LOCUS_t00010 372 446 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 545 790 gene locus_tag LOCUS_00500 545 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 996 1469 gene locus_tag LOCUS_00510 996 1469 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03AV9 protein_id gnl|my_center|LOCUS_00510 1723 2250 gene locus_tag LOCUS_00520 1723 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 2832 2257 gene locus_tag LOCUS_00530 2832 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 3208 2843 gene locus_tag LOCUS_00540 3208 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 3666 5852 gene locus_tag LOCUS_00550 3666 5852 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072660.1 protein_id gnl|my_center|LOCUS_00550 6970 6083 gene locus_tag LOCUS_00560 6970 6083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 7956 7042 gene locus_tag LOCUS_00570 7956 7042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 8042 8269 gene locus_tag LOCUS_00580 8042 8269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 8381 8875 gene locus_tag LOCUS_00590 8381 8875 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932013.1 protein_id gnl|my_center|LOCUS_00590 11112 8872 gene locus_tag LOCUS_00600 11112 8872 CDS product heavy metal-(Cd/Co/Hg/Pb/Zn)-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003507.1 protein_id gnl|my_center|LOCUS_00600 12161 11469 gene locus_tag LOCUS_00610 12161 11469 CDS product UPF0502 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GL3 protein_id gnl|my_center|LOCUS_00610 13334 12393 gene locus_tag LOCUS_00620 13334 12393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 14749 13394 gene locus_tag LOCUS_00630 gene mntB 14749 13394 CDS product manganese ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123736.1 protein_id gnl|my_center|LOCUS_00630 15660 14851 gene locus_tag LOCUS_00640 gene mntA 15660 14851 CDS product manganese ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325374.1 protein_id gnl|my_center|LOCUS_00640 16693 15680 gene locus_tag LOCUS_00650 gene mtsA 16693 15680 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123738.1 protein_id gnl|my_center|LOCUS_00650 16960 17442 gene locus_tag LOCUS_00660 16960 17442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 19557 17506 gene locus_tag LOCUS_00670 gene ftsH 19557 17506 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CS60 protein_id gnl|my_center|LOCUS_00670 21021 19567 gene locus_tag LOCUS_00680 gene tilS 21021 19567 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1V1 protein_id gnl|my_center|LOCUS_00680 >Feature sequence004 676 1590 gene locus_tag LOCUS_00690 676 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 1612 2907 gene locus_tag LOCUS_00700 gene murA 1612 2907 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83DI0 protein_id gnl|my_center|LOCUS_00700 3495 3031 gene locus_tag LOCUS_00710 3495 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 protein_id gnl|my_center|LOCUS_00710 3586 4503 gene locus_tag LOCUS_00720 gene desC 3586 4503 CDS product delta 9 acyl-lipid fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036524.1 protein_id gnl|my_center|LOCUS_00720 4496 5284 gene locus_tag LOCUS_00730 4496 5284 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036519.1 protein_id gnl|my_center|LOCUS_00730 5326 6495 gene locus_tag LOCUS_00740 5326 6495 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096717.1 protein_id gnl|my_center|LOCUS_00740 6814 6539 gene locus_tag LOCUS_00750 6814 6539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 7420 6827 gene locus_tag LOCUS_00760 7420 6827 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091628.1 protein_id gnl|my_center|LOCUS_00760 8278 7526 gene locus_tag LOCUS_00770 8278 7526 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338709.1 protein_id gnl|my_center|LOCUS_00770 9630 8323 gene locus_tag LOCUS_00780 9630 8323 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266740.1 protein_id gnl|my_center|LOCUS_00780 9805 10326 gene locus_tag LOCUS_00790 9805 10326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 11651 10389 gene locus_tag LOCUS_00800 gene pfp 11651 10389 CDS product pyrophosphate--fructose 6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJ41 protein_id gnl|my_center|LOCUS_00800 13143 11719 gene locus_tag LOCUS_00810 13143 11719 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MHW2 protein_id gnl|my_center|LOCUS_00810 13790 13329 gene locus_tag LOCUS_00820 13790 13329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 13981 13787 gene locus_tag LOCUS_00830 13981 13787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 14918 13956 gene locus_tag LOCUS_00840 14918 13956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 15965 14925 gene locus_tag LOCUS_00850 15965 14925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00850 16713 16231 gene locus_tag LOCUS_00860 16713 16231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 17157 16819 gene locus_tag LOCUS_00870 17157 16819 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_00870 17801 17325 gene locus_tag LOCUS_00880 17801 17325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 18258 17788 gene locus_tag LOCUS_00890 gene nrdR 18258 17788 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X233 protein_id gnl|my_center|LOCUS_00890 18869 18306 gene locus_tag LOCUS_00900 gene trpG 18869 18306 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943018.1 protein_id gnl|my_center|LOCUS_00900 20277 19048 gene locus_tag LOCUS_00910 gene trpB1 20277 19048 CDS product tryptophan synthase beta chain 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66923 protein_id gnl|my_center|LOCUS_00910 20984 20310 gene locus_tag LOCUS_00920 gene kdsB 20984 20310 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E0E9 protein_id gnl|my_center|LOCUS_00920 >Feature sequence005 1022 1098 gene locus_tag LOCUS_t00020 1022 1098 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1156 2427 gene locus_tag LOCUS_00930 1156 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 2424 3053 gene locus_tag LOCUS_00940 2424 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 3043 4617 gene locus_tag LOCUS_00950 3043 4617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 6440 4632 gene locus_tag LOCUS_00960 6440 4632 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064474.1 protein_id gnl|my_center|LOCUS_00960 7576 6443 gene locus_tag LOCUS_00970 7576 6443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064473.1 protein_id gnl|my_center|LOCUS_00970 8101 8637 gene locus_tag LOCUS_00980 8101 8637 CDS product antirestriction protein ArdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021204.1 protein_id gnl|my_center|LOCUS_00980 8911 8684 gene locus_tag LOCUS_00990 8911 8684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 9035 9970 gene locus_tag LOCUS_01000 9035 9970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 13336 10010 gene locus_tag LOCUS_01010 13336 10010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 14103 14345 gene locus_tag LOCUS_01020 14103 14345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 14766 14539 gene locus_tag LOCUS_01030 14766 14539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 15123 15509 gene locus_tag LOCUS_01040 15123 15509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 15499 16950 gene locus_tag LOCUS_01050 15499 16950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 17915 17052 gene locus_tag LOCUS_01060 17915 17052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 18722 18318 gene locus_tag LOCUS_01070 18722 18318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 19433 18732 gene locus_tag LOCUS_01080 19433 18732 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074390.1 protein_id gnl|my_center|LOCUS_01080 19790 19584 gene locus_tag LOCUS_01090 19790 19584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 20343 19792 gene locus_tag LOCUS_01100 20343 19792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 >Feature sequence006 <1 600 gene locus_tag LOCUS_01110 <1 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RGV0:phosphoribosylamine--glycine ligase 616 1521 gene locus_tag LOCUS_01120 616 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 1581 2063 gene locus_tag LOCUS_01130 1581 2063 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437844.1 protein_id gnl|my_center|LOCUS_01130 2634 2152 gene locus_tag LOCUS_01140 2634 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 4643 2838 gene locus_tag LOCUS_01150 gene pckG 4643 2838 CDS product phosphoenolpyruvate carboxykinase [GTP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Y3 protein_id gnl|my_center|LOCUS_01150 4839 6980 gene locus_tag LOCUS_01160 gene parC 4839 6980 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962810.1 protein_id gnl|my_center|LOCUS_01160 7460 7071 gene locus_tag LOCUS_01170 gene dgkA 7460 7071 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY23 protein_id gnl|my_center|LOCUS_01170 8356 7577 gene locus_tag LOCUS_01180 gene tpiA 8356 7577 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP89 protein_id gnl|my_center|LOCUS_01180 9585 8392 gene locus_tag LOCUS_01190 gene pgk 9585 8392 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HYC0 protein_id gnl|my_center|LOCUS_01190 10840 9815 gene locus_tag LOCUS_01200 gene gapA 10840 9815 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JQH1 protein_id gnl|my_center|LOCUS_01200 11220 12320 gene locus_tag LOCUS_01210 gene oel1 11220 12320 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070593.1 protein_id gnl|my_center|LOCUS_01210 14814 12379 gene locus_tag LOCUS_01220 14814 12379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 15091 16161 gene locus_tag LOCUS_01230 gene mnmA 15091 16161 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZR6 protein_id gnl|my_center|LOCUS_01230 17923 16244 gene locus_tag LOCUS_01240 17923 16244 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EP31 protein_id gnl|my_center|LOCUS_01240 18383 19066 gene locus_tag LOCUS_01250 18383 19066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 19590 19369 gene locus_tag LOCUS_01260 19590 19369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 19900 19658 gene locus_tag LOCUS_01270 19900 19658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 >Feature sequence007 86 925 gene locus_tag LOCUS_01280 86 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 1256 1068 gene locus_tag LOCUS_01290 1256 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705982.1 protein_id gnl|my_center|LOCUS_01290 1608 2417 gene locus_tag LOCUS_01300 1608 2417 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172559.1 protein_id gnl|my_center|LOCUS_01300 5084 3162 gene locus_tag LOCUS_01310 5084 3162 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488980.1 protein_id gnl|my_center|LOCUS_01310 5456 6619 gene locus_tag LOCUS_01320 gene metK 5456 6619 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPS4 protein_id gnl|my_center|LOCUS_01320 6661 8106 gene locus_tag LOCUS_01330 gene ahcY 6661 8106 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCH5 protein_id gnl|my_center|LOCUS_01330 8559 9665 gene locus_tag LOCUS_01340 8559 9665 CDS product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257568.1 protein_id gnl|my_center|LOCUS_01340 9758 10756 gene locus_tag LOCUS_01350 9758 10756 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WK73 protein_id gnl|my_center|LOCUS_01350 11414 10857 gene locus_tag LOCUS_01360 gene efp 11414 10857 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q812U1 protein_id gnl|my_center|LOCUS_01360 12369 11497 gene locus_tag LOCUS_01370 12369 11497 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057658.1 protein_id gnl|my_center|LOCUS_01370 12845 12375 gene locus_tag LOCUS_01380 12845 12375 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143166.1 protein_id gnl|my_center|LOCUS_01380 13909 12842 gene locus_tag LOCUS_01390 gene dusB 13909 12842 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181F5 protein_id gnl|my_center|LOCUS_01390 13958 14257 gene locus_tag LOCUS_01400 13958 14257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 15800 14292 gene locus_tag LOCUS_01410 15800 14292 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121424.1 protein_id gnl|my_center|LOCUS_01410 16522 16007 gene locus_tag LOCUS_01420 16522 16007 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329717.1 protein_id gnl|my_center|LOCUS_01420 16762 18309 gene locus_tag LOCUS_01430 gene purH 16762 18309 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFK6 protein_id gnl|my_center|LOCUS_01430 19856 18570 gene locus_tag LOCUS_01440 19856 18570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 20129 20281 gene locus_tag LOCUS_01450 20129 20281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 >Feature sequence008 1583 741 gene locus_tag LOCUS_01460 1583 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142866.1 protein_id gnl|my_center|LOCUS_01460 2470 1580 gene locus_tag LOCUS_01470 2470 1580 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120812.1 protein_id gnl|my_center|LOCUS_01470 2732 2472 gene locus_tag LOCUS_01480 gene acyP 2732 2472 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NNW4 protein_id gnl|my_center|LOCUS_01480 2929 3603 gene locus_tag LOCUS_01490 2929 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 3670 5007 gene locus_tag LOCUS_01500 3670 5007 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671775.1 protein_id gnl|my_center|LOCUS_01500 5129 5836 gene locus_tag LOCUS_01510 gene lipB 5129 5836 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WKF8 protein_id gnl|my_center|LOCUS_01510 5833 6756 gene locus_tag LOCUS_01520 gene lipA 5833 6756 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HBT4 protein_id gnl|my_center|LOCUS_01520 6925 10062 gene locus_tag LOCUS_01530 6925 10062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 11375 10260 gene locus_tag LOCUS_01540 11375 10260 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963093.1 protein_id gnl|my_center|LOCUS_01540 11609 12001 gene locus_tag LOCUS_01550 11609 12001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 12006 12902 gene locus_tag LOCUS_01560 12006 12902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226805.1 protein_id gnl|my_center|LOCUS_01560 13130 13522 gene locus_tag LOCUS_01570 13130 13522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 13638 14570 gene locus_tag LOCUS_01580 13638 14570 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036699.1 protein_id gnl|my_center|LOCUS_01580 15694 14624 gene locus_tag LOCUS_01590 gene rlmN 15694 14624 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK16 protein_id gnl|my_center|LOCUS_01590 16536 15841 gene locus_tag LOCUS_01600 16536 15841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 17189 16533 gene locus_tag LOCUS_01610 17189 16533 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403102.1 protein_id gnl|my_center|LOCUS_01610 18607 17189 gene locus_tag LOCUS_01620 18607 17189 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403101.1 protein_id gnl|my_center|LOCUS_01620 19065 18778 gene locus_tag LOCUS_01630 19065 18778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 >Feature sequence009 1 1230 gene locus_tag LOCUS_01640 1 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 1978 1787 gene locus_tag LOCUS_01650 1978 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 3418 2591 gene locus_tag LOCUS_01660 3418 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 3499 4401 gene locus_tag LOCUS_01670 gene scrK 3499 4401 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120323.1 protein_id gnl|my_center|LOCUS_01670 4407 6581 gene locus_tag LOCUS_01680 gene sps 4407 6581 CDS product sucrose-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336886.1 protein_id gnl|my_center|LOCUS_01680 6574 8535 gene locus_tag LOCUS_01690 6574 8535 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120322.1 protein_id gnl|my_center|LOCUS_01690 8786 8702 gene locus_tag LOCUS_t00030 8786 8702 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9554 8949 gene locus_tag LOCUS_01700 gene metW 9554 8949 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217230.1 protein_id gnl|my_center|LOCUS_01700 10702 9563 gene locus_tag LOCUS_01710 gene metX 10702 9563 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89UL7 protein_id gnl|my_center|LOCUS_01710 11670 10720 gene locus_tag LOCUS_01720 gene prs 11670 10720 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG56 protein_id gnl|my_center|LOCUS_01720 12734 11676 gene locus_tag LOCUS_01730 gene lpxD 12734 11676 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHC2 protein_id gnl|my_center|LOCUS_01730 13348 12806 gene locus_tag LOCUS_01740 13348 12806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 15749 13392 gene locus_tag LOCUS_01750 15749 13392 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546857.1 protein_id gnl|my_center|LOCUS_01750 17229 15781 gene locus_tag LOCUS_01760 gene dnaB 17229 15781 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EG4 protein_id gnl|my_center|LOCUS_01760 17770 17267 gene locus_tag LOCUS_01770 gene rplI 17770 17267 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67830 protein_id gnl|my_center|LOCUS_01770 18300 17815 gene locus_tag LOCUS_01780 18300 17815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 >Feature sequence010 368 784 gene locus_tag LOCUS_01790 368 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 803 1222 gene locus_tag LOCUS_01800 803 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 2257 1502 gene locus_tag LOCUS_01810 2257 1502 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_01810 3570 2296 gene locus_tag LOCUS_01820 3570 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 3904 4785 gene locus_tag LOCUS_01830 gene rsmJ 3904 4785 CDS product ribosomal RNA small subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886R2 protein_id gnl|my_center|LOCUS_01830 5016 5738 gene locus_tag LOCUS_01840 5016 5738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 5759 6793 gene locus_tag LOCUS_01850 5759 6793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967555.1 protein_id gnl|my_center|LOCUS_01850 8742 7096 gene locus_tag LOCUS_01860 8742 7096 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403181.1 protein_id gnl|my_center|LOCUS_01860 8851 10221 gene locus_tag LOCUS_01870 gene tolC 8851 10221 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038435.1 protein_id gnl|my_center|LOCUS_01870 10265 10870 gene locus_tag LOCUS_01880 gene maf 10265 10870 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q82ZA4 protein_id gnl|my_center|LOCUS_01880 10871 12019 gene locus_tag LOCUS_01890 10871 12019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 12028 12927 gene locus_tag LOCUS_01900 12028 12927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 13093 13665 gene locus_tag LOCUS_01910 13093 13665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 15248 13869 gene locus_tag LOCUS_01920 15248 13869 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942585.1 protein_id gnl|my_center|LOCUS_01920 17405 15270 gene locus_tag LOCUS_01930 17405 15270 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942586.1 protein_id gnl|my_center|LOCUS_01930 17991 18392 gene locus_tag LOCUS_01940 17991 18392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 >Feature sequence011 797 537 gene locus_tag LOCUS_01950 797 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 1127 2416 gene locus_tag LOCUS_01960 1127 2416 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937373.1 protein_id gnl|my_center|LOCUS_01960 2545 8769 gene locus_tag LOCUS_01970 2545 8769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 8762 13231 gene locus_tag LOCUS_01980 8762 13231 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144209.1 protein_id gnl|my_center|LOCUS_01980 13260 14165 gene locus_tag LOCUS_01990 13260 14165 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420070.1 protein_id gnl|my_center|LOCUS_01990 14469 15740 gene locus_tag LOCUS_02000 14469 15740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144206.1 protein_id gnl|my_center|LOCUS_02000 15794 18202 gene locus_tag LOCUS_02010 15794 18202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 >Feature sequence012 93 587 gene locus_tag LOCUS_02020 93 587 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142371.1 protein_id gnl|my_center|LOCUS_02020 1694 711 gene locus_tag LOCUS_02030 1694 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 3305 1752 gene locus_tag LOCUS_02040 gene zwf 3305 1752 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WE89 protein_id gnl|my_center|LOCUS_02040 3793 3302 gene locus_tag LOCUS_02050 3793 3302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 3979 5076 gene locus_tag LOCUS_02060 3979 5076 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002661162.1 protein_id gnl|my_center|LOCUS_02060 5063 5629 gene locus_tag LOCUS_02070 5063 5629 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989776.1 protein_id gnl|my_center|LOCUS_02070 8152 5702 gene locus_tag LOCUS_02080 8152 5702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 8808 8191 gene locus_tag LOCUS_02090 8808 8191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 11950 8924 gene locus_tag LOCUS_02100 11950 8924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 14390 12117 gene locus_tag LOCUS_02110 14390 12117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 14648 15841 gene locus_tag LOCUS_02120 14648 15841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140828.1 protein_id gnl|my_center|LOCUS_02120 17571 15922 gene locus_tag LOCUS_02130 17571 15922 CDS product ubiquinone biosynthesis protein UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941749.1 protein_id gnl|my_center|LOCUS_02130 >Feature sequence013 979 293 gene locus_tag LOCUS_02140 979 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 1841 1023 gene locus_tag LOCUS_02150 1841 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02150 1960 2220 gene locus_tag LOCUS_02160 1960 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 2329 3765 gene locus_tag LOCUS_02170 2329 3765 CDS product UDP-N-acetylhexosamine pyrophosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 protein_id gnl|my_center|LOCUS_02170 3808 5772 gene locus_tag LOCUS_02180 3808 5772 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104219.1 protein_id gnl|my_center|LOCUS_02180 6527 6390 gene locus_tag LOCUS_02190 6527 6390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 7341 6742 gene locus_tag LOCUS_02200 gene drga 7341 6742 CDS product reductase DrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123320.1 protein_id gnl|my_center|LOCUS_02200 7702 8874 gene locus_tag LOCUS_02210 7702 8874 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919304.1 protein_id gnl|my_center|LOCUS_02210 8871 9773 gene locus_tag LOCUS_02220 8871 9773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 9789 10769 gene locus_tag LOCUS_02230 9789 10769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 13465 10766 gene locus_tag LOCUS_02240 13465 10766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 15461 13488 gene locus_tag LOCUS_02250 15461 13488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 16948 15467 gene locus_tag LOCUS_02260 16948 15467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 17712 16948 gene locus_tag LOCUS_02270 17712 16948 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404002.1 protein_id gnl|my_center|LOCUS_02270 >Feature sequence014 1664 4486 gene locus_tag LOCUS_02280 1664 4486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 5420 4761 gene locus_tag LOCUS_02290 gene rpe 5420 4761 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A1H8 protein_id gnl|my_center|LOCUS_02290 6370 5552 gene locus_tag LOCUS_02300 6370 5552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189747.1 protein_id gnl|my_center|LOCUS_02300 7533 6403 gene locus_tag LOCUS_02310 7533 6403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 7838 8521 gene locus_tag LOCUS_02320 7838 8521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 8941 8612 gene locus_tag LOCUS_02330 8941 8612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 10269 8962 gene locus_tag LOCUS_02340 gene argA 10269 8962 CDS product amino-acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPQ0 protein_id gnl|my_center|LOCUS_02340 10408 11340 gene locus_tag LOCUS_02350 gene xerD 10408 11340 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46352 protein_id gnl|my_center|LOCUS_02350 11568 11326 gene locus_tag LOCUS_02360 11568 11326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 12421 11555 gene locus_tag LOCUS_02370 12421 11555 CDS product UPF0294 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MF7 protein_id gnl|my_center|LOCUS_02370 12661 12578 gene locus_tag LOCUS_t00040 12661 12578 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 15037 12812 gene locus_tag LOCUS_02380 15037 12812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 16024 15146 gene locus_tag LOCUS_02390 gene cysE 16024 15146 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815280.1 protein_id gnl|my_center|LOCUS_02390 16436 17311 gene locus_tag LOCUS_02400 16436 17311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 17825 17649 gene locus_tag LOCUS_02410 17825 17649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 >Feature sequence015 <1 1076 gene locus_tag LOCUS_02420 <1 1076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706898.1:aspartate aminotransferase 1180 1545 gene locus_tag LOCUS_02430 1180 1545 CDS product heat-shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760336.1 protein_id gnl|my_center|LOCUS_02430 1692 2348 gene locus_tag LOCUS_02440 1692 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119745.1 protein_id gnl|my_center|LOCUS_02440 2498 2271 gene locus_tag LOCUS_02450 2498 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 2519 3466 gene locus_tag LOCUS_02460 2519 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 3843 4292 gene locus_tag LOCUS_02470 3843 4292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 4393 5067 gene locus_tag LOCUS_02480 4393 5067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 6557 5460 gene locus_tag LOCUS_02490 gene rsgA 6557 5460 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81EH2 protein_id gnl|my_center|LOCUS_02490 6913 6659 gene locus_tag LOCUS_02500 6913 6659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 8383 6980 gene locus_tag LOCUS_02510 8383 6980 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766157.1 protein_id gnl|my_center|LOCUS_02510 11531 8373 gene locus_tag LOCUS_02520 11531 8373 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766158.1 protein_id gnl|my_center|LOCUS_02520 12500 11535 gene locus_tag LOCUS_02530 12500 11535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 13941 13006 gene locus_tag LOCUS_02540 13941 13006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 14949 14440 gene locus_tag LOCUS_02550 14949 14440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 15707 14952 gene locus_tag LOCUS_02560 15707 14952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 17302 15704 gene locus_tag LOCUS_02570 17302 15704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 >Feature sequence016 1494 133 gene locus_tag LOCUS_02580 gene clpX 1494 133 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U0 protein_id gnl|my_center|LOCUS_02580 2136 1540 gene locus_tag LOCUS_02590 gene clpP 2136 1540 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZF9 protein_id gnl|my_center|LOCUS_02590 3566 2223 gene locus_tag LOCUS_02600 gene tig 3566 2223 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YR5 protein_id gnl|my_center|LOCUS_02600 4353 3760 gene locus_tag LOCUS_02610 4353 3760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 4493 4897 gene locus_tag LOCUS_02620 4493 4897 CDS product acyl-CoA thioester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811622.1 protein_id gnl|my_center|LOCUS_02620 5845 5009 gene locus_tag LOCUS_02630 5845 5009 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057953.1 protein_id gnl|my_center|LOCUS_02630 7280 5907 gene locus_tag LOCUS_02640 7280 5907 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918720.1 protein_id gnl|my_center|LOCUS_02640 7467 8297 gene locus_tag LOCUS_02650 7467 8297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073205.1 protein_id gnl|my_center|LOCUS_02650 8364 8558 gene locus_tag LOCUS_02660 8364 8558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02660 8624 9859 gene locus_tag LOCUS_02670 8624 9859 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123361.