>Feature sequence01 1092 1628 gene locus_tag LOCUS_00010 1092 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1818 2603 gene locus_tag LOCUS_00020 gene fkpA 1818 2603 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JS63 protein_id gnl|my_center|LOCUS_00020 2650 3984 gene locus_tag LOCUS_00030 2650 3984 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIE4 protein_id gnl|my_center|LOCUS_00030 5204 4023 gene locus_tag LOCUS_00040 gene nos 5204 4023 CDS product nitric oxide synthase oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34453 protein_id gnl|my_center|LOCUS_00040 5338 6552 gene locus_tag LOCUS_00050 5338 6552 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGC1 protein_id gnl|my_center|LOCUS_00050 6563 7921 gene locus_tag LOCUS_00060 gene thrC 6563 7921 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942338.1 protein_id gnl|my_center|LOCUS_00060 8325 7930 gene locus_tag LOCUS_00070 8325 7930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 9493 8315 gene locus_tag LOCUS_00080 9493 8315 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706898.1 protein_id gnl|my_center|LOCUS_00080 10680 9490 gene locus_tag LOCUS_00090 10680 9490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 11094 10741 gene locus_tag LOCUS_00100 11094 10741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 12697 11207 gene locus_tag LOCUS_00110 12697 11207 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880464.1 protein_id gnl|my_center|LOCUS_00110 13028 13537 gene locus_tag LOCUS_00120 13028 13537 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258757.1 protein_id gnl|my_center|LOCUS_00120 13550 13855 gene locus_tag LOCUS_00130 gene nuoK 13550 13855 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1Q3 protein_id gnl|my_center|LOCUS_00130 13857 15704 gene locus_tag LOCUS_00140 13857 15704 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392500.1 protein_id gnl|my_center|LOCUS_00140 15710 17296 gene locus_tag LOCUS_00150 15710 17296 CDS product NADH dehydrogenase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813230.1 protein_id gnl|my_center|LOCUS_00150 17289 18818 gene locus_tag LOCUS_00160 gene nuoN 17289 18818 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU27 protein_id gnl|my_center|LOCUS_00160 20360 18798 gene locus_tag LOCUS_00170 20360 18798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 20655 20374 gene locus_tag LOCUS_00180 20655 20374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 20974 22116 gene locus_tag LOCUS_00190 20974 22116 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902891.1 protein_id gnl|my_center|LOCUS_00190 23927 22128 gene locus_tag LOCUS_00200 gene argS 23927 22128 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43832 protein_id gnl|my_center|LOCUS_00200 24323 25660 gene locus_tag LOCUS_00210 24323 25660 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583823.1 protein_id gnl|my_center|LOCUS_00210 26227 25706 gene locus_tag LOCUS_00220 gene efp 26227 25706 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HDW8 protein_id gnl|my_center|LOCUS_00220 26412 27998 gene locus_tag LOCUS_00230 gene serA 26412 27998 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKK8 protein_id gnl|my_center|LOCUS_00230 28021 28629 gene locus_tag LOCUS_00240 gene plsY 28021 28629 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66905 protein_id gnl|my_center|LOCUS_00240 28756 30006 gene locus_tag LOCUS_00250 gene nusA 28756 30006 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJM8 protein_id gnl|my_center|LOCUS_00250 30050 32422 gene locus_tag LOCUS_00260 gene infB 30050 32422 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P17889 protein_id gnl|my_center|LOCUS_00260 32548 32820 gene locus_tag LOCUS_00270 32548 32820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 32817 33824 gene locus_tag LOCUS_00280 32817 33824 CDS product phosphoesterase RecJ-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392566.1 protein_id gnl|my_center|LOCUS_00280 33851 34564 gene locus_tag LOCUS_00290 33851 34564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 34607 36526 gene locus_tag LOCUS_00300 34607 36526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 37463 36552 gene locus_tag LOCUS_00310 37463 36552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 37558 38583 gene locus_tag LOCUS_00320 gene obg 37558 38583 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CNZ7 protein_id gnl|my_center|LOCUS_00320 39631 38678 gene locus_tag LOCUS_00330 39631 38678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 39952 39650 gene locus_tag LOCUS_00340 39952 39650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 40186 40722 gene locus_tag LOCUS_00350 40186 40722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 40758 41366 gene locus_tag LOCUS_00360 40758 41366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 41411 42649 gene locus_tag LOCUS_00370 gene nuoD 41411 42649 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GA5 protein_id gnl|my_center|LOCUS_00370 42662 43159 gene locus_tag LOCUS_00380 42662 43159 CDS product NADH dehydrogenase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250565.1 protein_id gnl|my_center|LOCUS_00380 43165 44529 gene locus_tag LOCUS_00390 gene nuoF 43165 44529 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829484.1 protein_id gnl|my_center|LOCUS_00390 44535 46250 gene locus_tag LOCUS_00400 gene nuoG 44535 46250 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403178.1 protein_id gnl|my_center|LOCUS_00400 46261 47355 gene locus_tag LOCUS_00410 gene nuoH 46261 47355 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7Q5 protein_id gnl|my_center|LOCUS_00410 47361 47912 gene locus_tag LOCUS_00420 gene nuoI 47361 47912 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1Q5 protein_id gnl|my_center|LOCUS_00420 48413 47943 gene locus_tag LOCUS_00430 48413 47943 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ST9 protein_id gnl|my_center|LOCUS_00430 50041 48416 gene locus_tag LOCUS_00440 50041 48416 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_00440 50304 50146 gene locus_tag LOCUS_00450 50304 50146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 50426 50797 gene locus_tag LOCUS_00460 gene crcB2 50426 50797 CDS product putative fluoride ion transporter CrcB 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HBI2 protein_id gnl|my_center|LOCUS_00460 50794 51222 gene locus_tag LOCUS_00470 gene crcB1 50794 51222 CDS product putative fluoride ion transporter CrcB 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y5I1 protein_id gnl|my_center|LOCUS_00470 52065 51184 gene locus_tag LOCUS_00480 52065 51184 CDS product 8-oxoguanine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965994.1 protein_id gnl|my_center|LOCUS_00480 52632 52120 gene locus_tag LOCUS_00490 52632 52120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 53910 52993 gene locus_tag LOCUS_00500 gene dapF 53910 52993 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZX7 protein_id gnl|my_center|LOCUS_00500 55555 53864 gene locus_tag LOCUS_00510 gene leuA 55555 53864 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97MC5 protein_id gnl|my_center|LOCUS_00510 55648 56205 gene locus_tag LOCUS_00520 55648 56205 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595814.1 protein_id gnl|my_center|LOCUS_00520 56309 57112 gene locus_tag LOCUS_00530 56309 57112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 58019 58393 gene locus_tag LOCUS_00540 58019 58393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 58445 59608 gene locus_tag LOCUS_00550 gene metK 58445 59608 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LK6 protein_id gnl|my_center|LOCUS_00550 59627 61078 gene locus_tag LOCUS_00560 gene ahcY 59627 61078 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCH5 protein_id gnl|my_center|LOCUS_00560 64232 61053 gene locus_tag LOCUS_00570 64232 61053 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_00570 65386 64229 gene locus_tag LOCUS_00580 65386 64229 CDS product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086651.1 protein_id gnl|my_center|LOCUS_00580 66812 65409 gene locus_tag LOCUS_00590 66812 65409 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552095.1 protein_id gnl|my_center|LOCUS_00590 67103 66885 gene locus_tag LOCUS_00600 67103 66885 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904300.1 protein_id gnl|my_center|LOCUS_00600 69114 67282 gene locus_tag LOCUS_00610 gene yknV 69114 67282 CDS product putative ABC transporter ATP-binding protein YknV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31708 protein_id gnl|my_center|LOCUS_00610 69239 69496 gene locus_tag LOCUS_00620 69239 69496 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939490.1 protein_id gnl|my_center|LOCUS_00620 70248 69706 gene locus_tag LOCUS_00630 70248 69706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 70789 70556 gene locus_tag LOCUS_00640 70789 70556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 70914 71102 gene locus_tag LOCUS_00650 70914 71102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 71299 71374 gene locus_tag LOCUS_t00010 71299 71374 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 71797 72219 gene locus_tag LOCUS_00660 71797 72219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 72517 74310 gene locus_tag LOCUS_00670 72517 74310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 74372 75115 gene locus_tag LOCUS_00680 74372 75115 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P62042 protein_id gnl|my_center|LOCUS_00680 75182 76879 gene locus_tag LOCUS_00690 75182 76879 CDS product peptide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259368.1 protein_id gnl|my_center|LOCUS_00690 77272 77012 gene locus_tag LOCUS_00700 77272 77012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 77394 77813 gene locus_tag LOCUS_00710 77394 77813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 77836 78705 gene locus_tag LOCUS_00720 77836 78705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 79342 79857 gene locus_tag LOCUS_00730 79342 79857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 79994 81175 gene locus_tag LOCUS_00740 79994 81175 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHD7 protein_id gnl|my_center|LOCUS_00740 81217 83442 gene locus_tag LOCUS_00750 81217 83442 CDS product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481838.1 protein_id gnl|my_center|LOCUS_00750 84682 83426 gene locus_tag LOCUS_00760 84682 83426 CDS product miniconductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367814.1 protein_id gnl|my_center|LOCUS_00760 85445 84777 gene locus_tag LOCUS_00770 85445 84777 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125812.1 protein_id gnl|my_center|LOCUS_00770 85807 85502 gene locus_tag LOCUS_00780 85807 85502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 86076 88022 gene locus_tag LOCUS_00790 gene dnaK 86076 88022 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H59 protein_id gnl|my_center|LOCUS_00790 88063 88350 gene locus_tag LOCUS_00800 gene groS 88063 88350 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747C8 protein_id gnl|my_center|LOCUS_00800 88383 90035 gene locus_tag LOCUS_00810 gene groL 88383 90035 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AL6 protein_id gnl|my_center|LOCUS_00810 91286 90225 gene locus_tag LOCUS_00820 91286 90225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 91474 92619 gene locus_tag LOCUS_00830 91474 92619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 92664 93044 gene locus_tag LOCUS_00840 92664 93044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 93119 93748 gene locus_tag LOCUS_00850 93119 93748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 96310 93800 gene locus_tag LOCUS_00860 gene gyrA 96310 93800 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG27 protein_id gnl|my_center|LOCUS_00860 98921 96384 gene locus_tag LOCUS_00870 gene gyrB 98921 96384 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O84193 protein_id gnl|my_center|LOCUS_00870 99002 99487 gene locus_tag LOCUS_00880 99002 99487 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730224.1 protein_id gnl|my_center|LOCUS_00880 101316 99490 gene locus_tag LOCUS_00890 101316 99490 CDS product sodium:sulfate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003705.1 protein_id gnl|my_center|LOCUS_00890 102107 101313 gene locus_tag LOCUS_00900 gene ctaG 102107 101313 CDS product protein CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34329 protein_id gnl|my_center|LOCUS_00900 102545 102201 gene locus_tag LOCUS_00910 102545 102201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 103166 102564 gene locus_tag LOCUS_00920 gene qoxC 103166 102564 CDS product quinol oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P34958 protein_id gnl|my_center|LOCUS_00920 105182 103188 gene locus_tag LOCUS_00930 105182 103188 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q819N3 protein_id gnl|my_center|LOCUS_00930 106494 105199 gene locus_tag LOCUS_00940 gene ctaC 106494 105199 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24011 protein_id gnl|my_center|LOCUS_00940 107094 106669 gene locus_tag LOCUS_00950 107094 106669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 107992 107114 gene locus_tag LOCUS_00960 gene ctaB 107992 107114 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S012 protein_id gnl|my_center|LOCUS_00960 108992 108030 gene locus_tag LOCUS_00970 108992 108030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 109273 109578 gene locus_tag LOCUS_00980 109273 109578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 111911 109797 gene locus_tag LOCUS_00990 gene ispG 111911 109797 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F1H5 protein_id gnl|my_center|LOCUS_00990 113347 111926 gene locus_tag LOCUS_01000 gene rseP 113347 111926 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3E6 protein_id gnl|my_center|LOCUS_01000 114528 113347 gene locus_tag LOCUS_01010 gene dxr 114528 113347 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1H0 protein_id gnl|my_center|LOCUS_01010 115361 114531 gene locus_tag LOCUS_01020 115361 114531 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4K7 protein_id gnl|my_center|LOCUS_01020 116076 115375 gene locus_tag LOCUS_01030 gene uppS 116076 115375 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1H2 protein_id gnl|my_center|LOCUS_01030 117046 116117 gene locus_tag LOCUS_01040 gene argF 117046 116117 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GU2 protein_id gnl|my_center|LOCUS_01040 118245 117061 gene locus_tag LOCUS_01050 gene argD 118245 117061 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X2A5 protein_id gnl|my_center|LOCUS_01050 119176 118259 gene locus_tag LOCUS_01060 119176 118259 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459300.1 protein_id gnl|my_center|LOCUS_01060 120437 119205 gene locus_tag LOCUS_01070 gene argJ 120437 119205 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGC2 protein_id gnl|my_center|LOCUS_01070 121501 120479 gene locus_tag LOCUS_01080 gene argC 121501 120479 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Z3 protein_id gnl|my_center|LOCUS_01080 122009 121608 gene locus_tag LOCUS_01090 gene rpsI 122009 121608 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0Z5 protein_id gnl|my_center|LOCUS_01090 122488 122063 gene locus_tag LOCUS_01100 gene rplM 122488 122063 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1G6 protein_id gnl|my_center|LOCUS_01100 122655 122864 gene locus_tag LOCUS_01110 122655 122864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 122974 123462 gene locus_tag LOCUS_01120 gene smpB 122974 123462 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92R54 protein_id gnl|my_center|LOCUS_01120 125779 123452 gene locus_tag LOCUS_01130 125779 123452 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459887.1 protein_id gnl|my_center|LOCUS_01130 126584 125769 gene locus_tag LOCUS_01140 126584 125769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 128031 127045 gene locus_tag LOCUS_01150 gene nadA 128031 127045 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM90 protein_id gnl|my_center|LOCUS_01150 130026 128044 gene locus_tag LOCUS_01160 gene tkt 130026 128044 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45694 protein_id gnl|my_center|LOCUS_01160 130104 130526 gene locus_tag LOCUS_01170 130104 130526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 131134 130619 gene locus_tag LOCUS_01180 131134 130619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 132193 131159 gene locus_tag LOCUS_01190 132193 131159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 133232 132249 gene locus_tag LOCUS_01200 gene fabH 133232 132249 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJX8 protein_id gnl|my_center|LOCUS_01200 134324 133263 gene locus_tag LOCUS_01210 gene plsX 134324 133263 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CS5 protein_id gnl|my_center|LOCUS_01210 135648 134605 gene locus_tag LOCUS_01220 gene uppP2 135648 134605 CDS product undecaprenyl-diphosphatase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTE2 protein_id gnl|my_center|LOCUS_01220 135752 136819 gene locus_tag LOCUS_01230 gene trpD 135752 136819 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJD7 protein_id gnl|my_center|LOCUS_01230 136842 138209 gene locus_tag LOCUS_01240 gene glmM 136842 138209 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3A5 protein_id gnl|my_center|LOCUS_01240 138257 139648 gene locus_tag LOCUS_01250 138257 139648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 140051 139794 gene locus_tag LOCUS_01260 140051 139794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 141168 140125 gene locus_tag LOCUS_01270 gene galM 141168 140125 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ38 protein_id gnl|my_center|LOCUS_01270 141474 143207 gene locus_tag LOCUS_01280 141474 143207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 143321 144703 gene locus_tag LOCUS_01290 143321 144703 CDS product beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MFS4 protein_id gnl|my_center|LOCUS_01290 144707 146191 gene locus_tag LOCUS_01300 gene arsA 144707 146191 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122187.1 protein_id gnl|my_center|LOCUS_01300 146201 147364 gene locus_tag LOCUS_01310 gene xynA 146201 147364 CDS product beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3F6 protein_id gnl|my_center|LOCUS_01310 147425 148966 gene locus_tag LOCUS_01320 147425 148966 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123571.1 protein_id gnl|my_center|LOCUS_01320 149000 151801 gene locus_tag LOCUS_01330 149000 151801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 151794 153305 gene locus_tag LOCUS_01340 151794 153305 CDS product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119008.1 protein_id gnl|my_center|LOCUS_01340 153575 157930 gene locus_tag LOCUS_01350 153575 157930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 158139 160214 gene locus_tag LOCUS_01360 158139 160214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 160285 161691 gene locus_tag LOCUS_01370 gene gutA 160285 161691 CDS product putative glucitol transport protein GutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34368 protein_id gnl|my_center|LOCUS_01370 161781 164699 gene locus_tag LOCUS_01380 161781 164699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 165896 164733 gene locus_tag LOCUS_01390 gene xylR 165896 164733 CDS product XylR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124078.1 protein_id gnl|my_center|LOCUS_01390 166189 167076 gene locus_tag LOCUS_01400 166189 167076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 167157 169175 gene locus_tag LOCUS_01410 167157 169175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 169257 169523 gene locus_tag LOCUS_01420 169257 169523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 169755 173705 gene locus_tag LOCUS_01430 169755 173705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 175277 173724 gene locus_tag LOCUS_01440 175277 173724 CDS product sugar (pentulose and hexulose) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_599365.1 protein_id gnl|my_center|LOCUS_01440 176606 175302 gene locus_tag LOCUS_01450 gene xylA 176606 175302 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVG2 protein_id gnl|my_center|LOCUS_01450 177031 176955 gene locus_tag LOCUS_t00020 177031 176955 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 177441 177082 gene locus_tag LOCUS_01460 177441 177082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 