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02670 10087 10902 gene locus_tag LOCUS_02680 10087 10902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 10968 11420 gene locus_tag LOCUS_02690 10968 11420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141721.1 protein_id gnl|my_center|LOCUS_02690 11423 11986 gene locus_tag LOCUS_02700 11423 11986 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887596.1 protein_id gnl|my_center|LOCUS_02700 12109 12540 gene locus_tag LOCUS_02710 12109 12540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 12769 13380 gene locus_tag LOCUS_02720 12769 13380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 13373 14395 gene locus_tag LOCUS_02730 13373 14395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974307.1 protein_id gnl|my_center|LOCUS_02730 14392 15360 gene locus_tag LOCUS_02740 14392 15360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 15487 15412 gene locus_tag LOCUS_t00050 15487 15412 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 15690 16892 gene locus_tag LOCUS_02750 15690 16892 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943408.1 protein_id gnl|my_center|LOCUS_02750 >Feature sequence017 1131 193 gene locus_tag LOCUS_02760 gene ddl 1131 193 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748D8 protein_id gnl|my_center|LOCUS_02760 3442 1124 gene locus_tag LOCUS_02770 3442 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 4566 3439 gene locus_tag LOCUS_02780 gene murG 4566 3439 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q728U8 protein_id gnl|my_center|LOCUS_02780 5651 4563 gene locus_tag LOCUS_02790 5651 4563 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460697.1 protein_id gnl|my_center|LOCUS_02790 6931 5744 gene locus_tag LOCUS_02800 6931 5744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 8267 6966 gene locus_tag LOCUS_02810 gene murD 8267 6966 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NEZ5 protein_id gnl|my_center|LOCUS_02810 9369 8269 gene locus_tag LOCUS_02820 gene mraY 9369 8269 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748D3 protein_id gnl|my_center|LOCUS_02820 10808 9420 gene locus_tag LOCUS_02830 gene murF 10808 9420 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4M9 protein_id gnl|my_center|LOCUS_02830 12435 10828 gene locus_tag LOCUS_02840 gene murE 12435 10828 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK84 protein_id gnl|my_center|LOCUS_02840 14221 12407 gene locus_tag LOCUS_02850 14221 12407 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545621.1 protein_id gnl|my_center|LOCUS_02850 14773 14450 gene locus_tag LOCUS_02860 14773 14450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 15806 14850 gene locus_tag LOCUS_02870 gene rsmH 15806 14850 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ5 protein_id gnl|my_center|LOCUS_02870 16512 16039 gene locus_tag LOCUS_02880 gene mraZ 16512 16039 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WT94 protein_id gnl|my_center|LOCUS_02880 >Feature sequence018 1975 1649 gene locus_tag LOCUS_02890 1975 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 3737 2085 gene locus_tag LOCUS_02900 3737 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 3847 4482 gene locus_tag LOCUS_02910 3847 4482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 7035 4630 gene locus_tag LOCUS_02920 7035 4630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 7335 7060 gene locus_tag LOCUS_02930 7335 7060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 7402 7554 gene locus_tag LOCUS_02940 7402 7554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 9406 7766 gene locus_tag LOCUS_02950 9406 7766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 10207 9419 gene locus_tag LOCUS_02960 10207 9419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 11291 10269 gene locus_tag LOCUS_02970 11291 10269 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460894.1 protein_id gnl|my_center|LOCUS_02970 11406 12401 gene locus_tag LOCUS_02980 11406 12401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 12830 12378 gene locus_tag LOCUS_02990 12830 12378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 14663 13089 gene locus_tag LOCUS_03000 gene der 14663 13089 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4V0 protein_id gnl|my_center|LOCUS_03000 15990 14815 gene locus_tag LOCUS_03010 gene yugH 15990 14815 CDS product putative aminotransferase YugH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q795M6 protein_id gnl|my_center|LOCUS_03010 16472 15990 gene locus_tag LOCUS_03020 16472 15990 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002003749.1 protein_id gnl|my_center|LOCUS_03020 16933 16703 gene locus_tag LOCUS_03030 16933 16703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 >Feature sequence019 1460 420 gene locus_tag LOCUS_03040 gene dprA 1460 420 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_03040 3290 1707 gene locus_tag LOCUS_03050 gene nnr 3290 1707 CDS product bifunctional NAD(P)H-hydrate repair enzyme Nnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGI2 protein_id gnl|my_center|LOCUS_03050 4160 3402 gene locus_tag LOCUS_03060 gene pdxJ 4160 3402 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G5 protein_id gnl|my_center|LOCUS_03060 6078 4363 gene locus_tag LOCUS_03070 gene recJ 6078 4363 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_03070 8773 6224 gene locus_tag LOCUS_03080 gene secD 8773 6224 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971714.1 protein_id gnl|my_center|LOCUS_03080 9127 8801 gene locus_tag LOCUS_03090 gene yajC 9127 8801 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194088.1 protein_id gnl|my_center|LOCUS_03090 10593 9625 gene locus_tag LOCUS_03100 gene menA 10593 9625 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCB3 protein_id gnl|my_center|LOCUS_03100 13336 10652 gene locus_tag LOCUS_03110 13336 10652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 13492 14067 gene locus_tag LOCUS_03120 13492 14067 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113995.1 protein_id gnl|my_center|LOCUS_03120 14126 15118 gene locus_tag LOCUS_03130 14126 15118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640180.1 protein_id gnl|my_center|LOCUS_03130 15226 15954 gene locus_tag LOCUS_03140 15226 15954 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537552.1 protein_id gnl|my_center|LOCUS_03140 >Feature sequence020 2831 1743 gene locus_tag LOCUS_03150 gene yacI 2831 1743 CDS product protein-arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMV3 protein_id gnl|my_center|LOCUS_03150 3340 2828 gene locus_tag LOCUS_03160 3340 2828 CDS product excinuclease Uvr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357604.1 protein_id gnl|my_center|LOCUS_03160 4421 3525 gene locus_tag LOCUS_03170 gene ilvE 4421 3525 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005489.1 protein_id gnl|my_center|LOCUS_03170 6331 4463 gene locus_tag LOCUS_03180 gene acsA 6331 4463 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKH2 protein_id gnl|my_center|LOCUS_03180 6642 8417 gene locus_tag LOCUS_03190 6642 8417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 8508 9269 gene locus_tag LOCUS_03200 gene hisF 8508 9269 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TBG5 protein_id gnl|my_center|LOCUS_03200 9424 10311 gene locus_tag LOCUS_03210 9424 10311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 11412 10300 gene locus_tag LOCUS_03220 11412 10300 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654729.1 protein_id gnl|my_center|LOCUS_03220 12036 11779 gene locus_tag LOCUS_03230 12036 11779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 14189 12519 gene locus_tag LOCUS_03240 gene glnS 14189 12519 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UX42 protein_id gnl|my_center|LOCUS_03240 15819 14455 gene locus_tag LOCUS_03250 gene gltX 15819 14455 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1L8 protein_id gnl|my_center|LOCUS_03250 >Feature sequence021 1741 2019 gene locus_tag LOCUS_03260 1741 2019 CDS product antitoxin VapB33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406302.1 protein_id gnl|my_center|LOCUS_03260 2016 2447 gene locus_tag LOCUS_03270 gene vapc33 2016 2447 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3P3B5 protein_id gnl|my_center|LOCUS_03270 2553 3269 gene locus_tag LOCUS_03280 gene lolD 2553 3269 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z80 protein_id gnl|my_center|LOCUS_03280 3285 5870 gene locus_tag LOCUS_03290 3285 5870 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404082.1 protein_id gnl|my_center|LOCUS_03290 5876 7018 gene locus_tag LOCUS_03300 5876 7018 CDS product carotenoid 1,2-hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404080.1 protein_id gnl|my_center|LOCUS_03300 7721 7080 gene locus_tag LOCUS_03310 7721 7080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 8207 7836 gene locus_tag LOCUS_03320 8207 7836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 8461 11103 gene locus_tag LOCUS_03330 8461 11103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 11100 11828 gene locus_tag LOCUS_03340 11100 11828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 12190 12708 gene locus_tag LOCUS_03350 12190 12708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 14487 13204 gene locus_tag LOCUS_03360 14487 13204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 <16122 14783 gene locus_tag LOCUS_03370 <16122 14783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403467.1:permease >Feature sequence022 9841 7106 gene locus_tag LOCUS_03380 9841 7106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 10784 9885 gene locus_tag LOCUS_03390 10784 9885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 11765 10791 gene locus_tag LOCUS_03400 11765 10791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 13438 11771 gene locus_tag LOCUS_03410 13438 11771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 13853 14392 gene locus_tag LOCUS_03420 13853 14392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 15518 14436 gene locus_tag LOCUS_03430 gene recF 15518 14436 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMJ4 protein_id gnl|my_center|LOCUS_03430 >Feature sequence023 2311 1127 gene locus_tag LOCUS_03440 2311 1127 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_03440 2548 2835 gene locus_tag LOCUS_03450 2548 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 2848 3156 gene locus_tag LOCUS_03460 2848 3156 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920707.1 protein_id gnl|my_center|LOCUS_03460 3855 3277 gene locus_tag LOCUS_03470 3855 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 4703 3852 gene locus_tag LOCUS_03480 gene dinD 4703 3852 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962420.1 protein_id gnl|my_center|LOCUS_03480 4772 5101 gene locus_tag LOCUS_03490 4772 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 5185 5466 gene locus_tag LOCUS_03500 5185 5466 CDS product plasmid maintenance system killer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_03500 5483 5776 gene locus_tag LOCUS_03510 5483 5776 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389772.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03510 6012 6203 gene locus_tag LOCUS_03520 6012 6203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 7342 6200 gene locus_tag LOCUS_03530 7342 6200 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958509.1 protein_id gnl|my_center|LOCUS_03530 8505 7432 gene locus_tag LOCUS_03540 8505 7432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 8977 9999 gene locus_tag LOCUS_03550 gene mreB-1 8977 9999 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_03550 10009 10869 gene locus_tag LOCUS_03560 10009 10869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 10859 11389 gene locus_tag LOCUS_03570 10859 11389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 11386 13326 gene locus_tag LOCUS_03580 gene mrdA 11386 13326 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_03580 14117 13401 gene locus_tag LOCUS_03590 gene adh2 14117 13401 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880787.1 protein_id gnl|my_center|LOCUS_03590 14783 14199 gene locus_tag LOCUS_03600 14783 14199 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_03600 14907 15647 gene locus_tag LOCUS_03610 gene truA 14907 15647 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MTA1 protein_id gnl|my_center|LOCUS_03610 >Feature sequence024 340 179 gene locus_tag LOCUS_03620 340 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 530 1894 gene locus_tag LOCUS_03630 530 1894 CDS product voltage-gated chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416818.1 protein_id gnl|my_center|LOCUS_03630 1900 2814 gene locus_tag LOCUS_03640 gene psd 1900 2814 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFM0 protein_id gnl|my_center|LOCUS_03640 3309 2827 gene locus_tag LOCUS_03650 3309 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 4868 3567 gene locus_tag LOCUS_03660 gene avtA 4868 3567 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704054.1 protein_id gnl|my_center|LOCUS_03660 5559 4963 gene locus_tag LOCUS_03670 5559 4963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 5667 6503 gene locus_tag LOCUS_03680 5667 6503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 7264 7177 gene locus_tag LOCUS_t00060 7264 7177 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8929 7382 gene locus_tag LOCUS_03690 gene comM 8929 7382 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_03690 9069 9626 gene locus_tag LOCUS_03700 9069 9626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 9682 11733 gene locus_tag LOCUS_03710 9682 11733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 11773 13494 gene locus_tag LOCUS_03720 gene pilB 11773 13494 CDS product type IV fimbrial assembly protein PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123899.1 protein_id gnl|my_center|LOCUS_03720 13538 14626 gene locus_tag LOCUS_03730 gene pilT 13538 14626 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329383.1 protein_id gnl|my_center|LOCUS_03730 >Feature sequence025 305 673 gene locus_tag LOCUS_03740 305 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 755 1738 gene locus_tag LOCUS_03750 755 1738 CDS product 3'-5' exoribonuclease YhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475776.1 protein_id gnl|my_center|LOCUS_03750 2557 1745 gene locus_tag LOCUS_03760 gene mutM 2557 1745 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZM34 protein_id gnl|my_center|LOCUS_03760 2674 3630 gene locus_tag LOCUS_03770 2674 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 5217 3706 gene locus_tag LOCUS_03780 gene lysS 5217 3706 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37477 protein_id gnl|my_center|LOCUS_03780 5397 6485 gene locus_tag LOCUS_03790 gene queA 5397 6485 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZ44 protein_id gnl|my_center|LOCUS_03790 6553 7077 gene locus_tag LOCUS_03800 6553 7077 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355429.1 protein_id gnl|my_center|LOCUS_03800 7081 7974 gene locus_tag LOCUS_03810 7081 7974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 7984 8553 gene locus_tag LOCUS_03820 7984 8553 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896521.1 protein_id gnl|my_center|LOCUS_03820 9339 9692 gene locus_tag LOCUS_03830 9339 9692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 9973 11082 gene locus_tag LOCUS_03840 9973 11082 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AE7 protein_id gnl|my_center|LOCUS_03840 12203 11274 gene locus_tag LOCUS_03850 gene miaA 12203 11274 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BP1 protein_id gnl|my_center|LOCUS_03850 12347 12670 gene locus_tag LOCUS_03860 12347 12670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 13646 12708 gene locus_tag LOCUS_03870 gene fcl 13646 12708 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVN0 protein_id gnl|my_center|LOCUS_03870 14786 13668 gene locus_tag LOCUS_03880 gene gmd 14786 13668 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56872 protein_id gnl|my_center|LOCUS_03880 >Feature sequence026 1023 373 gene locus_tag LOCUS_03890 1023 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 1649 1176 gene locus_tag LOCUS_03900 1649 1176 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939700.1 protein_id gnl|my_center|LOCUS_03900 2914 1718 gene locus_tag LOCUS_03910 2914 1718 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094878.1 protein_id gnl|my_center|LOCUS_03910 3168 3093 gene locus_tag LOCUS_t00070 3168 3093 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3286 3900 gene locus_tag LOCUS_03920 3286 3900 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_03920 3897 4565 gene locus_tag LOCUS_03930 3897 4565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 5277 4675 gene locus_tag LOCUS_03940 gene ruvA 5277 4675 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NS57 protein_id gnl|my_center|LOCUS_03940 6033 5296 gene locus_tag LOCUS_03950 gene dapB 6033 5296 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GT5 protein_id gnl|my_center|LOCUS_03950 6948 6058 gene locus_tag LOCUS_03960 gene dapA 6948 6058 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AX2 protein_id gnl|my_center|LOCUS_03960 7068 8168 gene locus_tag LOCUS_03970 gene pilT 7068 8168 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880449.1 protein_id gnl|my_center|LOCUS_03970 8169 9386 gene locus_tag LOCUS_03980 8169 9386 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267685.1 protein_id gnl|my_center|LOCUS_03980 10460 9588 gene locus_tag LOCUS_03990 10460 9588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 11891 10926 gene locus_tag LOCUS_04000 gene pilC 11891 10926 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262624.1 protein_id gnl|my_center|LOCUS_04000 13082 12432 gene locus_tag LOCUS_04010 gene engB 13082 12432 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UN4 protein_id gnl|my_center|LOCUS_04010 14093 13173 gene locus_tag LOCUS_04020 14093 13173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 <15167 14123 gene locus_tag LOCUS_04030 <15167 14123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941590.1:ABC transporter ATP-binding protein >Feature sequence027 <1 629 gene locus_tag LOCUS_04040 <1 629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P60885:imidazoleglycerol-phosphate dehydratase 845 1483 gene locus_tag LOCUS_04050 gene hisH 845 1483 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0ML54 protein_id gnl|my_center|LOCUS_04050 1562 2851 gene locus_tag LOCUS_04060 gene gltA 1562 2851 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPW5 protein_id gnl|my_center|LOCUS_04060 4190 3384 gene locus_tag LOCUS_04070 4190 3384 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841479.1 protein_id gnl|my_center|LOCUS_04070 4216 4866 gene locus_tag LOCUS_04080 4216 4866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 4943 6115 gene locus_tag LOCUS_04090 gene gnfL 4943 6115 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941669.1 protein_id gnl|my_center|LOCUS_04090 6807 9917 gene locus_tag LOCUS_04100 6807 9917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037348.1 protein_id gnl|my_center|LOCUS_04100 9980 11860 gene locus_tag LOCUS_04110 9980 11860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 12961 11909 gene locus_tag LOCUS_04120 12961 11909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 13818 12958 gene locus_tag LOCUS_04130 13818 12958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 14916 13849 gene locus_tag LOCUS_04140 gene hemH 14916 13849 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP3 protein_id gnl|my_center|LOCUS_04140 >Feature sequence028 <1 730 gene locus_tag LOCUS_04150 <1 730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389792.1:alpha/beta hydrolase 810 2264 gene locus_tag LOCUS_04160 810 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 2278 3660 gene locus_tag LOCUS_04170 2278 3660 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650Q1 protein_id gnl|my_center|LOCUS_04170 3765 4748 gene locus_tag LOCUS_04180 3765 4748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 4795 5454 gene locus_tag LOCUS_04190 4795 5454 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940717.1 protein_id gnl|my_center|LOCUS_04190 6125 5532 gene locus_tag LOCUS_04200 6125 5532 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140820.1 protein_id gnl|my_center|LOCUS_04200 7164 6142 gene locus_tag LOCUS_04210 gene asd 7164 6142 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67716 protein_id gnl|my_center|LOCUS_04210 7338 7703 gene locus_tag LOCUS_04220 7338 7703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 7793 8062 gene locus_tag LOCUS_04230 7793 8062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 8235 9827 gene locus_tag LOCUS_04240 8235 9827 CDS product NAD-utilizing dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202072.1 protein_id gnl|my_center|LOCUS_04240 10148 9831 gene locus_tag LOCUS_04250 gene erpA 10148 9831 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45344 protein_id gnl|my_center|LOCUS_04250 10279 11280 gene locus_tag LOCUS_04260 10279 11280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 11305 12753 gene locus_tag LOCUS_04270 gene rpoN 11305 12753 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BZ1 protein_id gnl|my_center|LOCUS_04270 12904 14427 gene locus_tag LOCUS_04280 gene ilvA 12904 14427 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WHM0 protein_id gnl|my_center|LOCUS_04280 >Feature sequence029 <1 2244 gene locus_tag LOCUS_04290 <1 2244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120353.1:helicase 2324 3499 gene locus_tag LOCUS_04300 2324 3499 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 protein_id gnl|my_center|LOCUS_04300 3653 4825 gene locus_tag LOCUS_04310 3653 4825 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887074.1 protein_id gnl|my_center|LOCUS_04310 6619 4835 gene locus_tag LOCUS_04320 6619 4835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 6816 7007 gene locus_tag LOCUS_04330 6816 7007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04330 7294 8307 gene locus_tag LOCUS_04340 7294 8307 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978090.1 protein_id gnl|my_center|LOCUS_04340 8310 8828 gene locus_tag LOCUS_04350 8310 8828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 8862 10619 gene locus_tag LOCUS_04360 8862 10619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 10623 12635 gene locus_tag LOCUS_04370 10623 12635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 13478 13032 gene locus_tag LOCUS_04380 13478 13032 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872160.1 protein_id gnl|my_center|LOCUS_04380 13633 14298 gene locus_tag LOCUS_04390 13633 14298 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932468.1 protein_id gnl|my_center|LOCUS_04390 >Feature sequence030 2606 1455 gene locus_tag LOCUS_04400 2606 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880980.1 protein_id gnl|my_center|LOCUS_04400 3595 2627 gene locus_tag LOCUS_04410 3595 2627 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250797.1 protein_id gnl|my_center|LOCUS_04410 3848 4339 gene locus_tag LOCUS_04420 3848 4339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 4393 4842 gene locus_tag LOCUS_04430 4393 4842 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012601750.1 protein_id gnl|my_center|LOCUS_04430 4784 5356 gene locus_tag LOCUS_04440 4784 5356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 5353 5817 gene locus_tag LOCUS_04450 5353 5817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 5886 6545 gene locus_tag LOCUS_04460 5886 6545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 6547 7677 gene locus_tag LOCUS_04470 6547 7677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 7700 9043 gene locus_tag LOCUS_04480 7700 9043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 9043 9594 gene locus_tag LOCUS_04490 9043 9594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 9623 11800 gene locus_tag LOCUS_04500 9623 11800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 11835 12395 gene locus_tag LOCUS_04510 11835 12395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 13002 12523 gene locus_tag LOCUS_04520 gene ispF 13002 12523 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z805 protein_id gnl|my_center|LOCUS_04520 13410 13006 gene locus_tag LOCUS_04530 13410 13006 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q836S2 protein_id gnl|my_center|LOCUS_04530 14380 13529 gene locus_tag LOCUS_04540 14380 13529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 14601 14525 gene locus_tag LOCUS_t00080 14601 14525 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence031 220 672 gene locus_tag LOCUS_04550 220 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 764 1117 gene locus_tag LOCUS_04560 gene arsC 764 1117 CDS product ArsC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001971937.1 protein_id gnl|my_center|LOCUS_04560 1998 1114 gene locus_tag LOCUS_04570 1998 1114 CDS product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_04570 2024 2620 gene locus_tag LOCUS_04580 2024 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 2641 3342 gene locus_tag LOCUS_04590 2641 3342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 3342 4490 gene locus_tag LOCUS_04600 3342 4490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 5384 4503 gene locus_tag LOCUS_04610 5384 4503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 5530 8535 gene locus_tag LOCUS_04620 5530 8535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 8641 9123 gene locus_tag LOCUS_04630 8641 9123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 11144 9201 gene locus_tag LOCUS_04640 11144 9201 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_04640 11274 11843 gene locus_tag LOCUS_04650 11274 11843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 11854 13515 gene locus_tag LOCUS_04660 11854 13515 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIC3 protein_id gnl|my_center|LOCUS_04660 14030 13569 gene locus_tag LOCUS_04670 14030 13569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 >Feature sequence032 146 400 gene locus_tag LOCUS_04680 146 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 1366 713 gene locus_tag LOCUS_04690 1366 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 1804 1397 gene locus_tag LOCUS_04700 1804 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 3128 2211 gene locus_tag LOCUS_04710 gene pilD 3128 2211 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BJ8 protein_id gnl|my_center|LOCUS_04710 4044 3121 gene locus_tag LOCUS_04720 4044 3121 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870596.1 protein_id gnl|my_center|LOCUS_04720 4888 4193 gene locus_tag LOCUS_04730 4888 4193 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256816.1 protein_id gnl|my_center|LOCUS_04730 5096 5914 gene locus_tag LOCUS_04740 5096 5914 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329773.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04740 6138 9221 gene locus_tag LOCUS_04750 6138 9221 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121470.1 protein_id gnl|my_center|LOCUS_04750 9425 9874 gene locus_tag LOCUS_04760 9425 9874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 9959 10423 gene locus_tag LOCUS_04770 9959 10423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328395.1 protein_id gnl|my_center|LOCUS_04770 12392 10581 gene locus_tag LOCUS_04780 12392 10581 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203293.1 protein_id gnl|my_center|LOCUS_04780 12650 13609 gene locus_tag LOCUS_04790 12650 13609 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUQ5 protein_id gnl|my_center|LOCUS_04790 13697 14203 gene locus_tag LOCUS_04800 13697 14203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 >Feature sequence033 871 569 gene locus_tag LOCUS_04810 871 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 1008 1784 gene locus_tag LOCUS_04820 gene panB 1008 1784 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM79 protein_id gnl|my_center|LOCUS_04820 1906 2904 gene locus_tag LOCUS_04830 gene gpsA 1906 2904 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RND0 protein_id gnl|my_center|LOCUS_04830 2937 3452 gene locus_tag LOCUS_04840 2937 3452 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929825.1 protein_id gnl|my_center|LOCUS_04840 5251 3725 gene locus_tag LOCUS_04850 gene glyQS 5251 3725 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UEU9 protein_id gnl|my_center|LOCUS_04850 5459 6172 gene locus_tag LOCUS_04860 5459 6172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 6864 6439 gene locus_tag LOCUS_04870 6864 6439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 7684 7043 gene locus_tag LOCUS_04880 gene phoU 7684 7043 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YH75 protein_id gnl|my_center|LOCUS_04880 8598 7783 gene locus_tag LOCUS_04890 gene pstB 8598 7783 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51546 protein_id gnl|my_center|LOCUS_04890 9844 8639 gene locus_tag LOCUS_04900 9844 8639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 11578 9872 gene locus_tag LOCUS_04910 11578 9872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 12779 11952 gene locus_tag LOCUS_04920 12779 11952 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538556.1 protein_id gnl|my_center|LOCUS_04920 14018 12879 gene locus_tag LOCUS_04930 14018 12879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 >Feature sequence034 855 307 gene locus_tag LOCUS_04940 gene nuoI 855 307 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1Q5 protein_id gnl|my_center|LOCUS_04940 1980 868 gene locus_tag LOCUS_04950 gene nuoH1 1980 868 CDS product NADH-quinone oxidoreductase subunit H 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GA1 protein_id gnl|my_center|LOCUS_04950 3717 1996 gene locus_tag LOCUS_04960 gene nuoG 3717 1996 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403178.1 protein_id gnl|my_center|LOCUS_04960 5089 3722 gene locus_tag LOCUS_04970 gene nuoF 5089 3722 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829484.1 protein_id gnl|my_center|LOCUS_04970 5640 5161 gene locus_tag LOCUS_04980 5640 5161 CDS product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969256.1 protein_id gnl|my_center|LOCUS_04980 6941 5703 gene locus_tag LOCUS_04990 gene nuoD 6941 5703 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GA5 protein_id gnl|my_center|LOCUS_04990 7573 6956 gene locus_tag LOCUS_05000 7573 6956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 8140 7577 gene locus_tag LOCUS_05010 gene nuoB 8140 7577 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CYI7 protein_id gnl|my_center|LOCUS_05010 8352 9677 gene locus_tag LOCUS_05020 gene gdhA 8352 9677 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFF0 protein_id gnl|my_center|LOCUS_05020 10116 11261 gene locus_tag LOCUS_05030 gene rho 10116 11261 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7C5 protein_id gnl|my_center|LOCUS_05030 11410 12195 gene locus_tag LOCUS_05040 11410 12195 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462044.1 protein_id gnl|my_center|LOCUS_05040 12204 13181 gene locus_tag LOCUS_05050 gene thiL 12204 13181 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPP0 protein_id gnl|my_center|LOCUS_05050 13178 13627 gene locus_tag LOCUS_05060 13178 13627 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583329.1 protein_id gnl|my_center|LOCUS_05060 >Feature sequence035 558 1274 gene locus_tag LOCUS_05070 558 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 2326 1352 gene locus_tag LOCUS_05080 2326 1352 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461587.1 protein_id gnl|my_center|LOCUS_05080 2557 3672 gene locus_tag LOCUS_05090 2557 3672 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811750.1 protein_id gnl|my_center|LOCUS_05090 3632 4393 gene locus_tag LOCUS_05100 3632 4393 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z3F9 protein_id gnl|my_center|LOCUS_05100 4506 4685 gene locus_tag LOCUS_05110 4506 4685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 4727 5794 gene locus_tag LOCUS_05120 4727 5794 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_05120 5842 6846 gene locus_tag LOCUS_05130 gene fabH 5842 6846 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJX8 protein_id gnl|my_center|LOCUS_05130 6837 7868 gene locus_tag LOCUS_05140 6837 7868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 7894 8454 gene locus_tag LOCUS_05150 7894 8454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 9365 8808 gene locus_tag LOCUS_05160 9365 8808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 10981 9365 gene locus_tag LOCUS_05170 10981 9365 CDS product paraquat-inducible protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881538.1 protein_id gnl|my_center|LOCUS_05170 11486 10974 gene locus_tag LOCUS_05180 11486 10974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05180 12208 11585 gene locus_tag LOCUS_05190 12208 11585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05190 13122 12313 gene locus_tag LOCUS_05200 gene trpA 13122 12313 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X4E8 protein_id gnl|my_center|LOCUS_05200 >Feature sequence036 205 1278 gene locus_tag LOCUS_05210 205 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 1894 1298 gene locus_tag LOCUS_05220 gene rdgB 1894 1298 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3D3 protein_id gnl|my_center|LOCUS_05220 3032 1917 gene locus_tag LOCUS_05230 3032 1917 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK07 protein_id gnl|my_center|LOCUS_05230 3688 3029 gene locus_tag LOCUS_05240 gene ycbL 3688 3029 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065967.1 protein_id gnl|my_center|LOCUS_05240 3811 4716 gene locus_tag LOCUS_05250 3811 4716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 6119 4788 gene locus_tag LOCUS_05260 6119 4788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 6995 6708 gene locus_tag LOCUS_05270 6995 6708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 7276 7067 gene locus_tag LOCUS_05280 7276 7067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 7460 8560 gene locus_tag LOCUS_05290 gene leuB 7460 8560 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CFL3 protein_id gnl|my_center|LOCUS_05290 8914 11835 gene locus_tag LOCUS_05300 gene alaS 8914 11835 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2B6 protein_id gnl|my_center|LOCUS_05300 <13837 11887 gene locus_tag LOCUS_05310 <13837 11887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962407.1:metalloprotease Fpp1 >Feature sequence037 1065 157 gene locus_tag LOCUS_05320 gene cysD 1065 157 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S508 protein_id gnl|my_center|LOCUS_05320 1755 1135 gene locus_tag LOCUS_05330 gene cysC 1755 1135 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAQ1 protein_id gnl|my_center|LOCUS_05330 3531 1870 gene locus_tag LOCUS_05340 3531 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 4563 3535 gene locus_tag LOCUS_05350 4563 3535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 5237 4569 gene locus_tag LOCUS_05360 5237 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 5828 5451 gene locus_tag LOCUS_05370 5828 5451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144365.1 protein_id gnl|my_center|LOCUS_05370 6803 5862 gene locus_tag LOCUS_05380 gene pdxA1 6803 5862 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U4 protein_id gnl|my_center|LOCUS_05380 7620 6826 gene locus_tag LOCUS_05390 gene lpxA 7620 6826 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAZ0 protein_id gnl|my_center|LOCUS_05390 8583 7672 gene locus_tag LOCUS_05400 gene thrB 8583 7672 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIX1 protein_id gnl|my_center|LOCUS_05400 9066 8590 gene locus_tag LOCUS_05410 gene smpB 9066 8590 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CG4 protein_id gnl|my_center|LOCUS_05410 9356 9138 gene locus_tag LOCUS_05420 9356 9138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 9512 9937 gene locus_tag LOCUS_05430 gene rplM 9512 9937 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMK8 protein_id gnl|my_center|LOCUS_05430 9956 10348 gene locus_tag LOCUS_05440 gene rpsI 9956 10348 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88XU7 protein_id gnl|my_center|LOCUS_05440 10498 11520 gene locus_tag LOCUS_05450 gene argC 10498 11520 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Q9 protein_id gnl|my_center|LOCUS_05450 11582 12805 gene locus_tag LOCUS_05460 gene argJ 11582 12805 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGC2 protein_id gnl|my_center|LOCUS_05460 12852 13742 gene locus_tag LOCUS_05470 12852 13742 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496896.1 protein_id gnl|my_center|LOCUS_05470 >Feature sequence038 1519 296 gene locus_tag LOCUS_05480 gene rlmN 1519 296 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0X3 protein_id gnl|my_center|LOCUS_05480 1552 2271 gene locus_tag LOCUS_05490 1552 2271 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I683 protein_id gnl|my_center|LOCUS_05490 3014 2268 gene locus_tag LOCUS_05500 3014 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 3072 4841 gene locus_tag LOCUS_05510 3072 4841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 4943 6499 gene locus_tag LOCUS_05520 4943 6499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 9944 6567 gene locus_tag LOCUS_05530 9944 6567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386656.1 protein_id gnl|my_center|LOCUS_05530 11070 10018 gene locus_tag LOCUS_05540 11070 10018 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628650.1 protein_id gnl|my_center|LOCUS_05540 12719 11178 gene locus_tag LOCUS_05550 12719 11178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791295.1 protein_id gnl|my_center|LOCUS_05550 12784 13062 gene locus_tag LOCUS_05560 12784 13062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 >Feature sequence039 <1 2341 gene locus_tag LOCUS_05570 <1 2341 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933346.1:pyruvate, phosphate dikinase 2548 3366 gene locus_tag LOCUS_05580 2548 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 3436 4866 gene locus_tag LOCUS_05590 3436 4866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 5031 6641 gene locus_tag LOCUS_05600 5031 6641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 6982 9129 gene locus_tag LOCUS_05610 6982 9129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680025.1 protein_id gnl|my_center|LOCUS_05610 9254 9048 gene locus_tag LOCUS_05620 9254 9048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 11446 9386 gene locus_tag LOCUS_05630 gene uvrB 11446 9386 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180R0 protein_id gnl|my_center|LOCUS_05630 11688 12032 gene locus_tag LOCUS_05640 11688 12032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 <13249 12096 gene locus_tag LOCUS_05650 <13249 12096 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010929970.1:membrane protein >Feature sequence040 2845 776 gene locus_tag LOCUS_05660 gene ispG 2845 776 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG23 protein_id gnl|my_center|LOCUS_05660 4590 3094 gene locus_tag LOCUS_05670 4590 3094 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ME4 protein_id gnl|my_center|LOCUS_05670 5835 4666 gene locus_tag LOCUS_05680 gene dxr 5835 4666 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK30 protein_id gnl|my_center|LOCUS_05680 6666 5836 gene locus_tag LOCUS_05690 gene cdsA 6666 5836 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VBI1 protein_id gnl|my_center|LOCUS_05690 7400 6711 gene locus_tag LOCUS_05700 gene uppS 7400 6711 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31751 protein_id gnl|my_center|LOCUS_05700 8418 7693 gene locus_tag LOCUS_05710 gene cysH 8418 7693 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJS4 protein_id gnl|my_center|LOCUS_05710 9856 8621 gene locus_tag LOCUS_05720 gene galK 9856 8621 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A3CML9 protein_id gnl|my_center|LOCUS_05720 10864 9884 gene locus_tag LOCUS_05730 10864 9884 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255969.1 protein_id gnl|my_center|LOCUS_05730 12534 11038 gene locus_tag LOCUS_05740 12534 11038 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870743.1 protein_id gnl|my_center|LOCUS_05740 13115 12645 gene locus_tag LOCUS_05750 13115 12645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 >Feature sequence041 494 315 gene locus_tag LOCUS_05760 494 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 1360 845 gene locus_tag LOCUS_05770 1360 845 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958442.1 protein_id gnl|my_center|LOCUS_05770 2968 1385 gene locus_tag LOCUS_05780 gene guaB 2968 1385 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZU8 protein_id gnl|my_center|LOCUS_05780 3068 4027 gene locus_tag LOCUS_05790 gene menC 3068 4027 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJP8 protein_id gnl|my_center|LOCUS_05790 4000 5379 gene locus_tag LOCUS_05800 gene menE 4000 5379 CDS product O-succinylbenzoic acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057063.1 protein_id gnl|my_center|LOCUS_05800 5448 5723 gene locus_tag LOCUS_05810 5448 5723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 5878 7614 gene locus_tag LOCUS_05820 5878 7614 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957611.1 protein_id gnl|my_center|LOCUS_05820 7774 9300 gene locus_tag LOCUS_05830 gene rny 7774 9300 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZZ6 protein_id gnl|my_center|LOCUS_05830 10890 9514 gene locus_tag LOCUS_05840 10890 9514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 12064 11012 gene locus_tag LOCUS_05850 12064 11012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021055.1 protein_id gnl|my_center|LOCUS_05850 >Feature sequence042 <1 1346 gene locus_tag LOCUS_05860 <1 1346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122787.1:helicase 1446 1643 gene locus_tag LOCUS_05870 1446 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 1722 2726 gene locus_tag LOCUS_05880 1722 2726 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX96 protein_id gnl|my_center|LOCUS_05880 5076 2797 gene locus_tag LOCUS_05890 5076 2797 CDS product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147064.1 protein_id gnl|my_center|LOCUS_05890 5763 5095 gene locus_tag LOCUS_05900 5763 5095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 7061 5826 gene locus_tag LOCUS_05910 7061 5826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 7255 8925 gene locus_tag LOCUS_05920 7255 8925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 10275 8971 gene locus_tag LOCUS_05930 10275 8971 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439596.1 protein_id gnl|my_center|LOCUS_05930 11387 10272 gene locus_tag LOCUS_05940 gene hisC2 11387 10272 CDS product histidinol-phosphate aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ68 protein_id gnl|my_center|LOCUS_05940 >Feature sequence043 1573 794 gene locus_tag LOCUS_05950 1573 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 2651 1671 gene locus_tag LOCUS_05960 2651 1671 CDS product oxidoreductase/dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_602267.1 protein_id gnl|my_center|LOCUS_05960 2801 4594 gene locus_tag LOCUS_05970 2801 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05970 6685 4871 gene locus_tag LOCUS_05980 6685 4871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 7276 6806 gene locus_tag LOCUS_05990 gene dnaQ 7276 6806 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963327.1 protein_id gnl|my_center|LOCUS_05990 8472 7360 gene locus_tag LOCUS_06000 8472 7360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 <12191 8499 gene locus_tag LOCUS_06010 <12191 8499 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109348.1:restriction endonuclease subunit M >Feature sequence044 <1 667 gene locus_tag LOCUS_06020 <1 667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RVD3:pseudouridine synthase 801 1886 gene locus_tag LOCUS_06030 801 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 2230 3213 gene locus_tag LOCUS_06040 2230 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 3341 5122 gene locus_tag LOCUS_06050 3341 5122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 5119 7470 gene locus_tag LOCUS_06060 5119 7470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 7467 8693 gene locus_tag LOCUS_06070 7467 8693 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708592.1 protein_id gnl|my_center|LOCUS_06070 8700 11066 gene locus_tag LOCUS_06080 8700 11066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 11832 11068 gene locus_tag LOCUS_06090 11832 11068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 >Feature sequence045 <1 898 gene locus_tag LOCUS_06100 <1 898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P43832:arginine--tRNA ligase 1223 4678 gene locus_tag LOCUS_06110 1223 4678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121009.1 protein_id gnl|my_center|LOCUS_06110 5339 4695 gene locus_tag LOCUS_06120 gene trpF 5339 4695 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MD92 protein_id gnl|my_center|LOCUS_06120 5661 6152 gene locus_tag LOCUS_06130 5661 6152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 6238 6311 gene locus_tag LOCUS_t00090 6238 6311 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 6726 8978 gene locus_tag LOCUS_06140 gene ccoN/ccoO 6726 8978 CDS product bifunctional cbb3-type cytochrome C oxidase subunit I/II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_06140 9009 9197 gene locus_tag LOCUS_06150 9009 9197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 9194 9775 gene locus_tag LOCUS_06160 9194 9775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 9932 11371 gene locus_tag LOCUS_06170 gene ccoG 9932 11371 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963297.1 protein_id gnl|my_center|LOCUS_06170 >Feature sequence046 2676 2119 gene locus_tag LOCUS_06180 2676 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 3013 4710 gene locus_tag LOCUS_06190 gene leuA-2 3013 4710 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAP9 protein_id gnl|my_center|LOCUS_06190 4810 5667 gene locus_tag LOCUS_06200 gene dapF 4810 5667 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZX7 protein_id gnl|my_center|LOCUS_06200 5821 7704 gene locus_tag LOCUS_06210 5821 7704 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460040.1 protein_id gnl|my_center|LOCUS_06210 8101 7910 gene locus_tag LOCUS_06220 8101 7910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 8290 10434 gene locus_tag LOCUS_06230 gene ppk 8290 10434 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGU8 protein_id gnl|my_center|LOCUS_06230 10494 11486 gene locus_tag LOCUS_06240 10494 11486 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038316.1 protein_id gnl|my_center|LOCUS_06240 >Feature sequence047 460 1155 gene locus_tag LOCUS_06250 gene ybbA 460 1155 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072831.1 protein_id gnl|my_center|LOCUS_06250 1499 2911 gene locus_tag LOCUS_06260 1499 2911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332558.1 protein_id gnl|my_center|LOCUS_06260 3234 3995 gene locus_tag LOCUS_06270 3234 3995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 4151 4909 gene locus_tag LOCUS_06280 4151 4909 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGZ8 protein_id gnl|my_center|LOCUS_06280 5021 5728 gene locus_tag LOCUS_06290 5021 5728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 5814 6395 gene locus_tag LOCUS_06300 5814 6395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 7198 6476 gene locus_tag LOCUS_06310 7198 6476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 9444 7258 gene locus_tag LOCUS_06320 gene ligA 9444 7258 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180F3 protein_id gnl|my_center|LOCUS_06320 9729 9463 gene locus_tag LOCUS_06330 9729 9463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 9881 9654 gene locus_tag LOCUS_06340 9881 9654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 11335 9965 gene locus_tag LOCUS_06350 gene hemG 11335 9965 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403969.1 protein_id gnl|my_center|LOCUS_06350 >Feature sequence048 <1 628 gene locus_tag LOCUS_06360 <1 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KNX6:FKBP-type peptidyl-prolyl cis-trans isomerase SlyD 786 3554 gene locus_tag LOCUS_06370 gene acnB 786 3554 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974111.1 protein_id gnl|my_center|LOCUS_06370 4944 4588 gene locus_tag LOCUS_06380 4944 4588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 5574 4972 gene locus_tag LOCUS_06390 5574 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 7056 5662 gene locus_tag LOCUS_06400 7056 5662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 7657 7139 gene locus_tag LOCUS_06410 7657 7139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 8259 7789 gene locus_tag LOCUS_06420 8259 7789 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080908.1 protein_id gnl|my_center|LOCUS_06420 9568 8387 gene locus_tag LOCUS_06430 gene tyrS 9568 8387 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYU8 protein_id gnl|my_center|LOCUS_06430 10090 9878 gene locus_tag LOCUS_06440 10090 9878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 10871 10629 gene locus_tag LOCUS_06450 10871 10629 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011171671.1 protein_id gnl|my_center|LOCUS_06450 >Feature sequence049 <1 595 gene locus_tag LOCUS_06460 <1 595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405282.1:VWA domain-containing protein 592 2595 gene locus_tag LOCUS_06470 592 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 2615 4408 gene locus_tag LOCUS_06480 2615 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405278.1 protein_id gnl|my_center|LOCUS_06480 4405 5145 gene locus_tag LOCUS_06490 4405 5145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 5258 6142 gene locus_tag LOCUS_06500 gene hibD 5258 6142 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879952.1 protein_id gnl|my_center|LOCUS_06500 7280 6258 gene locus_tag LOCUS_06510 gene tsaD 7280 6258 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z3M6 protein_id gnl|my_center|LOCUS_06510 8707 7454 gene locus_tag LOCUS_06520 8707 7454 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545828.1 protein_id gnl|my_center|LOCUS_06520 8795 9790 gene locus_tag LOCUS_06530 8795 9790 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545013.1 protein_id gnl|my_center|LOCUS_06530 9871 10101 gene locus_tag LOCUS_06540 gene rpmB 9871 10101 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CS2 protein_id gnl|my_center|LOCUS_06540 10334 11218 gene locus_tag LOCUS_06550 10334 11218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 >Feature sequence050 71 325 gene locus_tag LOCUS_06560 71 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 553 702 gene locus_tag LOCUS_06570 553 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 741 2030 gene locus_tag LOCUS_06580 741 2030 CDS product UDP-N-acetyl-D-glucosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118902.1 protein_id gnl|my_center|LOCUS_06580 2514 3815 gene locus_tag LOCUS_06590 2514 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 3849 4847 gene locus_tag LOCUS_06600 3849 4847 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_06600 4923 5090 gene locus_tag LOCUS_06610 4923 5090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 5101 6054 gene locus_tag LOCUS_06620 5101 6054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 6276 6734 gene locus_tag LOCUS_06630 6276 6734 CDS product putative tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HYB0 protein_id gnl|my_center|LOCUS_06630 7099 6737 gene locus_tag LOCUS_06640 7099 6737 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870369.1 protein_id gnl|my_center|LOCUS_06640 7852 7217 gene locus_tag LOCUS_06650 7852 7217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 8441 8130 gene locus_tag LOCUS_06660 8441 8130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 9397 8507 gene locus_tag LOCUS_06670 9397 8507 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLG6 protein_id gnl|my_center|LOCUS_06670 10358 9495 gene locus_tag LOCUS_06680 10358 9495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880814.1 protein_id gnl|my_center|LOCUS_06680 11188 10370 gene locus_tag LOCUS_06690 11188 10370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 >Feature sequence051 3105 484 gene locus_tag LOCUS_06700 3105 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 3294 3893 gene locus_tag LOCUS_06710 3294 3893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 4331 3906 gene locus_tag LOCUS_06720 4331 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329952.1 protein_id gnl|my_center|LOCUS_06720 5489 4389 gene locus_tag LOCUS_06730 5489 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 5677 6171 gene locus_tag LOCUS_06740 5677 6171 CDS product HIT family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146469.1 protein_id gnl|my_center|LOCUS_06740 6248 7198 gene locus_tag LOCUS_06750 gene phoH 6248 7198 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840510.1 protein_id gnl|my_center|LOCUS_06750 7290 9722 gene locus_tag LOCUS_06760 7290 9722 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392131.1 protein_id gnl|my_center|LOCUS_06760 9682 10152 gene locus_tag LOCUS_06770 gene ybeY 9682 10152 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1J7 protein_id gnl|my_center|LOCUS_06770 >Feature sequence052 1809 535 gene locus_tag LOCUS_06780 1809 535 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C893 protein_id gnl|my_center|LOCUS_06780 2832 1855 gene locus_tag LOCUS_06790 2832 1855 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257842.1 protein_id gnl|my_center|LOCUS_06790 3366 2950 gene locus_tag LOCUS_06800 3366 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 4503 3409 gene locus_tag LOCUS_06810 gene pdhA 4503 3409 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8U6 protein_id gnl|my_center|LOCUS_06810 5168 4623 gene locus_tag LOCUS_06820 5168 4623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 5929 5171 gene locus_tag LOCUS_06830 5929 5171 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333296.1 protein_id gnl|my_center|LOCUS_06830 6228 8963 gene locus_tag LOCUS_06840 gene valS 6228 8963 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q05873 protein_id gnl|my_center|LOCUS_06840 10781 9372 gene locus_tag LOCUS_06850 10781 9372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 >Feature sequence053 273 596 gene locus_tag LOCUS_06860 273 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 650 1903 gene locus_tag LOCUS_06870 650 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 3347 2001 gene locus_tag LOCUS_06880 3347 2001 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903476.1 protein_id gnl|my_center|LOCUS_06880 3702 3394 gene locus_tag LOCUS_06890 3702 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 3797 5425 gene locus_tag LOCUS_06900 3797 5425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 5452 6153 gene locus_tag LOCUS_06910 gene menG 5452 6153 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SH76 protein_id gnl|my_center|LOCUS_06910 8184 6271 gene locus_tag LOCUS_06920 gene purF 8184 6271 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_06920 9234 8296 gene locus_tag LOCUS_06930 9234 8296 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705495.1 protein_id gnl|my_center|LOCUS_06930 9398 9817 gene locus_tag LOCUS_06940 9398 9817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 >Feature sequence054 1421 408 gene locus_tag LOCUS_06950 1421 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 2385 1459 gene locus_tag LOCUS_06960 2385 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 2453 3001 gene locus_tag LOCUS_06970 2453 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 5145 3163 gene locus_tag LOCUS_06980 5145 3163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 5617 5228 gene locus_tag LOCUS_06990 5617 5228 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939303.1 protein_id gnl|my_center|LOCUS_06990 6840 5662 gene locus_tag LOCUS_07000 6840 5662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 7500 6844 gene locus_tag LOCUS_07010 7500 6844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 8843 7740 gene locus_tag LOCUS_07020 gene ychF 8843 7740 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3XYK0 protein_id gnl|my_center|LOCUS_07020 9215 10687 gene locus_tag LOCUS_07030 gene glcD-1 9215 10687 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_07030 >Feature sequence055 <1 829 gene locus_tag LOCUS_07040 <1 829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005462594.1:transporter NadC family protein 1022 843 gene locus_tag LOCUS_07050 1022 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 1099 2220 gene locus_tag LOCUS_07060 1099 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 2634 3290 gene locus_tag LOCUS_07070 2634 3290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268013.1 protein_id gnl|my_center|LOCUS_07070 3325 3963 gene locus_tag LOCUS_07080 3325 3963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 4032 4202 gene locus_tag LOCUS_07090 4032 4202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 4199 4783 gene locus_tag LOCUS_07100 4199 4783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 5309 4794 gene locus_tag LOCUS_07110 5309 4794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 8445 5338 gene locus_tag LOCUS_07120 8445 5338 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790618.1 protein_id gnl|my_center|LOCUS_07120 9654 8518 gene locus_tag LOCUS_07130 9654 8518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 <10718 9784 gene locus_tag LOCUS_07140 <10718 9784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947847.1:cellobiose phosphorylase >Feature sequence056 522 842 gene locus_tag LOCUS_07150 522 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 948 2213 gene locus_tag LOCUS_07160 948 2213 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946828.1 protein_id gnl|my_center|LOCUS_07160 2345 4141 gene locus_tag LOCUS_07170 2345 4141 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203354.1 protein_id gnl|my_center|LOCUS_07170 4193 4627 gene locus_tag LOCUS_07180 4193 4627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 4624 8412 gene locus_tag LOCUS_07190 4624 8412 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_07190 8473 8694 gene locus_tag LOCUS_07200 8473 8694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 9206 9009 gene locus_tag LOCUS_07210 9206 9009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 9288 10370 gene locus_tag LOCUS_07220 9288 10370 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947748.1 protein_id gnl|my_center|LOCUS_07220 >Feature sequence057 486 1463 gene locus_tag LOCUS_07230 486 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 1460 1873 gene locus_tag LOCUS_07240 1460 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 2614 3486 gene locus_tag LOCUS_07250 2614 3486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 3499 4080 gene locus_tag LOCUS_07260 3499 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 4083 4823 gene locus_tag LOCUS_07270 4083 4823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 4924 7251 gene locus_tag LOCUS_07280 4924 7251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 7238 7837 gene locus_tag LOCUS_07290 7238 7837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 8195 7779 gene locus_tag LOCUS_07300 8195 7779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 8376 8888 gene locus_tag LOCUS_07310 8376 8888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 8885 9859 gene locus_tag LOCUS_07320 8885 9859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 10021 9848 gene locus_tag LOCUS_07330 10021 9848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 10234 10569 gene locus_tag LOCUS_07340 10234 10569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 >Feature sequence058 120 1136 gene locus_tag LOCUS_07350 120 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 4507 1265 gene locus_tag LOCUS_07360 gene kefA 4507 1265 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120603.1 protein_id gnl|my_center|LOCUS_07360 5362 4769 gene locus_tag LOCUS_07370 gene tsf 5362 4769 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61333 protein_id gnl|my_center|LOCUS_07370 6227 5421 gene locus_tag LOCUS_07380 gene rpsB 6227 5421 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QVB8 protein_id gnl|my_center|LOCUS_07380 7453 6572 gene locus_tag LOCUS_07390 7453 6572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 7820 7620 gene locus_tag LOCUS_07400 7820 7620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 9270 7888 gene locus_tag LOCUS_07410 gene rumA 9270 7888 CDS product 23S rRNA (uracil-5-)-methyltransferase RumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546143.1 protein_id gnl|my_center|LOCUS_07410 9269 10078 gene locus_tag LOCUS_07420 9269 10078 CDS product 23S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227823.1 protein_id gnl|my_center|LOCUS_07420 >Feature sequence059 1235 354 gene locus_tag LOCUS_07430 1235 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 2659 1262 gene locus_tag LOCUS_07440 gene gadA 2659 1262 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E5Y7 protein_id gnl|my_center|LOCUS_07440 3014 3571 gene locus_tag LOCUS_07450 3014 3571 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021108.1 protein_id gnl|my_center|LOCUS_07450 3725 4447 gene locus_tag LOCUS_07460 3725 4447 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_07460 4480 5358 gene locus_tag LOCUS_07470 gene accD 4480 5358 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AI4 protein_id gnl|my_center|LOCUS_07470 5371 6669 gene locus_tag LOCUS_07480 gene folC 5371 6669 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723235.1 protein_id gnl|my_center|LOCUS_07480 6829 8469 gene locus_tag LOCUS_07490 6829 8469 CDS product potassium efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404996.1 protein_id gnl|my_center|LOCUS_07490 8466 10055 gene locus_tag LOCUS_07500 8466 10055 CDS product potassium transporter CPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404997.1 protein_id gnl|my_center|LOCUS_07500 >Feature sequence060 1897 1019 gene locus_tag LOCUS_07510 1897 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 2110 3378 gene locus_tag LOCUS_07520 gene hflX 2110 3378 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDT2 protein_id gnl|my_center|LOCUS_07520 4410 3382 gene locus_tag LOCUS_07530 4410 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 5378 4449 gene locus_tag LOCUS_07540 gene parA 5378 4449 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330043.1 protein_id gnl|my_center|LOCUS_07540 6140 5421 gene locus_tag LOCUS_07550 6140 5421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 7165 6209 gene locus_tag LOCUS_07560 7165 6209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 8325 7210 gene locus_tag LOCUS_07570 8325 7210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 8756 9658 gene locus_tag LOCUS_07580 8756 9658 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085310.1 protein_id gnl|my_center|LOCUS_07580 <10453 9745 gene locus_tag LOCUS_07590 <10453 9745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583832.1:ATP-dependent Clp protease ATP-binding subunit ClpC >Feature sequence061 2419 917 gene locus_tag LOCUS_07600 2419 917 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262844.1 protein_id gnl|my_center|LOCUS_07600 2863 2600 gene locus_tag LOCUS_07610 2863 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07610 3037 3357 gene locus_tag LOCUS_07620 3037 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 3393 4388 gene locus_tag LOCUS_07630 3393 4388 CDS product exported protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813087.1 protein_id gnl|my_center|LOCUS_07630 4887 4537 gene locus_tag LOCUS_07640 4887 4537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 5885 5094 gene locus_tag LOCUS_07650 5885 5094 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404334.1 protein_id gnl|my_center|LOCUS_07650 6898 5882 gene locus_tag LOCUS_07660 6898 5882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 9573 6895 gene locus_tag LOCUS_07670 9573 6895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 9874 9951 gene locus_tag LOCUS_t00100 9874 9951 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence062 1067 291 gene locus_tag LOCUS_07680 1067 291 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938542.1 protein_id gnl|my_center|LOCUS_07680 3095 1227 gene locus_tag LOCUS_07690 3095 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 3157 4449 gene locus_tag LOCUS_07700 gene sun 3157 4449 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KES9 protein_id gnl|my_center|LOCUS_07700 5883 4480 gene locus_tag LOCUS_07710 5883 4480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 7276 5924 gene locus_tag LOCUS_07720 gene glmM 7276 5924 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CID9 protein_id gnl|my_center|LOCUS_07720 8356 7298 gene locus_tag LOCUS_07730 gene trpD 8356 7298 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT49 protein_id gnl|my_center|LOCUS_07730 8489 9505 gene locus_tag LOCUS_07740 gene uppP3 8489 9505 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KML1 protein_id gnl|my_center|LOCUS_07740 >Feature sequence063 3090 2755 gene locus_tag LOCUS_07750 3090 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 3625 3215 gene locus_tag LOCUS_07760 3625 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 4304 3759 gene locus_tag LOCUS_07770 4304 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 4843 4394 gene locus_tag LOCUS_07780 4843 4394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 6236 4872 gene locus_tag LOCUS_07790 gene accC 6236 4872 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966833.1 protein_id gnl|my_center|LOCUS_07790 6724 6242 gene locus_tag LOCUS_07800 gene accB 6724 6242 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545496.1 protein_id gnl|my_center|LOCUS_07800 8200 6827 gene locus_tag LOCUS_07810 8200 6827 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259605.1 protein_id gnl|my_center|LOCUS_07810 8907 8209 gene locus_tag LOCUS_07820 8907 8209 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339011.1 protein_id gnl|my_center|LOCUS_07820 9212 8904 gene locus_tag LOCUS_07830 9212 8904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 >Feature sequence064 5469 5044 gene locus_tag LOCUS_07840 5469 5044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 6484 5501 gene locus_tag LOCUS_07850 gene fmt 6484 5501 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FM71 protein_id gnl|my_center|LOCUS_07850 7353 6508 gene locus_tag LOCUS_07860 7353 6508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 7437 8225 gene locus_tag LOCUS_07870 7437 8225 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090456.1 protein_id gnl|my_center|LOCUS_07870 >Feature sequence065 3307 1964 gene locus_tag LOCUS_07880 3307 1964 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035780.1 protein_id gnl|my_center|LOCUS_07880 9129 3514 gene locus_tag LOCUS_07890 gene uvrA 9129 3514 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63P87 protein_id gnl|my_center|LOCUS_07890 >Feature sequence066 1819 338 gene locus_tag LOCUS_07900 1819 338 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967491.1 protein_id gnl|my_center|LOCUS_07900 3229 2111 gene locus_tag LOCUS_07910 gene rhlE 3229 2111 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986366.1 protein_id gnl|my_center|LOCUS_07910 3471 3241 gene locus_tag LOCUS_07920 3471 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_274823.2 protein_id gnl|my_center|LOCUS_07920 3746 4906 gene locus_tag LOCUS_07930 3746 4906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143093.1 protein_id gnl|my_center|LOCUS_07930 4918 5967 gene locus_tag LOCUS_07940 4918 5967 CDS product amino-acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582642.1 protein_id gnl|my_center|LOCUS_07940 7186 7001 gene locus_tag LOCUS_07950 7186 7001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 7506 7300 gene locus_tag LOCUS_07960 7506 7300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 8722 7571 gene locus_tag LOCUS_07970 8722 7571 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957954.1 protein_id gnl|my_center|LOCUS_07970 <9818 8777 gene locus_tag LOCUS_07980 <9818 8777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000453500.1:IS110 family transposase >Feature sequence067 1037 1405 gene locus_tag LOCUS_07990 1037 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 1810 1520 gene locus_tag LOCUS_08000 1810 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 2698 1919 gene locus_tag LOCUS_08010 gene tcdA 2698 1919 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q57097 protein_id gnl|my_center|LOCUS_08010 2829 3587 gene locus_tag LOCUS_08020 2829 3587 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RY41 protein_id gnl|my_center|LOCUS_08020 3645 4079 gene locus_tag LOCUS_08030 gene aroQ 3645 4079 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RW91 protein_id gnl|my_center|LOCUS_08030 4159 4488 gene locus_tag LOCUS_08040 4159 4488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 7882 5324 gene locus_tag LOCUS_08050 7882 5324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 9188 8160 gene locus_tag LOCUS_08060 9188 8160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 >Feature sequence068 842 988 gene locus_tag LOCUS_08070 842 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 1314 1529 gene locus_tag LOCUS_08080 1314 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 1659 1880 gene locus_tag LOCUS_08090 1659 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 2402 2722 gene locus_tag LOCUS_08100 2402 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 3334 3726 gene locus_tag LOCUS_08110 3334 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 3710 4132 gene locus_tag LOCUS_08120 3710 4132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 5013 5261 gene locus_tag LOCUS_08130 5013 5261 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870423.1 protein_id gnl|my_center|LOCUS_08130 5258 5455 gene locus_tag LOCUS_08140 5258 5455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 6301 6528 gene locus_tag LOCUS_08150 6301 6528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_08150 6525 6860 gene locus_tag LOCUS_08160 6525 6860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142392.1 protein_id gnl|my_center|LOCUS_08160 7382 7912 gene locus_tag LOCUS_08170 7382 7912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 8576 8827 gene locus_tag LOCUS_08180 8576 8827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 8820 9305 gene locus_tag LOCUS_08190 8820 9305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 >Feature sequence069 922 2142 gene locus_tag LOCUS_08200 922 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 3184 2228 gene locus_tag LOCUS_08210 gene nosX 3184 2228 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92Z49 protein_id gnl|my_center|LOCUS_08210 4006 3239 gene locus_tag LOCUS_08220 4006 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 4530 4003 gene locus_tag LOCUS_08230 4530 4003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 5951 4599 gene locus_tag LOCUS_08240 5951 4599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 6329 6402 gene locus_tag LOCUS_t00110 6329 6402 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7456 6677 gene locus_tag LOCUS_08250 7456 6677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 8069 7560 gene locus_tag LOCUS_08260 8069 7560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 8794 8096 gene locus_tag LOCUS_08270 8794 8096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 9269 8892 gene locus_tag LOCUS_08280 9269 8892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 >Feature sequence070 1297 338 gene locus_tag LOCUS_08290 1297 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 1886 1287 gene locus_tag LOCUS_08300 1886 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 2350 1883 gene locus_tag LOCUS_08310 2350 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 2719 2937 gene locus_tag LOCUS_08320 2719 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 3803 2997 gene locus_tag LOCUS_08330 gene proC 3803 2997 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG91 protein_id gnl|my_center|LOCUS_08330 4922 3810 gene locus_tag LOCUS_08340 4922 3810 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546841.1 protein_id gnl|my_center|LOCUS_08340 5674 5036 gene locus_tag LOCUS_08350 5674 5036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 6555 5671 gene locus_tag LOCUS_08360 gene folD 6555 5671 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73RS2 protein_id gnl|my_center|LOCUS_08360 7547 6609 gene locus_tag LOCUS_08370 7547 6609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 8314 7580 gene locus_tag LOCUS_08380 8314 7580 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLS4 protein_id gnl|my_center|LOCUS_08380 8446 9192 gene locus_tag LOCUS_08390 gene fabG 8446 9192 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367190.1 protein_id gnl|my_center|LOCUS_08390 >Feature sequence071 3900 754 gene locus_tag LOCUS_08400 gene mexF 3900 754 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122351.1 protein_id gnl|my_center|LOCUS_08400 4958 3921 gene locus_tag LOCUS_08410 gene mexE 4958 3921 CDS product resistance-nodulation-cell division multidrug efflux membrane fusion protein MexE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103549.1 protein_id gnl|my_center|LOCUS_08410 6630 5161 gene locus_tag LOCUS_08420 6630 5161 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887698.1 protein_id gnl|my_center|LOCUS_08420 7949 6795 gene locus_tag LOCUS_08430 7949 6795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 8099 8674 gene locus_tag LOCUS_08440 8099 8674 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582959.1 protein_id gnl|my_center|LOCUS_08440 >Feature sequence072 308 1564 gene locus_tag LOCUS_08450 gene fabF 308 1564 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97DA7 protein_id gnl|my_center|LOCUS_08450 1910 2380 gene locus_tag LOCUS_08460 1910 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 2404 3717 gene locus_tag LOCUS_08470 2404 3717 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941261.1 protein_id gnl|my_center|LOCUS_08470 3756 5069 gene locus_tag LOCUS_08480 gene zraR 3756 5069 CDS product transcriptional regulatory protein ZraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z333 protein_id gnl|my_center|LOCUS_08480 5128 6864 gene locus_tag LOCUS_08490 5128 6864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 8199 6898 gene locus_tag LOCUS_08500 gene kdtA 8199 6898 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957353.1 protein_id gnl|my_center|LOCUS_08500 8880 8338 gene locus_tag LOCUS_08510 8880 8338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 9031 9120 gene locus_tag LOCUS_t00120 9031 9120 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence073 <1 641 gene locus_tag LOCUS_08520 <1 641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CV54:beta-glucosidase 661 2529 gene locus_tag LOCUS_08530 661 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 3670 3041 gene locus_tag LOCUS_08540 3670 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 5350 3800 gene locus_tag LOCUS_08550 5350 3800 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG3 protein_id gnl|my_center|LOCUS_08550 5522 6592 gene locus_tag LOCUS_08560 5522 6592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 6641 7816 gene locus_tag LOCUS_08570 6641 7816 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942324.1 protein_id gnl|my_center|LOCUS_08570 8053 8292 gene locus_tag LOCUS_08580 8053 8292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 >Feature sequence074 <1 639 gene locus_tag LOCUS_08590 <1 639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_426301.2:2-oxoglutarate dehydrogenase subunit E1 769 2028 gene locus_tag LOCUS_08600 gene aceF 769 2028 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F6S9 protein_id gnl|my_center|LOCUS_08600 2170 3573 gene locus_tag LOCUS_08610 gene lpdA2 2170 3573 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LK0 protein_id gnl|my_center|LOCUS_08610 5211 3709 gene locus_tag LOCUS_08620 5211 3709 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460435.1 protein_id gnl|my_center|LOCUS_08620 6800 5211 gene locus_tag LOCUS_08630 6800 5211 CDS product NADH dehydrogenase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813230.1 protein_id gnl|my_center|LOCUS_08630 <8707 6831 gene locus_tag LOCUS_08640 <8707 6831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460436.1:NADH-quinone oxidoreductase subunit L >Feature sequence075 201 3296 gene locus_tag LOCUS_08650 201 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 3314 4453 gene locus_tag LOCUS_08660 3314 4453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 4456 5268 gene locus_tag LOCUS_08670 4456 5268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 5300 5704 gene locus_tag LOCUS_08680 5300 5704 CDS product biopolymer transporter protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707897.1 protein_id gnl|my_center|LOCUS_08680 5708 6142 gene locus_tag LOCUS_08690 gene exbD 5708 6142 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118238.1 protein_id gnl|my_center|LOCUS_08690 6243 7625 gene locus_tag LOCUS_08700 6243 7625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 >Feature sequence076 2418 721 gene locus_tag LOCUS_08710 2418 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 3354 2521 gene locus_tag LOCUS_08720 gene rsmA 3354 2521 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z6K0 protein_id gnl|my_center|LOCUS_08720 4244 3435 gene locus_tag LOCUS_08730 gene trpC 4244 3435 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCF2 protein_id gnl|my_center|LOCUS_08730 6131 4518 gene locus_tag LOCUS_08740 gene pyrG 6131 4518 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJ86 protein_id gnl|my_center|LOCUS_08740 6527 7270 gene locus_tag LOCUS_08750 6527 7270 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257751.1 protein_id gnl|my_center|LOCUS_08750 >Feature sequence077 377 901 gene locus_tag LOCUS_08760 377 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 861 3794 gene locus_tag LOCUS_08770 861 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 3967 4824 gene locus_tag LOCUS_08780 3967 4824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895674.1 protein_id gnl|my_center|LOCUS_08780 5024 5689 gene locus_tag LOCUS_08790 gene cmk 5024 5689 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WTS4 protein_id gnl|my_center|LOCUS_08790 5745 6395 gene locus_tag LOCUS_08800 gene plsC 5745 6395 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873822.1 protein_id gnl|my_center|LOCUS_08800 6748 7938 gene locus_tag LOCUS_08810 6748 7938 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764417.1 protein_id gnl|my_center|LOCUS_08810 >Feature sequence078 784 356 gene locus_tag LOCUS_08820 gene vapC33 784 356 CDS product ribonuclease VapC33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WF69 protein_id gnl|my_center|LOCUS_08820 1032 781 gene locus_tag LOCUS_08830 1032 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 1876 2334 gene locus_tag LOCUS_08840 1876 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 2324 3433 gene locus_tag LOCUS_08850 2324 3433 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_08850 6762 3574 gene locus_tag LOCUS_08860 6762 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 >Feature sequence079 728 1867 gene locus_tag LOCUS_08870 gene pntA 728 1867 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123663.1 protein_id gnl|my_center|LOCUS_08870 1955 2236 gene locus_tag LOCUS_08880 1955 2236 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325302.1 protein_id gnl|my_center|LOCUS_08880 2281 3684 gene locus_tag LOCUS_08890 gene pntB 2281 3684 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIW3 protein_id gnl|my_center|LOCUS_08890 4369 3746 gene locus_tag LOCUS_08900 4369 3746 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036085.1 protein_id gnl|my_center|LOCUS_08900 4490 5833 gene locus_tag LOCUS_08910 4490 5833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 5956 7152 gene locus_tag LOCUS_08920 gene lys1 5956 7152 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937725.1 protein_id gnl|my_center|LOCUS_08920 <8222 7277 gene locus_tag LOCUS_08930 <8222 7277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EYJ5:sulfate adenylyltransferase subunit 1 >Feature sequence080 7 1839 gene locus_tag LOCUS_08940 7 1839 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WRW1 protein_id gnl|my_center|LOCUS_08940 2877 1927 gene locus_tag LOCUS_08950 2877 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 3797 3078 gene locus_tag LOCUS_08960 3797 3078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 6973 3794 gene locus_tag LOCUS_08970 6973 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 7608 6976 gene locus_tag LOCUS_08980 7608 6976 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_08980 >Feature sequence081 <1 709 gene locus_tag LOCUS_08990 <1 709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P54378:aminomethyltransferase 741 1220 gene locus_tag LOCUS_09000 741 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 1287 2831 gene locus_tag LOCUS_09010 gene lamB1 1287 2831 CDS product maltoporin-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZAS9 protein_id gnl|my_center|LOCUS_09010 4640 3399 gene locus_tag LOCUS_09020 4640 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 5211 4651 gene locus_tag LOCUS_09030 5211 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 5870 5238 gene locus_tag LOCUS_09040 gene sigE 5870 5238 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MGI0 protein_id gnl|my_center|LOCUS_09040 5987 7255 gene locus_tag LOCUS_09050 gene fabF 5987 7255 CDS product beta-ketoacyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118441.1 protein_id gnl|my_center|LOCUS_09050 7292 7540 gene locus_tag LOCUS_09060 7292 7540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 >Feature sequence082 570 3518 gene locus_tag LOCUS_09070 gene gcvP 570 3518 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AK84 protein_id gnl|my_center|LOCUS_09070 3751 4368 gene locus_tag LOCUS_09080 3751 4368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208071.1 protein_id gnl|my_center|LOCUS_09080 5501 4575 gene locus_tag LOCUS_09090 5501 4575 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_09090 5933 5520 gene locus_tag LOCUS_09100 5933 5520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 6232 6459 gene locus_tag LOCUS_09110 6232 6459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 6649 7227 gene locus_tag LOCUS_09120 6649 7227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 >Feature sequence083 1088 666 gene locus_tag LOCUS_09130 1088 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 1193 3541 gene locus_tag LOCUS_09140 gene topB 1193 3541 CDS product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97DB3 protein_id gnl|my_center|LOCUS_09140 3789 4835 gene locus_tag LOCUS_09150 3789 4835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 4832 5476 gene locus_tag LOCUS_09160 4832 5476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 5473 6051 gene locus_tag LOCUS_09170 5473 6051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 6061 6636 gene locus_tag LOCUS_09180 6061 6636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 >Feature sequence084 3518 1410 gene locus_tag LOCUS_09190 3518 1410 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071650.1 protein_id gnl|my_center|LOCUS_09190 4137 3568 gene locus_tag LOCUS_09200 4137 3568 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460653.1 protein_id gnl|my_center|LOCUS_09200 4316 5410 gene locus_tag LOCUS_09210 gene lptF 4316 5410 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942567.1 protein_id gnl|my_center|LOCUS_09210 5485 6969 gene locus_tag LOCUS_09220 gene pabB 5485 6969 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861217.1 protein_id gnl|my_center|LOCUS_09220 6954 7781 gene locus_tag LOCUS_09230 6954 7781 CDS product 4-amino-4-deoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957563.1 protein_id gnl|my_center|LOCUS_09230 >Feature sequence085 4397 3192 gene locus_tag LOCUS_09240 4397 3192 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527919.1 protein_id gnl|my_center|LOCUS_09240 5782 4394 gene locus_tag LOCUS_09250 gene ibeB 5782 4394 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123112.1 protein_id gnl|my_center|LOCUS_09250 5951 5811 gene locus_tag LOCUS_09260 5951 5811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 6730 6047 gene locus_tag LOCUS_09270 6730 6047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 <7942 6975 gene locus_tag LOCUS_09280 <7942 6975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q72AE2:methionine--tRNA ligase >Feature sequence086 <1 887 gene locus_tag LOCUS_09290 <1 887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037245.1:NAD(FAD)-utilizing dehydrogenase 1082 2341 gene locus_tag LOCUS_09300 1082 2341 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958440.1 protein_id gnl|my_center|LOCUS_09300 2644 4170 gene locus_tag LOCUS_09310 2644 4170 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDD3 protein_id gnl|my_center|LOCUS_09310 6518 4254 gene locus_tag LOCUS_09320 gene priA 6518 4254 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94461 protein_id gnl|my_center|LOCUS_09320 6898 6533 gene locus_tag LOCUS_09330 6898 6533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 7396 6911 gene locus_tag LOCUS_09340 7396 6911 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405408.1 protein_id gnl|my_center|LOCUS_09340 >Feature sequence087 705 1496 gene locus_tag LOCUS_09350 705 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 2395 1784 gene locus_tag LOCUS_09360 2395 1784 CDS product 3'-exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938381.1 protein_id gnl|my_center|LOCUS_09360 3434 2457 gene locus_tag LOCUS_09370 3434 2457 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220497.1 protein_id gnl|my_center|LOCUS_09370 4691 4014 gene locus_tag LOCUS_09380 4691 4014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 5652 6326 gene