177928 177557 gene locus_tag LOCUS_01470 177928 177557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 178188 178964 gene locus_tag LOCUS_01480 178188 178964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 179021 180013 gene locus_tag LOCUS_01490 179021 180013 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268709.1 protein_id gnl|my_center|LOCUS_01490 180153 181670 gene locus_tag LOCUS_01500 180153 181670 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268710.1 protein_id gnl|my_center|LOCUS_01500 183467 181722 gene locus_tag LOCUS_01510 183467 181722 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UHW9 protein_id gnl|my_center|LOCUS_01510 183736 184539 gene locus_tag LOCUS_01520 183736 184539 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_01520 185882 184605 gene locus_tag LOCUS_01530 gene hemL 185882 184605 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FRE3 protein_id gnl|my_center|LOCUS_01530 187548 185911 gene locus_tag LOCUS_01540 187548 185911 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392090.1 protein_id gnl|my_center|LOCUS_01540 187637 188224 gene locus_tag LOCUS_01550 187637 188224 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NH22 protein_id gnl|my_center|LOCUS_01550 188199 189347 gene locus_tag LOCUS_01560 188199 189347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 189347 190135 gene locus_tag LOCUS_01570 189347 190135 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073014.1 protein_id gnl|my_center|LOCUS_01570 190139 191635 gene locus_tag LOCUS_01580 190139 191635 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405167.1 protein_id gnl|my_center|LOCUS_01580 191645 192169 gene locus_tag LOCUS_01590 191645 192169 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664737.1 protein_id gnl|my_center|LOCUS_01590 196086 192187 gene locus_tag LOCUS_01600 gene purL 196086 192187 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N6E4 protein_id gnl|my_center|LOCUS_01600 198136 196160 gene locus_tag LOCUS_01610 198136 196160 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X0W5 protein_id gnl|my_center|LOCUS_01610 198234 199664 gene locus_tag LOCUS_01620 198234 199664 CDS product menaquinone-specific isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057055.1 protein_id gnl|my_center|LOCUS_01620 200596 199676 gene locus_tag LOCUS_01630 200596 199676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 201700 200654 gene locus_tag LOCUS_01640 201700 200654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 202997 201693 gene locus_tag LOCUS_01650 gene met17 202997 201693 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137848.1 protein_id gnl|my_center|LOCUS_01650 203143 203067 gene locus_tag LOCUS_t00030 203143 203067 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 203321 203728 gene locus_tag LOCUS_01660 gene ndk 203321 203728 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJK7 protein_id gnl|my_center|LOCUS_01660 203742 204236 gene locus_tag LOCUS_01670 gene ispF 203742 204236 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B0B806 protein_id gnl|my_center|LOCUS_01670 204696 204310 gene locus_tag LOCUS_01680 gene gloA3 204696 204310 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002327753.1 protein_id gnl|my_center|LOCUS_01680 205442 204786 gene locus_tag LOCUS_01690 gene lexA 205442 204786 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D1N3 protein_id gnl|my_center|LOCUS_01690 205547 207370 gene locus_tag LOCUS_01700 gene oppA 205547 207370 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880932.1 protein_id gnl|my_center|LOCUS_01700 207393 209696 gene locus_tag LOCUS_01710 207393 209696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 209715 210560 gene locus_tag LOCUS_01720 209715 210560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 211451 210600 gene locus_tag LOCUS_01730 211451 210600 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388348.1 protein_id gnl|my_center|LOCUS_01730 212361 211444 gene locus_tag LOCUS_01740 gene oppB 212361 211444 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262164.1 protein_id gnl|my_center|LOCUS_01740 214009 212390 gene locus_tag LOCUS_01750 214009 212390 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144112.1 protein_id gnl|my_center|LOCUS_01750 214195 214968 gene locus_tag LOCUS_01760 214195 214968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 214999 215442 gene locus_tag LOCUS_01770 gene rlmH 214999 215442 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CM9 protein_id gnl|my_center|LOCUS_01770 215515 215605 gene locus_tag LOCUS_t00040 215515 215605 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 216976 216554 gene locus_tag LOCUS_01780 216976 216554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 217759 217007 gene locus_tag LOCUS_01790 217759 217007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 219216 217816 gene locus_tag LOCUS_01800 219216 217816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 220163 219276 gene locus_tag LOCUS_01810 gene metF 220163 219276 CDS product 5,10-methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67422 protein_id gnl|my_center|LOCUS_01810 220343 220870 gene locus_tag LOCUS_01820 gene mraZ 220343 220870 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07103 protein_id gnl|my_center|LOCUS_01820 221107 222087 gene locus_tag LOCUS_01830 gene rsmH 221107 222087 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCY2 protein_id gnl|my_center|LOCUS_01830 222084 222446 gene locus_tag LOCUS_01840 222084 222446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 222659 224434 gene locus_tag LOCUS_01850 222659 224434 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545621.1 protein_id gnl|my_center|LOCUS_01850 224448 225947 gene locus_tag LOCUS_01860 gene murE 224448 225947 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK84 protein_id gnl|my_center|LOCUS_01860 225969 227348 gene locus_tag LOCUS_01870 gene murF 225969 227348 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SG8 protein_id gnl|my_center|LOCUS_01870 227364 228464 gene locus_tag LOCUS_01880 gene mraY 227364 228464 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZIF2 protein_id gnl|my_center|LOCUS_01880 228466 229725 gene locus_tag LOCUS_01890 gene murD 228466 229725 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NEZ5 protein_id gnl|my_center|LOCUS_01890 229755 230708 gene locus_tag LOCUS_01900 229755 230708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 230730 231872 gene locus_tag LOCUS_01910 gene ftsW 230730 231872 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZSA4 protein_id gnl|my_center|LOCUS_01910 231869 232987 gene locus_tag LOCUS_01920 gene murG 231869 232987 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VDZ2 protein_id gnl|my_center|LOCUS_01920 233001 235319 gene locus_tag LOCUS_01930 233001 235319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 235316 236257 gene locus_tag LOCUS_01940 gene ddlB 235316 236257 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJJ5 protein_id gnl|my_center|LOCUS_01940 236257 237195 gene locus_tag LOCUS_01950 236257 237195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 237235 238473 gene locus_tag LOCUS_01960 gene ftsA 237235 238473 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK73 protein_id gnl|my_center|LOCUS_01960 238500 239765 gene locus_tag LOCUS_01970 238500 239765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 239880 240794 gene locus_tag LOCUS_01980 239880 240794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 240815 241702 gene locus_tag LOCUS_01990 240815 241702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 242562 241699 gene locus_tag LOCUS_02000 242562 241699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546653.1 protein_id gnl|my_center|LOCUS_02000 243416 242559 gene locus_tag LOCUS_02010 243416 242559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 246002 243420 gene locus_tag LOCUS_02020 gene leuS 246002 243420 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HCE2 protein_id gnl|my_center|LOCUS_02020 246166 246804 gene locus_tag LOCUS_02030 246166 246804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 246862 248439 gene locus_tag LOCUS_02040 246862 248439 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807020.1 protein_id gnl|my_center|LOCUS_02040 248450 250192 gene locus_tag LOCUS_02050 248450 250192 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551361.1 protein_id gnl|my_center|LOCUS_02050 250425 251831 gene locus_tag LOCUS_02060 gene rny 250425 251831 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I3U5C4 protein_id gnl|my_center|LOCUS_02060 251842 252903 gene locus_tag LOCUS_02070 251842 252903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 252930 253529 gene locus_tag LOCUS_02080 gene ysnA 252930 253529 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94558 protein_id gnl|my_center|LOCUS_02080 254344 253526 gene locus_tag LOCUS_02090 gene proC 254344 253526 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFV0 protein_id gnl|my_center|LOCUS_02090 255036 254341 gene locus_tag LOCUS_02100 255036 254341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 255901 255029 gene locus_tag LOCUS_02110 gene folD 255901 255029 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73RS2 protein_id gnl|my_center|LOCUS_02110 256674 255931 gene locus_tag LOCUS_02120 256674 255931 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLS4 protein_id gnl|my_center|LOCUS_02120 256784 257530 gene locus_tag LOCUS_02130 256784 257530 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_02130 257559 257813 gene locus_tag LOCUS_02140 gene acpP 257559 257813 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67611 protein_id gnl|my_center|LOCUS_02140 257875 259131 gene locus_tag LOCUS_02150 gene fabF 257875 259131 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18B43 protein_id gnl|my_center|LOCUS_02150 259191 260720 gene locus_tag LOCUS_02160 259191 260720 CDS product phospholipase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207627.1 protein_id gnl|my_center|LOCUS_02160 261038 260724 gene locus_tag LOCUS_02170 261038 260724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 263895 261043 gene locus_tag LOCUS_02180 gene polA 263895 261043 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 protein_id gnl|my_center|LOCUS_02180 265318 263927 gene locus_tag LOCUS_02190 gene cca 265318 263927 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPN1 protein_id gnl|my_center|LOCUS_02190 266155 265322 gene locus_tag LOCUS_02200 gene nadK 266155 265322 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BH6 protein_id gnl|my_center|LOCUS_02200 266947 266171 gene locus_tag LOCUS_02210 266947 266171 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_02210 267085 267930 gene locus_tag LOCUS_02220 gene rsmJ 267085 267930 CDS product ribosomal RNA small subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWU6 protein_id gnl|my_center|LOCUS_02220 267968 269077 gene locus_tag LOCUS_02230 gene ampS 267968 269077 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654739.1 protein_id gnl|my_center|LOCUS_02230 269842 269093 gene locus_tag LOCUS_02240 269842 269093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 269927 270778 gene locus_tag LOCUS_02250 269927 270778 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EES8 protein_id gnl|my_center|LOCUS_02250 270840 271469 gene locus_tag LOCUS_02260 270840 271469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 271476 272063 gene locus_tag LOCUS_02270 271476 272063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 272149 272835 gene locus_tag LOCUS_02280 272149 272835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 272859 273563 gene locus_tag LOCUS_02290 272859 273563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 273560 274450 gene locus_tag LOCUS_02300 273560 274450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 277130 274437 gene locus_tag LOCUS_02310 gene alaS 277130 274437 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG04 protein_id gnl|my_center|LOCUS_02310 278256 277156 gene locus_tag LOCUS_02320 gene leuB 278256 277156 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SS8 protein_id gnl|my_center|LOCUS_02320 279213 278329 gene locus_tag LOCUS_02330 gene sucD 279213 278329 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P677 protein_id gnl|my_center|LOCUS_02330 280445 279249 gene locus_tag LOCUS_02340 gene sucC 280445 279249 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ84 protein_id gnl|my_center|LOCUS_02340 282753 280642 gene locus_tag LOCUS_02350 gene fusA2 282753 280642 CDS product elongation factor G 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPM5 protein_id gnl|my_center|LOCUS_02350 283162 284406 gene locus_tag LOCUS_02360 283162 284406 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403679.1 protein_id gnl|my_center|LOCUS_02360 284468 286045 gene locus_tag LOCUS_02370 gene cimA 284468 286045 CDS product (R)-citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66682 protein_id gnl|my_center|LOCUS_02370 286261 286064 gene locus_tag LOCUS_02380 286261 286064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 286998 286345 gene locus_tag LOCUS_02390 286998 286345 CDS product putative RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45215 protein_id gnl|my_center|LOCUS_02390 287086 288096 gene locus_tag LOCUS_02400 287086 288096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 288102 289049 gene locus_tag LOCUS_02410 288102 289049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 289128 290849 gene locus_tag LOCUS_02420 gene msbA 289128 290849 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_02420 290861 291658 gene locus_tag LOCUS_02430 290861 291658 CDS product beta 1,4 glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016465.1 protein_id gnl|my_center|LOCUS_02430 291586 292677 gene locus_tag LOCUS_02440 gene cps2F 291586 292677 CDS product glycosyltransferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101303.1 protein_id gnl|my_center|LOCUS_02440 293452 292700 gene locus_tag LOCUS_02450 293452 292700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266471.1 protein_id gnl|my_center|LOCUS_02450 294582 293455 gene locus_tag LOCUS_02460 gene lpsB 294582 293455 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208294.1 protein_id gnl|my_center|LOCUS_02460 294927 296204 gene locus_tag LOCUS_02470 gene serS 294927 296204 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1G4 protein_id gnl|my_center|LOCUS_02470 296222 296437 gene locus_tag LOCUS_02480 296222 296437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 296454 297953 gene locus_tag LOCUS_02490 gene proS 296454 297953 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGJ7 protein_id gnl|my_center|LOCUS_02490 298531 297947 gene locus_tag LOCUS_02500 gene msrA 298531 297947 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBS2 protein_id gnl|my_center|LOCUS_02500 298881 298609 gene locus_tag LOCUS_02510 298881 298609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 299008 299093 gene locus_tag LOCUS_t00050 299008 299093 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 299441 301711 gene locus_tag LOCUS_02520 299441 301711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 301713 303188 gene locus_tag LOCUS_02530 301713 303188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920272.1 protein_id gnl|my_center|LOCUS_02530 303185 303910 gene locus_tag LOCUS_02540 303185 303910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 304069 304569 gene locus_tag LOCUS_02550 304069 304569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 304815 305042 gene locus_tag LOCUS_02560 304815 305042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 >Feature sequence02 1564 770 gene locus_tag LOCUS_02570 1564 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 2725 1694 gene locus_tag LOCUS_02580 2725 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 3248 2760 gene locus_tag LOCUS_02590 3248 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 3662 6247 gene locus_tag LOCUS_02600 gene mutS 3662 6247 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJY3 protein_id gnl|my_center|LOCUS_02600 6410 7648 gene locus_tag LOCUS_02610 gene dinB 6410 7648 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJ46 protein_id gnl|my_center|LOCUS_02610 7641 8366 gene locus_tag LOCUS_02620 7641 8366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 10783 8363 gene locus_tag LOCUS_02630 10783 8363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 13258 11366 gene locus_tag LOCUS_02640 gene mnmG 13258 11366 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249657.1 protein_id gnl|my_center|LOCUS_02640 14624 13263 gene locus_tag LOCUS_02650 gene mnmE 14624 13263 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67030 protein_id gnl|my_center|LOCUS_02650 15752 14688 gene locus_tag LOCUS_02660 gene recA 15752 14688 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58254 protein_id gnl|my_center|LOCUS_02660 15836 16249 gene locus_tag LOCUS_02670 15836 16249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 16249 16896 gene locus_tag LOCUS_02680 16249 16896 CDS product putative phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705604.1 protein_id gnl|my_center|LOCUS_02680 17322 16930 gene locus_tag LOCUS_02690 17322 16930 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056985.1 protein_id gnl|my_center|LOCUS_02690 17420 18745 gene locus_tag LOCUS_02700 gene miaB 17420 18745 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I2S3 protein_id gnl|my_center|LOCUS_02700 20477 18789 gene locus_tag LOCUS_02710 20477 18789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 20541 20888 gene locus_tag LOCUS_02720 20541 20888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 21155 22285 gene locus_tag LOCUS_02730 gene dnaN 21155 22285 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H91 protein_id gnl|my_center|LOCUS_02730 22425 23354 gene locus_tag LOCUS_02740 22425 23354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 24882 23362 gene locus_tag LOCUS_02750 gene gndA 24882 23362 CDS product 6-phosphogluconate dehydrogenase, NADP(+)-dependent, decarboxylating inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80859 protein_id gnl|my_center|LOCUS_02750 26489 24909 gene locus_tag LOCUS_02760 26489 24909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 27584 26541 gene locus_tag LOCUS_02770 27584 26541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51040 protein_id gnl|my_center|LOCUS_02770 27653 28741 gene locus_tag LOCUS_02780 gene prfA 27653 28741 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B9V1 protein_id gnl|my_center|LOCUS_02780 28754 29623 gene locus_tag LOCUS_02790 gene prmC 28754 29623 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULT2 protein_id gnl|my_center|LOCUS_02790 31962 29644 gene locus_tag LOCUS_02800 gene prc 31962 29644 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329904.1 protein_id gnl|my_center|LOCUS_02800 32990 32085 gene locus_tag LOCUS_02810 32990 32085 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761931.1 protein_id gnl|my_center|LOCUS_02810 33098 33346 gene locus_tag LOCUS_02820 33098 33346 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764038.1 protein_id gnl|my_center|LOCUS_02820 34830 33337 gene locus_tag LOCUS_02830 34830 33337 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812211.1 protein_id gnl|my_center|LOCUS_02830 36199 34847 gene locus_tag LOCUS_02840 gene trkA 36199 34847 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327001.1 protein_id gnl|my_center|LOCUS_02840 36448 37887 gene locus_tag LOCUS_02850 36448 37887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583133.1 protein_id gnl|my_center|LOCUS_02850 37988 38980 gene locus_tag LOCUS_02860 37988 38980 CDS product UPF0365 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SJG0 protein_id gnl|my_center|LOCUS_02860 39039 39692 gene locus_tag LOCUS_02870 39039 39692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 40625 39744 gene locus_tag LOCUS_02880 40625 39744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 41582 40635 gene locus_tag LOCUS_02890 41582 40635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 42190 41591 gene locus_tag LOCUS_02900 gene purN 42190 41591 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q833Z2 protein_id gnl|my_center|LOCUS_02900 43342 42206 gene locus_tag LOCUS_02910 gene dnaJ 43342 42206 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NHB7 protein_id gnl|my_center|LOCUS_02910 43943 43368 gene locus_tag LOCUS_02920 43943 43368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 44179 44880 gene locus_tag LOCUS_02930 gene phoB 44179 44880 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941763.1 protein_id gnl|my_center|LOCUS_02930 44880 46166 gene locus_tag LOCUS_02940 44880 46166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 46159 46806 gene locus_tag LOCUS_02950 46159 46806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 47047 46799 gene locus_tag LOCUS_02960 47047 46799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 47224 48048 gene locus_tag LOCUS_02970 gene atpB 47224 48048 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLP8 protein_id gnl|my_center|LOCUS_02970 48128 48340 gene locus_tag LOCUS_02980 48128 48340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 48472 49014 gene locus_tag LOCUS_02990 gene atpF 48472 49014 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KA4 protein_id gnl|my_center|LOCUS_02990 49025 49417 gene locus_tag LOCUS_03000 49025 49417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 49441 50985 gene locus_tag LOCUS_03010 gene atpA 49441 50985 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X72 protein_id gnl|my_center|LOCUS_03010 51026 51916 gene locus_tag LOCUS_03020 gene atpG 51026 51916 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCZ6 protein_id gnl|my_center|LOCUS_03020 51963 53381 gene locus_tag LOCUS_03030 gene atpD 51963 53381 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV18 protein_id gnl|my_center|LOCUS_03030 53394 53825 gene locus_tag LOCUS_03040 53394 53825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 54583 53792 gene locus_tag LOCUS_03050 gene coaX 54583 53792 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8N6 protein_id gnl|my_center|LOCUS_03050 55587 54580 gene locus_tag LOCUS_03060 gene birA 55587 54580 CDS product bifunctional ligase/repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HL18 protein_id gnl|my_center|LOCUS_03060 56541 55612 gene locus_tag LOCUS_03070 56541 55612 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014095.1 protein_id gnl|my_center|LOCUS_03070 57190 56573 gene locus_tag LOCUS_03080 gene gmk 57190 56573 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4U2 protein_id gnl|my_center|LOCUS_03080 57728 57192 gene locus_tag LOCUS_03090 57728 57192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 58509 57835 gene locus_tag LOCUS_03100 58509 57835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 62258 58647 gene locus_tag LOCUS_03110 gene metH 62258 58647 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262613.1 protein_id gnl|my_center|LOCUS_03110 62485 63135 gene locus_tag LOCUS_03120 gene rsmG 62485 63135 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ2 protein_id gnl|my_center|LOCUS_03120 63255 63836 gene locus_tag LOCUS_03130 63255 63836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070887.1 protein_id gnl|my_center|LOCUS_03130 64508 63930 gene locus_tag LOCUS_03140 gene def 64508 63930 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MF24 protein_id gnl|my_center|LOCUS_03140 64632 66566 gene locus_tag LOCUS_03150 64632 66566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 66911 66495 gene locus_tag LOCUS_03160 66911 66495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 68605 66911 gene locus_tag LOCUS_03170 68605 66911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 71447 68655 gene locus_tag LOCUS_03180 gene glnD 71447 68655 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C55 protein_id gnl|my_center|LOCUS_03180 72938 71619 gene locus_tag LOCUS_03190 72938 71619 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S152 protein_id gnl|my_center|LOCUS_03190 73943 72966 gene locus_tag LOCUS_03200 gene pdhB 73943 72966 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882953.1 protein_id gnl|my_center|LOCUS_03200 75061 73964 gene locus_tag LOCUS_03210 gene pdhA 75061 73964 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y472 protein_id gnl|my_center|LOCUS_03210 75708 75169 gene locus_tag LOCUS_03220 75708 75169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 76515 75763 gene locus_tag LOCUS_03230 76515 75763 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333296.1 protein_id gnl|my_center|LOCUS_03230 76638 79400 gene locus_tag LOCUS_03240 gene valS 76638 79400 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q05873 protein_id gnl|my_center|LOCUS_03240 80848 79397 gene locus_tag LOCUS_03250 80848 79397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 81400 80876 gene locus_tag LOCUS_03260 81400 80876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 84190 81479 gene locus_tag LOCUS_03270 gene citB 84190 81479 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JJ0 protein_id gnl|my_center|LOCUS_03270 85124 84321 gene locus_tag LOCUS_03280 85124 84321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 85323 85153 gene locus_tag LOCUS_03290 85323 85153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 85364 86158 gene locus_tag LOCUS_03300 85364 86158 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871056.1 protein_id gnl|my_center|LOCUS_03300 86189 86440 gene locus_tag LOCUS_03310 86189 86440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 86492 88006 gene locus_tag LOCUS_03320 86492 88006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 88405 89598 gene locus_tag LOCUS_03330 88405 89598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 89681 90616 gene locus_tag LOCUS_03340 89681 90616 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403393.1 protein_id gnl|my_center|LOCUS_03340 90619 91740 gene locus_tag LOCUS_03350 gene glf 90619 91740 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222174.1 protein_id gnl|my_center|LOCUS_03350 91744 93231 gene locus_tag LOCUS_03360 91744 93231 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888197.1 protein_id gnl|my_center|LOCUS_03360 93215 94120 gene locus_tag LOCUS_03370 93215 94120 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403764.1 protein_id gnl|my_center|LOCUS_03370 94105 95007 gene locus_tag LOCUS_03380 94105 95007 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254560.1 protein_id gnl|my_center|LOCUS_03380 95355 96284 gene locus_tag LOCUS_03390 95355 96284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 96281 97165 gene locus_tag LOCUS_03400 96281 97165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 97162 98289 gene locus_tag LOCUS_03410 97162 98289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 98286 99074 gene locus_tag LOCUS_03420 98286 99074 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403390.1 protein_id gnl|my_center|LOCUS_03420 99442 100248 gene locus_tag LOCUS_03430 99442 100248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 100245 101207 gene locus_tag LOCUS_03440 100245 101207 CDS product NDP-sugar dehydratase or epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544985.1 protein_id gnl|my_center|LOCUS_03440 101209 102339 gene locus_tag LOCUS_03450 101209 102339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 102422 104809 gene locus_tag LOCUS_03460 102422 104809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 106343 104856 gene locus_tag LOCUS_03470 gene gltD 106343 104856 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_03470 110987 106365 gene locus_tag LOCUS_03480 110987 106365 CDS product glutamate synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807931.1 protein_id gnl|my_center|LOCUS_03480 111520 111185 gene locus_tag LOCUS_03490 111520 111185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 112019 111576 gene locus_tag LOCUS_03500 112019 111576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 112594 112100 gene locus_tag LOCUS_03510 112594 112100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 113173 112742 gene locus_tag LOCUS_03520 113173 112742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 114562 113198 gene locus_tag LOCUS_03530 114562 113198 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259259.1 protein_id gnl|my_center|LOCUS_03530 115042 114572 gene locus_tag LOCUS_03540 115042 114572 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732266.1 protein_id gnl|my_center|LOCUS_03540 115192 116277 gene locus_tag LOCUS_03550 115192 116277 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198211.1 protein_id gnl|my_center|LOCUS_03550 116333 116575 gene locus_tag LOCUS_03560 116333 116575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 116572 117219 gene locus_tag LOCUS_03570 116572 117219 CDS product transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382700.1 protein_id gnl|my_center|LOCUS_03570 117990 117304 gene locus_tag LOCUS_03580 117990 117304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 119408 120019 gene locus_tag LOCUS_03590 119408 120019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 120073 120870 gene locus_tag LOCUS_03600 120073 120870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 121256 120936 gene locus_tag LOCUS_03610 121256 120936 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687228.1 protein_id gnl|my_center|LOCUS_03610 121284 122033 gene locus_tag LOCUS_03620 gene kdsB 121284 122033 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NEX8 protein_id gnl|my_center|LOCUS_03620 122078 123319 gene locus_tag LOCUS_03630 gene trpB1 122078 123319 CDS product tryptophan synthase beta chain 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66923 protein_id gnl|my_center|LOCUS_03630 123342 123905 gene locus_tag LOCUS_03640 gene trpG 123342 123905 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943018.1 protein_id gnl|my_center|LOCUS_03640 124029 124409 gene locus_tag LOCUS_03650 gene nrdR 124029 124409 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPU0 protein_id gnl|my_center|LOCUS_03650 124425 124913 gene locus_tag LOCUS_03660 124425 124913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 124926 125270 gene locus_tag LOCUS_03670 124926 125270 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_03670 126747 125278 gene locus_tag LOCUS_03680 gene crtI 126747 125278 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118443.1 protein_id gnl|my_center|LOCUS_03680 127013 126765 gene locus_tag LOCUS_03690 127013 126765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 128274 127024 gene locus_tag LOCUS_03700 gene fabF 128274 127024 CDS product beta-ketoacyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118441.1 protein_id gnl|my_center|LOCUS_03700 128404 129063 gene locus_tag LOCUS_03710 gene sigE 128404 129063 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MGI0 protein_id gnl|my_center|LOCUS_03710 129145 129933 gene locus_tag LOCUS_03720 129145 129933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 129933 131012 gene locus_tag LOCUS_03730 129933 131012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 131966 131052 gene locus_tag LOCUS_03740 131966 131052 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_03740 132876 132001 gene locus_tag LOCUS_03750 gene menA 132876 132001 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PX8 protein_id gnl|my_center|LOCUS_03750 133019 133315 gene locus_tag LOCUS_03760 gene YajC 133019 133315 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722646.1 protein_id gnl|my_center|LOCUS_03760 133334 135874 gene locus_tag LOCUS_03770 133334 135874 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531306.1 protein_id gnl|my_center|LOCUS_03770 136082 137809 gene locus_tag LOCUS_03780 gene recJ 136082 137809 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_03780 137813 138571 gene locus_tag LOCUS_03790 gene pdxJ 137813 138571 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3V870 protein_id gnl|my_center|LOCUS_03790 138597 140201 gene locus_tag LOCUS_03800 gene nnr 138597 140201 CDS product bifunctional NAD(P)H-hydrate repair enzyme Nnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGI2 protein_id gnl|my_center|LOCUS_03800 140268 141431 gene locus_tag LOCUS_03810 140268 141431 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392539.1 protein_id gnl|my_center|LOCUS_03810 142738 141494 gene locus_tag LOCUS_03820 142738 141494 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870908.1 protein_id gnl|my_center|LOCUS_03820 142828 143670 gene locus_tag LOCUS_03830 gene panC 142828 143670 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X0G6 protein_id gnl|my_center|LOCUS_03830 143685 145331 gene locus_tag LOCUS_03840 gene nadB 143685 145331 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C48 protein_id gnl|my_center|LOCUS_03840 145339 145989 gene locus_tag LOCUS_03850 gene nth 145339 145989 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYL6 protein_id gnl|my_center|LOCUS_03850 146049 146357 gene locus_tag LOCUS_03860 146049 146357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 146438 147877 gene locus_tag LOCUS_03870 146438 147877 CDS product UDP-N-acetylhexosamine pyrophosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 protein_id gnl|my_center|LOCUS_03870 147888 149849 gene locus_tag LOCUS_03880 gene pgmA 147888 149849 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121684.1 protein_id gnl|my_center|LOCUS_03880 149964 149888 gene locus_tag LOCUS_t00060 149964 149888 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 150076 151245 gene locus_tag LOCUS_03890 150076 151245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 152017 151310 gene locus_tag LOCUS_03900 152017 151310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 152167 152024 gene locus_tag LOCUS_03910 152167 152024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 152533 152171 gene locus_tag LOCUS_03920 152533 152171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 154159 152579 gene locus_tag LOCUS_03930 gene pgi 154159 152579 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DK5 protein_id gnl|my_center|LOCUS_03930 155842 154196 gene locus_tag LOCUS_03940 gene ilvD 155842 154196 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK13 protein_id gnl|my_center|LOCUS_03940 156029 156826 gene locus_tag LOCUS_03950 156029 156826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 156823 157905 gene locus_tag LOCUS_03960 gene pheA 156823 157905 CDS product P-protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67085 protein_id gnl|my_center|LOCUS_03960 157955 158344 gene locus_tag LOCUS_03970 gene panD 157955 158344 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV68 protein_id gnl|my_center|LOCUS_03970 158502 160352 gene locus_tag LOCUS_03980 gene btuB 158502 160352 CDS product vitamin B12 transporter BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CTG7 protein_id gnl|my_center|LOCUS_03980 160352 160744 gene locus_tag LOCUS_03990 160352 160744 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174007.1 protein_id gnl|my_center|LOCUS_03990 161262 160741 gene locus_tag LOCUS_04000 161262 160741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 161360 162640 gene locus_tag LOCUS_04010 gene lysA 161360 162640 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190627.1 protein_id gnl|my_center|LOCUS_04010 164472 162649 gene locus_tag LOCUS_04020 164472 162649 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933466.1 protein_id gnl|my_center|LOCUS_04020 164814 164479 gene locus_tag LOCUS_04030 164814 164479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 165949 164753 gene locus_tag LOCUS_04040 165949 164753 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085828.1 protein_id gnl|my_center|LOCUS_04040 166026 166913 gene locus_tag LOCUS_04050 gene miaA 166026 166913 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MBD2 protein_id gnl|my_center|LOCUS_04050 167798 166932 gene locus_tag LOCUS_04060 gene gluQ 167798 166932 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BE3 protein_id gnl|my_center|LOCUS_04060 167865 169163 gene locus_tag LOCUS_04070 gene rhlE-2 167865 169163 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941582.1 protein_id gnl|my_center|LOCUS_04070 169166 169963 gene locus_tag LOCUS_04080 169166 169963 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73J56 protein_id gnl|my_center|LOCUS_04080 170089 170826 gene locus_tag LOCUS_04090 170089 170826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 170846 171928 gene locus_tag LOCUS_04100 gene recF 170846 171928 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73R61 protein_id gnl|my_center|LOCUS_04100 172330 171956 gene locus_tag LOCUS_04110 172330 171956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 172791 173387 gene locus_tag LOCUS_04120 172791 173387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 173406 175157 gene locus_tag LOCUS_04130 173406 175157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 175174 176160 gene locus_tag LOCUS_04140 175174 176160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 176206 177075 gene locus_tag LOCUS_04150 176206 177075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 177134 179545 gene locus_tag LOCUS_04160 177134 179545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 179675 180484 gene locus_tag LOCUS_04170 179675 180484 CDS product TatD-related deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391597.1 protein_id gnl|my_center|LOCUS_04170 181116 180490 gene locus_tag LOCUS_04180 181116 180490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 181935 181141 gene locus_tag LOCUS_04190 gene kdsA 181935 181141 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66496 protein_id gnl|my_center|LOCUS_04190 182637 182002 gene locus_tag LOCUS_04200 gene pdxH 182637 182002 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4S5 protein_id gnl|my_center|LOCUS_04200 183575 182649 gene locus_tag LOCUS_04210 gene trxB 183575 182649 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R7I9 protein_id gnl|my_center|LOCUS_04210 184243 183647 gene locus_tag LOCUS_04220 gene ribB 184243 183647 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001255364.1 protein_id gnl|my_center|LOCUS_04220 184329 184255 gene locus_tag LOCUS_t00070 184329 184255 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 186242 184404 gene locus_tag LOCUS_04230 gene thrS 186242 184404 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYT8 protein_id gnl|my_center|LOCUS_04230 187205 186327 gene locus_tag LOCUS_04240 187205 186327 CDS product regucalcin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181677.1 protein_id gnl|my_center|LOCUS_04240 188707 187247 gene locus_tag LOCUS_04250 gene cysS 188707 187247 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MGC2 protein_id gnl|my_center|LOCUS_04250 188728 189801 gene locus_tag LOCUS_04260 gene hemB 188728 189801 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403773.1 protein_id gnl|my_center|LOCUS_04260 190833 189874 gene locus_tag LOCUS_04270 190833 189874 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262781.1 protein_id gnl|my_center|LOCUS_04270 191021 191524 gene locus_tag LOCUS_04280 191021 191524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 191533 193506 gene locus_tag LOCUS_04290 gene speA 191533 193506 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NE10 protein_id gnl|my_center|LOCUS_04290 193557 194696 gene locus_tag LOCUS_04300 gene metX 193557 194696 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZZ0 protein_id gnl|my_center|LOCUS_04300 194689 195324 gene locus_tag LOCUS_04310 gene metW 194689 195324 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217230.1 protein_id gnl|my_center|LOCUS_04310 195341 195730 gene locus_tag LOCUS_04320 gene queF 195341 195730 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVG9 protein_id gnl|my_center|LOCUS_04320 197113 195773 gene locus_tag LOCUS_04330 gene gltP 197113 195773 CDS product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_04330 197945 197091 gene locus_tag LOCUS_04340 gene rsmA 197945 197091 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z6K0 protein_id gnl|my_center|LOCUS_04340 198779 197985 gene locus_tag LOCUS_04350 gene trpC 198779 197985 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94327 protein_id gnl|my_center|LOCUS_04350 200415 198805 gene locus_tag LOCUS_04360 gene pyrG 200415 198805 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJ86 protein_id gnl|my_center|LOCUS_04360 200658 201545 gene locus_tag LOCUS_04370 200658 201545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345920.1 protein_id gnl|my_center|LOCUS_04370 201563 203506 gene locus_tag LOCUS_04380 gene sdhA 201563 203506 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_04380 203516 204271 gene locus_tag LOCUS_04390 203516 204271 