locus_tag LOCUS_09390 5652 6326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 7200 6481 gene locus_tag LOCUS_09400 7200 6481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 >Feature sequence088 <1 2775 gene locus_tag LOCUS_09410 <1 2775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8F435:UvrABC system protein A 4123 2846 gene locus_tag LOCUS_09420 gene ybdG 4123 2846 CDS product small conductance mechanosensitive ion channel protein YbdG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070528.1 protein_id gnl|my_center|LOCUS_09420 4352 5029 gene locus_tag LOCUS_09430 4352 5029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 5721 5041 gene locus_tag LOCUS_09440 5721 5041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 6040 5756 gene locus_tag LOCUS_09450 6040 5756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 >Feature sequence089 243 617 gene locus_tag LOCUS_09460 243 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 4178 687 gene locus_tag LOCUS_09470 4178 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 4401 5885 gene locus_tag LOCUS_09480 4401 5885 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331455.1 protein_id gnl|my_center|LOCUS_09480 5934 6788 gene locus_tag LOCUS_09490 5934 6788 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140509.1 protein_id gnl|my_center|LOCUS_09490 6812 7858 gene locus_tag LOCUS_09500 gene galM 6812 7858 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ38 protein_id gnl|my_center|LOCUS_09500 >Feature sequence090 <1 730 gene locus_tag LOCUS_09510 <1 730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_035249530.1:signal recognition particle-docking protein FtsY 873 1175 gene locus_tag LOCUS_09520 873 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 2244 1915 gene locus_tag LOCUS_09530 2244 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 3645 2353 gene locus_tag LOCUS_09540 gene pheA 3645 2353 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943245.1 protein_id gnl|my_center|LOCUS_09540 4438 3638 gene locus_tag LOCUS_09550 4438 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 4585 6300 gene locus_tag LOCUS_09560 gene ilvD 4585 6300 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF68 protein_id gnl|my_center|LOCUS_09560 >Feature sequence091 <1 1999 gene locus_tag LOCUS_09570 <1 1999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0C6P6B2:DNA topoisomerase 2103 3248 gene locus_tag LOCUS_09580 2103 3248 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388859.1 protein_id gnl|my_center|LOCUS_09580 3446 4132 gene locus_tag LOCUS_09590 3446 4132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 4142 4507 gene locus_tag LOCUS_09600 4142 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 4673 5701 gene locus_tag LOCUS_09610 gene lpxD 4673 5701 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AT5 protein_id gnl|my_center|LOCUS_09610 >Feature sequence092 146 778 gene locus_tag LOCUS_09620 146 778 CDS product transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382700.1 protein_id gnl|my_center|LOCUS_09620 1473 775 gene locus_tag LOCUS_09630 1473 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 1701 3653 gene locus_tag LOCUS_09640 1701 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 3704 4552 gene locus_tag LOCUS_09650 3704 4552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 4595 6970 gene locus_tag LOCUS_09660 4595 6970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 7700 7380 gene locus_tag LOCUS_09670 7700 7380 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687228.1 protein_id gnl|my_center|LOCUS_09670 >Feature sequence093 899 468 gene locus_tag LOCUS_09680 899 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 1610 2338 gene locus_tag LOCUS_09690 1610 2338 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ88 protein_id gnl|my_center|LOCUS_09690 3549 2335 gene locus_tag LOCUS_09700 3549 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 5815 4016 gene locus_tag LOCUS_09710 gene glmS 5815 4016 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIA9 protein_id gnl|my_center|LOCUS_09710 5943 7238 gene locus_tag LOCUS_09720 gene glgC 5943 7238 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674820.1 protein_id gnl|my_center|LOCUS_09720 >Feature sequence094 1951 1211 gene locus_tag LOCUS_09730 gene ispD 1951 1211 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFM0 protein_id gnl|my_center|LOCUS_09730 2760 2047 gene locus_tag LOCUS_09740 gene pyrF 2760 2047 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ97 protein_id gnl|my_center|LOCUS_09740 2919 3752 gene locus_tag LOCUS_09750 2919 3752 CDS product 4-diphosphocytidyl-2C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458917.1 protein_id gnl|my_center|LOCUS_09750 3813 5576 gene locus_tag LOCUS_09760 gene ptsI 3813 5576 CDS product phosphoenolpyruvate-protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183J1 protein_id gnl|my_center|LOCUS_09760 7512 5794 gene locus_tag LOCUS_09770 gene snf 7512 5794 CDS product sodium:calcium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881359.1 protein_id gnl|my_center|LOCUS_09770 >Feature sequence095 358 146 gene locus_tag LOCUS_09780 358 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 544 2352 gene locus_tag LOCUS_09790 gene cysJ 544 2352 CDS product sulfite reductase [NADPH] flavoprotein alpha-component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32214 protein_id gnl|my_center|LOCUS_09790 2386 3279 gene locus_tag LOCUS_09800 gene yihV 2386 3279 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331257.1 protein_id gnl|my_center|LOCUS_09800 3645 3460 gene locus_tag LOCUS_09810 3645 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 3950 3705 gene locus_tag LOCUS_09820 3950 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 4078 4926 gene locus_tag LOCUS_09830 4078 4926 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141899.1 protein_id gnl|my_center|LOCUS_09830 4962 5381 gene locus_tag LOCUS_09840 4962 5381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 5938 5681 gene locus_tag LOCUS_09850 5938 5681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 6179 6925 gene locus_tag LOCUS_09860 6179 6925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 >Feature sequence096 <1 909 gene locus_tag LOCUS_09870 <1 909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O66849:anthranilate synthase component 1 1045 2070 gene locus_tag LOCUS_09880 1045 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 3788 2211 gene locus_tag LOCUS_09890 gene lnt 3788 2211 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_09890 4686 3781 gene locus_tag LOCUS_09900 4686 3781 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946804.1 protein_id gnl|my_center|LOCUS_09900 5157 5630 gene locus_tag LOCUS_09910 5157 5630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 <7515 5732 gene locus_tag LOCUS_09920 <7515 5732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KD18:protein translocase subunit SecA >Feature sequence097 1558 2784 gene locus_tag LOCUS_09930 1558 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 2799 6098 gene locus_tag LOCUS_09940 2799 6098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 <7513 6116 gene locus_tag LOCUS_09950 <7513 6116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000262613.1:methionine synthase >Feature sequence098 2664 805 gene locus_tag LOCUS_09960 2664 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 3522 2812 gene locus_tag LOCUS_09970 3522 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 3762 3595 gene locus_tag LOCUS_09980 3762 3595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 3749 4555 gene locus_tag LOCUS_09990 3749 4555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095773.1 protein_id gnl|my_center|LOCUS_09990 4560 5243 gene locus_tag LOCUS_10000 4560 5243 CDS product toluene tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244588.1 protein_id gnl|my_center|LOCUS_10000 5250 6038 gene locus_tag LOCUS_10010 5250 6038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095770.1 protein_id gnl|my_center|LOCUS_10010 6687 6926 gene locus_tag LOCUS_10020 6687 6926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 6930 7325 gene locus_tag LOCUS_10030 6930 7325 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972683.1 protein_id gnl|my_center|LOCUS_10030 >Feature sequence099 1653 769 gene locus_tag LOCUS_10040 1653 769 CDS product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933176.1 protein_id gnl|my_center|LOCUS_10040 2698 1817 gene locus_tag LOCUS_10050 gene hisG 2698 1817 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KB10 protein_id gnl|my_center|LOCUS_10050 2838 3314 gene locus_tag LOCUS_10060 2838 3314 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142372.1 protein_id gnl|my_center|LOCUS_10060 3316 4065 gene locus_tag LOCUS_10070 gene phoB 3316 4065 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880155.1 protein_id gnl|my_center|LOCUS_10070 4388 4176 gene locus_tag LOCUS_10080 4388 4176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 5106 5180 gene locus_tag LOCUS_t00130 5106 5180 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence100 1481 1921 gene locus_tag LOCUS_10090 1481 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 4022 2205 gene locus_tag LOCUS_10100 4022 2205 CDS product sodium:sulfate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003705.1 protein_id gnl|my_center|LOCUS_10100 4846 4025 gene locus_tag LOCUS_10110 gene ctaG 4846 4025 CDS product cytochrome c oxidase assembly factor CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069017.1 protein_id gnl|my_center|LOCUS_10110 5315 4974 gene locus_tag LOCUS_10120 5315 4974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 5929 5327 gene locus_tag LOCUS_10130 gene qoxC 5929 5327 CDS product cytochrome aa3 quinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721631.1 protein_id gnl|my_center|LOCUS_10130 <7317 5980 gene locus_tag LOCUS_10140 <7317 5980 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q819N3:cytochrome c oxidase subunit 1 >Feature sequence101 1885 83 gene locus_tag LOCUS_10150 1885 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339303.1 protein_id gnl|my_center|LOCUS_10150 2177 2299 gene locus_tag LOCUS_10160 2177 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 2629 2880 gene locus_tag LOCUS_10170 gene yefM 2629 2880 CDS product antitoxin YefM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P69346 protein_id gnl|my_center|LOCUS_10170 2877 3131 gene locus_tag LOCUS_10180 2877 3131 CDS product toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964533.1 protein_id gnl|my_center|LOCUS_10180 3272 3559 gene locus_tag LOCUS_10190 3272 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 3658 4866 gene locus_tag LOCUS_10200 3658 4866 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258925.1 protein_id gnl|my_center|LOCUS_10200 4923 6893 gene locus_tag LOCUS_10210 gene glgE 4923 6893 CDS product alpha-1,4-glucan:maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAR6 protein_id gnl|my_center|LOCUS_10210 >Feature sequence102 1510 404 gene locus_tag LOCUS_10220 gene proB 1510 404 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKZ7 protein_id gnl|my_center|LOCUS_10220 2123 1566 gene locus_tag LOCUS_10230 gene frr 2123 1566 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YJ0 protein_id gnl|my_center|LOCUS_10230 2902 2162 gene locus_tag LOCUS_10240 gene pyrH 2902 2162 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97I64 protein_id gnl|my_center|LOCUS_10240 3086 3159 gene locus_tag LOCUS_t00140 3086 3159 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3866 3204 gene locus_tag LOCUS_10250 3866 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057912.1 protein_id gnl|my_center|LOCUS_10250 3940 4557 gene locus_tag LOCUS_10260 gene nadD 3940 4557 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DY31 protein_id gnl|my_center|LOCUS_10260 4565 4963 gene locus_tag LOCUS_10270 4565 4963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 5639 4950 gene locus_tag LOCUS_10280 gene truC 5639 4950 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261357.1 protein_id gnl|my_center|LOCUS_10280 5998 7110 gene locus_tag LOCUS_10290 5998 7110 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384289.1 protein_id gnl|my_center|LOCUS_10290 >Feature sequence103 346 570 gene locus_tag LOCUS_10300 346 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 714 974 gene locus_tag LOCUS_10310 714 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 1181 2644 gene locus_tag LOCUS_10320 1181 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 3159 2719 gene locus_tag LOCUS_10330 3159 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 4628 3279 gene locus_tag LOCUS_10340 4628 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 5152 4625 gene locus_tag LOCUS_10350 5152 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 6876 5260 gene locus_tag LOCUS_10360 6876 5260 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UH36 protein_id gnl|my_center|LOCUS_10360 >Feature sequence104 277 1557 gene locus_tag LOCUS_10370 277 1557 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119153.1 protein_id gnl|my_center|LOCUS_10370 2147 1572 gene locus_tag LOCUS_10380 2147 1572 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706500.1 protein_id gnl|my_center|LOCUS_10380 2995 2315 gene locus_tag LOCUS_10390 2995 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 3193 3690 gene locus_tag LOCUS_10400 3193 3690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 3706 4224 gene locus_tag LOCUS_10410 3706 4224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 4246 5262 gene locus_tag LOCUS_10420 4246 5262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 7058 5322 gene locus_tag LOCUS_10430 7058 5322 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578076.1 protein_id gnl|my_center|LOCUS_10430 >Feature sequence105 162 1445 gene locus_tag LOCUS_10440 162 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 1586 2176 gene locus_tag LOCUS_10450 1586 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 3652 2516 gene locus_tag LOCUS_10460 3652 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 4238 3843 gene locus_tag LOCUS_10470 4238 3843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 4671 4321 gene locus_tag LOCUS_10480 4671 4321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 4926 6461 gene locus_tag LOCUS_10490 4926 6461 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020819.1 protein_id gnl|my_center|LOCUS_10490 >Feature sequence106 536 381 gene locus_tag LOCUS_10500 536 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 773 846 gene locus_tag LOCUS_t00150 773 846 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1926 934 gene locus_tag LOCUS_10510 1926 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 5427 2011 gene locus_tag LOCUS_10520 5427 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 6107 5427 gene locus_tag LOCUS_10530 gene rnc 6107 5427 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PM40 protein_id gnl|my_center|LOCUS_10530 >Feature sequence107 1252 209 gene locus_tag LOCUS_10540 1252 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 2462 1281 gene locus_tag LOCUS_10550 2462 1281 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970506.1 protein_id gnl|my_center|LOCUS_10550 4012 2468 gene locus_tag LOCUS_10560 4012 2468 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940504.1 protein_id gnl|my_center|LOCUS_10560 5105 3993 gene locus_tag LOCUS_10570 5105 3993 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704993.1 protein_id gnl|my_center|LOCUS_10570 6738 5281 gene locus_tag LOCUS_10580 6738 5281 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118315.1 protein_id gnl|my_center|LOCUS_10580 >Feature sequence108 954 181 gene locus_tag LOCUS_10590 954 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 1067 1663 gene locus_tag LOCUS_10600 1067 1663 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869609.1 protein_id gnl|my_center|LOCUS_10600 1787 2011 gene locus_tag LOCUS_10610 1787 2011 CDS product iron transporter FeoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455496.1 protein_id gnl|my_center|LOCUS_10610 2011 4194 gene locus_tag LOCUS_10620 gene feoB 2011 4194 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F332 protein_id gnl|my_center|LOCUS_10620 4467 4931 gene locus_tag LOCUS_10630 4467 4931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 6649 5069 gene locus_tag LOCUS_10640 gene cimA 6649 5069 CDS product (R)-citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66682 protein_id gnl|my_center|LOCUS_10640 >Feature sequence109 8 83 gene locus_tag LOCUS_t00160 8 83 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2224 191 gene locus_tag LOCUS_10650 gene tkt 2224 191 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HG38 protein_id gnl|my_center|LOCUS_10650 2381 2806 gene locus_tag LOCUS_10660 2381 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 3839 2955 gene locus_tag LOCUS_10670 gene sucD 3839 2955 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JZP3 protein_id gnl|my_center|LOCUS_10670 5069 3876 gene locus_tag LOCUS_10680 gene sucC 5069 3876 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CPH5 protein_id gnl|my_center|LOCUS_10680 6236 5172 gene locus_tag LOCUS_10690 6236 5172 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RFK3 protein_id gnl|my_center|LOCUS_10690 6690 6316 gene locus_tag LOCUS_10700 6690 6316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 >Feature sequence110 197 472 gene locus_tag LOCUS_10710 197 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 2332 890 gene locus_tag LOCUS_10720 gene nrfA 2332 890 CDS product cytochrome c-552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJN5 protein_id gnl|my_center|LOCUS_10720 2871 2332 gene locus_tag LOCUS_10730 gene nrfC 2871 2332 CDS product cytochrome c nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325128.1 protein_id gnl|my_center|LOCUS_10730 4538 3078 gene locus_tag LOCUS_10740 gene cls 4538 3078 CDS product cardiolipin synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122347.1 protein_id gnl|my_center|LOCUS_10740 5310 5059 gene locus_tag LOCUS_10750 5310 5059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 6629 5322 gene locus_tag LOCUS_10760 gene hemL 6629 5322 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FRE3 protein_id gnl|my_center|LOCUS_10760 >Feature sequence111 897 49 gene locus_tag LOCUS_10770 897 49 CDS product lysine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974284.1 protein_id gnl|my_center|LOCUS_10770 1207 4935 gene locus_tag LOCUS_10780 gene smc 1207 4935 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S457 protein_id gnl|my_center|LOCUS_10780 5182 4985 gene locus_tag LOCUS_10790 5182 4985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 6253 5294 gene locus_tag LOCUS_10800 6253 5294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 >Feature sequence112 284 1507 gene locus_tag LOCUS_10810 284 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 1872 2207 gene locus_tag LOCUS_10820 1872 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 2914 2450 gene locus_tag LOCUS_10830 gene folA 2914 2450 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB86 protein_id gnl|my_center|LOCUS_10830 3764 2970 gene locus_tag LOCUS_10840 gene thyA 3764 2970 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JY72 protein_id gnl|my_center|LOCUS_10840 4200 3838 gene locus_tag LOCUS_10850 4200 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 5833 4784 gene locus_tag LOCUS_10860 gene dinB 5833 4784 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHU9 protein_id gnl|my_center|LOCUS_10860 6209 5886 gene locus_tag LOCUS_10870 6209 5886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 >Feature sequence113 1074 40 gene locus_tag LOCUS_10880 1074 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 2038 1241 gene locus_tag LOCUS_10890 2038 1241 CDS product pyruvate formate-lyase-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM95 protein_id gnl|my_center|LOCUS_10890 4374 2110 gene locus_tag LOCUS_10900 4374 2110 CDS product formate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056834.1 protein_id gnl|my_center|LOCUS_10900 4734 4991 gene locus_tag LOCUS_10910 4734 4991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 5896 4988 gene locus_tag LOCUS_10920 5896 4988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 >Feature sequence114 446 1933 gene locus_tag LOCUS_10930 gene argH 446 1933 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UCI6 protein_id gnl|my_center|LOCUS_10930 2580 1945 gene locus_tag LOCUS_10940 2580 1945 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325327.1 protein_id gnl|my_center|LOCUS_10940 3514 2600 gene locus_tag LOCUS_10950 3514 2600 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108322.1 protein_id gnl|my_center|LOCUS_10950 5167 3680 gene locus_tag LOCUS_10960 gene gltD 5167 3680 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_10960 <6822 5299 gene locus_tag LOCUS_10970 <6822 5299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_661305.1:glutamate synthase, large subunit >Feature sequence115 <1 1152 gene locus_tag LOCUS_10980 <1 1152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889170.1:2-nitropropane dioxygenase 2092 1355 gene locus_tag LOCUS_10990 2092 1355 CDS product 2-deoxyribose-5-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251054.1 protein_id gnl|my_center|LOCUS_10990 2163 2465 gene locus_tag LOCUS_11000 2163 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 2480 3277 gene locus_tag LOCUS_11010 gene deoD 2480 3277 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HE80 protein_id gnl|my_center|LOCUS_11010 4577 3279 gene locus_tag LOCUS_11020 4577 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104909.1 protein_id gnl|my_center|LOCUS_11020 6444 4585 gene locus_tag LOCUS_11030 gene mutL 6444 4585 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BP0 protein_id gnl|my_center|LOCUS_11030 >Feature sequence116 >Feature sequence117 <1 547 gene locus_tag LOCUS_11040 <1 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122776.1:RNA-binding protein 1223 669 gene locus_tag LOCUS_11050 1223 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 2333 1452 gene locus_tag LOCUS_11060 2333 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 4621 2528 gene locus_tag LOCUS_11070 gene fusA2 4621 2528 CDS product elongation factor G 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87M30 protein_id gnl|my_center|LOCUS_11070 5023 6438 gene locus_tag LOCUS_11080 5023 6438 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403679.1 protein_id gnl|my_center|LOCUS_11080 >Feature sequence118 109 966 gene locus_tag LOCUS_11090 109 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 963 1748 gene locus_tag LOCUS_11100 963 1748 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887606.1 protein_id gnl|my_center|LOCUS_11100 2425 1835 gene locus_tag LOCUS_11110 2425 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 3357 2737 gene locus_tag LOCUS_11120 3357 2737 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903191.1 protein_id gnl|my_center|LOCUS_11120 4433 3399 gene locus_tag LOCUS_11130 4433 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 4761 4537 gene locus_tag LOCUS_11140 4761 4537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 <6647 5058 gene locus_tag LOCUS_11150 <6647 5058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UHW9:acetolactate synthase >Feature sequence119 1393 818 gene locus_tag LOCUS_11160 1393 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 2004 1393 gene locus_tag LOCUS_11170 2004 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 2095 2778 gene locus_tag LOCUS_11180 2095 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 2768 4114 gene locus_tag LOCUS_11190 gene xseA 2768 4114 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXL8 protein_id gnl|my_center|LOCUS_11190 4528 5058 gene locus_tag LOCUS_11200 4528 5058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 5098 5490 gene locus_tag LOCUS_11210 5098 5490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 5595 6581 gene locus_tag LOCUS_11220 5595 6581 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797481.1 protein_id gnl|my_center|LOCUS_11220 >Feature sequence120 326 1381 gene locus_tag LOCUS_11230 326 1381 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073192.1 protein_id gnl|my_center|LOCUS_11230 2594 1998 gene locus_tag LOCUS_11240 gene recR 2594 1998 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAI4 protein_id gnl|my_center|LOCUS_11240 2915 2607 gene locus_tag LOCUS_11250 2915 2607 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5E5 protein_id gnl|my_center|LOCUS_11250 3531 3079 gene locus_tag LOCUS_11260 3531 3079 CDS product inosine-5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174003.1 protein_id gnl|my_center|LOCUS_11260 4541 3672 gene locus_tag LOCUS_11270 4541 3672 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266255.1 protein_id gnl|my_center|LOCUS_11270 4647 5567 gene locus_tag LOCUS_11280 gene hemF 4647 5567 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43898 protein_id gnl|my_center|LOCUS_11280 >Feature sequence121 199 438 gene locus_tag LOCUS_11290 199 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 1621 815 gene locus_tag LOCUS_11300 1621 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 2155 1634 gene locus_tag LOCUS_11310 2155 1634 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNG4 protein_id gnl|my_center|LOCUS_11310 2762 2148 gene locus_tag LOCUS_11320 2762 2148 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869392.1 protein_id gnl|my_center|LOCUS_11320 3650 2841 gene locus_tag LOCUS_11330 3650 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 4298 3783 gene locus_tag LOCUS_11340 4298 3783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404561.1 protein_id gnl|my_center|LOCUS_11340 5603 4455 gene locus_tag LOCUS_11350 5603 4455 CDS product 23S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257135.1 protein_id gnl|my_center|LOCUS_11350 6568 5615 gene locus_tag LOCUS_11360 6568 5615 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870030.1 protein_id gnl|my_center|LOCUS_11360 >Feature sequence122 1035 280 gene locus_tag LOCUS_11370 1035 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 1637 1032 gene locus_tag LOCUS_11380 1637 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 2787 1630 gene locus_tag LOCUS_11390 gene bioF 2787 1630 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z892 protein_id gnl|my_center|LOCUS_11390 3427 2768 gene locus_tag LOCUS_11400 gene bioD 3427 2768 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53558 protein_id gnl|my_center|LOCUS_11400 4380 3424 gene locus_tag LOCUS_11410 gene bioB 4380 3424 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I618 protein_id gnl|my_center|LOCUS_11410 5742 4384 gene locus_tag LOCUS_11420 gene bioA 5742 4384 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CT9 protein_id gnl|my_center|LOCUS_11420 6273 5989 gene locus_tag LOCUS_11430 6273 5989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 >Feature sequence123 922 338 gene locus_tag LOCUS_11440 922 338 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267143.1 protein_id gnl|my_center|LOCUS_11440 2340 943 gene locus_tag LOCUS_11450 2340 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 3123 2362 gene locus_tag LOCUS_11460 3123 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 4868 3168 gene locus_tag LOCUS_11470 4868 3168 CDS product general secretion pathway protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330716.1 protein_id gnl|my_center|LOCUS_11470 5516 5073 gene locus_tag LOCUS_11480 5516 5073 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177028.1 protein_id gnl|my_center|LOCUS_11480 5705 6256 gene locus_tag LOCUS_11490 5705 6256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 6423 6348 gene locus_tag LOCUS_t00170 6423 6348 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence124 1672 44 gene locus_tag LOCUS_11500 1672 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 2302 1844 gene locus_tag LOCUS_11510 2302 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 2711 3502 gene locus_tag LOCUS_11520 2711 3502 CDS product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582622.1 protein_id gnl|my_center|LOCUS_11520 3588 4514 gene locus_tag LOCUS_11530 gene xerC 3588 4514 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQY6 protein_id gnl|my_center|LOCUS_11530 4704 5690 gene locus_tag LOCUS_11540 4704 5690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 >Feature sequence125 3887 186 gene locus_tag LOCUS_11550 gene dnaE 3887 186 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I799 protein_id gnl|my_center|LOCUS_11550 4066 4719 gene locus_tag LOCUS_11560 