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_04390 204602 204372 gene locus_tag LOCUS_04400 204602 204372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 206509 204836 gene locus_tag LOCUS_04410 gene ppaC 206509 204836 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326733.1 protein_id gnl|my_center|LOCUS_04410 207339 206629 gene locus_tag LOCUS_04420 207339 206629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 208806 207550 gene locus_tag LOCUS_04430 gene glyA 208806 207550 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ59 protein_id gnl|my_center|LOCUS_04430 >Feature sequence03 81 6 gene locus_tag LOCUS_t00080 81 6 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 185 110 gene locus_tag LOCUS_t00090 185 110 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 768 1850 gene locus_tag LOCUS_04440 gene nrdB 768 1850 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MK81 protein_id gnl|my_center|LOCUS_04440 2021 5275 gene locus_tag LOCUS_04450 gene nrdA 2021 5275 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUL9 protein_id gnl|my_center|LOCUS_04450 7807 5396 gene locus_tag LOCUS_04460 gene rnr 7807 5396 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZI1 protein_id gnl|my_center|LOCUS_04460 9873 7867 gene locus_tag LOCUS_04470 gene ppk 9873 7867 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGU8 protein_id gnl|my_center|LOCUS_04470 11919 10042 gene locus_tag LOCUS_04480 11919 10042 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460040.1 protein_id gnl|my_center|LOCUS_04480 12094 13470 gene locus_tag LOCUS_04490 12094 13470 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_04490 13561 14415 gene locus_tag LOCUS_04500 13561 14415 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064991.1 protein_id gnl|my_center|LOCUS_04500 14472 14547 gene locus_tag LOCUS_t00100 14472 14547 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 14923 16290 gene locus_tag LOCUS_04510 14923 16290 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGU7 protein_id gnl|my_center|LOCUS_04510 16315 16653 gene locus_tag LOCUS_04520 gene glnB 16315 16653 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66513 protein_id gnl|my_center|LOCUS_04520 16797 18086 gene locus_tag LOCUS_04530 16797 18086 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500B0 protein_id gnl|my_center|LOCUS_04530 18142 18480 gene locus_tag LOCUS_04540 gene glnB 18142 18480 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812004.1 protein_id gnl|my_center|LOCUS_04540 18679 19737 gene locus_tag LOCUS_04550 18679 19737 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942836.1 protein_id gnl|my_center|LOCUS_04550 19941 21767 gene locus_tag LOCUS_04560 19941 21767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 22091 23065 gene locus_tag LOCUS_04570 22091 23065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 23233 24750 gene locus_tag LOCUS_04580 23233 24750 CDS product glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108760.1 protein_id gnl|my_center|LOCUS_04580 24929 27895 gene locus_tag LOCUS_04590 24929 27895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 27914 28999 gene locus_tag LOCUS_04600 27914 28999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 29023 29796 gene locus_tag LOCUS_04610 29023 29796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 29816 30223 gene locus_tag LOCUS_04620 gene exbD3 29816 30223 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919048.1 protein_id gnl|my_center|LOCUS_04620 30226 30666 gene locus_tag LOCUS_04630 30226 30666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 30790 31875 gene locus_tag LOCUS_04640 30790 31875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 32514 31990 gene locus_tag LOCUS_04650 gene slyD 32514 31990 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase SlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44830 protein_id gnl|my_center|LOCUS_04650 32938 32851 gene locus_tag LOCUS_t00110 32938 32851 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 33373 33900 gene locus_tag LOCUS_04660 33373 33900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 35562 33976 gene locus_tag LOCUS_04670 35562 33976 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546463.1 protein_id gnl|my_center|LOCUS_04670 35604 36227 gene locus_tag LOCUS_04680 gene coaE 35604 36227 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67792 protein_id gnl|my_center|LOCUS_04680 36411 38222 gene locus_tag LOCUS_04690 36411 38222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 38339 40048 gene locus_tag LOCUS_04700 gene pilB 38339 40048 CDS product type IV fimbrial assembly protein PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123899.1 protein_id gnl|my_center|LOCUS_04700 40069 41757 gene locus_tag LOCUS_04710 gene pilB 40069 41757 CDS product type IV fimbrial assembly protein PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123902.1 protein_id gnl|my_center|LOCUS_04710 41780 43036 gene locus_tag LOCUS_04720 gene pilC 41780 43036 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_04720 43136 44401 gene locus_tag LOCUS_04730 43136 44401 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555861.1 protein_id gnl|my_center|LOCUS_04730 44405 45403 gene locus_tag LOCUS_04740 44405 45403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 45442 46233 gene locus_tag LOCUS_04750 45442 46233 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403269.1 protein_id gnl|my_center|LOCUS_04750 47194 46217 gene locus_tag LOCUS_04760 gene accA 47194 46217 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SHG3 protein_id gnl|my_center|LOCUS_04760 47624 47259 gene locus_tag LOCUS_04770 47624 47259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 47675 48379 gene locus_tag LOCUS_04780 47675 48379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938748.1 protein_id gnl|my_center|LOCUS_04780 48446 49252 gene locus_tag LOCUS_04790 48446 49252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 49365 50348 gene locus_tag LOCUS_04800 49365 50348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 50548 50473 gene locus_tag LOCUS_t00120 50548 50473 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 52055 50646 gene locus_tag LOCUS_04810 52055 50646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 52598 54724 gene locus_tag LOCUS_04820 52598 54724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101985.1 protein_id gnl|my_center|LOCUS_04820 54895 59478 gene locus_tag LOCUS_04830 54895 59478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 59628 59552 gene locus_tag LOCUS_t00130 59628 59552 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 59680 60534 gene locus_tag LOCUS_04840 59680 60534 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124073.1 protein_id gnl|my_center|LOCUS_04840 62638 60611 gene locus_tag LOCUS_04850 62638 60611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 62901 64727 gene locus_tag LOCUS_04860 62901 64727 CDS product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080425.1 protein_id gnl|my_center|LOCUS_04860 64803 65030 gene locus_tag LOCUS_04870 64803 65030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 65180 65104 gene locus_tag LOCUS_t00140 65180 65104 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 66971 65322 gene locus_tag LOCUS_04880 66971 65322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 67732 67070 gene locus_tag LOCUS_04890 67732 67070 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957169.1 protein_id gnl|my_center|LOCUS_04890 67818 68333 gene locus_tag LOCUS_04900 67818 68333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 70180 68348 gene locus_tag LOCUS_04910 gene typA 70180 68348 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941168.1 protein_id gnl|my_center|LOCUS_04910 71615 70257 gene locus_tag LOCUS_04920 71615 70257 CDS product Ysh1p: subunit of polyadenylation factor I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404676.1 protein_id gnl|my_center|LOCUS_04920 71787 73700 gene locus_tag LOCUS_04930 gene purF 71787 73700 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_04930 73724 75289 gene locus_tag LOCUS_04940 gene purH 73724 75289 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFK6 protein_id gnl|my_center|LOCUS_04940 75369 76055 gene locus_tag LOCUS_04950 75369 76055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 76052 77122 gene locus_tag LOCUS_04960 gene gcvT 76052 77122 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CZV9 protein_id gnl|my_center|LOCUS_04960 77142 77525 gene locus_tag LOCUS_04970 gene gcvH 77142 77525 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SKW9 protein_id gnl|my_center|LOCUS_04970 77534 80383 gene locus_tag LOCUS_04980 gene gcvP 77534 80383 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXH2 protein_id gnl|my_center|LOCUS_04980 80441 81835 gene locus_tag LOCUS_04990 80441 81835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227990.1 protein_id gnl|my_center|LOCUS_04990 82458 81898 gene locus_tag LOCUS_05000 82458 81898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 82621 83370 gene locus_tag LOCUS_05010 82621 83370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 84624 83458 gene locus_tag LOCUS_05020 84624 83458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902666.1 protein_id gnl|my_center|LOCUS_05020 85717 84638 gene locus_tag LOCUS_05030 gene eutD 85717 84638 CDS product phosphotransacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254958.1 protein_id gnl|my_center|LOCUS_05030 85866 87455 gene locus_tag LOCUS_05040 gene mviN 85866 87455 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIQ1 protein_id gnl|my_center|LOCUS_05040 88447 87479 gene locus_tag LOCUS_05050 88447 87479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 88518 89150 gene locus_tag LOCUS_05060 88518 89150 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083722.1 protein_id gnl|my_center|LOCUS_05060 89147 90289 gene locus_tag LOCUS_05070 gene ribD 89147 90289 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66534 protein_id gnl|my_center|LOCUS_05070 90898 90290 gene locus_tag LOCUS_05080 gene ruvA 90898 90290 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51425 protein_id gnl|my_center|LOCUS_05080 91659 90916 gene locus_tag LOCUS_05090 gene dapB 91659 90916 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PIT2 protein_id gnl|my_center|LOCUS_05090 92549 91656 gene locus_tag LOCUS_05100 gene dapA 92549 91656 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67216 protein_id gnl|my_center|LOCUS_05100 93134 92616 gene locus_tag LOCUS_05110 gene lspA 93134 92616 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK54 protein_id gnl|my_center|LOCUS_05110 94393 93167 gene locus_tag LOCUS_05120 94393 93167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 97237 94418 gene locus_tag LOCUS_05130 gene ileS 97237 94418 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46213 protein_id gnl|my_center|LOCUS_05130 97373 98395 gene locus_tag LOCUS_05140 gene yrbG 97373 98395 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261186.1 protein_id gnl|my_center|LOCUS_05140 98419 100023 gene locus_tag LOCUS_05150 gene gpmI 98419 100023 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFG7 protein_id gnl|my_center|LOCUS_05150 100023 101003 gene locus_tag LOCUS_05160 100023 101003 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255969.1 protein_id gnl|my_center|LOCUS_05160 101850 101080 gene locus_tag LOCUS_05170 101850 101080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 102440 101883 gene locus_tag LOCUS_05180 gene frr 102440 101883 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS4 protein_id gnl|my_center|LOCUS_05180 103193 102447 gene locus_tag LOCUS_05190 gene pyrH 103193 102447 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97I64 protein_id gnl|my_center|LOCUS_05190 103303 103376 gene locus_tag LOCUS_t00150 103303 103376 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 104779 104096 gene locus_tag LOCUS_05200 104779 104096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057912.1 protein_id gnl|my_center|LOCUS_05200 104824 105498 gene locus_tag LOCUS_05210 gene nadD 104824 105498 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57090 protein_id gnl|my_center|LOCUS_05210 105502 105873 gene locus_tag LOCUS_05220 105502 105873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 105951 107006 gene locus_tag LOCUS_05230 gene pheS 105951 107006 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL09 protein_id gnl|my_center|LOCUS_05230 107003 109471 gene locus_tag LOCUS_05240 gene pheT 107003 109471 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CZ9 protein_id gnl|my_center|LOCUS_05240 109475 109765 gene locus_tag LOCUS_05250 gene gatC 109475 109765 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S325 protein_id gnl|my_center|LOCUS_05250 109795 111267 gene locus_tag LOCUS_05260 gene gatA 109795 111267 CDS product aspartyl/glutamyl-tRNA amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812377.1 protein_id gnl|my_center|LOCUS_05260 111280 112749 gene locus_tag LOCUS_05270 gene gatB 111280 112749 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YL60 protein_id gnl|my_center|LOCUS_05270 113451 112738 gene locus_tag LOCUS_05280 113451 112738 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I683 protein_id gnl|my_center|LOCUS_05280 113538 114734 gene locus_tag LOCUS_05290 gene rlmN 113538 114734 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0X3 protein_id gnl|my_center|LOCUS_05290 116046 114772 gene locus_tag LOCUS_05300 gene proA 116046 114772 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747Q4 protein_id gnl|my_center|LOCUS_05300 117086 116112 gene locus_tag LOCUS_05310 117086 116112 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108486.1 protein_id gnl|my_center|LOCUS_05310 117515 117111 gene locus_tag LOCUS_05320 117515 117111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 119212 117854 gene locus_tag LOCUS_05330 gene xseA 119212 117854 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXA6 protein_id gnl|my_center|LOCUS_05330 119283 119807 gene locus_tag LOCUS_05340 119283 119807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 119851 120414 gene locus_tag LOCUS_05350 119851 120414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 122558 120429 gene locus_tag LOCUS_05360 122558 120429 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072660.1 protein_id gnl|my_center|LOCUS_05360 123356 122895 gene locus_tag LOCUS_05370 123356 122895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 124235 123363 gene locus_tag LOCUS_05380 124235 123363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625866.1 protein_id gnl|my_center|LOCUS_05380 127087 124349 gene locus_tag LOCUS_05390 gene ppd 127087 124349 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933346.1 protein_id gnl|my_center|LOCUS_05390 127277 128065 gene locus_tag LOCUS_05400 gene tatC 127277 128065 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD48 protein_id gnl|my_center|LOCUS_05400 128071 129063 gene locus_tag LOCUS_05410 128071 129063 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118170.1 protein_id gnl|my_center|LOCUS_05410 131135 129111 gene locus_tag LOCUS_05420 gene ligA 131135 129111 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y6D0 protein_id gnl|my_center|LOCUS_05420 131684 131190 gene locus_tag LOCUS_05430 131684 131190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 133016 131925 gene locus_tag LOCUS_05440 133016 131925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 133782 133288 gene locus_tag LOCUS_05450 gene msrA 133782 133288 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87JF2 protein_id gnl|my_center|LOCUS_05450 133977 135767 gene locus_tag LOCUS_05460 133977 135767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 135805 136665 gene locus_tag LOCUS_05470 gene yigM 135805 136665 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418680.1 protein_id gnl|my_center|LOCUS_05470 136986 136858 gene locus_tag LOCUS_05480 136986 136858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 137039 137410 gene locus_tag LOCUS_05490 137039 137410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 137712 138368 gene locus_tag LOCUS_05500 137712 138368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 138378 139784 gene locus_tag LOCUS_05510 138378 139784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103627.1 protein_id gnl|my_center|LOCUS_05510 >Feature sequence04 1278 757 gene locus_tag LOCUS_05520 1278 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 1975 2706 gene locus_tag LOCUS_05530 1975 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 3734 2703 gene locus_tag LOCUS_05540 3734 2703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 3919 6945 gene locus_tag LOCUS_05550 gene secA 3919 6945 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD18 protein_id gnl|my_center|LOCUS_05550 7373 8533 gene locus_tag LOCUS_05560 7373 8533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 9563 8535 gene locus_tag LOCUS_05570 9563 8535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 11154 9649 gene locus_tag LOCUS_05580 gene trpE 11154 9649 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_05580 12323 11184 gene locus_tag LOCUS_05590 gene purK 12323 11184 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQS2 protein_id gnl|my_center|LOCUS_05590 12832 12320 gene locus_tag LOCUS_05600 gene purE 12832 12320 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72157 protein_id gnl|my_center|LOCUS_05600 13728 12880 gene locus_tag LOCUS_05610 13728 12880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 13825 16707 gene locus_tag LOCUS_05620 gene rapA 13825 16707 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KP70 protein_id gnl|my_center|LOCUS_05620 17957 16752 gene locus_tag LOCUS_05630 17957 16752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 18098 19243 gene locus_tag LOCUS_05640 gene carA 18098 19243 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFI2 protein_id gnl|my_center|LOCUS_05640 20610 19330 gene locus_tag LOCUS_05650 gene folC 20610 19330 CDS product tetrahydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002319749.1 protein_id gnl|my_center|LOCUS_05650 21478 20624 gene locus_tag LOCUS_05660 gene accD 21478 20624 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AI4 protein_id gnl|my_center|LOCUS_05660 21971 21555 gene locus_tag LOCUS_05670 21971 21555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 22055 22297 gene locus_tag LOCUS_05680 22055 22297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 23040 22300 gene locus_tag LOCUS_05690 gene truA 23040 22300 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P70973 protein_id gnl|my_center|LOCUS_05690 23132 23731 gene locus_tag LOCUS_05700 gene ruvC 23132 23731 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PDT0 protein_id gnl|my_center|LOCUS_05700 23754 24470 gene locus_tag LOCUS_05710 gene adh2 23754 24470 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880787.1 protein_id gnl|my_center|LOCUS_05710 26413 24482 gene locus_tag LOCUS_05720 gene mrdA 26413 24482 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_05720 26946 26419 gene locus_tag LOCUS_05730 26946 26419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 27819 26959 gene locus_tag LOCUS_05740 27819 26959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 28847 27825 gene locus_tag LOCUS_05750 gene mreB-1 28847 27825 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_05750 30118 28946 gene locus_tag LOCUS_05760 gene tyrS-2 30118 28946 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMW6 protein_id gnl|my_center|LOCUS_05760 30709 30140 gene locus_tag LOCUS_05770 30709 30140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 31786 30737 gene locus_tag LOCUS_05780 gene ruvB 31786 30737 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3F9 protein_id gnl|my_center|LOCUS_05780 33126 31831 gene locus_tag LOCUS_05790 gene murA 33126 31831 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83DI0 protein_id gnl|my_center|LOCUS_05790 33758 33147 gene locus_tag LOCUS_05800 33758 33147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 33965 34336 gene locus_tag LOCUS_05810 33965 34336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 34384 34986 gene locus_tag LOCUS_05820 34384 34986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 37142 34983 gene locus_tag LOCUS_05830 37142 34983 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888294.1 protein_id gnl|my_center|LOCUS_05830 38160 37162 gene locus_tag LOCUS_05840 38160 