gene yqjF 4066 4719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54543 protein_id gnl|my_center|LOCUS_11560 5587 4814 gene locus_tag LOCUS_11570 gene yvrD 5587 4814 CDS product putative oxidoreductase YvrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34782 protein_id gnl|my_center|LOCUS_11570 <6272 5624 gene locus_tag LOCUS_11580 <6272 5624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RH52:octanoyltransferase LipM >Feature sequence126 2994 796 gene locus_tag LOCUS_11590 gene recQ 2994 796 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142623.1 protein_id gnl|my_center|LOCUS_11590 4932 3115 gene locus_tag LOCUS_11600 4932 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 <6245 4939 gene locus_tag LOCUS_11610 <6245 4939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011017119.1:helicase SNF >Feature sequence127 353 1639 gene locus_tag LOCUS_11620 353 1639 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812916.1 protein_id gnl|my_center|LOCUS_11620 2292 3389 gene locus_tag LOCUS_11630 2292 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 3459 3701 gene locus_tag LOCUS_11640 3459 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 4118 5293 gene locus_tag LOCUS_11650 4118 5293 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 protein_id gnl|my_center|LOCUS_11650 <6242 5290 gene locus_tag LOCUS_11660 <6242 5290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118443.1:phytoene dehydrogenase >Feature sequence128 141 1163 gene locus_tag LOCUS_11670 gene hemB 141 1163 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WGF5 protein_id gnl|my_center|LOCUS_11670 2231 1176 gene locus_tag LOCUS_11680 2231 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_11680 2451 2948 gene locus_tag LOCUS_11690 2451 2948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 2990 3370 gene locus_tag LOCUS_11700 gene gcvH 2990 3370 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FJE8 protein_id gnl|my_center|LOCUS_11700 3512 5437 gene locus_tag LOCUS_11710 gene speA 3512 5437 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NE10 protein_id gnl|my_center|LOCUS_11710 >Feature sequence129 <1 586 gene locus_tag LOCUS_11720 <1 586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q6HDP2:superoxide dismutase 852 1364 gene locus_tag LOCUS_11730 852 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 2273 1572 gene locus_tag LOCUS_11740 2273 1572 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327344.1 protein_id gnl|my_center|LOCUS_11740 2823 2581 gene locus_tag LOCUS_11750 2823 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 5016 3097 gene locus_tag LOCUS_11760 5016 3097 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489375.1 protein_id gnl|my_center|LOCUS_11760 5638 5039 gene locus_tag LOCUS_11770 5638 5039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106328.1 protein_id gnl|my_center|LOCUS_11770 >Feature sequence130 2080 248 gene locus_tag LOCUS_11780 2080 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 3794 2136 gene locus_tag LOCUS_11790 3794 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 3973 5037 gene locus_tag LOCUS_11800 3973 5037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 5097 5471 gene locus_tag LOCUS_11810 gene nuoA1 5097 5471 CDS product NADH-quinone oxidoreductase subunit A 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GA8 protein_id gnl|my_center|LOCUS_11810 >Feature sequence131 1254 262 gene locus_tag LOCUS_11820 1254 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 2537 1383 gene locus_tag LOCUS_11830 2537 1383 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039748.1 protein_id gnl|my_center|LOCUS_11830 5176 2504 gene locus_tag LOCUS_11840 5176 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039747.1 protein_id gnl|my_center|LOCUS_11840 5467 5186 gene locus_tag LOCUS_11850 5467 5186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 <6145 5645 gene locus_tag LOCUS_11860 <6145 5645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022383.1:DUF1016 domain-containing protein >Feature sequence132 1386 451 gene locus_tag LOCUS_11870 1386 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 1964 2653 gene locus_tag LOCUS_11880 1964 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 2666 4153 gene locus_tag LOCUS_11890 2666 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 4156 4818 gene locus_tag LOCUS_11900 4156 4818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 >Feature sequence133 2727 3554 gene locus_tag LOCUS_11910 2727 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11910 3850 3680 gene locus_tag LOCUS_11920 3850 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 4016 4195 gene locus_tag LOCUS_11930 4016 4195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11930 4591 4370 gene locus_tag LOCUS_11940 4591 4370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 5026 5607 gene locus_tag LOCUS_11950 5026 5607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11950 >Feature sequence134 212 1990 gene locus_tag LOCUS_11960 212 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 2767 2072 gene locus_tag LOCUS_11970 2767 2072 CDS product DtxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728504.1 protein_id gnl|my_center|LOCUS_11970 2966 4117 gene locus_tag LOCUS_11980 2966 4117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 4198 5187 gene locus_tag LOCUS_11990 4198 5187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 >Feature sequence135 <1 2009 gene locus_tag LOCUS_12000 <1 2009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P18333:RNA polymerase sigma factor SigA 2050 2457 gene locus_tag LOCUS_12010 2050 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 2481 2786 gene locus_tag LOCUS_12020 2481 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 2982 3473 gene locus_tag LOCUS_12030 gene coaD 2982 3473 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EQJ2 protein_id gnl|my_center|LOCUS_12030 3616 4965 gene locus_tag LOCUS_12040 3616 4965 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651487.1 protein_id gnl|my_center|LOCUS_12040 >Feature sequence136 902 1222 gene locus_tag LOCUS_12050 902 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 1625 1924 gene locus_tag LOCUS_12060 1625 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 2005 2409 gene locus_tag LOCUS_12070 2005 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 2417 4246 gene locus_tag LOCUS_12080 2417 4246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 4483 4193 gene locus_tag LOCUS_12090 4483 4193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 4495 4674 gene locus_tag LOCUS_12100 4495 4674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 <6106 4784 gene locus_tag LOCUS_12110 <6106 4784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74C48:L-aspartate oxidase >Feature sequence137 <1 2289 gene locus_tag LOCUS_12120 <1 2289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000043635.1:translation initiation factor IF-2 2362 2715 gene locus_tag LOCUS_12130 2362 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 2702 3709 gene locus_tag LOCUS_12140 2702 3709 CDS product phosphoesterase RecJ-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392566.1 protein_id gnl|my_center|LOCUS_12140 3731 4459 gene locus_tag LOCUS_12150 3731 4459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 4472 5410 gene locus_tag LOCUS_12160 gene ribF 4472 5410 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VXK2 protein_id gnl|my_center|LOCUS_12160 >Feature sequence138 430 1194 gene locus_tag LOCUS_12170 430 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 >Feature sequence139 1005 268 gene locus_tag LOCUS_12180 1005 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 2063 1797 gene locus_tag LOCUS_12190 2063 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 1968 3512 gene locus_tag LOCUS_12200 1968 3512 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947578.1 protein_id gnl|my_center|LOCUS_12200 5507 3930 gene locus_tag LOCUS_12210 gene arsA 5507 3930 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122328.1 protein_id gnl|my_center|LOCUS_12210 >Feature sequence140 4170 2698 gene locus_tag LOCUS_12220 gene mloB 4170 2698 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891943.1 protein_id gnl|my_center|LOCUS_12220 4649 4167 gene locus_tag LOCUS_12230 4649 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 4922 4653 gene locus_tag LOCUS_12240 4922 4653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 >Feature sequence141 4 3090 gene locus_tag LOCUS_12250 4 3090 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943409.1 protein_id gnl|my_center|LOCUS_12250 3157 4749 gene locus_tag LOCUS_12260 3157 4749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 5579 4707 gene locus_tag LOCUS_12270 5579 4707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 >Feature sequence142 2247 589 gene locus_tag LOCUS_12280 2247 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765170.1 protein_id gnl|my_center|LOCUS_12280 3548 2361 gene locus_tag LOCUS_12290 3548 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 3743 4048 gene locus_tag LOCUS_12300 3743 4048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 >Feature sequence143 1121 720 gene locus_tag LOCUS_12310 1121 720 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681559.1 protein_id gnl|my_center|LOCUS_12310 1330 1103 gene locus_tag LOCUS_12320 1330 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 1797 2114 gene locus_tag LOCUS_12330 1797 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 2111 2389 gene locus_tag LOCUS_12340 2111 2389 CDS product plasmid maintenance system killer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_12340 2964 2632 gene locus_tag LOCUS_12350 2964 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 3253 2954 gene locus_tag LOCUS_12360 3253 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669612.1 protein_id gnl|my_center|LOCUS_12360 4437 3493 gene locus_tag LOCUS_12370 gene argF 4437 3493 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023243.1 protein_id gnl|my_center|LOCUS_12370 5650 4487 gene locus_tag LOCUS_12380 5650 4487 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459301.1 protein_id gnl|my_center|LOCUS_12380 >Feature sequence144 1473 115 gene locus_tag LOCUS_12390 gene ffh 1473 115 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BB4 protein_id gnl|my_center|LOCUS_12390 1721 3058 gene locus_tag LOCUS_12400 gene lpxC/fabZ 1721 3058 CDS product bifunctional enzyme LpxC/FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBX0 protein_id gnl|my_center|LOCUS_12400 3074 3850 gene locus_tag LOCUS_12410 gene lpxA 3074 3850 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63T24 protein_id gnl|my_center|LOCUS_12410 4656 3922 gene locus_tag LOCUS_12420 4656 3922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 <5768 4737 gene locus_tag LOCUS_12430 <5768 4737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DLM1:chorismate synthase >Feature sequence145 1439 789 gene locus_tag LOCUS_12440 1439 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 2428 1577 gene locus_tag LOCUS_12450 gene purU 2428 1577 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD6 protein_id gnl|my_center|LOCUS_12450 <5728 2502 gene locus_tag LOCUS_12460 <5728 2502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UJ58:carbamoyl-phosphate synthase large chain >Feature sequence146 2110 35 gene locus_tag LOCUS_12470 2110 35 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931283.1 protein_id gnl|my_center|LOCUS_12470 2501 2163 gene locus_tag LOCUS_12480 2501 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 3503 2613 gene locus_tag LOCUS_12490 3503 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 4058 3558 gene locus_tag LOCUS_12500 4058 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 >Feature sequence147 929 261 gene locus_tag LOCUS_12510 929 261 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404334.1 protein_id gnl|my_center|LOCUS_12510 3644 942 gene locus_tag LOCUS_12520 3644 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 4473 3769 gene locus_tag LOCUS_12530 4473 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 4532 4891 gene locus_tag LOCUS_12540 4532 4891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 >Feature sequence148 584 1705 gene locus_tag LOCUS_12550 584 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 1903 2844 gene locus_tag LOCUS_12560 1903 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 3254 2937 gene locus_tag LOCUS_12570 3254 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 3566 4411 gene locus_tag LOCUS_12580 3566 4411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 4398 4637 gene locus_tag LOCUS_12590 4398 4637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 >Feature sequence149 3201 898 gene locus_tag LOCUS_12600 3201 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 4584 3220 gene locus_tag LOCUS_12610 4584 3220 CDS product type I restriction-modification protein subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918507.1 protein_id gnl|my_center|LOCUS_12610 <5611 4584 gene locus_tag LOCUS_12620 <5611 4584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704240.1:restriction endonuclease subunit M >Feature sequence150 2486 744 gene locus_tag LOCUS_12630 2486 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 2796 3257 gene locus_tag LOCUS_12640 2796 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 4540 3416 gene locus_tag LOCUS_12650 4540 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 4995 4537 gene locus_tag LOCUS_12660 4995 4537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 >Feature sequence151 1312 287 gene locus_tag LOCUS_12670 1312 287 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121274.1 protein_id gnl|my_center|LOCUS_12670 1503 1309 gene locus_tag LOCUS_12680 1503 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 1909 1691 gene locus_tag LOCUS_12690 1909 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 2802 1951 gene locus_tag LOCUS_12700 2802 1951 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403707.1 protein_id gnl|my_center|LOCUS_12700 >Feature sequence152 1008 163 gene locus_tag LOCUS_12710 gene rfaP 1008 163 CDS product lipopolysaccharide core heptose(I) kinase RfaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUF7 protein_id gnl|my_center|LOCUS_12710 1937 1149 gene locus_tag LOCUS_12720 1937 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 2020 2898 gene locus_tag LOCUS_12730 2020 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 2962 4092 gene locus_tag LOCUS_12740 2962 4092 CDS product glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634235.1 protein_id gnl|my_center|LOCUS_12740 4097 5161 gene locus_tag LOCUS_12750 4097 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 >Feature sequence153 752 159 gene locus_tag LOCUS_12760 gene purN 752 159 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q833Z2 protein_id gnl|my_center|LOCUS_12760 2006 858 gene locus_tag LOCUS_12770 gene dnaJ 2006 858 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJD6 protein_id gnl|my_center|LOCUS_12770 2598 2023 gene locus_tag LOCUS_12780 2598 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 >Feature sequence154 2507 453 gene locus_tag LOCUS_12790 2507 453 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389852.1 protein_id gnl|my_center|LOCUS_12790 5368 2534 gene locus_tag LOCUS_12800 5368 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 >Feature sequence155 1542 400 gene locus_tag LOCUS_12810 1542 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 2310 1672 gene locus_tag LOCUS_12820 2310 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 2451 2831 gene locus_tag LOCUS_12830 2451 2831 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405261.1 protein_id gnl|my_center|LOCUS_12830 3591 4550 gene locus_tag LOCUS_12840 gene tal 3591 4550 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63W00 protein_id gnl|my_center|LOCUS_12840 4882 5253 gene locus_tag LOCUS_12850 4882 5253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 >Feature sequence156 246 995 gene locus_tag LOCUS_12860 246 995 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940725.1 protein_id gnl|my_center|LOCUS_12860 2277 1324 gene locus_tag LOCUS_12870 2277 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 2979 2299 gene locus_tag LOCUS_12880 2979 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 3525 2989 gene locus_tag LOCUS_12890 3525 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 3899 3579 gene locus_tag LOCUS_12900 3899 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 4550 4320 gene locus_tag LOCUS_12910 4550 4320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 >Feature sequence157 327 402 gene locus_tag LOCUS_t00180 327 402 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 601 1569 gene locus_tag LOCUS_12920 gene murK 601 1569 CDS product N-acetylmuramic acid/N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97ML3 protein_id gnl|my_center|LOCUS_12920 3208 1670 gene locus_tag LOCUS_12930 3208 1670 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938035.1 protein_id gnl|my_center|LOCUS_12930 4196 3336 gene locus_tag LOCUS_12940 gene hemC 4196 3336 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TJV6 protein_id gnl|my_center|LOCUS_12940 <5332 4367 gene locus_tag LOCUS_12950 <5332 4367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9Z565:ketol-acid reductoisomerase (NADP(+)) 1 >Feature sequence158 1533 385 gene locus_tag LOCUS_12960 1533 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WLM9 protein_id gnl|my_center|LOCUS_12960 2374 2066 gene locus_tag LOCUS_12970 2374 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 2477 2698 gene locus_tag LOCUS_12980 2477 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 2701 3606 gene locus_tag LOCUS_12990 2701 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 4202 3603 gene locus_tag LOCUS_13000 gene gmk 4202 3603 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJ36 protein_id gnl|my_center|LOCUS_13000 4749 4213 gene locus_tag LOCUS_13010 4749 4213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 >Feature sequence159 1548 1793 gene locus_tag LOCUS_13020 1548 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13020 1799 2686 gene locus_tag LOCUS_13030 1799 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13030 2683 3393 gene locus_tag LOCUS_13040 2683 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 4172 3402 gene locus_tag LOCUS_13050 4172 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 >Feature sequence160 374 1195 gene locus_tag LOCUS_13060 374 1195 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A669 protein_id gnl|my_center|LOCUS_13060 1255 1992 gene locus_tag LOCUS_13070 1255 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 2014 2883 gene locus_tag LOCUS_13080 gene rmlD 2014 2883 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943001.1 protein_id gnl|my_center|LOCUS_13080 2943 4004 gene locus_tag LOCUS_13090 gene rffG 2943 4004 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8I5 protein_id gnl|my_center|LOCUS_13090 >Feature sequence161 643 1587 gene locus_tag LOCUS_13100 643 1587 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117960.1 protein_id gnl|my_center|LOCUS_13100 1562 1756 gene locus_tag LOCUS_13110 1562 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 3049 3333 gene locus_tag LOCUS_13120 3049 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 3330 4040 gene locus_tag LOCUS_13130 3330 4040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 4157 5038 gene locus_tag LOCUS_13140 4157 5038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119280.1 protein_id gnl|my_center|LOCUS_13140 >Feature sequence162 106 510 gene locus_tag LOCUS_13150 106 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 542 1087 gene locus_tag LOCUS_13160 542 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 1505 1206 gene locus_tag LOCUS_13170 1505 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13170 2240 1542 gene locus_tag LOCUS_13180 2240 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13180 3276 2233 gene locus_tag LOCUS_13190 gene fabH 3276 2233 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123917.1 protein_id gnl|my_center|LOCUS_13190 4765 3392 gene locus_tag LOCUS_13200 4765 3392 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943105.1 protein_id gnl|my_center|LOCUS_13200 >Feature sequence163 585 2759 gene locus_tag LOCUS_13210 585 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 2772 3551 gene locus_tag LOCUS_13220 gene scpA 2772 3551 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C43 protein_id gnl|my_center|LOCUS_13220 3705 3995 gene locus_tag LOCUS_13230 3705 3995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 4014 4328 gene locus_tag LOCUS_13240 4014 4328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 4996 4421 gene locus_tag LOCUS_13250 4996 4421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 >Feature sequence164 <1 653 gene locus_tag LOCUS_13260 <1 653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267421.1:phosphoserine phosphatase 695 994 gene locus_tag LOCUS_13270 695 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 1028 1636 gene locus_tag LOCUS_13280 1028 1636 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108279.1 protein_id gnl|my_center|LOCUS_13280 1657 2178 gene locus_tag LOCUS_13290 1657 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 2292 3341 gene locus_tag LOCUS_13300 gene ruvB 2292 3341 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3F9 protein_id gnl|my_center|LOCUS_13300 3423 3989 gene locus_tag LOCUS_13310 3423 3989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 4277 4068 gene locus_tag LOCUS_13320 4277 4068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 >Feature sequence165 456 686 gene locus_tag LOCUS_13330 456 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 852 3440 gene locus_tag LOCUS_13340 852 3440 CDS product peptidase U32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140940.1 protein_id gnl|my_center|LOCUS_13340 4041 3571 gene locus_tag LOCUS_13350 4041 3571 CDS product transcription elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261386.1 protein_id gnl|my_center|LOCUS_13350 >Feature sequence166 139 1305 gene locus_tag LOCUS_13360 gene pncB 139 1305 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022501.1 protein_id gnl|my_center|LOCUS_13360 1346 1699 gene locus_tag LOCUS_13370 1346 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 2021 2650 gene locus_tag LOCUS_13380 2021 2650 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 protein_id gnl|my_center|LOCUS_13380 2718 2993 gene locus_tag LOCUS_13390 2718 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 3018 3440 gene locus_tag LOCUS_13400 3018 3440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 >Feature sequence167 <1 563 gene locus_tag LOCUS_13410 <1 563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140509.1:universal stress protein UspA 1408 560 gene locus_tag LOCUS_13420 gene lgt 1408 560 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG31 protein_id gnl|my_center|LOCUS_13420 1519 2127 gene locus_tag LOCUS_13430 1519 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 2130 3077 gene locus_tag LOCUS_13440 2130 3077 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393992.1 protein_id gnl|my_center|LOCUS_13440 4196 3093 gene locus_tag LOCUS_13450 4196 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 <5124 4392 gene locus_tag LOCUS_13460 <5124 4392 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461405.1:carboxynorspermidine decarboxylase >Feature sequence168 1212 34 gene locus_tag LOCUS_13470 gene pilC 1212 34 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_13470 2283 4130 gene locus_tag LOCUS_13480 gene yidC 2283 4130 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PAF9 protein_id gnl|my_center|LOCUS_13480 4224 4970 gene locus_tag LOCUS_13490 4224 4970 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F839 protein_id gnl|my_center|LOCUS_13490 >Feature sequence169 383 231 gene locus_tag LOCUS_13500 383 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 541 1890 gene locus_tag LOCUS_13510 gene thrC 541 1890 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942338.1 protein_id gnl|my_center|LOCUS_13510 2395 1970 gene locus_tag LOCUS_13520 2395 1970 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932212.1 protein_id gnl|my_center|LOCUS_13520 2635 4086 gene locus_tag LOCUS_13530 2635 4086 CDS product MucD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545685.1 protein_id gnl|my_center|LOCUS_13530 4086 4283 gene locus_tag LOCUS_13540 4086 4283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 >Feature sequence170 1133 840 gene locus_tag LOCUS_13550 1133 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 1396 1133 gene locus_tag LOCUS_13560 1396 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 2456 1410 gene locus_tag LOCUS_13570 gene xerD 2456 1410 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WTL7 protein_id gnl|my_center|LOCUS_13570 >Feature sequence171 1210 1713 gene locus_tag LOCUS_13580 1210 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089723.1 protein_id gnl|my_center|LOCUS_13580 1725 2783 gene locus_tag LOCUS_13590 1725 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 4951 3155 gene locus_tag LOCUS_13600 gene glgB 4951 3155 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHB1 protein_id gnl|my_center|LOCUS_13600 >Feature sequence172 232 309 gene locus_tag LOCUS_t00190 232 309 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 508 1209 gene locus_tag LOCUS_13610 508 1209 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583266.1 protein_id gnl|my_center|LOCUS_13610 1374 2738 gene locus_tag LOCUS_13620 1374 2738 CDS product carbon dioxide concentrating mechanism protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056989.1 protein_id gnl|my_center|LOCUS_13620 <4951 2891 gene locus_tag LOCUS_13630 <4951 2891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74CZ9:phenylalanine--tRNA ligase beta subunit >Feature sequence173 962 1324 gene locus_tag LOCUS_13640 962 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 1321 1764 gene locus_tag LOCUS_13650 1321 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 1745 2215 gene locus_tag LOCUS_13660 1745 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 2221 2787 gene locus_tag LOCUS_13670 2221 2787 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958442.1 protein_id gnl|my_center|LOCUS_13670 >Feature sequence174 272 1228 gene locus_tag LOCUS_13680 gene nadA 272 1228 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM90 protein_id gnl|my_center|LOCUS_13680 1538 2689 gene locus_tag LOCUS_13690 1538 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 4173 3883 gene locus_tag LOCUS_13700 4173 3883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 4447 4163 gene locus_tag LOCUS_13710 4447 4163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 >Feature sequence175 1150 878 gene locus_tag LOCUS_13720 1150 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 2323 1520 gene locus_tag LOCUS_13730 2323 1520 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704177.1 protein_id gnl|my_center|LOCUS_13730 3465 2443 gene locus_tag LOCUS_13740 gene queG 3465 2443 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WH3 protein_id gnl|my_center|LOCUS_13740 3658 4872 gene locus_tag LOCUS_13750 3658 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 >Feature sequence176 513 157 gene locus_tag LOCUS_13760 513 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 2851 596 gene locus_tag LOCUS_13770 2851 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 <4876 2857 gene locus_tag LOCUS_13780 <4876 2857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704238.1:type I restriction-modification system, restriction (R) subunit >Feature sequence177 1660 1199 gene locus_tag LOCUS_13790 1660 1199 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804034.1 protein_id gnl|my_center|LOCUS_13790 1800 2135 gene locus_tag LOCUS_13800 1800 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 2194 3543 gene locus_tag LOCUS_13810 2194 3543 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBV0 protein_id gnl|my_center|LOCUS_13810 4267 3614 gene locus_tag LOCUS_13820 4267 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 4296 4661 gene locus_tag LOCUS_13830 4296 4661 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942008.1 protein_id gnl|my_center|LOCUS_13830 >Feature sequence178 213 584 gene locus_tag LOCUS_13840 gene cutA 213 584 CDS product divalent cation tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226991.1 protein_id gnl|my_center|LOCUS_13840 1009 2382 gene locus_tag LOCUS_13850 1009 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227990.1 protein_id