37162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 39449 38262 gene locus_tag LOCUS_05850 39449 38262 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764417.1 protein_id gnl|my_center|LOCUS_05850 40109 39453 gene locus_tag LOCUS_05860 gene aas 40109 39453 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881346.1 protein_id gnl|my_center|LOCUS_05860 40773 40111 gene locus_tag LOCUS_05870 gene cmk 40773 40111 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749Y7 protein_id gnl|my_center|LOCUS_05870 42160 40766 gene locus_tag LOCUS_05880 gene aroA 42160 40766 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DEX7 protein_id gnl|my_center|LOCUS_05880 43035 42166 gene locus_tag LOCUS_05890 43035 42166 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545810.1 protein_id gnl|my_center|LOCUS_05890 43161 44855 gene locus_tag LOCUS_05900 43161 44855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 44872 45219 gene locus_tag LOCUS_05910 44872 45219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 46743 45262 gene locus_tag LOCUS_05920 46743 45262 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5F2 protein_id gnl|my_center|LOCUS_05920 46845 48122 gene locus_tag LOCUS_05930 46845 48122 CDS product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DYM0 protein_id gnl|my_center|LOCUS_05930 48229 49329 gene locus_tag LOCUS_05940 48229 49329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 49397 50824 gene locus_tag LOCUS_05950 49397 50824 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CK34 protein_id gnl|my_center|LOCUS_05950 50899 52164 gene locus_tag LOCUS_05960 gene pfp 50899 52164 CDS product pyrophosphate--fructose 6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJ41 protein_id gnl|my_center|LOCUS_05960 52753 52226 gene locus_tag LOCUS_05970 52753 52226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 53381 52761 gene locus_tag LOCUS_05980 53381 52761 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202077.1 protein_id gnl|my_center|LOCUS_05980 53701 53402 gene locus_tag LOCUS_05990 53701 53402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 54325 53720 gene locus_tag LOCUS_06000 gene thrH 54325 53720 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116438.1 protein_id gnl|my_center|LOCUS_06000 54976 54332 gene locus_tag LOCUS_06010 54976 54332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 56120 54990 gene locus_tag LOCUS_06020 gene fjo30 56120 54990 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_06020 56182 56544 gene locus_tag LOCUS_06030 56182 56544 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ1 protein_id gnl|my_center|LOCUS_06030 56577 58118 gene locus_tag LOCUS_06040 gene zwf 56577 58118 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WE89 protein_id gnl|my_center|LOCUS_06040 58145 59107 gene locus_tag LOCUS_06050 58145 59107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 59607 59146 gene locus_tag LOCUS_06060 59607 59146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 61115 59688 gene locus_tag LOCUS_06070 gene pykA 61115 59688 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UF82 protein_id gnl|my_center|LOCUS_06070 61948 61112 gene locus_tag LOCUS_06080 gene yycJ 61948 61112 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883514.1 protein_id gnl|my_center|LOCUS_06080 62084 63067 gene locus_tag LOCUS_06090 gene folE2 62084 63067 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5D3 protein_id gnl|my_center|LOCUS_06090 63180 63728 gene locus_tag LOCUS_06100 63180 63728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 63785 65278 gene locus_tag LOCUS_06110 gene gnfM 63785 65278 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941668.1 protein_id gnl|my_center|LOCUS_06110 66026 65352 gene locus_tag LOCUS_06120 66026 65352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 66069 66488 gene locus_tag LOCUS_06130 66069 66488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140630.1 protein_id gnl|my_center|LOCUS_06130 68006 66504 gene locus_tag LOCUS_06140 68006 66504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 69845 68292 gene locus_tag LOCUS_06150 gene purA 69845 68292 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q814H1 protein_id gnl|my_center|LOCUS_06150 71429 69852 gene locus_tag LOCUS_06160 gene guaB 71429 69852 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZU8 protein_id gnl|my_center|LOCUS_06160 71484 72500 gene locus_tag LOCUS_06170 gene menC 71484 72500 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJP8 protein_id gnl|my_center|LOCUS_06170 72490 73899 gene locus_tag LOCUS_06180 gene menE 72490 73899 CDS product O-succinylbenzoic acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057063.1 protein_id gnl|my_center|LOCUS_06180 73999 74646 gene locus_tag LOCUS_06190 73999 74646 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328559.1 protein_id gnl|my_center|LOCUS_06190 74691 76049 gene locus_tag LOCUS_06200 gene ugdH 74691 76049 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118525.1 protein_id gnl|my_center|LOCUS_06200 76085 77269 gene locus_tag LOCUS_06210 gene fabV 76085 77269 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG14 protein_id gnl|my_center|LOCUS_06210 77613 77275 gene locus_tag LOCUS_06220 77613 77275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 77723 77799 gene locus_tag LOCUS_t00160 77723 77799 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 78077 82708 gene locus_tag LOCUS_06230 78077 82708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 83653 82787 gene locus_tag LOCUS_06240 gene suhB 83653 82787 CDS product inositol phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050899.1 protein_id gnl|my_center|LOCUS_06240 84373 83720 gene locus_tag LOCUS_06250 84373 83720 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875742.1 protein_id gnl|my_center|LOCUS_06250 84853 84416 gene locus_tag LOCUS_06260 84853 84416 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_06260 86143 84863 gene locus_tag LOCUS_06270 gene mntH 86143 84863 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125355.1 protein_id gnl|my_center|LOCUS_06270 86362 87834 gene locus_tag LOCUS_06280 86362 87834 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118315.1 protein_id gnl|my_center|LOCUS_06280 87946 88377 gene locus_tag LOCUS_06290 87946 88377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 88374 89180 gene locus_tag LOCUS_06300 gene fabI 88374 89180 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UG49 protein_id gnl|my_center|LOCUS_06300 90068 89190 gene locus_tag LOCUS_06310 90068 89190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 90200 91237 gene locus_tag LOCUS_06320 gene fabH 90200 91237 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123917.1 protein_id gnl|my_center|LOCUS_06320 91248 92147 gene locus_tag LOCUS_06330 91248 92147 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259370.1 protein_id gnl|my_center|LOCUS_06330 92366 92848 gene locus_tag LOCUS_06340 92366 92848 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879119.1 protein_id gnl|my_center|LOCUS_06340 92850 94022 gene locus_tag LOCUS_06350 92850 94022 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJ87 protein_id gnl|my_center|LOCUS_06350 94027 95577 gene locus_tag LOCUS_06360 gene der 94027 95577 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4V0 protein_id gnl|my_center|LOCUS_06360 96302 95676 gene locus_tag LOCUS_06370 gene sodA 96302 95676 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPW1 protein_id gnl|my_center|LOCUS_06370 96958 96434 gene locus_tag LOCUS_06380 gene tadA 96958 96434 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2VEQ5 protein_id gnl|my_center|LOCUS_06380 97038 97367 gene locus_tag LOCUS_06390 97038 97367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 97471 98430 gene locus_tag LOCUS_06400 gene cysK 97471 98430 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7DDL5 protein_id gnl|my_center|LOCUS_06400 99162 98563 gene locus_tag LOCUS_06410 99162 98563 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100063.1 protein_id gnl|my_center|LOCUS_06410 99269 100702 gene locus_tag LOCUS_06420 gene phrB 99269 100702 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179955.1 protein_id gnl|my_center|LOCUS_06420 100708 102261 gene locus_tag LOCUS_06430 100708 102261 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121705.1 protein_id gnl|my_center|LOCUS_06430 102262 103179 gene locus_tag LOCUS_06440 102262 103179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 103169 104149 gene locus_tag LOCUS_06450 103169 104149 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266745.1 protein_id gnl|my_center|LOCUS_06450 106729 104138 gene locus_tag LOCUS_06460 106729 104138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 108710 106758 gene locus_tag LOCUS_06470 108710 106758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 110188 108707 gene locus_tag LOCUS_06480 110188 108707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 110976 110194 gene locus_tag LOCUS_06490 110976 110194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 111964 110990 gene locus_tag LOCUS_06500 111964 110990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 112099 112755 gene locus_tag LOCUS_06510 gene rnhB 112099 112755 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL36 protein_id gnl|my_center|LOCUS_06510 112923 112997 gene locus_tag LOCUS_t00170 112923 112997 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 113133 114323 gene locus_tag LOCUS_06520 gene tuf 113133 114323 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMZ0 protein_id gnl|my_center|LOCUS_06520 114454 114529 gene locus_tag LOCUS_t00180 114454 114529 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 114782 115360 gene locus_tag LOCUS_06530 gene nusG 114782 115360 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y1 protein_id gnl|my_center|LOCUS_06530 115367 115792 gene locus_tag LOCUS_06540 gene rplK 115367 115792 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EG5 protein_id gnl|my_center|LOCUS_06540 115825 116529 gene locus_tag LOCUS_06550 gene rplA 115825 116529 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MH85 protein_id gnl|my_center|LOCUS_06550 116546 117070 gene locus_tag LOCUS_06560 gene rplJ 116546 117070 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV1 protein_id gnl|my_center|LOCUS_06560 117189 117578 gene locus_tag LOCUS_06570 gene rplL 117189 117578 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A466 protein_id gnl|my_center|LOCUS_06570 117745 121536 gene locus_tag LOCUS_06580 gene rpoB 117745 121536 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B0B7N1 protein_id gnl|my_center|LOCUS_06580 121561 125811 gene locus_tag LOCUS_06590 gene rpoC 121561 125811 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O84316 protein_id gnl|my_center|LOCUS_06590 126013 126387 gene locus_tag LOCUS_06600 gene rpsL 126013 126387 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG52 protein_id gnl|my_center|LOCUS_06600 126436 126909 gene locus_tag LOCUS_06610 gene rpsG 126436 126909 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38526 protein_id gnl|my_center|LOCUS_06610 126998 129139 gene locus_tag LOCUS_06620 gene fusA 126998 129139 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFP4 protein_id gnl|my_center|LOCUS_06620 129241 129549 gene locus_tag LOCUS_06630 gene rpsJ 129241 129549 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV9 protein_id gnl|my_center|LOCUS_06630 >Feature sequence05 849 88 gene locus_tag LOCUS_06640 849 88 CDS product xanthorhodopsin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404249.1 protein_id gnl|my_center|LOCUS_06640 2566 992 gene locus_tag LOCUS_06650 2566 992 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437464.1 protein_id gnl|my_center|LOCUS_06650 2680 2607 gene locus_tag LOCUS_t00190 2680 2607 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2793 3506 gene locus_tag LOCUS_06660 gene yqjF 2793 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54543 protein_id gnl|my_center|LOCUS_06660 3521 3937 gene locus_tag LOCUS_06670 3521 3937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 4046 4699 gene locus_tag LOCUS_06680 gene eda 4046 4699 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958121.1 protein_id gnl|my_center|LOCUS_06680 5113 5187 gene locus_tag LOCUS_t00200 5113 5187 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 6568 5306 gene locus_tag LOCUS_06690 6568 5306 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123037.1 protein_id gnl|my_center|LOCUS_06690 8163 6613 gene locus_tag LOCUS_06700 8163 6613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942511.1 protein_id gnl|my_center|LOCUS_06700 8283 8954 gene locus_tag LOCUS_06710 gene rnc 8283 8954 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E314 protein_id gnl|my_center|LOCUS_06710 8967 12347 gene locus_tag LOCUS_06720 8967 12347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 12344 13360 gene locus_tag LOCUS_06730 12344 13360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 14919 13387 gene locus_tag LOCUS_06740 gene metG 14919 13387 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJ14 protein_id gnl|my_center|LOCUS_06740 15779 14946 gene locus_tag LOCUS_06750 gene menB 15779 14946 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG66 protein_id gnl|my_center|LOCUS_06750 17572 15797 gene locus_tag LOCUS_06760 gene menD 17572 15797 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMI6 protein_id gnl|my_center|LOCUS_06760 18698 17637 gene locus_tag LOCUS_06770 gene trpS 18698 17637 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182U4 protein_id gnl|my_center|LOCUS_06770 19538 18720 gene locus_tag LOCUS_06780 19538 18720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 20048 19572 gene locus_tag LOCUS_06790 gene pgpA 20048 19572 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6Z5 protein_id gnl|my_center|LOCUS_06790 20697 20083 gene locus_tag LOCUS_06800 20697 20083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 20757 21242 gene locus_tag LOCUS_06810 gene coaD 20757 21242 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NET8 protein_id gnl|my_center|LOCUS_06810 21320 22666 gene locus_tag LOCUS_06820 21320 22666 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651487.1 protein_id gnl|my_center|LOCUS_06820 24606 22744 gene locus_tag LOCUS_06830 24606 22744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 24632 26002 gene locus_tag LOCUS_06840 gene rsmB 24632 26002 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94464 protein_id gnl|my_center|LOCUS_06840 27630 26005 gene locus_tag LOCUS_06850 gene fumA 27630 26005 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJY1 protein_id gnl|my_center|LOCUS_06850 28024 27707 gene locus_tag LOCUS_06860 28024 27707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 28270 29715 gene locus_tag LOCUS_06870 gene rpoN 28270 29715 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BZ1 protein_id gnl|my_center|LOCUS_06870 30849 29695 gene locus_tag LOCUS_06880 gene hemN 30849 29695 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001255455.1 protein_id gnl|my_center|LOCUS_06880 31676 30888 gene locus_tag LOCUS_06890 31676 30888 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172559.1 protein_id gnl|my_center|LOCUS_06890 34695 31846 gene locus_tag LOCUS_06900 gene uvrA 34695 31846 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34863 protein_id gnl|my_center|LOCUS_06900 34759 35022 gene locus_tag LOCUS_06910 34759 35022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 36251 35019 gene locus_tag LOCUS_06920 36251 35019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 36347 37459 gene locus_tag LOCUS_06930 36347 37459 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKJ7 protein_id gnl|my_center|LOCUS_06930 37506 37778 gene locus_tag LOCUS_06940 37506 37778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 38116 38559 gene locus_tag LOCUS_06950 gene rpiB 38116 38559 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947986.1 protein_id gnl|my_center|LOCUS_06950 38601 39167 gene locus_tag LOCUS_06960 gene clpP 38601 39167 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4T6 protein_id gnl|my_center|LOCUS_06960 40045 39191 gene locus_tag LOCUS_06970 gene zupT 40045 39191 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GP0 protein_id gnl|my_center|LOCUS_06970 40240 40165 gene locus_tag LOCUS_t00210 40240 40165 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 41354 40317 gene locus_tag LOCUS_06980 gene tsaD 41354 40317 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMF4 protein_id gnl|my_center|LOCUS_06980 41431 42423 gene locus_tag LOCUS_06990 41431 42423 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545013.1 protein_id gnl|my_center|LOCUS_06990 42499 42729 gene locus_tag LOCUS_07000 42499 42729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 43220 42855 gene locus_tag LOCUS_07010 gene rplS 43220 42855 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YK97 protein_id gnl|my_center|LOCUS_07010 43909 43226 gene locus_tag LOCUS_07020 gene trmD 43909 43226 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CQL4 protein_id gnl|my_center|LOCUS_07020 44456 43944 gene locus_tag LOCUS_07030 44456 43944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 44777 44538 gene locus_tag LOCUS_07040 44777 44538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 44834 45094 gene locus_tag LOCUS_07050 44834 45094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 47411 45135 gene locus_tag LOCUS_07060 gene priA 47411 45135 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94461 protein_id gnl|my_center|LOCUS_07060 47875 47408 gene locus_tag LOCUS_07070 47875 47408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 48359 47853 gene locus_tag LOCUS_07080 gene fur 48359 47853 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078417.1 protein_id gnl|my_center|LOCUS_07080 48467 48784 gene locus_tag LOCUS_07090 48467 48784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 48840 49097 gene locus_tag LOCUS_07100 gene rpmA 48840 49097 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P56050 protein_id gnl|my_center|LOCUS_07100 49262 50386 gene locus_tag LOCUS_07110 49262 50386 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811750.1 protein_id gnl|my_center|LOCUS_07110 53019 50539 gene locus_tag LOCUS_07120 gene clpC 53019 50539 CDS product ATP-dependent Clp protease ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121080.1 protein_id gnl|my_center|LOCUS_07120 54123 53053 gene locus_tag LOCUS_07130 gene mcsB 54123 53053 CDS product protein-arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CB0 protein_id gnl|my_center|LOCUS_07130 54642 54136 gene locus_tag LOCUS_07140 gene mcsA 54642 54136 CDS product protein-arginine kinase activator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37569 protein_id gnl|my_center|LOCUS_07140 55691 54825 gene locus_tag LOCUS_07150 gene ilvE 55691 54825 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005489.1 protein_id gnl|my_center|LOCUS_07150 57737 55797 gene locus_tag LOCUS_07160 gene acsA 57737 55797 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NP98 protein_id gnl|my_center|LOCUS_07160 57878 59653 gene locus_tag LOCUS_07170 57878 59653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 59711 60427 gene locus_tag LOCUS_07180 gene hisF 59711 60427 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBC1 protein_id gnl|my_center|LOCUS_07180 61171 60464 gene locus_tag LOCUS_07190 gene mazG 61171 60464 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071643.1 protein_id gnl|my_center|LOCUS_07190 62569 61211 gene locus_tag LOCUS_07200 62569 61211 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903476.1 protein_id gnl|my_center|LOCUS_07200 62911 62606 gene locus_tag LOCUS_07210 62911 62606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 63060 63776 gene locus_tag LOCUS_07220 gene ubiE 63060 63776 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EU2 protein_id gnl|my_center|LOCUS_07220 64584 63781 gene locus_tag LOCUS_07230 64584 63781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 64660 65538 gene locus_tag LOCUS_07240 64660 65538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 66046 65561 gene locus_tag LOCUS_07250 66046 65561 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_07250 67260 66043 gene locus_tag LOCUS_07260 gene csdB 67260 66043 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BY0 protein_id gnl|my_center|LOCUS_07260 67371 67625 gene locus_tag LOCUS_07270 67371 