gnl|my_center|LOCUS_13850 2695 4665 gene locus_tag LOCUS_13860 2695 4665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 >Feature sequence179 <1 1167 gene locus_tag LOCUS_13870 <1 1167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E0I2:phospho-2-dehydro-3-deoxyheptonate aldolase 1281 1823 gene locus_tag LOCUS_13880 gene hpt 1281 1823 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420875.1 protein_id gnl|my_center|LOCUS_13880 2346 1948 gene locus_tag LOCUS_13890 2346 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 2555 2343 gene locus_tag LOCUS_13900 2555 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 >Feature sequence180 319 1086 gene locus_tag LOCUS_13910 319 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 1373 2209 gene locus_tag LOCUS_13920 1373 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 4291 3281 gene locus_tag LOCUS_13930 4291 3281 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388434.1 protein_id gnl|my_center|LOCUS_13930 >Feature sequence181 950 402 gene locus_tag LOCUS_13940 950 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 1173 2483 gene locus_tag LOCUS_13950 1173 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051537.1 protein_id gnl|my_center|LOCUS_13950 2929 3939 gene locus_tag LOCUS_13960 gene fic 2929 3939 CDS product adenosine monophosphate-protein transferase SoFic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9K5 protein_id gnl|my_center|LOCUS_13960 3947 4222 gene locus_tag LOCUS_13970 3947 4222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 >Feature sequence182 1681 764 gene locus_tag LOCUS_13980 gene xerD 1681 764 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIC9 protein_id gnl|my_center|LOCUS_13980 4614 1684 gene locus_tag LOCUS_13990 4614 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 >Feature sequence183 1439 456 gene locus_tag LOCUS_14000 gene mdh 1439 456 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4A2 protein_id gnl|my_center|LOCUS_14000 2610 1555 gene locus_tag LOCUS_14010 2610 1555 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KU34 protein_id gnl|my_center|LOCUS_14010 2725 3657 gene locus_tag LOCUS_14020 2725 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 4008 4283 gene locus_tag LOCUS_14030 gene hupB 4008 4283 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006081127.1 protein_id gnl|my_center|LOCUS_14030 >Feature sequence184 <1 773 gene locus_tag LOCUS_14040 <1 773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8PBB7:catalase-peroxidase 2070 1066 gene locus_tag LOCUS_14050 gene rnhC 2070 1066 CDS product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B0B9B5 protein_id gnl|my_center|LOCUS_14050 2138 3193 gene locus_tag LOCUS_14060 gene mutY 2138 3193 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284765.1 protein_id gnl|my_center|LOCUS_14060 3280 4392 gene locus_tag LOCUS_14070 3280 4392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 >Feature sequence185 1288 1884 gene locus_tag LOCUS_14080 1288 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 2001 2885 gene locus_tag LOCUS_14090 2001 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 <4663 4121 gene locus_tag LOCUS_14100 <4663 4121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087771.1:resolvase >Feature sequence186 3004 506 gene locus_tag LOCUS_14110 3004 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 4023 3001 gene locus_tag LOCUS_14120 4023 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14120 4515 4069 gene locus_tag LOCUS_14130 4515 4069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 >Feature sequence187 <1 1323 gene locus_tag LOCUS_14140 <1 1323 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011402874.1:pyridine nucleotide-disulfide oxidoreductase 1361 3355 gene locus_tag LOCUS_14150 1361 3355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 3421 4578 gene locus_tag LOCUS_14160 3421 4578 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121077.1 protein_id gnl|my_center|LOCUS_14160 >Feature sequence188 138 1073 gene locus_tag LOCUS_14170 138 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 1261 2280 gene locus_tag LOCUS_14180 1261 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 3374 2685 gene locus_tag LOCUS_14190 gene queE 3374 2685 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1N2 protein_id gnl|my_center|LOCUS_14190 4140 3706 gene locus_tag LOCUS_14200 4140 3706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 >Feature sequence189 373 2442 gene locus_tag LOCUS_14210 gene yoaA 373 2442 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121692.1 protein_id gnl|my_center|LOCUS_14210 2491 3207 gene locus_tag LOCUS_14220 2491 3207 CDS product serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058076.1 protein_id gnl|my_center|LOCUS_14220 3328 3633 gene locus_tag LOCUS_14230 3328 3633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 3654 4031 gene locus_tag LOCUS_14240 3654 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 >Feature sequence190 1052 177 gene locus_tag LOCUS_14250 1052 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 2020 1043 gene locus_tag LOCUS_14260 2020 1043 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261760.1 protein_id gnl|my_center|LOCUS_14260 2615 2118 gene locus_tag LOCUS_14270 2615 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 3208 2924 gene locus_tag LOCUS_14280 3208 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 4416 3283 gene locus_tag LOCUS_14290 4416 3283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 >Feature sequence191 407 1957 gene locus_tag LOCUS_14300 407 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 2196 2864 gene locus_tag LOCUS_14310 2196 2864 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230112.1 protein_id gnl|my_center|LOCUS_14310 2866 3714 gene locus_tag LOCUS_14320 2866 3714 CDS product urea amidolyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249287.1 protein_id gnl|my_center|LOCUS_14320 4154 3816 gene locus_tag LOCUS_14330 4154 3816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 >Feature sequence192 1138 368 gene locus_tag LOCUS_14340 1138 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 1228 2142 gene locus_tag LOCUS_14350 1228 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 2195 3178 gene locus_tag LOCUS_14360 2195 3178 CDS product putative phosphosugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67500 protein_id gnl|my_center|LOCUS_14360 >Feature sequence193 56 226 gene locus_tag LOCUS_14370 56 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 245 706 gene locus_tag LOCUS_14380 245 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14380 756 1349 gene locus_tag LOCUS_14390 756 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14390 1392 1919 gene locus_tag LOCUS_14400 1392 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14400 1973 2773 gene locus_tag LOCUS_14410 1973 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 2809 3942 gene locus_tag LOCUS_14420 2809 3942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 >Feature sequence194 442 813 gene locus_tag LOCUS_14430 442 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121586.1 protein_id gnl|my_center|LOCUS_14430 1586 1885 gene locus_tag LOCUS_14440 1586 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 2072 3583 gene locus_tag LOCUS_14450 2072 3583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 4202 3870 gene locus_tag LOCUS_14460 4202 3870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 >Feature sequence195 1588 149 gene locus_tag LOCUS_14470 1588 149 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228400.1 protein_id gnl|my_center|LOCUS_14470 1910 2308 gene locus_tag LOCUS_14480 1910 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 2564 3913 gene locus_tag LOCUS_14490 gene trkA 2564 3913 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327001.1 protein_id gnl|my_center|LOCUS_14490 >Feature sequence196 546 169 gene locus_tag LOCUS_14500 546 169 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203336.1 protein_id gnl|my_center|LOCUS_14500 1466 666 gene locus_tag LOCUS_14510 1466 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 1885 1472 gene locus_tag LOCUS_14520 1885 1472 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720851.1 protein_id gnl|my_center|LOCUS_14520 2658 1930 gene locus_tag LOCUS_14530 2658 1930 CDS product Tol-Pal system subunit TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_14530 2860 3969 gene locus_tag LOCUS_14540 2860 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 >Feature sequence197 1182 667 gene locus_tag LOCUS_14550 1182 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 1733 1179 gene locus_tag LOCUS_14560 1733 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 2184 1702 gene locus_tag LOCUS_14570 2184 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 2607 2416 gene locus_tag LOCUS_14580 2607 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 3436 2591 gene locus_tag LOCUS_14590 3436 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004804477.1 protein_id gnl|my_center|LOCUS_14590 <4425 3426 gene locus_tag LOCUS_14600 <4425 3426 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932358.1:DNA methyltransferase >Feature sequence198 517 134 gene locus_tag LOCUS_14610 517 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 656 781 gene locus_tag LOCUS_14620 656 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 1417 833 gene locus_tag LOCUS_14630 1417 833 CDS product CIA30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123297.1 protein_id gnl|my_center|LOCUS_14630 1635 2003 gene locus_tag LOCUS_14640 1635 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 2269 2000 gene locus_tag LOCUS_14650 2269 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 2567 2397 gene locus_tag LOCUS_14660 2567 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 3529 3209 gene locus_tag LOCUS_14670 gene yoaB 3529 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262907.1 protein_id gnl|my_center|LOCUS_14670 4057 3677 gene locus_tag LOCUS_14680 4057 3677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 >Feature sequence199 141 1298 gene locus_tag LOCUS_14690 141 1298 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035783.1 protein_id gnl|my_center|LOCUS_14690 1639 2739 gene locus_tag LOCUS_14700 1639 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 2732 3553 gene locus_tag LOCUS_14710 2732 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 3682 4230 gene locus_tag LOCUS_14720 3682 4230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 >Feature sequence200 941 150 gene locus_tag LOCUS_14730 941 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 2344 1079 gene locus_tag LOCUS_14740 2344 1079 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555861.1 protein_id gnl|my_center|LOCUS_14740 3731 2478 gene locus_tag LOCUS_14750 gene pilC 3731 2478 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_14750 <4379 3756 gene locus_tag LOCUS_14760 <4379 3756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123902.1:type IV fimbrial assembly protein PilB >Feature sequence201 65 895 gene locus_tag LOCUS_14770 65 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 1429 1920 gene locus_tag LOCUS_14780 1429 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 2670 2347 gene locus_tag LOCUS_14790 2670 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 3278 4249 gene locus_tag LOCUS_14800 3278 4249 CDS product ISL3 family transposase ISMac21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022377.1 protein_id gnl|my_center|LOCUS_14800 >Feature sequence202 486 405 gene locus_tag LOCUS_t00200 486 405 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 628 1059 gene locus_tag LOCUS_14810 628 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 1155 2003 gene locus_tag LOCUS_14820 1155 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 3037 2138 gene locus_tag LOCUS_14830 3037 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 3070 4245 gene locus_tag LOCUS_14840 3070 4245 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_14840 >Feature sequence203 236 1978 gene locus_tag LOCUS_14850 gene cafA 236 1978 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_14850 2057 3247 gene locus_tag LOCUS_14860 gene glxK 2057 3247 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039287.1 protein_id gnl|my_center|LOCUS_14860 3244 3903 gene locus_tag LOCUS_14870 3244 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 >Feature sequence204 1729 260 gene locus_tag LOCUS_14880 gene gatB 1729 260 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66766 protein_id gnl|my_center|LOCUS_14880 2138 1785 gene locus_tag LOCUS_14890 2138 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962310.1 protein_id gnl|my_center|LOCUS_14890 3668 2202 gene locus_tag LOCUS_14900 gene gatA 3668 2202 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Y7 protein_id gnl|my_center|LOCUS_14900 4110 3730 gene locus_tag LOCUS_14910 4110 3730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 >Feature sequence205 1125 2459 gene locus_tag LOCUS_14920 1125 2459 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583823.1 protein_id gnl|my_center|LOCUS_14920 >Feature sequence206 1208 147 gene locus_tag LOCUS_14930 1208 147 CDS product peptidase M24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020271.1 protein_id gnl|my_center|LOCUS_14930 1366 1884 gene locus_tag LOCUS_14940 1366 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 1884 3515 gene locus_tag LOCUS_14950 1884 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 >Feature sequence207 274 3072 gene locus_tag LOCUS_14960 gene glnD 274 3072 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C55 protein_id gnl|my_center|LOCUS_14960 >Feature sequence208 <1 955 gene locus_tag LOCUS_14970 <1 955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q72D86:GMP synthase [glutamine-hydrolyzing] 1024 1755 gene locus_tag LOCUS_14980 1024 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 1800 3095 gene locus_tag LOCUS_14990 gene hisD1 1800 3095 CDS product histidinol dehydrogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92S26 protein_id gnl|my_center|LOCUS_14990 3997 3296 gene locus_tag LOCUS_15000 3997 3296 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937553.1 protein_id gnl|my_center|LOCUS_15000 >Feature sequence209 517 1389 gene locus_tag LOCUS_15010 gene tatC 517 1389 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9L8 protein_id gnl|my_center|LOCUS_15010 1713 1465 gene locus_tag LOCUS_15020 1713 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 2050 2496 gene locus_tag LOCUS_15030 2050 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 2643 3422 gene locus_tag LOCUS_15040 2643 3422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 >Feature sequence210 <1 691 gene locus_tag LOCUS_15050 <1 691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681769.1:toxin Fic 1092 1853 gene locus_tag LOCUS_15060 1092 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228741.1 protein_id gnl|my_center|LOCUS_15060 2020 2484 gene locus_tag LOCUS_15070 2020 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 2590 3201 gene locus_tag LOCUS_15080 2590 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974802.1 protein_id gnl|my_center|LOCUS_15080 3198 4199 gene locus_tag LOCUS_15090 3198 4199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967225.1 protein_id gnl|my_center|LOCUS_15090 >Feature sequence211 22 1266 gene locus_tag LOCUS_15100 22 1266 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870908.1 protein_id gnl|my_center|LOCUS_15100 1576 2187 gene locus_tag LOCUS_15110 1576 2187 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF82 protein_id gnl|my_center|LOCUS_15110 2715 2209 gene locus_tag LOCUS_15120 gene tag 2715 2209 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957540.1 protein_id gnl|my_center|LOCUS_15120 3255 2935 gene locus_tag LOCUS_15130 3255 2935 CDS product UPF0345 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q186L5 protein_id gnl|my_center|LOCUS_15130 >Feature sequence212 1089 2333 gene locus_tag LOCUS_15140 gene lpxK 1089 2333 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AU2 protein_id gnl|my_center|LOCUS_15140 2428 3645 gene locus_tag LOCUS_15150 gene adk 2428 3645 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXV7 protein_id gnl|my_center|LOCUS_15150 >Feature sequence213 552 1454 gene locus_tag LOCUS_15160 552 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 1572 2981 gene locus_tag LOCUS_15170 1572 2981 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072107.1 protein_id gnl|my_center|LOCUS_15170 3075 3356 gene locus_tag LOCUS_15180 3075 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 3338 3733 gene locus_tag LOCUS_15190 3338 3733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 >Feature sequence214 1045 2844 gene locus_tag LOCUS_15200 gene cysJ 1045 2844 CDS product sulfite reductase [NADPH] flavoprotein alpha-component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32214 protein_id gnl|my_center|LOCUS_15200 2878 3795 gene locus_tag LOCUS_15210 gene yihV 2878 3795 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331257.1 protein_id gnl|my_center|LOCUS_15210 >Feature sequence215 160 85 gene locus_tag LOCUS_t00210 160 85 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1158 226 gene locus_tag LOCUS_15220 1158 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 2577 1210 gene locus_tag LOCUS_15230 2577 1210 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_15230 2698 3699 gene locus_tag LOCUS_15240 2698 3699 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330234.1 protein_id gnl|my_center|LOCUS_15240 >Feature sequence216 398 553 gene locus_tag LOCUS_15250 398 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 943 1839 gene locus_tag LOCUS_15260 gene prmA 943 1839 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN40 protein_id gnl|my_center|LOCUS_15260 1993 2820 gene locus_tag LOCUS_15270 1993 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 3458 2826 gene locus_tag LOCUS_15280 3458 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 <4168 3521 gene locus_tag LOCUS_15290 <4168 3521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5SJG0:UPF0365 protein >Feature sequence217 1243 794 gene locus_tag LOCUS_15300 1243 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 2785 1355 gene locus_tag LOCUS_15310 gene dnaA 2785 1355 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HQ03 protein_id gnl|my_center|LOCUS_15310 <4094 3291 gene locus_tag LOCUS_15320 <4094 3291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8F3J9:HPr kinase/phosphorylase >Feature sequence218 <1 672 gene locus_tag LOCUS_15330 <1 672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880851.1:sodium:dicarboxylate symporter 935 1393 gene locus_tag LOCUS_15340 935 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087890.1 protein_id gnl|my_center|LOCUS_15340 2853 1426 gene locus_tag LOCUS_15350 2853 1426 CDS product menaquinone-specific isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057055.1 protein_id gnl|my_center|LOCUS_15350 3078 3467 gene locus_tag LOCUS_15360 3078 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 4078 3605 gene locus_tag LOCUS_15370 4078 3605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 >Feature sequence219 871 611 gene locus_tag LOCUS_15380 871 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 1479 895 gene locus_tag LOCUS_15390 1479 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 >Feature sequence220 1923 379 gene locus_tag LOCUS_15400 gene xylB 1923 379 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762617.1 protein_id gnl|my_center|LOCUS_15400 3284 1980 gene locus_tag LOCUS_15410 gene xylA 3284 1980 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVG2 protein_id gnl|my_center|LOCUS_15410 3522 3449 gene locus_tag LOCUS_t00220 3522 3449 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence221 605 979 gene locus_tag LOCUS_15420 605 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 972 1487 gene locus_tag LOCUS_15430 972 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 1680 3557 gene locus_tag LOCUS_15440 1680 3557 CDS product polysaccharide biosynthesis protein CapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868795.1 protein_id gnl|my_center|LOCUS_15440 >Feature sequence222 <1 1550 gene locus_tag LOCUS_15450 <1 1550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007329904.1:tail-specific protease 1882 1754 gene locus_tag LOCUS_15460 1882 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 2057 3082 gene locus_tag LOCUS_15470 2057 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 3139 3381 gene locus_tag LOCUS_15480 3139 3381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 3381 3791 gene locus_tag LOCUS_15490 gene vapC 3381 3791 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q930F9 protein_id gnl|my_center|LOCUS_15490 >Feature sequence223 1574 873 gene locus_tag LOCUS_15500 1574 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 1661 2590 gene locus_tag LOCUS_15510 1661 2590 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804027.1 protein_id gnl|my_center|LOCUS_15510 2664 3683 gene locus_tag LOCUS_15520 gene birA 2664 3683 CDS product bifunctional ligase/repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CI75 protein_id gnl|my_center|LOCUS_15520 >Feature sequence224 2298 1093 gene locus_tag LOCUS_15530 2298 1093 CDS product toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 protein_id gnl|my_center|LOCUS_15530 2612 2295 gene locus_tag LOCUS_15540 2612 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 >Feature sequence225 197 676 gene locus_tag LOCUS_15550 197 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 1470 784 gene locus_tag LOCUS_15560 1470 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15560 1928 1455 gene locus_tag LOCUS_15570 1928 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15570 3563 2031 gene locus_tag LOCUS_15580 3563 2031 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673997.1 protein_id gnl|my_center|LOCUS_15580 >Feature sequence226 2086 770 gene locus_tag LOCUS_15590 2086 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 2250 3320 gene locus_tag LOCUS_15600 2250 3320 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKJ7 protein_id gnl|my_center|LOCUS_15600 3424 3663 gene locus_tag LOCUS_15610 3424 3663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 >Feature sequence227 1552 1001 gene locus_tag LOCUS_15620 1552 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 2337 1729 gene locus_tag LOCUS_15630 2337 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 2737 2330 gene locus_tag LOCUS_15640 2737 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 <3853 2830 gene locus_tag LOCUS_15650 <3853 2830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105653.1:DEAD/DEAH box helicase >Feature sequence228 <1 1792 gene locus_tag LOCUS_15660 <1 1792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_207833.1:type I restriction-modification system endonuclease 1927 2142 gene locus_tag LOCUS_15670 1927 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 2146 3717 gene locus_tag LOCUS_15680 2146 3717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 >Feature sequence229 643 1854 gene locus_tag LOCUS_15690 gene ftsA 643 1854 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K0X8 protein_id gnl|my_center|LOCUS_15690 1851 3152 gene locus_tag LOCUS_15700 gene ftsZ 1851 3152 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94337 protein_id gnl|my_center|LOCUS_15700 >Feature sequence230 407 1153 gene locus_tag LOCUS_15710 407 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 2526 1150 gene locus_tag LOCUS_15720 2526 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 <3761 2698 gene locus_tag LOCUS_15730 <3761 2698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KRB0:3-phosphoshikimate 1-carboxyvinyltransferase >Feature sequence231 1383 703 gene locus_tag LOCUS_15740 1383 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 2132 1578 gene locus_tag LOCUS_15750 2132 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 3208 2216 gene locus_tag LOCUS_15760 3208 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 <3744 3174 gene locus_tag LOCUS_15770 <3744 3174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q18C47:dihydroorotase >Feature sequence232 1333 470 gene locus_tag LOCUS_15780 1333 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 2049 1402 gene locus_tag LOCUS_15790 2049 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 2586 2281 gene locus_tag LOCUS_15800 gene ptsH 2586 2281 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668605.1 protein_id gnl|my_center|LOCUS_15800 <3706 2800 gene locus_tag LOCUS_15810 <3706 2800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031376.1:ABC transporter ATP-binding protein >Feature sequence233 <1 1056 gene locus_tag LOCUS_15820 <1 1056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939302.1:alkaline phosphatase 1068 3134 gene locus_tag LOCUS_15830 1068 3134 CDS product ATP-dependent Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939301.1 protein_id gnl|my_center|LOCUS_15830 >Feature sequence234 <1 762 gene locus_tag LOCUS_15840 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257750.1:succinate dehydrogenase flavoprotein subunit 789 1547 gene locus_tag LOCUS_15850 789 1547 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_15850 1812 3413 gene locus_tag LOCUS_15860 gene omcB 1812 3413 CDS product large cysteine-rich periplasmic protein OmcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23700 protein_id gnl|my_center|LOCUS_15860 >Feature sequence235 2171 957 gene locus_tag LOCUS_15870 2171 957 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGC1 protein_id gnl|my_center|LOCUS_15870 3549 2224 gene locus_tag LOCUS_15880 3549 2224 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIE4 protein_id gnl|my_center|LOCUS_15880 >Feature sequence236 1508 2290 gene locus_tag LOCUS_15890 gene hisA 1508 2290 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QK7 protein_id gnl|my_center|LOCUS_15890 2986 3543 gene locus_tag LOCUS_15900 2986 3543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 >Feature sequence237 255 935 gene locus_tag LOCUS_15910 255 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 935 1522 gene locus_tag LOCUS_15920 935 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 1564 2229 gene locus_tag LOCUS_15930 1564 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 2365 2904 gene locus_tag LOCUS_15940 2365 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 >Feature sequence238 <1 1134 gene locus_tag LOCUS_15950 <1 1134 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9RTF6:deoxyguanosinetriphosphate triphosphohydrolase-like protein 2 2738 1131 gene locus_tag LOCUS_15960 2738 1131 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869365.1 protein_id gnl|my_center|LOCUS_15960 >Feature sequence239 1530 610 gene locus_tag LOCUS_15970 1530 610 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257720.1 protein_id gnl|my_center|LOCUS_15970 2247 1612 gene locus_tag LOCUS_15980 2247 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 2507 2340 gene locus_tag LOCUS_15990 2507 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 3250 2519 gene locus_tag LOCUS_16000 3250 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 3474 3247 gene locus_tag LOCUS_16010 3474 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 >Feature sequence240 1693 161 gene locus_tag LOCUS_16020 1693 161 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937421.1 protein_id gnl|my_center|LOCUS_16020 1910 2383 gene locus_tag LOCUS_16030 1910 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 3335 2367 gene locus_tag LOCUS_16040 3335 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 >Feature sequence241 1174 1944 gene locus_tag LOCUS_16050 1174 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 1963 2748 gene locus_tag LOCUS_16060 1963 2748 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030712.1 protein_id gnl|my_center|LOCUS_16060 2804 3247 gene locus_tag LOCUS_16070 gene rlmH 2804 3247 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VCH9 protein_id gnl|my_center|LOCUS_16070 3549 3459 gene locus_tag LOCUS_t00230 3549 3459 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence242 797 147 gene locus_tag LOCUS_16080 797 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941153.1 protein_id gnl|my_center|LOCUS_16080 927 2246 gene locus_tag LOCUS_16090 gene ugdH 927 2246 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118525.1 protein_id gnl|my_center|LOCUS_16090 >Feature sequence243 <1 1021 gene locus_tag LOCUS_16100 <1 1021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583708.1:glutamine--scyllo-inositol aminotransferase 1071 1310 gene locus_tag LOCUS_16110 1071 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 