67625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 67710 69617 gene locus_tag LOCUS_07280 gene dxs1 67710 69617 CDS product 1-deoxy-D-xylulose-5-phosphate synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FC3 protein_id gnl|my_center|LOCUS_07280 71784 69652 gene locus_tag LOCUS_07290 gene uvrB 71784 69652 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLV3 protein_id gnl|my_center|LOCUS_07290 72486 71899 gene locus_tag LOCUS_07300 gene tsf 72486 71899 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61333 protein_id gnl|my_center|LOCUS_07300 73306 72515 gene locus_tag LOCUS_07310 gene rpsB 73306 72515 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZM1 protein_id gnl|my_center|LOCUS_07310 74072 73572 gene locus_tag LOCUS_07320 74072 73572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 75375 74413 gene locus_tag LOCUS_07330 75375 74413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 75651 75451 gene locus_tag LOCUS_07340 75651 75451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 76958 75732 gene locus_tag LOCUS_07350 gene rumA 76958 75732 CDS product 23S rRNA (uracil-5-)-methyltransferase RumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546143.1 protein_id gnl|my_center|LOCUS_07350 77008 77820 gene locus_tag LOCUS_07360 77008 77820 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963972.1 protein_id gnl|my_center|LOCUS_07360 79324 77852 gene locus_tag LOCUS_07370 gene glgA1 79324 77852 CDS product glycogen synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74ED9 protein_id gnl|my_center|LOCUS_07370 80398 79325 gene locus_tag LOCUS_07380 80398 79325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 80553 81074 gene locus_tag LOCUS_07390 80553 81074 CDS product HIT family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146469.1 protein_id gnl|my_center|LOCUS_07390 81328 83595 gene locus_tag LOCUS_07400 81328 83595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 83625 84077 gene locus_tag LOCUS_07410 83625 84077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 84916 84101 gene locus_tag LOCUS_07420 84916 84101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 86247 84913 gene locus_tag LOCUS_07430 gene clpX 86247 84913 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NDN9 protein_id gnl|my_center|LOCUS_07430 86850 86254 gene locus_tag LOCUS_07440 gene clpP 86850 86254 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YI38 protein_id gnl|my_center|LOCUS_07440 88284 86920 gene locus_tag LOCUS_07450 gene tig 88284 86920 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DE09 protein_id gnl|my_center|LOCUS_07450 88913 88365 gene locus_tag LOCUS_07460 88913 88365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 88998 89402 gene locus_tag LOCUS_07470 88998 89402 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405066.1 protein_id gnl|my_center|LOCUS_07470 89975 89442 gene locus_tag LOCUS_07480 gene aroK 89975 89442 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHI3 protein_id gnl|my_center|LOCUS_07480 90019 90540 gene locus_tag LOCUS_07490 90019 90540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 90598 91605 gene locus_tag LOCUS_07500 90598 91605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 93140 91731 gene locus_tag LOCUS_07510 gene argH 93140 91731 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJI1 protein_id gnl|my_center|LOCUS_07510 95206 93203 gene locus_tag LOCUS_07520 95206 93203 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948731.1 protein_id gnl|my_center|LOCUS_07520 95280 97091 gene locus_tag LOCUS_07530 gene mutL 95280 97091 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BP0 protein_id gnl|my_center|LOCUS_07530 97332 97973 gene locus_tag LOCUS_07540 97332 97973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 99112 98081 gene locus_tag LOCUS_07550 99112 98081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 99632 99126 gene locus_tag LOCUS_07560 99632 99126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 99734 100387 gene locus_tag LOCUS_07570 99734 100387 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080979.1 protein_id gnl|my_center|LOCUS_07570 102196 100460 gene locus_tag LOCUS_07580 gene cysI 102196 100460 CDS product sulfite reductase [NADPH] hemoprotein beta-component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32213 protein_id gnl|my_center|LOCUS_07580 102366 104150 gene locus_tag LOCUS_07590 gene cysJ 102366 104150 CDS product sulfite reductase [NADPH] flavoprotein alpha-component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32214 protein_id gnl|my_center|LOCUS_07590 105571 104147 gene locus_tag LOCUS_07600 105571 104147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332558.1 protein_id gnl|my_center|LOCUS_07600 105753 106625 gene locus_tag LOCUS_07610 105753 106625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 106805 107170 gene locus_tag LOCUS_07620 106805 107170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 107763 107197 gene locus_tag LOCUS_07630 107763 107197 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036085.1 protein_id gnl|my_center|LOCUS_07630 107892 109091 gene locus_tag LOCUS_07640 gene lys1 107892 109091 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937725.1 protein_id gnl|my_center|LOCUS_07640 109145 109891 gene locus_tag LOCUS_07650 gene cysH 109145 109891 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FIY7 protein_id gnl|my_center|LOCUS_07650 110857 109934 gene locus_tag LOCUS_07660 gene fabD 110857 109934 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A3CQ57 protein_id gnl|my_center|LOCUS_07660 111105 111893 gene locus_tag LOCUS_07670 gene cysE 111105 111893 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208974.1 protein_id gnl|my_center|LOCUS_07670 111886 113739 gene locus_tag LOCUS_07680 111886 113739 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481446.1 protein_id gnl|my_center|LOCUS_07680 113846 113930 gene locus_tag LOCUS_t00220 113846 113930 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 114065 115216 gene locus_tag LOCUS_07690 114065 115216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 115287 115451 gene locus_tag LOCUS_07700 115287 115451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 115473 115994 gene locus_tag LOCUS_07710 115473 115994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 116142 116486 gene locus_tag LOCUS_07720 116142 116486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 >Feature sequence06 3633 3830 gene locus_tag LOCUS_07730 3633 3830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 3933 4946 gene locus_tag LOCUS_07740 3933 4946 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHN0 protein_id gnl|my_center|LOCUS_07740 7575 5164 gene locus_tag LOCUS_07750 7575 5164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 8115 7585 gene locus_tag LOCUS_07760 8115 7585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 9811 8669 gene locus_tag LOCUS_07770 9811 8669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 9932 11566 gene locus_tag LOCUS_07780 9932 11566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 12788 11652 gene locus_tag LOCUS_07790 gene hisC 12788 11652 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RL44 protein_id gnl|my_center|LOCUS_07790 12841 13746 gene locus_tag LOCUS_07800 12841 13746 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257001.1 protein_id gnl|my_center|LOCUS_07800 13779 17456 gene locus_tag LOCUS_07810 gene dnaE 13779 17456 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z7N8 protein_id gnl|my_center|LOCUS_07810 17640 17933 gene locus_tag LOCUS_07820 17640 17933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 18795 17992 gene locus_tag LOCUS_07830 18795 17992 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938538.1 protein_id gnl|my_center|LOCUS_07830 19405 18764 gene locus_tag LOCUS_07840 19405 18764 CDS product toluene tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546348.1 protein_id gnl|my_center|LOCUS_07840 19872 19411 gene locus_tag LOCUS_07850 19872 19411 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941481.1 protein_id gnl|my_center|LOCUS_07850 20636 19887 gene locus_tag LOCUS_07860 20636 19887 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_07860 21410 20637 gene locus_tag LOCUS_07870 21410 20637 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938542.1 protein_id gnl|my_center|LOCUS_07870 21521 21448 gene locus_tag LOCUS_t00230 21521 21448 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 21993 21589 gene locus_tag LOCUS_07880 21993 21589 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCR4 protein_id gnl|my_center|LOCUS_07880 23081 21990 gene locus_tag LOCUS_07890 gene manC 23081 21990 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426511.1 protein_id gnl|my_center|LOCUS_07890 24007 23153 gene locus_tag LOCUS_07900 24007 23153 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750470.1 protein_id gnl|my_center|LOCUS_07900 25382 24027 gene locus_tag LOCUS_07910 25382 24027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 25520 26266 gene locus_tag LOCUS_07920 gene queC 25520 26266 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6W2G5 protein_id gnl|my_center|LOCUS_07920 26269 26709 gene locus_tag LOCUS_07930 26269 26709 CDS product 6-pyruvoyltetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124736.1 protein_id gnl|my_center|LOCUS_07930 26719 27408 gene locus_tag LOCUS_07940 gene queE 26719 27408 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1N2 protein_id gnl|my_center|LOCUS_07940 27411 27959 gene locus_tag LOCUS_07950 27411 27959 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582465.1 protein_id gnl|my_center|LOCUS_07950 28032 28262 gene locus_tag LOCUS_07960 28032 28262 CDS product iron transporter FeoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545730.1 protein_id gnl|my_center|LOCUS_07960 28268 30424 gene locus_tag LOCUS_07970 gene feoB 28268 30424 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023399.1 protein_id gnl|my_center|LOCUS_07970 32692 30635 gene locus_tag LOCUS_07980 gene ftsH 32692 30635 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CK5 protein_id gnl|my_center|LOCUS_07980 33765 32770 gene locus_tag LOCUS_07990 33765 32770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 33858 34943 gene locus_tag LOCUS_08000 gene queA 33858 34943 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZ44 protein_id gnl|my_center|LOCUS_08000 35228 35605 gene locus_tag LOCUS_08010 35228 35605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08010 35544 35798 gene locus_tag LOCUS_08020 35544 35798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 36414 35872 gene locus_tag LOCUS_08030 36414 35872 CDS product putative 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN92 protein_id gnl|my_center|LOCUS_08030 37186 36395 gene locus_tag LOCUS_08040 37186 36395 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6T0 protein_id gnl|my_center|LOCUS_08040 37257 37709 gene locus_tag LOCUS_08050 37257 37709 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021008.1 protein_id gnl|my_center|LOCUS_08050 37742 38506 gene locus_tag LOCUS_08060 37742 38506 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888738.1 protein_id gnl|my_center|LOCUS_08060 38524 39948 gene locus_tag LOCUS_08070 38524 39948 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259322.1 protein_id gnl|my_center|LOCUS_08070 39968 41275 gene locus_tag LOCUS_08080 39968 41275 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173864.1 protein_id gnl|my_center|LOCUS_08080 41278 41823 gene locus_tag LOCUS_08090 41278 41823 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023300.1 protein_id gnl|my_center|LOCUS_08090 42133 42747 gene locus_tag LOCUS_08100 42133 42747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 42835 43851 gene locus_tag LOCUS_08110 gene yhaM 42835 43851 CDS product 3'-5' exoribonuclease YhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07521 protein_id gnl|my_center|LOCUS_08110 45401 43917 gene locus_tag LOCUS_08120 gene lysS 45401 43917 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37477 protein_id gnl|my_center|LOCUS_08120 45501 45836 gene locus_tag LOCUS_08130 45501 45836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 45827 48679 gene locus_tag LOCUS_08140 45827 48679 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120395.1 protein_id gnl|my_center|LOCUS_08140 48676 51849 gene locus_tag LOCUS_08150 48676 51849 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O26077 protein_id gnl|my_center|LOCUS_08150 52952 51894 gene locus_tag LOCUS_08160 52952 51894 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933174.1 protein_id gnl|my_center|LOCUS_08160 53886 52945 gene locus_tag LOCUS_08170 53886 52945 CDS product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259145.1 protein_id gnl|my_center|LOCUS_08170 54799 53918 gene locus_tag LOCUS_08180 gene hisG 54799 53918 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KB10 protein_id gnl|my_center|LOCUS_08180 55326 56297 gene locus_tag LOCUS_08190 gene dusB 55326 56297 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181F5 protein_id gnl|my_center|LOCUS_08190 56294 56776 gene locus_tag LOCUS_08200 56294 56776 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143166.1 protein_id gnl|my_center|LOCUS_08200 57331 56828 gene locus_tag LOCUS_08210 57331 56828 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551114.1 protein_id gnl|my_center|LOCUS_08210 58372 57353 gene locus_tag LOCUS_08220 gene gpsA 58372 57353 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182W5 protein_id gnl|my_center|LOCUS_08220 59141 58365 gene locus_tag LOCUS_08230 gene panB 59141 58365 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM79 protein_id gnl|my_center|LOCUS_08230 60184 59156 gene locus_tag LOCUS_08240 60184 59156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 61539 61691 gene locus_tag LOCUS_08250 61539 61691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 61944 61729 gene locus_tag LOCUS_08260 61944 61729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 61971 64265 gene locus_tag LOCUS_08270 gene recD2 61971 64265 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGW5 protein_id gnl|my_center|LOCUS_08270 64311 65177 gene locus_tag LOCUS_08280 64311 65177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 65181 65495 gene locus_tag LOCUS_08290 65181 65495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 65497 65859 gene locus_tag LOCUS_08300 65497 65859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 66659 65847 gene locus_tag LOCUS_08310 66659 65847 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073641.1 protein_id gnl|my_center|LOCUS_08310 66744 67502 gene locus_tag LOCUS_08320 66744 67502 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RY41 protein_id gnl|my_center|LOCUS_08320 67519 67953 gene locus_tag LOCUS_08330 gene aroQ 67519 67953 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HDW6 protein_id gnl|my_center|LOCUS_08330 70514 67977 gene locus_tag LOCUS_08340 70514 67977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 71316 70591 gene locus_tag LOCUS_08350 gene smuG1 71316 70591 CDS product single-strand selective monofunctional uracil DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122744.1 protein_id gnl|my_center|LOCUS_08350 71632 71336 gene locus_tag LOCUS_08360 71632 71336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767690.1 protein_id gnl|my_center|LOCUS_08360 72606 71608 gene locus_tag LOCUS_08370 72606 71608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 72962 72597 gene locus_tag LOCUS_08380 72962 72597 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TC16 protein_id gnl|my_center|LOCUS_08380 73797 72949 gene locus_tag LOCUS_08390 gene sul 73797 72949 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97F29 protein_id gnl|my_center|LOCUS_08390 74638 73808 gene locus_tag LOCUS_08400 gene pabC 74638 73808 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438634.1 protein_id gnl|my_center|LOCUS_08400 76007 74652 gene locus_tag LOCUS_08410 gene pabB 76007 74652 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861217.1 protein_id gnl|my_center|LOCUS_08410 77216 76071 gene locus_tag LOCUS_08420 gene lptF 77216 76071 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942567.1 protein_id gnl|my_center|LOCUS_08420 77310 77879 gene locus_tag LOCUS_08430 gene pyrE 77310 77879 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGM1 protein_id gnl|my_center|LOCUS_08430 77910 78359 gene locus_tag LOCUS_08440 77910 78359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 78365 79543 gene locus_tag LOCUS_08450 78365 79543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 79550 80665 gene locus_tag LOCUS_08460 79550 80665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 80677 81372 gene locus_tag LOCUS_08470 80677 81372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 82178 81420 gene locus_tag LOCUS_08480 82178 81420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 83492 82320 gene locus_tag LOCUS_08490 83492 82320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 83751 84209 gene locus_tag LOCUS_08500 83751 84209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 84196 84504 gene locus_tag LOCUS_08510 84196 84504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 84538 85239 gene locus_tag LOCUS_08520 84538 85239 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339011.1 protein_id gnl|my_center|LOCUS_08520 85268 86650 gene locus_tag LOCUS_08530 85268 86650 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259605.1 protein_id gnl|my_center|LOCUS_08530 86881 87573 gene locus_tag LOCUS_08540 86881 87573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 87583 87822 gene locus_tag LOCUS_08550 87583 87822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 87943 88692 gene locus_tag LOCUS_08560 87943 88692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 >Feature sequence07 835 257 gene locus_tag LOCUS_08570 835 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 2089 1142 gene locus_tag LOCUS_08580 gene manA 2089 1142 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174418.1 protein_id gnl|my_center|LOCUS_08580 2734 2354 gene locus_tag LOCUS_08590 2734 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 2834 4243 gene locus_tag LOCUS_08600 2834 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 5146 4556 gene locus_tag LOCUS_08610 5146 4556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228210.1 protein_id gnl|my_center|LOCUS_08610 5424 7223 gene locus_tag LOCUS_08620 gene aspS 5424 7223 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32038 protein_id gnl|my_center|LOCUS_08620 7283 9127 gene locus_tag LOCUS_08630 7283 9127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 9144 9887 gene locus_tag LOCUS_08640 9144 9887 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094355.1 protein_id gnl|my_center|LOCUS_08640 9894 10862 gene locus_tag LOCUS_08650 gene hprK 9894 10862 CDS product HPr kinase/phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3J9 protein_id gnl|my_center|LOCUS_08650 11307 12713 gene locus_tag LOCUS_08660 gene dnaA 11307 12713 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HQ03 protein_id gnl|my_center|LOCUS_08660 12771 13226 gene locus_tag LOCUS_08670 12771 13226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 13863 13348 gene locus_tag LOCUS_08680 13863 13348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 14018 14230 gene locus_tag LOCUS_08690 14018 14230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 14244 14897 gene locus_tag LOCUS_08700 14244 14897 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404835.1 protein_id gnl|my_center|LOCUS_08700 14907 18287 gene locus_tag LOCUS_08710 14907 18287 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258002.1 protein_id gnl|my_center|LOCUS_08710 18299 19810 gene locus_tag LOCUS_08720 18299 19810 CDS product polysulfide reductase chain C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404833.1 protein_id gnl|my_center|LOCUS_08720 19810 20382 gene locus_tag LOCUS_08730 19810 20382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404832.1 protein_id gnl|my_center|LOCUS_08730 20388 21041 gene locus_tag LOCUS_08740 20388 21041 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404831.1 protein_id gnl|my_center|LOCUS_08740 21047 22324 gene locus_tag LOCUS_08750 21047 22324 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453372.1 protein_id gnl|my_center|LOCUS_08750 22333 22611 gene locus_tag LOCUS_08760 22333 22611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 22678 24090 gene locus_tag LOCUS_08770 22678 24090 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403101.1 protein_id gnl|my_center|LOCUS_08770 24100 24780 gene locus_tag LOCUS_08780 24100 24780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 24764 25573 gene locus_tag LOCUS_08790 24764 25573 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403103.1 protein_id gnl|my_center|LOCUS_08790 25613 26314 gene locus_tag LOCUS_08800 25613 26314 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_08800 26335 26760 gene locus_tag LOCUS_08810 26335 26760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 27188 26754 gene locus_tag LOCUS_08820 27188 26754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 27579 28238 gene locus_tag LOCUS_08830 gene trpF 27579 28238 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67853 protein_id gnl|my_center|LOCUS_08830 28336 28412 gene locus_tag LOCUS_t00240 28336 28412 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 29654 28506 gene locus_tag LOCUS_08840 gene serC 29654 28506 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709275.1 protein_id gnl|my_center|LOCUS_08840 29998 29669 gene locus_tag LOCUS_08850 29998 29669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 31179 29998 gene locus_tag LOCUS_08860 31179 29998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 31249 32175 gene locus_tag LOCUS_08870 gene xerD 31249 32175 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HE77 protein_id gnl|my_center|LOCUS_08870 32342 32265 gene locus_tag LOCUS_t00250 32342 32265 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 32480 33379 gene locus_tag LOCUS_08880 gene purC 32480 33379 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFN3 protein_id gnl|my_center|LOCUS_08880 33380 34489 gene locus_tag LOCUS_08890 33380 34489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 34596 35015 gene locus_tag LOCUS_08900 34596 35015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403489.1 protein_id gnl|my_center|LOCUS_08900 36540 35032 gene locus_tag LOCUS_08910 36540 35032 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDD3 protein_id gnl|my_center|LOCUS_08910 37408 36614 gene locus_tag LOCUS_08920 gene thyA 37408 36614 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F732 protein_id gnl|my_center|LOCUS_08920 38155 37424 gene locus_tag LOCUS_08930 38155 37424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 38878 38174 gene locus_tag LOCUS_08940 gene pyrF 38878 38174 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87N49 protein_id gnl|my_center|LOCUS_08940 38985 39920 gene locus_tag LOCUS_08950 gene ispE 38985 39920 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG57 protein_id gnl|my_center|LOCUS_08950 39976 41640 gene locus_tag LOCUS_08960 gene ptsI 39976 41640 CDS product phosphoenolpyruvate-protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183J1 protein_id gnl|my_center|LOCUS_08960 41817 41683 gene locus_tag LOCUS_08970 41817 41683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 43544 41832 gene locus_tag LOCUS_08980 43544 41832 CDS product symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198012.1 protein_id gnl|my_center|LOCUS_08980 43614 44708 gene locus_tag LOCUS_08990 43614 44708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 44951 44867 gene locus_tag LOCUS_t00260 44951 44867 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 45080 46963 gene locus_tag LOCUS_09000 45080 46963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 48084 46960 gene locus_tag LOCUS_09010 48084 46960 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGI3 protein_id gnl|my_center|LOCUS_09010 48745 48095 gene locus_tag LOCUS_09020 48745 48095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 49614 48766 gene locus_tag LOCUS_09030 49614 48766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 50200 49637 gene locus_tag LOCUS_09040 50200 49637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 52750 50216 gene locus_tag LOCUS_09050 gene topB 52750 50216 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200734.1 protein_id gnl|my_center|LOCUS_09050 52857 54101 gene locus_tag LOCUS_09060 gene lpxK 52857 54101 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8REH3 protein_id gnl|my_center|LOCUS_09060 54117 55304 gene locus_tag LOCUS_09070 gene adk 54117 55304 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXV7 protein_id gnl|my_center|LOCUS_09070 56150 55284 gene locus_tag LOCUS_09080 gene menH 56150 55284 CDS product putative 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBD4 protein_id gnl|my_center|LOCUS_09080 56681 56211 gene locus_tag LOCUS_09090 gene ppiB 56681 56211 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WVQ0 protein_id gnl|my_center|LOCUS_09090 58236 56686 gene locus_tag LOCUS_09100 58236 56686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460180.1 protein_id gnl|my_center|LOCUS_09100 59097 58240 gene locus_tag LOCUS_09110 gene hemC 59097 58240 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RND3 protein_id gnl|my_center|LOCUS_09110 60234 59206 gene locus_tag LOCUS_09120 gene ilvC 60234 59206 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIS6 protein_id gnl|my_center|LOCUS_09120 60746 60273 gene locus_tag LOCUS_09130 gene ilvN 60746 60273 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942555.1 protein_id gnl|my_center|LOCUS_09130 60901 60825 gene locus_tag LOCUS_t00270 60901 60825 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 61683 61006 gene locus_tag LOCUS_09140 gene rpe1 61683 61006 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182R3 protein_id gnl|my_center|LOCUS_09140 62479 61664 gene locus_tag LOCUS_09150 62479 61664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189747.1 protein_id gnl|my_center|LOCUS_09150 62626 63159 gene locus_tag LOCUS_09160 62626 63159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 63215 65020 gene locus_tag LOCUS_09170 gene lepA 63215 65020 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O84067 protein_id gnl|my_center|LOCUS_09170 65078 66361 gene locus_tag LOCUS_09180 65078 66361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 68281 66404 gene locus_tag LOCUS_09190 68281 66404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 72521 70230 gene locus_tag LOCUS_09200 72521 70230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 73435 72539 gene locus_tag LOCUS_09210 73435 72539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 >Feature sequence08 2398 245 gene locus_tag LOCUS_09220 2398 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 3091 3345 gene locus_tag LOCUS_09230 3091 3345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 3782 5467 gene locus_tag LOCUS_09240 3782 5467 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_09240 7062 5662 gene locus_tag LOCUS_09250 7062 5662 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0Q1 protein_id gnl|my_center|LOCUS_09250 7235 8341 gene locus_tag LOCUS_09260 7235 8341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063795.1 protein_id gnl|my_center|LOCUS_09260 8466 10874 gene locus_tag LOCUS_09270 8466 10874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 11919 10939 gene locus_tag LOCUS_09280 11919 10939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 11930 15247 gene locus_tag LOCUS_09290 11930 15247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 15273 16700 gene locus_tag LOCUS_09300 15273 16700 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_09300 17054 18958 gene locus_tag LOCUS_09310 17054 18958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 19019 20059 gene locus_tag LOCUS_09320 19019 20059 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964012.1 protein_id gnl|my_center|LOCUS_09320 20219 20827 gene locus_tag LOCUS_09330 20219 20827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 20987 22267 gene locus_tag LOCUS_09340 20987 22267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 23715 22270 gene locus_tag LOCUS_09350 23715 22270 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203533.1 protein_id gnl|my_center|LOCUS_09350 23751 25253 gene locus_tag LOCUS_09360 23751 25253 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_09360 27650 25308 gene locus_tag LOCUS_09370 27650 25308 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109396.1 protein_id gnl|my_center|LOCUS_09370 27899 28651 gene locus_tag LOCUS_09380 27899 28651 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203172.1 protein_id gnl|my_center|LOCUS_09380 28741 29529 gene locus_tag LOCUS_09390 28741 29529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 29544 30947 gene locus_tag LOCUS_09400 29544 30947 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707200.1 protein_id gnl|my_center|LOCUS_09400 30962 31555 gene locus_tag LOCUS_09410 30962 31555 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267143.1 protein_id gnl|my_center|LOCUS_09410 31593 31991 gene locus_tag LOCUS_09420 31593 31991 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459364.1 protein_id gnl|my_center|LOCUS_09420 32036 32695 gene locus_tag LOCUS_09430 32036 32695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 32724 34082 gene locus_tag LOCUS_09440 32724 34082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 34079 34879 gene locus_tag LOCUS_09450 34079 34879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 34876 35565 gene locus_tag LOCUS_09460 34876 35565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 35577 36299 gene locus_tag LOCUS_09470 35577 36299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 37526 36747 gene locus_tag LOCUS_09480 37526 36747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 38350 37598 gene locus_tag LOCUS_09490 38350 37598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 40183 38408 gene locus_tag LOCUS_09500 40183 38408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 44253 40264 gene locus_tag LOCUS_09510 44253 40264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 44547 45368 gene locus_tag LOCUS_09520 44547 45368 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079990.1 protein_id gnl|my_center|LOCUS_09520 45514 47322 gene locus_tag LOCUS_09530 45514 47322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 47352 48554 gene locus_tag LOCUS_09540 47352 48554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 48631 49440 gene locus_tag LOCUS_09550 48631 49440 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870525.1 protein_id gnl|my_center|LOCUS_09550 49462 50100 gene locus_tag LOCUS_09560 gene phoU 49462 50100 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51547 protein_id gnl|my_center|LOCUS_09560 51847 50156 gene locus_tag LOCUS_09570 gene glnS 51847 50156 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UX42 protein_id gnl|my_center|LOCUS_09570 53252 51879 gene locus_tag LOCUS_09580 gene gltX 53252 51879 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0A6 protein_id gnl|my_center|LOCUS_09580 54210 53260 gene locus_tag LOCUS_09590 gene fcl 54210 53260 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVN0 protein_id gnl|my_center|LOCUS_09590 55263 54238 gene locus_tag LOCUS_09600 gene gmd 55263 54238 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL63 protein_id gnl|my_center|LOCUS_09600 55395 56468 gene locus_tag LOCUS_09610 gene hemH 55395 56468 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP3 protein_id gnl|my_center|LOCUS_09610 56523 57386 gene locus_tag LOCUS_09620 56523 57386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 57405 58457 gene locus_tag LOCUS_09630 gene hemA 57405 58457 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72C23 protein_id gnl|my_center|LOCUS_09630 59902 58451 gene locus_tag LOCUS_09640 gene glcD-1 59902 58451 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_09640 60015 61118 gene locus_tag LOCUS_09650 gene ychF 60015 61118 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HAG1 protein_id gnl|my_center|LOCUS_09650 61198 61857 gene locus_tag LOCUS_09660 61198 61857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 61857 63059 gene locus_tag LOCUS_09670 61857 63059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 63056 64936 gene locus_tag LOCUS_09680 63056 64936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 65958 65035 gene locus_tag LOCUS_09690 gene xerC 65958 65035 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500B4 protein_id gnl|my_center|LOCUS_09690 66760 65951 gene locus_tag LOCUS_09700 gene parA 66760 65951 CDS product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516556.1 protein_id gnl|my_center|LOCUS_09700 66882 66808 gene locus_tag LOCUS_t00280 66882 66808 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 67498 66884 gene locus_tag LOCUS_09710 67498 66884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 >Feature sequence09 1295 498 gene locus_tag LOCUS_09720 1295 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 2068 2712 gene locus_tag LOCUS_09730 gene rplC 2068 2712 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CG0 protein_id gnl|my_center|LOCUS_09730 2741 3403 gene locus_tag LOCUS_09740 gene rplD 2741 3403 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NT08 protein_id gnl|my_center|LOCUS_09740 3403 3693 gene locus_tag LOCUS_09750 gene rplW 3403 3693 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66433 protein_id gnl|my_center|LOCUS_09750 3712 4557 gene locus_tag LOCUS_09760 gene rplB 3712 4557 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CH7 protein_id gnl|my_center|LOCUS_09760 4567 4836 gene locus_tag LOCUS_09770 gene rpsS 4567 4836 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PLX5 protein_id gnl|my_center|LOCUS_09770 4846 5250 gene locus_tag LOCUS_09780 4846 5250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 5265 5600 gene locus_tag LOCUS_09790 gene rplV 5265 5600 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E2C7 protein_id gnl|my_center|LOCUS_09790 5617 6252 gene locus_tag LOCUS_09800 gene rpsC 5617 6252 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CH4 protein_id gnl|my_center|LOCUS_09800 6296 6712 gene locus_tag LOCUS_09810 gene rplP 6296 6712 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CG4 protein_id gnl|my_center|LOCUS_09810 6753 6956 gene locus_tag LOCUS_09820 gene rpmC 6753 6956 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644737.1 protein_id gnl|my_center|LOCUS_09820 6976 7257 gene locus_tag LOCUS_09830 6976 7257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 7289 7651 gene locus_tag LOCUS_09840 gene rplN 7289 7651 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q927L7 protein_id gnl|my_center|LOCUS_09840 7665 7916 gene locus_tag LOCUS_09850 7665 7916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 7980 8603 gene locus_tag LOCUS_09860 gene rplE 7980 8603 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38517 protein_id gnl|my_center|LOCUS_09860 8648 8953 gene locus_tag LOCUS_09870 gene rpsN 8648 8953 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VTB8 protein_id gnl|my_center|LOCUS_09870 9014 9412 gene locus_tag LOCUS_09880 gene rpsH 9014 9412 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML9 protein_id gnl|my_center|LOCUS_09880 9428 9964 gene locus_tag LOCUS_09890 gene rplF 9428 9964 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1E8 protein_id gnl|my_center|LOCUS_09890 9982 10332 gene locus_tag LOCUS_09900 gene rplR 9982 10332 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7J0 protein_id gnl|my_center|LOCUS_09900 10338 10868 gene locus_tag LOCUS_09910 10338 10868 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810132.1 protein_id gnl|my_center|LOCUS_09910 10889 11365 gene locus_tag LOCUS_09920 gene rplO 10889 11365 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73PL3 protein_id gnl|my_center|LOCUS_09920 11411 12925 gene locus_tag LOCUS_09930 gene secY 11411 12925 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG28 protein_id gnl|my_center|LOCUS_09930 12987 13754 gene locus_tag LOCUS_09940 gene map 12987 13754 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG27 protein_id gnl|my_center|LOCUS_09940 13839 14201 gene locus_tag LOCUS_09950 13839 14201 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810116.1 protein_id gnl|my_center|LOCUS_09950 14231 14842 gene locus_tag LOCUS_09960 14231 14842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 14906 15514 gene locus_tag LOCUS_09970 gene rpsD 14906 15514 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80373 protein_id gnl|my_center|LOCUS_09970 15576 16577 gene locus_tag LOCUS_09980 gene rpoA 15576 16577 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3N9 protein_id gnl|my_center|LOCUS_09980 16602 17210 gene locus_tag LOCUS_09990 16602 17210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 17378 18454 gene locus_tag LOCUS_10000 gene epsN 17378 18454 CDS product putative pyridoxal phosphate-dependent aminotransferase EpsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q795J3 protein_id gnl|my_center|LOCUS_10000 18473 20350 gene locus_tag LOCUS_10010 18473 20350 CDS product capsular polysaccharide biosynthesis protein CapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582947.1 protein_id gnl|my_center|LOCUS_10010 21166 20363 gene locus_tag LOCUS_10020 21166 20363 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096718.1 protein_id gnl|my_center|LOCUS_10020 22462 21167 gene locus_tag LOCUS_10030 22462 21167 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942964.1 protein_id gnl|my_center|LOCUS_10030 23472 22459 gene locus_tag LOCUS_10040 23472 22459 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942955.1 protein_id gnl|my_center|LOCUS_10040 23602 24117 gene locus_tag LOCUS_10050 23602 24117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 27821 24120 gene locus_tag LOCUS_10060 27821 24120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 29463 28441 gene locus_tag LOCUS_10070 gene glnA 29463 28441 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CX42 protein_id gnl|my_center|LOCUS_10070 29649 30089 gene locus_tag LOCUS_10080 29649 30089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 30185 31051 gene locus_tag LOCUS_10090 30185 31051 CDS product protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_10090 32612 31071 gene locus_tag LOCUS_10100 gene glyQS 32612 31071 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UEU9 protein_id gnl|my_center|LOCUS_10100 32789 33433 gene locus_tag LOCUS_10110 32789 33433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 34089 33586 gene locus_tag LOCUS_10120 34089 33586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 34860 35114 gene locus_tag LOCUS_10130 gene rpsT 34860 35114 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97JK0 protein_id gnl|my_center|LOCUS_10130 35272 36081 gene locus_tag LOCUS_10140 35272 36081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 36680 37666 gene locus_tag LOCUS_10150 gene kdsD 36680 37666 CDS product arabinose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942538.1 protein_id gnl|my_center|LOCUS_10150 38523 37663 gene locus_tag LOCUS_10160 38523 37663 CDS product lysine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706658.1 protein_id gnl|my_center|LOCUS_10160 38522 42337 gene locus_tag LOCUS_10170 gene smc 38522 42337 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C711 protein_id gnl|my_center|LOCUS_10170 42370 42603 gene locus_tag LOCUS_10180 42370 42603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 42691 44238 gene locus_tag LOCUS_10190 gene guaA 42691 44238 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHY9 protein_id gnl|my_center|LOCUS_10190 44474 45799 gene locus_tag LOCUS_10200 gene hisD 44474 45799 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQM7 protein_id gnl|my_center|LOCUS_10200 45824 46924 gene locus_tag LOCUS_10210 gene hisC 45824 46924 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61000 protein_id gnl|my_center|LOCUS_10210 46897 47493 gene locus_tag LOCUS_10220 gene hisB 46897 47493 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60885 protein_id gnl|my_center|LOCUS_10220 47597 48253 gene locus_tag LOCUS_10230 gene hisH 47597 48253 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGL5 protein_id gnl|my_center|LOCUS_10230 48286 49578 gene locus_tag LOCUS_10240 gene gltA 48286 49578 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPW5 protein_id gnl|my_center|LOCUS_10240 50429 49647 gene locus_tag LOCUS_10250 50429 49647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477491.1 protein_id gnl|my_center|LOCUS_10250 50453 51124 gene locus_tag LOCUS_10260 50453 51124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 