1307 1696 gene locus_tag LOCUS_16120 1307 1696 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143544.1 protein_id gnl|my_center|LOCUS_16120 1727 3481 gene locus_tag LOCUS_16130 gene msbA 1727 3481 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_16130 >Feature sequence244 188 784 gene locus_tag LOCUS_16140 188 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 784 909 gene locus_tag LOCUS_16150 784 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 913 1137 gene locus_tag LOCUS_16160 913 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 2603 1638 gene locus_tag LOCUS_16170 2603 1638 CDS product cell filamentation protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957282.1 protein_id gnl|my_center|LOCUS_16170 2803 3405 gene locus_tag LOCUS_16180 2803 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 >Feature sequence245 751 188 gene locus_tag LOCUS_16190 751 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 848 923 gene locus_tag LOCUS_t00240 848 923 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence246 <3415 1200 gene locus_tag LOCUS_16200 <3415 1200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005796991.1:DNA polymerase I >Feature sequence247 191 1291 gene locus_tag LOCUS_16210 191 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 >Feature sequence248 1778 426 gene locus_tag LOCUS_16220 1778 426 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546821.1 protein_id gnl|my_center|LOCUS_16220 >Feature sequence249 583 1092 gene locus_tag LOCUS_16230 583 1092 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225858.1 protein_id gnl|my_center|LOCUS_16230 1120 1238 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gatggcgatggggtcagtccacg 2206 1229 gene locus_tag LOCUS_16240 2206 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 2600 2238 gene locus_tag LOCUS_16250 2600 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 >Feature sequence250 304 3165 gene locus_tag LOCUS_16260 gene rapA 304 3165 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGL5 protein_id gnl|my_center|LOCUS_16260 >Feature sequence251 <1 1476 gene locus_tag LOCUS_16270 <1 1476 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to K0MK29:ribonucleoside-diphosphate reductase 2499 1921 gene locus_tag LOCUS_16280 gene clpP 2499 1921 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4T6 protein_id gnl|my_center|LOCUS_16280 2991 2548 gene locus_tag LOCUS_16290 2991 2548 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721856.1 protein_id gnl|my_center|LOCUS_16290 >Feature sequence252 872 1213 gene locus_tag LOCUS_16300 872 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 1308 1745 gene locus_tag LOCUS_16310 gene arsC 1308 1745 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933387.1 protein_id gnl|my_center|LOCUS_16310 1765 2811 gene locus_tag LOCUS_16320 1765 2811 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462028.1 protein_id gnl|my_center|LOCUS_16320 >Feature sequence253 <1 768 gene locus_tag LOCUS_16330 <1 768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8YAC5:type III pantothenate kinase 868 2109 gene locus_tag LOCUS_16340 868 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_16340 3163 2309 gene locus_tag LOCUS_16350 gene prmC 3163 2309 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748B2 protein_id gnl|my_center|LOCUS_16350 >Feature sequence254 2624 1188 gene locus_tag LOCUS_16360 2624 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 <3252 2617 gene locus_tag LOCUS_16370 <3252 2617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8Y4D8:peptide chain release factor 2 >Feature sequence255 244 633 gene locus_tag LOCUS_16380 244 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 2114 987 gene locus_tag LOCUS_16390 2114 987 CDS product IS91 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118153.1 protein_id gnl|my_center|LOCUS_16390 3028 2111 gene locus_tag LOCUS_16400 3028 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 >Feature sequence256 3149 1713 gene locus_tag LOCUS_16410 gene cysS 3149 1713 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MGC2 protein_id gnl|my_center|LOCUS_16410 >Feature sequence257 104 1495 gene locus_tag LOCUS_16420 gene cca 104 1495 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5D4 protein_id gnl|my_center|LOCUS_16420 2989 1799 gene locus_tag LOCUS_16430 gene lpxB 2989 1799 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83DS5 protein_id gnl|my_center|LOCUS_16430 >Feature sequence258 1851 91 gene locus_tag LOCUS_16440 1851 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 >Feature sequence259 1334 117 gene locus_tag LOCUS_16450 1334 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 2996 1662 gene locus_tag LOCUS_16460 2996 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 >Feature sequence260 359 2356 gene locus_tag LOCUS_16470 359 2356 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X0W5 protein_id gnl|my_center|LOCUS_16470 >Feature sequence261 753 1421 gene locus_tag LOCUS_16480 753 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 <3023 1566 gene locus_tag LOCUS_16490 <3023 1566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005454162.1:arylsulfatase >Feature sequence262 106 1050 gene locus_tag LOCUS_16500 gene uxs 106 1050 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942460.1 protein_id gnl|my_center|LOCUS_16500 1078 2073 gene locus_tag LOCUS_16510 1078 2073 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWC5 protein_id gnl|my_center|LOCUS_16510 >Feature sequence263 5 2038 gene locus_tag LOCUS_16520 gene gyrA 5 2038 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HXQ3 protein_id gnl|my_center|LOCUS_16520 2912 2400 gene locus_tag LOCUS_16530 2912 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 >Feature sequence264 603 836 gene locus_tag LOCUS_16540 603 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 1881 961 gene locus_tag LOCUS_16550 1881 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038852.1 protein_id gnl|my_center|LOCUS_16550 >Feature sequence265 <2901 2262 gene locus_tag LOCUS_16560 <2901 2262 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DGG0:aminotransferase >Feature sequence266 215 688 gene locus_tag LOCUS_16570 gene rplO 215 688 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58121 protein_id gnl|my_center|LOCUS_16570 729 2243 gene locus_tag LOCUS_16580 gene secY 729 2243 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAJ1 protein_id gnl|my_center|LOCUS_16580 >Feature sequence267 171 854 gene locus_tag LOCUS_16590 171 854 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_16590 1519 857 gene locus_tag LOCUS_16600 1519 857 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393503.1 protein_id gnl|my_center|LOCUS_16600 2182 1520 gene locus_tag LOCUS_16610 gene gph-2 2182 1520 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN24 protein_id gnl|my_center|LOCUS_16610 2535 2611 gene locus_tag LOCUS_t00250 2535 2611 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence268 1947 550 gene locus_tag LOCUS_16620 gene lpdA2 1947 550 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI6 protein_id gnl|my_center|LOCUS_16620 2723 2232 gene locus_tag LOCUS_16630 2723 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 >Feature sequence269 537 1208 gene locus_tag LOCUS_16640 537 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 1205 1837 gene locus_tag LOCUS_16650 1205 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 1953 2414 gene locus_tag LOCUS_16660 1953 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 >Feature sequence270 2141 1479 gene locus_tag LOCUS_16670 2141 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 2449 2195 gene locus_tag LOCUS_16680 2449 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 2714 2463 gene locus_tag LOCUS_16690 2714 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 >Feature sequence271 1127 39 gene locus_tag LOCUS_16700 gene prfA 1127 39 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B9V1 protein_id gnl|my_center|LOCUS_16700 1604 1783 gene locus_tag LOCUS_16710 1604 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 2038 2496 gene locus_tag LOCUS_16720 2038 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 >Feature sequence272 688 290 gene locus_tag LOCUS_16730 688 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 1294 719 gene locus_tag LOCUS_16740 1294 719 CDS product biopolymer transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064089.1 protein_id gnl|my_center|LOCUS_16740 1987 1382 gene locus_tag LOCUS_16750 gene leuD 1987 1382 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZND4 protein_id gnl|my_center|LOCUS_16750 <2743 2067 gene locus_tag LOCUS_16760 <2743 2067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9ZND5:3-isopropylmalate dehydratase large subunit >Feature sequence273 336 932 gene locus_tag LOCUS_16770 336 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 1170 943 gene locus_tag LOCUS_16780 1170 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 1379 2221 gene locus_tag LOCUS_16790 gene atpB 1379 2221 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFX3 protein_id gnl|my_center|LOCUS_16790 2310 2516 gene locus_tag LOCUS_16800 2310 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 >Feature sequence274 <2698 392 gene locus_tag LOCUS_16810 <2698 392 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120395.1:nuclease >Feature sequence275 99 25 gene locus_tag LOCUS_t00260 99 25 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 784 1866 gene locus_tag LOCUS_16820 gene nrdB 784 1866 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MK81 protein_id gnl|my_center|LOCUS_16820 >Feature sequence276 778 536 gene locus_tag LOCUS_16830 778 536 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764038.1 protein_id gnl|my_center|LOCUS_16830 977 1873 gene locus_tag LOCUS_16840 gene glpG 977 1873 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145885.1 protein_id gnl|my_center|LOCUS_16840 2024 2569 gene locus_tag LOCUS_16850 2024 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 >Feature sequence277 515 1264 gene locus_tag LOCUS_16860 515 1264 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038753.1 protein_id gnl|my_center|LOCUS_16860 1707 2573 gene locus_tag LOCUS_16870 1707 2573 CDS product conjugative transfer protein GumN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704979.1 protein_id gnl|my_center|LOCUS_16870 >Feature sequence278 2333 1914 gene locus_tag LOCUS_16880 2333 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 2537 2334 gene locus_tag LOCUS_16890 2537 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 >Feature sequence279 <1 2328 gene locus_tag LOCUS_16900 <1 2328 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8RH47:isoleucine--tRNA ligase >Feature sequence280 398 712 gene locus_tag LOCUS_16910 398 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229003.1 protein_id gnl|my_center|LOCUS_16910 699 998 gene locus_tag LOCUS_16920 699 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 1957 1625 gene locus_tag LOCUS_16930 1957 1625 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058065.1 protein_id gnl|my_center|LOCUS_16930 2237 1947 gene locus_tag LOCUS_16940 2237 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 >Feature sequence281 712 1377 gene locus_tag LOCUS_16950 712 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 1449 1679 gene locus_tag LOCUS_16960 1449 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 1810 2178 gene locus_tag LOCUS_16970 1810 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 >Feature sequence282 788 1183 gene locus_tag LOCUS_16980 788 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 1197 1835 gene locus_tag LOCUS_16990 1197 1835 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941551.1 protein_id gnl|my_center|LOCUS_16990 2112 2480 gene locus_tag LOCUS_17000 2112 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_17000 >Feature sequence283 302 577 gene locus_tag LOCUS_17010 302 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 719 1264 gene locus_tag LOCUS_17020 gene msrA 719 1264 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBS2 protein_id gnl|my_center|LOCUS_17020 1418 2308 gene locus_tag LOCUS_17030 1418 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 >Feature sequence284 454 1422 gene locus_tag LOCUS_17040 454 1422 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969434.1 protein_id gnl|my_center|LOCUS_17040 1546 2508 gene locus_tag LOCUS_17050 1546 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122330.1 protein_id gnl|my_center|LOCUS_17050 >Feature sequence285 1004 102 gene locus_tag LOCUS_17060 1004 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 1094 1354 gene locus_tag LOCUS_17070 1094 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 2136 1351 gene locus_tag LOCUS_17080 gene ymdB 2136 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31775 protein_id gnl|my_center|LOCUS_17080 >Feature sequence286 571 996 gene locus_tag LOCUS_17090 571 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 1156 2478 gene locus_tag LOCUS_17100 gene ctaC 1156 2478 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24011 protein_id gnl|my_center|LOCUS_17100 >Feature sequence287 481 636 gene locus_tag LOCUS_17110 481 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 1697 1128 gene locus_tag LOCUS_17120 1697 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17120 <2502 1646 gene locus_tag LOCUS_17130 <2502 1646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005808874.1:group II intron reverse transcriptase/maturase note possible pseudo, frameshifted >Feature sequence288 <1 767 gene locus_tag LOCUS_17140 <1 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058218.1:hemolytic protein HlpA 857 1768 gene locus_tag LOCUS_17150 857 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203008.1 protein_id gnl|my_center|LOCUS_17150 <2356 1770 gene locus_tag LOCUS_17160 <2356 1770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203390.1:acetyltransferase >Feature sequence289 1608 598 gene locus_tag LOCUS_17170 1608 598 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_17170 >Feature sequence290 1771 656 gene locus_tag LOCUS_17180 gene tgt 1771 656 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112045.1 protein_id gnl|my_center|LOCUS_17180 >Feature sequence291 1750 611 gene locus_tag LOCUS_17190 gene epsN 1750 611 CDS product putative pyridoxal phosphate-dependent aminotransferase EpsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q795J3 protein_id gnl|my_center|LOCUS_17190 >Feature sequence292 6 1772 gene locus_tag LOCUS_17200 6 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 >Feature sequence293 2086 620 gene locus_tag LOCUS_17210 2086 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 >Feature sequence294 125 757 gene locus_tag LOCUS_17220 gene rpsC 125 757 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CH4 protein_id gnl|my_center|LOCUS_17220 805 1221 gene locus_tag LOCUS_17230 gene rplP 805 1221 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CG4 protein_id gnl|my_center|LOCUS_17230 1255 1461 gene locus_tag LOCUS_17240 1255 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 1483 1761 gene locus_tag LOCUS_17250 gene rpsQ 1483 1761 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ90 protein_id gnl|my_center|LOCUS_17250 1805 2167 gene locus_tag LOCUS_17260 gene rplN 1805 2167 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q927L7 protein_id gnl|my_center|LOCUS_17260 >Feature sequence295 1336 401 gene locus_tag LOCUS_17270 1336 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 1702 1496 gene locus_tag LOCUS_17280 1702 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 1919 1695 gene locus_tag LOCUS_17290 1919 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 >Feature sequence296 763 966 gene locus_tag LOCUS_17300 763 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 1937 1134 gene locus_tag LOCUS_17310 1937 1134 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940726.1 protein_id gnl|my_center|LOCUS_17310 >Feature sequence297 1026 316 gene locus_tag LOCUS_17320 1026 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 1320 1763 gene locus_tag LOCUS_17330 gene fabZ 1320 1763 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WUR8 protein_id gnl|my_center|LOCUS_17330 >Feature sequence298 705 124 gene locus_tag LOCUS_17340 gene pth 705 124 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3Y183 protein_id gnl|my_center|LOCUS_17340 1417 755 gene locus_tag LOCUS_17350 gene rplY 1417 755 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG55 protein_id gnl|my_center|LOCUS_17350 >Feature sequence299 1103 267 gene locus_tag LOCUS_17360 1103 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 >Feature sequence300 1687 281 gene locus_tag LOCUS_17370 gene mpl 1687 281 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933145.1 protein_id gnl|my_center|LOCUS_17370 >Feature sequence301 214 1422 gene locus_tag LOCUS_17380 214 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 >Feature sequence302 1616 1885 gene locus_tag LOCUS_17390 1616 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 >Feature sequence303 202 1659 gene locus_tag LOCUS_17400 202 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 >Feature sequence304 1495 1683 gene locus_tag LOCUS_17410 1495 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 1711 1965 gene locus_tag LOCUS_17420 1711 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 >Feature sequence305 >Feature sequence306 >Feature sequence307 160 86 gene locus_tag LOCUS_t00270 160 86 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1155 298 gene locus_tag LOCUS_17430 1155 298 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933758.1 protein_id gnl|my_center|LOCUS_17430 <1973 1241 gene locus_tag LOCUS_17440 <1973 1241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933759.1:ABC transporter ATP-binding protein >Feature sequence308 1752 1201 gene locus_tag LOCUS_17450 1752 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 >Feature sequence309 203 1609 gene locus_tag LOCUS_17460 203 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 >Feature sequence310 555 1364 gene locus_tag LOCUS_17470 555 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 >Feature sequence311 275 532 gene locus_tag LOCUS_17480 275 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808730.1 protein_id gnl|my_center|LOCUS_17480 532 780 gene locus_tag LOCUS_17490 532 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 1322 1477 gene locus_tag LOCUS_17500 1322 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 >Feature sequence312 423 836 gene locus_tag LOCUS_17510 423 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 1078 1233 gene locus_tag LOCUS_17520 1078 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 1393 1668 gene locus_tag LOCUS_17530 1393 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 >Feature sequence313 52 282 gene locus_tag LOCUS_17540 52 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 273 674 gene locus_tag LOCUS_17550 273 674 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258116.1 protein_id gnl|my_center|LOCUS_17550 688 1185 gene locus_tag LOCUS_17560 688 1185 CDS product ADP-heptose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258042.1 protein_id gnl|my_center|LOCUS_17560 1237 1800 gene locus_tag LOCUS_17570 gene gmhA 1237 1800 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCW2 protein_id gnl|my_center|LOCUS_17570 >Feature sequence314 >Feature sequence315 1141 1314 gene locus_tag LOCUS_17580 1141 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 1298 1819 gene locus_tag LOCUS_17590 1298 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17590 >Feature sequence316 76 249 gene locus_tag LOCUS_17600 76 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 767 1840 gene locus_tag LOCUS_17610 767 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 >Feature sequence317 <1 552 gene locus_tag LOCUS_17620 <1 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272711.1:group II intron reverse transcriptase/maturase note possible pseudo, frameshifted 648 1148 gene locus_tag LOCUS_17630 648 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17630 1514 1236 gene locus_tag LOCUS_17640 1514 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 >Feature sequence318 <1 1017 gene locus_tag LOCUS_17650 <1 1017 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q6HAG9:adenylosuccinate synthetase 1033 1209 gene locus_tag LOCUS_17660 1033 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 1452 1808 gene locus_tag LOCUS_17670 1452 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 >Feature sequence319 1579 1220 gene locus_tag LOCUS_17680 1579 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 >Feature sequence320 3 1175 gene locus_tag LOCUS_17690 3 1175 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD2 protein_id gnl|my_center|LOCUS_17690 1219 1557 gene locus_tag LOCUS_17700 gene glnB 1219 1557 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66513 protein_id gnl|my_center|LOCUS_17700 >Feature sequence321 202 495 gene locus_tag LOCUS_17710 202 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17710 496 837 gene locus_tag LOCUS_17720 496 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17720 863 1093 gene locus_tag LOCUS_17730 863 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 1095 1433 gene locus_tag LOCUS_17740 1095 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 >Feature sequence322 190 116 gene locus_tag LOCUS_t00280 190 116 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 490 813 gene locus_tag LOCUS_17750 490 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 1502 768 gene locus_tag LOCUS_17760 1502 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 1542 1715 gene locus_tag LOCUS_17770 1542 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 >Feature sequence323 545 192 gene locus_tag LOCUS_17780 545 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 1640 981 gene locus_tag LOCUS_17790 1640 981 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107355.1 protein_id gnl|my_center|LOCUS_17790 >Feature sequence324 670 401 gene locus_tag LOCUS_17800 670 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 1091 633 gene locus_tag LOCUS_17810 1091 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 1462 1088 gene locus_tag LOCUS_17820 1462 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 >Feature sequence325 111 1256 gene locus_tag LOCUS_17830 111 1256 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775575.1 protein_id gnl|my_center|LOCUS_17830 >Feature sequence326 >Feature sequence327 95 508 gene locus_tag LOCUS_17840 95 508 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760582.1 protein_id gnl|my_center|LOCUS_17840 524 967 gene locus_tag LOCUS_17850 gene exbD 524 967 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118238.1 protein_id gnl|my_center|LOCUS_17850 1386 1201 gene locus_tag LOCUS_17860 1386 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 >Feature sequence328 <1613 436 gene locus_tag LOCUS_17870 <1613 436 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729527.1:IS630 family transposase >Feature sequence329 962 1174 gene locus_tag LOCUS_17880 962 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 >Feature sequence330 <1 1003 gene locus_tag LOCUS_17890 <1 1003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q1WTL7:tyrosine recombinase XerD >Feature sequence331 169 1431 gene locus_tag LOCUS_17900 169 1431 CDS product ISL3 family transposase ISMac21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022377.1 protein_id gnl|my_center|LOCUS_17900 >Feature sequence332 1507 125 gene locus_tag LOCUS_17910 gene rhlE 1507 125 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CPJ8 protein_id gnl|my_center|LOCUS_17910 >Feature sequence333 439 365 gene locus_tag LOCUS_t00290 439 365 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence334 563 297 gene locus_tag LOCUS_17920 563 297 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939490.1 protein_id gnl|my_center|LOCUS_17920 >Feature sequence335 111 1214 gene locus_tag LOCUS_17930 111 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 >Feature sequence336 >Feature sequence337 >Feature sequence338 508 239 gene locus_tag LOCUS_17940 gene rpsS 508 239 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG43 protein_id gnl|my_center|LOCUS_17940 1370 525 gene locus_tag LOCUS_17950 gene rplB 1370 525 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CH7 protein_id gnl|my_center|LOCUS_17950 >Feature sequence339 466 774 gene locus_tag LOCUS_17960 466 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 764 1099 gene locus_tag LOCUS_17970 764 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 >Feature sequence340 242 823 gene locus_tag LOCUS_17980 gene def 242 823 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SH6 protein_id gnl|my_center|LOCUS_17980 1327 896 gene locus_tag LOCUS_17990 1327 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 >Feature sequence341 <1 1264 gene locus_tag LOCUS_18000 <1 1264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011110378.1:competence protein ComG >Feature sequence342 >Feature sequence343 885 1142 gene locus_tag LOCUS_18010 885 1142 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JIL4 protein_id gnl|my_center|LOCUS_18010 1139 1396 gene locus_tag LOCUS_18020 gene relE 1139 1396 CDS product toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769718.1 protein_id gnl|my_center|LOCUS_18020 >Feature sequence344 >Feature sequence345 821 597 gene locus_tag LOCUS_18030 821 597 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775528.1 protein_id gnl|my_center|LOCUS_18030 <1438 872 gene locus_tag LOCUS_18040 <1438 872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202154.1:3-oxoacyl-ACP synthase >Feature sequence346 1344 112 gene locus_tag LOCUS_18050 1344 112 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932205.1 protein_id gnl|my_center|LOCUS_18050 >Feature sequence347 884 1249 gene locus_tag LOCUS_18060 884 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 >Feature sequence348 317 1357 gene locus_tag LOCUS_18070 gene pheS 317 1357 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HCW7 protein_id gnl|my_center|LOCUS_18070 >Feature sequence349 >Feature sequence350 <1 987 gene locus_tag LOCUS_18080 <1 987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXC8:DNA topoisomerase (ATP-hydrolyzing) >Feature sequence351 >Feature sequence352 91 1089 gene locus_tag LOCUS_18090 91 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 >Feature sequence353 >Feature sequence354 <1289 395 gene locus_tag LOCUS_18100 <1289 395 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UES2:pyrophosphate--fructose 6-phosphate 1-phosphotransferase >Feature sequence355 723 307 gene locus_tag LOCUS_18110 723 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 807 1124 gene locus_tag LOCUS_18120 807 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 >Feature sequence356 >Feature sequence357 >Feature sequence358 <1252 326 gene locus_tag LOCUS_18130 <1252 326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O34469:putative ATP-dependent helicase YeeB >Feature sequence359 629 156 gene locus_tag LOCUS_18140 gene ilvN 629 156 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942555.1 protein_id gnl|my_center|LOCUS_18140 738 662 gene locus_tag LOCUS_t00300 738 662 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence360 <1 1064 gene locus_tag LOCUS_18150 <1 1064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120825.1:mannose-1-phosphate guanylyltransferase >Feature sequence361 344 967 gene locus_tag LOCUS_18160 344 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 >Feature sequence362 <1145 395 gene locus_tag LOCUS_18170 <1145 395 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404833.1:polysulfide reductase chain C >Feature sequence363 >Feature sequence364 787 134 gene locus_tag LOCUS_18180 787 134 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404835.1 protein_id gnl|my_center|LOCUS_18180 >Feature sequence365 <1 941 gene locus_tag LOCUS_18190 <1 941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O32213:sulfite reductase [NADPH] hemoprotein beta-component >Feature sequence366 >Feature sequence367 50 337 gene locus_tag LOCUS_18200 gene groS 50 337 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747C8 protein_id gnl|my_center|LOCUS_18200 >Feature sequence368 >Feature sequence369 >Feature sequence370 >Feature sequence371 >Feature sequence372 >Feature sequence373 332 114 gene locus_tag LOCUS_18210 332 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 775 329 gene locus_tag LOCUS_18220 775 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 >Feature sequence374 >Feature sequence375 415 606 gene locus_tag LOCUS_18230 415 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230