51121 52311 gene locus_tag LOCUS_10270 gene gnfL 51121 52311 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941669.1 protein_id gnl|my_center|LOCUS_10270 52527 55673 gene locus_tag LOCUS_10280 gene cas9 52527 55673 CDS product CRISPR-associated endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P897 protein_id gnl|my_center|LOCUS_10280 55777 >56272 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq acagtaattgatctctatcggttgtcaatctacagc >Feature sequence10 216 140 gene locus_tag LOCUS_t00290 216 140 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 546 2801 gene locus_tag LOCUS_10290 546 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 3018 2803 gene locus_tag LOCUS_10300 3018 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 3160 3828 gene locus_tag LOCUS_10310 gene gph 3160 3828 CDS product phosphoglycolate phosphatase, bacterial inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035829.1 protein_id gnl|my_center|LOCUS_10310 3857 4483 gene locus_tag LOCUS_10320 gene gph 3857 4483 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932569.1 protein_id gnl|my_center|LOCUS_10320 5683 4448 gene locus_tag LOCUS_10330 5683 4448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 6193 5729 gene locus_tag LOCUS_10340 6193 5729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 6347 7237 gene locus_tag LOCUS_10350 6347 7237 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697633.1 protein_id gnl|my_center|LOCUS_10350 8249 7230 gene locus_tag LOCUS_10360 gene asd 8249 7230 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMP2 protein_id gnl|my_center|LOCUS_10360 8327 8791 gene locus_tag LOCUS_10370 8327 8791 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_10370 9479 8796 gene locus_tag LOCUS_10380 9479 8796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 9916 9476 gene locus_tag LOCUS_10390 9916 9476 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390003.1 protein_id gnl|my_center|LOCUS_10390 10665 9934 gene locus_tag LOCUS_10400 gene tolQ-2 10665 9934 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940358.1 protein_id gnl|my_center|LOCUS_10400 10734 11828 gene locus_tag LOCUS_10410 10734 11828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 11828 12463 gene locus_tag LOCUS_10420 gene tmk 11828 12463 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RY40 protein_id gnl|my_center|LOCUS_10420 12477 13424 gene locus_tag LOCUS_10430 12477 13424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 13458 14114 gene locus_tag LOCUS_10440 13458 14114 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_10440 17632 14195 gene locus_tag LOCUS_10450 gene pyc 17632 14195 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AE8 protein_id gnl|my_center|LOCUS_10450 18145 17732 gene locus_tag LOCUS_10460 18145 17732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 18364 18146 gene locus_tag LOCUS_10470 18364 18146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 18463 21216 gene locus_tag LOCUS_10480 gene sucA 18463 21216 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943088.1 protein_id gnl|my_center|LOCUS_10480 21314 22582 gene locus_tag LOCUS_10490 gene sucB 21314 22582 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74B14 protein_id gnl|my_center|LOCUS_10490 24878 22647 gene locus_tag LOCUS_10500 gene glgB 24878 22647 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RR72 protein_id gnl|my_center|LOCUS_10500 24995 27145 gene locus_tag LOCUS_10510 24995 27145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 27160 27900 gene locus_tag LOCUS_10520 gene scpA 27160 27900 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I2Y0 protein_id gnl|my_center|LOCUS_10520 27959 28198 gene locus_tag LOCUS_10530 27959 28198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 28295 28609 gene locus_tag LOCUS_10540 28295 28609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 30031 28655 gene locus_tag LOCUS_10550 gene mpl 30031 28655 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933145.1 protein_id gnl|my_center|LOCUS_10550 30198 31487 gene locus_tag LOCUS_10560 gene purD 30198 31487 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E256 protein_id gnl|my_center|LOCUS_10560 31558 31971 gene locus_tag LOCUS_10570 31558 31971 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458338.1 protein_id gnl|my_center|LOCUS_10570 32711 31968 gene locus_tag LOCUS_10580 32711 31968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 33653 32721 gene locus_tag LOCUS_10590 33653 32721 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036699.1 protein_id gnl|my_center|LOCUS_10590 35423 33765 gene locus_tag LOCUS_10600 gene rpsA 35423 33765 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872374.1 protein_id gnl|my_center|LOCUS_10600 36238 35858 gene locus_tag LOCUS_10610 36238 35858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 36929 36231 gene locus_tag LOCUS_10620 36929 36231 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943050.1 protein_id gnl|my_center|LOCUS_10620 38193 36922 gene locus_tag LOCUS_10630 38193 36922 CDS product lipoprotein releasing system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191984.1 protein_id gnl|my_center|LOCUS_10630 38337 39368 gene locus_tag LOCUS_10640 38337 39368 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704981.1 protein_id gnl|my_center|LOCUS_10640 40003 39407 gene locus_tag LOCUS_10650 gene recR 40003 39407 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRX0 protein_id gnl|my_center|LOCUS_10650 40326 40015 gene locus_tag LOCUS_10660 40326 40015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 41302 40403 gene locus_tag LOCUS_10670 41302 40403 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902154.1 protein_id gnl|my_center|LOCUS_10670 41358 42263 gene locus_tag LOCUS_10680 gene hemF 41358 42263 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500S4 protein_id gnl|my_center|LOCUS_10680 42281 43315 gene locus_tag LOCUS_10690 gene hemE 42281 43315 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F9N1 protein_id gnl|my_center|LOCUS_10690 43303 44679 gene locus_tag LOCUS_10700 gene hemG 43303 44679 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403969.1 protein_id gnl|my_center|LOCUS_10700 45874 44666 gene locus_tag LOCUS_10710 gene lpxB1 45874 44666 CDS product lipid-A-disaccharide synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVR9 protein_id gnl|my_center|LOCUS_10710 47169 45886 gene locus_tag LOCUS_10720 gene cysN 47169 45886 CDS product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYJ5 protein_id gnl|my_center|LOCUS_10720 48088 47186 gene locus_tag LOCUS_10730 gene cysD 48088 47186 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S508 protein_id gnl|my_center|LOCUS_10730 48673 48101 gene locus_tag LOCUS_10740 gene cysC 48673 48101 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAQ1 protein_id gnl|my_center|LOCUS_10740 50471 48771 gene locus_tag LOCUS_10750 50471 48771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 51145 50531 gene locus_tag LOCUS_10760 gene infC 51145 50531 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33567 protein_id gnl|my_center|LOCUS_10760 51701 51318 gene locus_tag LOCUS_10770 51701 51318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144365.1 protein_id gnl|my_center|LOCUS_10770 52324 51701 gene locus_tag LOCUS_10780 52324 51701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 53485 52448 gene locus_tag LOCUS_10790 gene pdxA 53485 52448 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMZ2 protein_id gnl|my_center|LOCUS_10790 54898 53876 gene locus_tag LOCUS_10800 gene queG 54898 53876 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WH3 protein_id gnl|my_center|LOCUS_10800 >Feature sequence11 5 350 gene locus_tag LOCUS_tm00010 5 350 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 2782 1028 gene locus_tag LOCUS_10810 2782 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 4106 3141 gene locus_tag LOCUS_10820 4106 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 4768 4334 gene locus_tag LOCUS_10830 4768 4334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 5023 5544 gene locus_tag LOCUS_10840 5023 5544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 5816 6082 gene locus_tag LOCUS_10850 5816 6082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 6725 6084 gene locus_tag LOCUS_10860 6725 6084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 6874 8004 gene locus_tag LOCUS_10870 6874 8004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 9387 8062 gene locus_tag LOCUS_10880 9387 8062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 10888 9410 gene locus_tag LOCUS_10890 gene arsA 10888 9410 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122622.1 protein_id gnl|my_center|LOCUS_10890 12036 10921 gene locus_tag LOCUS_10900 gene gfo 12036 10921 CDS product glucose-fructose oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036051.1 protein_id gnl|my_center|LOCUS_10900 12173 12982 gene locus_tag LOCUS_10910 12173 12982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 14047 13034 gene locus_tag LOCUS_10920 14047 13034 CDS product glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098184.1 protein_id gnl|my_center|LOCUS_10920 14380 14159 gene locus_tag LOCUS_10930 14380 14159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 14672 14445 gene locus_tag LOCUS_10940 14672 14445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 15280 15684 gene locus_tag LOCUS_10950 15280 15684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 16874 15882 gene locus_tag LOCUS_10960 gene mdh 16874 15882 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4A2 protein_id gnl|my_center|LOCUS_10960 17937 16879 gene locus_tag LOCUS_10970 17937 16879 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KU34 protein_id gnl|my_center|LOCUS_10970 18015 18998 gene locus_tag LOCUS_10980 18015 18998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 19002 19187 gene locus_tag LOCUS_10990 19002 19187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 19344 19619 gene locus_tag LOCUS_11000 19344 19619 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389428.1 protein_id gnl|my_center|LOCUS_11000 19739 21148 gene locus_tag LOCUS_11010 gene leuC 19739 21148 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZND5 protein_id gnl|my_center|LOCUS_11010 21179 21781 gene locus_tag LOCUS_11020 gene leuD 21179 21781 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZND4 protein_id gnl|my_center|LOCUS_11020 21781 22353 gene locus_tag LOCUS_11030 21781 22353 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069550.1 protein_id gnl|my_center|LOCUS_11030 22355 22750 gene locus_tag LOCUS_11040 22355 22750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 22754 23374 gene locus_tag LOCUS_11050 22754 23374 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140820.1 protein_id gnl|my_center|LOCUS_11050 24144 23425 gene locus_tag LOCUS_11060 24144 23425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 24353 25417 gene locus_tag LOCUS_11070 gene pyrD 24353 25417 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLB7 protein_id gnl|my_center|LOCUS_11070 26382 25489 gene locus_tag LOCUS_11080 26382 25489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 27032 26391 gene locus_tag LOCUS_11090 gene lipB 27032 26391 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WKF8 protein_id gnl|my_center|LOCUS_11090 29144 27087 gene locus_tag LOCUS_11100 29144 27087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 29328 29642 gene locus_tag LOCUS_11110 29328 29642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 31567 29711 gene locus_tag LOCUS_11120 gene parE 31567 29711 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC8 protein_id gnl|my_center|LOCUS_11120 >Feature sequence12 <1 893 gene locus_tag LOCUS_11130 <1 893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920748.1:kinase 874 1743 gene locus_tag LOCUS_11140 874 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 1752 4718 gene locus_tag LOCUS_11150 1752 4718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 5450 4794 gene locus_tag LOCUS_11160 5450 4794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 6229 5447 gene locus_tag LOCUS_11170 6229 5447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 7763 6606 gene locus_tag LOCUS_11180 7763 6606 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085582.1 protein_id gnl|my_center|LOCUS_11180 10006 7940 gene locus_tag LOCUS_11190 10006 7940 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704434.1 protein_id gnl|my_center|LOCUS_11190 10212 11195 gene locus_tag LOCUS_11200 10212 11195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 11883 11176 gene locus_tag LOCUS_11210 11883 11176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 11929 12327 gene locus_tag LOCUS_11220 11929 12327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 12406 12597 gene locus_tag LOCUS_11230 gene rpmI 12406 12597 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9L2 protein_id gnl|my_center|LOCUS_11230 12681 13046 gene locus_tag LOCUS_11240 gene rplT 12681 13046 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A481 protein_id gnl|my_center|LOCUS_11240 14445 13126 gene locus_tag LOCUS_11250 gene eno 14445 13126 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HBF3 protein_id gnl|my_center|LOCUS_11250 15240 14587 gene locus_tag LOCUS_11260 15240 14587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 16122 15259 gene locus_tag LOCUS_11270 gene purU 16122 15259 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67681 protein_id gnl|my_center|LOCUS_11270 19358 16131 gene locus_tag LOCUS_11280 19358 16131 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJR3 protein_id gnl|my_center|LOCUS_11280 19490 20023 gene locus_tag LOCUS_11290 19490 20023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 20030 21694 gene locus_tag LOCUS_11300 20030 21694 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E250 protein_id gnl|my_center|LOCUS_11300 23417 21711 gene locus_tag LOCUS_11310 23417 21711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 24369 23476 gene locus_tag LOCUS_11320 24369 23476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 25656 24373 gene locus_tag LOCUS_11330 gene pyrC 25656 24373 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK42 protein_id gnl|my_center|LOCUS_11330 26638 25676 gene locus_tag LOCUS_11340 gene pyrB 26638 25676 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2K5 protein_id gnl|my_center|LOCUS_11340 >Feature sequence13 1517 516 gene locus_tag LOCUS_11350 1517 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 1783 3171 gene locus_tag LOCUS_11360 gene srfJ 1783 3171 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636452.2 protein_id gnl|my_center|LOCUS_11360 3897 3217 gene locus_tag LOCUS_11370 3897 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 7902 3907 gene locus_tag LOCUS_11380 7902 3907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 9322 8240 gene locus_tag LOCUS_11390 9322 8240 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584083.1 protein_id gnl|my_center|LOCUS_11390 9624 10889 gene locus_tag LOCUS_11400 9624 10889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 10914 14363 gene locus_tag LOCUS_11410 10914 14363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 14382 15782 gene locus_tag LOCUS_11420 14382 15782 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202170.1 protein_id gnl|my_center|LOCUS_11420 15862 16365 gene locus_tag LOCUS_11430 15862 16365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 20041 16754 gene locus_tag LOCUS_11440 20041 16754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 >Feature sequence14 86 2 gene locus_tag LOCUS_t00300 86 2 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 218 1309 gene locus_tag LOCUS_11450 gene aroC 218 1309 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLM1 protein_id gnl|my_center|LOCUS_11450 1328 2044 gene locus_tag LOCUS_11460 1328 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 2140 6831 gene locus_tag LOCUS_11470 2140 6831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 6889 7395 gene locus_tag LOCUS_11480 6889 7395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 10095 7432 gene locus_tag LOCUS_11490 10095 7432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 10454 10164 gene locus_tag LOCUS_11500 10454 10164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 10942 10454 gene locus_tag LOCUS_11510 10942 10454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 12475 11741 gene locus_tag LOCUS_11520 12475 11741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 12969 12520 gene locus_tag LOCUS_11530 12969 12520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 13448 13143 gene locus_tag LOCUS_11540 13448 13143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 13954 13445 gene locus_tag LOCUS_11550 13954 13445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 15742 14309 gene locus_tag LOCUS_11560 15742 14309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 15943 17889 gene locus_tag LOCUS_11570 15943 17889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 18351 19385 gene locus_tag LOCUS_11580 18351 19385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 >Feature sequence15 1943 546 gene locus_tag LOCUS_11590 gene lpdA2 1943 546 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI6 protein_id gnl|my_center|LOCUS_11590 2748 3698 gene locus_tag LOCUS_11600 2748 3698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 4120 3812 gene locus_tag LOCUS_11610 gene rpmE2 4120 3812 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MFN5 protein_id gnl|my_center|LOCUS_11610 4775 4305 gene locus_tag LOCUS_11620 4775 4305 CDS product dCMP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831274.1 protein_id gnl|my_center|LOCUS_11620 5612 4797 gene locus_tag LOCUS_11630 5612 4797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 6149 5646 gene locus_tag LOCUS_11640 6149 5646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 6810 6142 gene locus_tag LOCUS_11650 6810 6142 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404426.1 protein_id gnl|my_center|LOCUS_11650 9500 6816 gene locus_tag LOCUS_11660 9500 6816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 9623 9549 gene locus_tag LOCUS_t00310 9623 9549 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 <10221 9707 gene locus_tag LOCUS_11670 <10221 9707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962333.1:cell envelope biogenesis protein OmpA >Feature sequence16 2098 1733 gene locus_tag LOCUS_11680 2098 1733 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942008.1 protein_id gnl|my_center|LOCUS_11680 3458 2106 gene locus_tag LOCUS_11690 3458 2106 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBV0 protein_id gnl|my_center|LOCUS_11690 3936 3595 gene locus_tag LOCUS_11700 3936 3595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 4019 4480 gene locus_tag LOCUS_11710 4019 4480 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804034.1 protein_id gnl|my_center|LOCUS_11710 4537 5802 gene locus_tag LOCUS_11720 4537 5802 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392081.1 protein_id gnl|my_center|LOCUS_11720 5878 7611 gene locus_tag LOCUS_11730 gene cafA 5878 7611 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_11730 7586 8881 gene locus_tag LOCUS_11740 7586 8881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201992.1 protein_id gnl|my_center|LOCUS_11740 >Feature sequence17 1203 361 gene locus_tag LOCUS_11750 1203 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 1519 2883 gene locus_tag LOCUS_11760 1519 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 4143 2914 gene locus_tag LOCUS_11770 gene argG 4143 2914 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59846 protein_id gnl|my_center|LOCUS_11770 5171 4287 gene locus_tag LOCUS_11780 5171 4287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 5586 6035 gene locus_tag LOCUS_11790 5586 6035 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121867.1 protein_id gnl|my_center|LOCUS_11790 6089 6871 gene locus_tag LOCUS_11800 gene surE 6089 6871 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBU3 protein_id gnl|my_center|LOCUS_11800 6981 7646 gene locus_tag LOCUS_11810 6981 7646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392134.1 protein_id gnl|my_center|LOCUS_11810 7643 8329 gene locus_tag LOCUS_11820 7643 8329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 9107 8412 gene locus_tag LOCUS_11830 9107 8412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830